#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SMCHD1	23347	hgsc.bcm.edu	37	18	2732488	2732491	+	Splice_Site	DEL	AAAG	AAAG	-			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:2732488_2732491delAAAG	ENST00000320876.6	+	25	3612_3614	c.3274_3276delAAAG	c.(3274-3276)aaadel	p.K1092fs	SMCHD1_ENST00000261598.8_Splice_Site_p.K1092fs|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1092					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AGAAAAAATTAAAGTAAGTATCTC	0.284																																					p.1091_1092del		Atlas-Indel	.											.	SMCHD1	88	.	0			c.3273_3276del						PASS	.																																			SO:0001630	splice_region_variant	23347	exon25			.	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3276+1AAAG>-	18.37:g.2732488_2732491delAAAG		84.0	0.0	0		144.0	16.0	0.111111	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Frame_Shift_Del	DEL	ENST00000320876.6	37	CCDS45822.1																																																																																			.	.	none		0.284	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		Frame_Shift_Del
EPS8L2	64787	hgsc.bcm.edu	37	11	726654	726655	+	Frame_Shift_Ins	INS	-	-	GCTC			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:726654_726655insGCTC	ENST00000533256.1	+	21	2345_2346	c.1970_1971insGCTC	c.(1969-1974)cagctcfs	p.-658fs	EPS8L2_ENST00000526198.1_Frame_Shift_Ins_p.-674fs|EPS8L2_ENST00000530636.1_Frame_Shift_Ins_p.-658fs|EPS8L2_ENST00000534449.1_3'UTR|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000318562.8_Frame_Shift_Ins_p.-658fs			Q9H6S3	ES8L2_HUMAN	EPS8-like 2						positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACCGGGCCGCAGCTCTTCTCCC	0.678																																					p.Q657fs		Pindel,Atlas-Indel	.											.	EPS8L2	42	.	0			c.1970_1971insGCTC						PASS	.																																			SO:0001589	frameshift_variant	64787	exon20			.	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1971_1974dupGCTC	11.37:g.726655_726658dupGCTC	ENSP00000435585:p.Leu658fs	103.0	0.0	.		106.0	18.0	0.170	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Frame_Shift_Ins	INS	ENST00000533256.1	37	CCDS31328.1																																																																																			.	.	none		0.678	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
IGLL5	100423062	hgsc.bcm.edu	37	22	23235883	23235884	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:23235883_23235884delCC	ENST00000526893.1	+	2	484_485	c.210_211delCC	c.(208-213)ctcctgfs	p.LL70fs	IGLL5_ENST00000531372.1_Intron|IGLJ1_ENST00000390320.2_RNA|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Frame_Shift_Del_p.LL71fs	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	70						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCAGCAGGCTCCTGCTCCAGCC	0.658																																					p.70_70del		Atlas-Indel	.											.	IGLL5	26	.	0			c.209_210del						PASS	.																																			SO:0001589	frameshift_variant	100423062	exon2			.	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.210_211delCC	22.37:g.23235883_23235884delCC	ENSP00000431254:p.Leu70fs	48.0	0.0	0		26.0	12.0	0.461538	NM_001178126		Frame_Shift_Del	DEL	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.658	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
PIM1	5292	hgsc.bcm.edu	37	6	37139046	37139047	+	In_Frame_Ins	INS	-	-	CTTCGA			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37139046_37139047insCTTCGA	ENST00000373509.5	+	4	759_760	c.386_387insCTTCGA	c.(385-390)ctcttc>ctCTTCGActtc	p.132_133insDF		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GTGCAAGATCTCTTCGACTTCA	0.634			T	BCL6	NHL																																p.L220delinsLFD		Atlas-Indel	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.659_660insCTTCGA						PASS	.																																			SO:0001652	inframe_insertion	5292	exon4			.		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.387_392dupCTTCGA	6.37:g.37139047_37139052dupCTTCGA	ENSP00000362608:p.Asp131_Phe132dup	110.0	0.0	0		123.0	14.0	0.113821	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	In_Frame_Ins	INS	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.634	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
MEF2B	100271849	hgsc.bcm.edu	37	19	19261528	19261529	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:19261528_19261529insT	ENST00000602424.2	-	4	742_743	c.16_17insA	c.(16-18)atcfs	p.I6fs	MEF2BNB-MEF2B_ENST00000444486.3_Frame_Shift_Ins_p.I6fs|MEF2B_ENST00000162023.5_Frame_Shift_Ins_p.I6fs|MEF2B_ENST00000409447.2_Frame_Shift_Ins_p.I6fs|MEF2BNB-MEF2B_ENST00000514819.3_Frame_Shift_Ins_p.I23fs|MEF2B_ENST00000424583.2_Frame_Shift_Ins_p.I6fs|MEF2B_ENST00000410050.1_Frame_Shift_Ins_p.I6fs|MEF2B_ENST00000409224.1_Frame_Shift_Ins_p.I6fs|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	6	Lys-rich (basic).|MADS-box. {ECO:0000255|PROSITE- ProRule:PRU00251}.				muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			GGAGATCTGGATTTTTTTCCTC	0.564																																					p.I6fs		Pindel,Atlas-Indel	.											.	MEF2BNB-MEF2B	29	.	0			c.17_18insA						PASS	.																																			SO:0001589	frameshift_variant	4207	exon4			.	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.17dupA	19.37:g.19261535_19261535dupT	ENSP00000473308:p.Ile6fs	154.0	0.0	.		180.0	37.0	0.206	NM_005919	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Frame_Shift_Ins	INS	ENST00000602424.2	37	CCDS12394.1																																																																																			.	.	none		0.564	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_005919	
CD79B	974	hgsc.bcm.edu	37	17	62007630	62007635	+	In_Frame_Del	DEL	CCAGAG	CCAGAG	-			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	CCAGAG	CCAGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:62007630_62007635delCCAGAG	ENST00000006750.3	-	3	321_326	c.229_234delCTCTGG	c.(229-234)ctctggdel	p.LW77del	CD79B_ENST00000349817.2_Intron|CD79B_ENST00000392795.3_In_Frame_Del_p.LW78del	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	77	Ig-like V-type.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						TCTCCTGCTTCCAGAGCCAGCTCACA	0.573			"""Mis, O"""		DLBCL																																p.78_80del		Pindel,Atlas-Indel	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	.	CD79B	38	.	0			c.233_238del						PASS	.																																			SO:0001651	inframe_deletion	974	exon3			.	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.229_234delCTCTGG	17.37:g.62007630_62007635delCCAGAG	ENSP00000006750:p.Leu77_Trp78del	104.0	0.0	.		67.0	11.0	0.164	NM_001039933	Q53FS2|Q9BU06	In_Frame_Del	DEL	ENST00000006750.3	37	CCDS11655.1																																																																																			.	.	none		0.573	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
CD58	965	hgsc.bcm.edu	37	1	117087138	117087139	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:117087138_117087139delCT	ENST00000369489.5	-	2	224_225	c.158_159delAG	c.(157-159)gagfs	p.E53fs	CD58_ENST00000457047.2_Frame_Shift_Del_p.E53fs|CD58_ENST00000369487.3_Frame_Shift_Del_p.E53fs	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	53	Ig-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		TCCATAGGACCTCTTTTAAAGG	0.347																																					p.53_54del		Pindel,Atlas-Indel	.											.	CD58	40	.	0			c.159_160del						PASS	.																																			SO:0001589	frameshift_variant	965	exon2			.	BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.158_159delAG	1.37:g.117087140_117087141delCT	ENSP00000358501:p.Glu53fs	276.0	0.0	.		203.0	45.0	0.222	NM_001144822	A8K7G5|Q5U053|Q6IB65|Q96KI9	Frame_Shift_Del	DEL	ENST00000369489.5	37	CCDS888.1																																																																																			.	.	none		0.347	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059036.1	NM_001779	
IL22RA2	116379	hgsc.bcm.edu	37	6	137468925	137468926	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:137468925_137468926insT	ENST00000296980.2	-	6	875_876	c.575_576insA	c.(574-576)aatfs	p.N192fs	IL22RA2_ENST00000349184.4_Frame_Shift_Ins_p.N160fs|IL22RA2_ENST00000339602.3_Intron	NM_052962.2	NP_443194.1	Q969J5	I22R2_HUMAN	interleukin 22 receptor, alpha 2	192	Fibronectin type-III 3.				cytokine-mediated signaling pathway (GO:0019221)|negative regulation of inflammatory response (GO:0050728)|regulation of tyrosine phosphorylation of Stat3 protein (GO:0042516)	cytosol (GO:0005829)|extracellular space (GO:0005615)	interleukin-22 binding (GO:0042017)|interleukin-22 receptor activity (GO:0042018)			endometrium(1)|large_intestine(1)|lung(3)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		CTATAGATACATTTTTTTCCTT	0.292																																					p.N192fs		Atlas-Indel	.											.	IL22RA2	17	.	0			c.576_577insA						PASS	.																																			SO:0001589	frameshift_variant	116379	exon6			.	AY044429	CCDS5182.1, CCDS5183.1, CCDS5184.1	6q24.1-q24.2	2008-02-05			ENSG00000164485	ENSG00000164485		"""Interleukins and interleukin receptors"""	14901	protein-coding gene	gene with protein product		606648				11481447, 11390454	Standard	NM_181309		Approved	CRF2-S1, IL-22BP	uc003qhl.3	Q969J5	OTTHUMG00000015655	ENST00000296980.2:c.576dupA	6.37:g.137468932_137468932dupT	ENSP00000296980:p.Asn192fs	238.0	0.0	0		248.0	51.0	0.205645	NM_052962	Q08AH7|Q6UWM1|Q96A41|Q96QR0	Frame_Shift_Ins	INS	ENST00000296980.2	37	CCDS5182.1																																																																																			.	.	none		0.292	IL22RA2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042399.1		
PCDH7	5099	hgsc.bcm.edu	37	4	30724220	30724221	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:30724220_30724221insC	ENST00000361762.2	+	1	2184_2185	c.1176_1177insC	c.(1177-1179)cccfs	p.P393fs	PCDH7_ENST00000543491.1_Frame_Shift_Ins_p.P393fs	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	393	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						ACCGCGGGCAGCCCCCCAAGAC	0.634																																					p.Q392fs		Pindel,Atlas-Indel	.											.	PCDH7	215	.	0			c.1176_1177insC						PASS	.																																			SO:0001589	frameshift_variant	5099	exon1			.	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1182dupC	4.37:g.30724226_30724226dupC	ENSP00000355243:p.Pro393fs	103.0	0.0	.		86.0	13.0	0.151	NM_032457	O60246|O60247|Q4W5C4	Frame_Shift_Ins	INS	ENST00000361762.2	37	CCDS33971.1																																																																																			.	.	none		0.634	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
CD79B	974	hgsc.bcm.edu	37	17	62006798	62006798	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:62006798T>C	ENST00000006750.3	-	5	679	c.587A>G	c.(586-588)tAc>tGc	p.Y196C	CD79B_ENST00000349817.2_Missense_Mutation_p.Y92C|CD79B_ENST00000392795.3_Missense_Mutation_p.Y197C	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	196	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.Y196C(1)|p.Y196F(1)|p.Y196S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CCTTACCTCGTAGGTGTGATC	0.632			"""Mis, O"""		DLBCL																																p.Y197C		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,NS,lymphoid_neoplasm,-1,13	CD79B	38	13	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.A590G						PASS	.						93.0	74.0	81.0					17																	62006798		2203	4300	6503	SO:0001583	missense	974	exon5			ACCTCGTAGGTGT	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.587A>G	17.37:g.62006798T>C	ENSP00000006750:p.Tyr196Cys	74.0	0.0	0		72.0	24.0	0.333333	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151836	0.38021	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	D;D;D	0.96651	-4.08;-4.08;-4.08	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	D	0.95601	0.8570	N	0.24115	0.695	0.53005	D	0.999969	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.95387	0.8478	10	0.87932	D	0	-12.4743	9.5968	0.39578	0.0:0.0:0.0:1.0	.	92;196	P40259-2;P40259	.;CD79B_HUMAN	C	92;197;196	ENSP00000245862:Y92C;ENSP00000376544:Y197C;ENSP00000006750:Y196C	ENSP00000006750:Y196C	Y	-	2	0	CD79B	59360530	0.997000	0.39634	0.977000	0.42913	0.245000	0.25701	3.902000	0.56310	1.782000	0.52362	0.358000	0.22013	TAC	.	.	none		0.632	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
STAP2	55620	hgsc.bcm.edu	37	19	4328706	4328706	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:4328706C>T	ENST00000594605.1	-	6	679	c.556G>A	c.(556-558)Ggc>Agc	p.G186S	STAP2_ENST00000600324.1_Missense_Mutation_p.G186S|STAP2_ENST00000597593.1_5'Flank	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	186	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGACACGCCGTCGGCGCCG	0.716																																					p.G186S		Atlas-SNP	.											.	STAP2	38	.	0			c.G556A						PASS	.																																			SO:0001583	missense	55620	exon6			ACACGCCGTCGGC	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.556G>A	19.37:g.4328706C>T	ENSP00000471052:p.Gly186Ser	102.0	0.0	0		114.0	36.0	0.315789	NM_001013841	A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	37	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	C	3.199	-0.164145	0.06502	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.47	0.897	0.19258	SH2 motif (3);	1.373150	0.05071	N	0.481758	T	0.17746	0.0426	N	0.03608	-0.345	0.19945	N	0.999944	B;B	0.14012	0.009;0.002	B;B	0.12837	0.008;0.004	T	0.25779	-1.0122	9	0.87932	D	0	-8.0506	4.4444	0.11589	0.0:0.5903:0.1844:0.2253	.	186;186	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	S	186	.	ENSP00000317912:G186S	G	-	1	0	STAP2	4279706	0.000000	0.05858	0.170000	0.22879	0.499000	0.33736	0.007000	0.13174	0.282000	0.22254	0.479000	0.44913	GGC	.	.	none		0.716	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	
POU4F2	5458	hgsc.bcm.edu	37	4	147560457	147560457	+	Silent	SNP	T	T	C	rs530695040|rs5862765		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:147560457T>C	ENST00000281321.3	+	1	413	c.165T>C	c.(163-165)ggT>ggC	p.G55G	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	55	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ACGCTggtggtggcggcggcg	0.761																																					p.G55G		Atlas-SNP	.											.	POU4F2	83	.	0			c.T165C						PASS	.						3.0	3.0	3.0					4																	147560457		1733	3503	5236	SO:0001819	synonymous_variant	5458	exon1			TGGTGGTGGCGGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.165T>C	4.37:g.147560457T>C		105.0	0.0	0		81.0	5.0	0.0617284	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	37	CCDS34074.1																																																																																			.	.	none		0.761	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
EFHB	151651	hgsc.bcm.edu	37	3	19974810	19974810	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr3:19974810C>T	ENST00000295824.9	-	1	862	c.701G>A	c.(700-702)gGa>gAa	p.G234E	EFHB_ENST00000344838.4_Missense_Mutation_p.G104E|EFHB_ENST00000498089.1_5'UTR	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	234							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						TTCAATGTTTCCAGCCTCCTT	0.478																																					p.G234E		Atlas-SNP	.											.	EFHB	186	.	0			c.G701A						PASS	.						107.0	102.0	104.0					3																	19974810		2203	4300	6503	SO:0001583	missense	151651	exon1			ATGTTTCCAGCCT	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.701G>A	3.37:g.19974810C>T	ENSP00000295824:p.Gly234Glu	152.0	0.0	0		122.0	38.0	0.311475	NM_144715	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	C	0.205	-1.041511	0.02013	.	.	ENSG00000163576	ENST00000295824;ENST00000344838;ENST00000389256	T;T;T	0.19938	2.11;2.11;2.38	5.0	-4.58	0.03410	.	0.774623	0.11571	N	0.550800	T	0.04092	0.0114	N	0.00926	-1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37663	-0.9696	9	.	.	.	-4.4587	2.2528	0.04048	0.1215:0.2865:0.123:0.469	.	104;234	Q8N7U6-3;Q8N7U6	.;EFHB_HUMAN	E	234;104;234	ENSP00000295824:G234E;ENSP00000342263:G104E;ENSP00000373908:G234E	.	G	-	2	0	EFHB	19949814	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.311000	0.08124	-0.692000	0.05128	-0.136000	0.14681	GGA	.	.	none		0.478	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715	
WDR70	55100	hgsc.bcm.edu	37	5	37703146	37703146	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr5:37703146G>A	ENST00000265107.4	+	13	1529	c.1373G>A	c.(1372-1374)cGt>cAt	p.R458H	RNU6-484P_ENST00000384016.1_RNA	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	458							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTCTTTGAGCGTAGGACTTTC	0.423																																					p.R458H		Atlas-SNP	.											.	WDR70	76	.	0			c.G1373A						PASS	.						126.0	114.0	118.0					5																	37703146		2203	4300	6503	SO:0001583	missense	55100	exon13			TTGAGCGTAGGAC	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1373G>A	5.37:g.37703146G>A	ENSP00000265107:p.Arg458His	188.0	0.0	0		194.0	44.0	0.226804	NM_018034	Q9H053	Missense_Mutation	SNP	ENST00000265107.4	37	CCDS34147.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523092	0.64747	.	.	ENSG00000082068	ENST00000265107	T	0.01335	5.0	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.246635	0.34223	N	0.004145	T	0.02533	0.0077	M	0.74647	2.275	0.80722	D	1	B	0.33841	0.428	B	0.20577	0.03	T	0.52162	-0.8612	10	0.38643	T	0.18	-35.416	14.7489	0.69511	0.0:0.0:0.8553:0.1447	.	458	Q9NW82	WDR70_HUMAN	H	458	ENSP00000265107:R458H	ENSP00000265107:R458H	R	+	2	0	WDR70	37738903	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.761000	0.68801	2.880000	0.98712	0.650000	0.86243	CGT	.	.	none		0.423	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
EPS8L1	54869	hgsc.bcm.edu	37	19	55593906	55593906	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:55593906G>A	ENST00000201647.6	+	12	1206	c.1150G>A	c.(1150-1152)Gac>Aac	p.D384N	EPS8L1_ENST00000540810.1_Missense_Mutation_p.D320N|EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000245618.5_Missense_Mutation_p.D257N|EPS8L1_ENST00000586329.1_Missense_Mutation_p.D366N|EPS8L1_ENST00000588359.1_Missense_Mutation_p.D38N	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	384					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GCTGCTGCGGGACAACGTCAC	0.692																																					p.D384N	Ovarian(149;255 1863 3636 27051 29647)	Atlas-SNP	.											.	EPS8L1	122	.	0			c.G1150A						PASS	.						14.0	12.0	13.0					19																	55593906		2175	4264	6439	SO:0001583	missense	54869	exon12			CTGCGGGACAACG	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.1150G>A	19.37:g.55593906G>A	ENSP00000201647:p.Asp384Asn	74.0	0.0	0		64.0	14.0	0.21875	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	37	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	G	8.107	0.777937	0.16120	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810;ENST00000245618;ENST00000539118	T;T;T	0.21734	1.99;1.99;1.99	4.05	4.05	0.47172	.	0.303746	0.34435	N	0.003973	T	0.07954	0.0199	N	0.04880	-0.145	0.27125	N	0.962039	B;B;B;B;B	0.33694	0.421;0.004;0.002;0.002;0.002	B;B;B;B;B	0.29785	0.107;0.004;0.007;0.002;0.003	T	0.23332	-1.0191	10	0.02654	T	1	-29.3165	11.9005	0.52680	0.0:0.0:1.0:0.0	.	320;366;131;257;384	B4DKV7;Q8TE68-3;Q8TE68-4;Q8TE68-2;Q8TE68	.;.;.;.;ES8L1_HUMAN	N	366;384;320;257;38	ENSP00000201647:D384N;ENSP00000437541:D320N;ENSP00000245618:D257N	ENSP00000201647:D384N	D	+	1	0	EPS8L1	60285718	0.353000	0.24904	0.976000	0.42696	0.927000	0.56198	2.970000	0.49240	2.262000	0.75019	0.561000	0.74099	GAC	.	.	none		0.692	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
PHF20	51230	hgsc.bcm.edu	37	20	34458897	34458897	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr20:34458897T>G	ENST00000374012.3	+	8	1072	c.943T>G	c.(943-945)Tac>Gac	p.Y315D	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	315					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					GTCAAAAAACTACTCGGAAAA	0.428																																					p.Y315D		Atlas-SNP	.											.	PHF20	94	.	0			c.T943G						PASS	.						82.0	77.0	79.0					20																	34458897		2203	4300	6503	SO:0001583	missense	51230	exon8			AAAAACTACTCGG	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.943T>G	20.37:g.34458897T>G	ENSP00000363124:p.Tyr315Asp	51.0	0.0	0		67.0	20.0	0.298507	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.524349	0.27299	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.43294	1.55;0.95;0.95	5.11	2.67	0.31697	.	0.743446	0.13065	N	0.416564	T	0.25005	0.0607	N	0.22421	0.69	0.21841	N	0.999515	B;B	0.28128	0.037;0.201	B;B	0.25759	0.014;0.063	T	0.13953	-1.0490	10	0.33141	T	0.24	.	5.4595	0.16610	0.0:0.093:0.1751:0.7319	.	315;315	Q9BVI0;Q66K49	PHF20_HUMAN;.	D	315	ENSP00000363124:Y315D;ENSP00000341900:Y315D;ENSP00000363112:Y315D	ENSP00000341900:Y315D	Y	+	1	0	PHF20	33922311	0.030000	0.19436	0.314000	0.25224	0.996000	0.88848	1.520000	0.35899	0.905000	0.36596	0.482000	0.46254	TAC	.	.	none		0.428	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
CNBD1	168975	hgsc.bcm.edu	37	8	88298781	88298781	+	Silent	SNP	T	T	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr8:88298781T>A	ENST00000518476.1	+	8	975	c.924T>A	c.(922-924)ctT>ctA	p.L308L		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	308										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AAATAAAACTTGAAAATATGC	0.274																																					p.L308L		Atlas-SNP	.											.	CNBD1	206	.	0			c.T924A						PASS	.						39.0	35.0	36.0					8																	88298781		1760	3999	5759	SO:0001819	synonymous_variant	168975	exon8			AAAACTTGAAAAT	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.924T>A	8.37:g.88298781T>A		82.0	0.0	0		70.0	19.0	0.271429	NM_173538		Silent	SNP	ENST00000518476.1	37	CCDS55259.1																																																																																			.	.	none		0.274	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
FAM179B	23116	hgsc.bcm.edu	37	14	45535938	45535938	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr14:45535938A>G	ENST00000361577.3	+	16	4772	c.4558A>G	c.(4558-4560)Aat>Gat	p.N1520D	FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Missense_Mutation_p.N1573D	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1520										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TACAGAAAATAATCAAGACCT	0.368																																					p.N1520D		Atlas-SNP	.											.	FAM179B	115	.	0			c.A4558G						PASS	.						77.0	81.0	79.0					14																	45535938		2203	4300	6503	SO:0001583	missense	23116	exon16			GAAAATAATCAAG	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4558A>G	14.37:g.45535938A>G	ENSP00000355045:p.Asn1520Asp	113.0	0.0	0		106.0	31.0	0.292453	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.183215	0.78677	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.22336	1.96;1.96	5.59	4.43	0.53597	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	M	0.65498	2.005	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.70935	0.949;0.971	T	0.23726	-1.0180	10	0.59425	D	0.04	-14.0258	11.3311	0.49477	0.8479:0.1521:0.0:0.0	.	1573;1520	G3XAE9;Q9Y4F4	.;F179B_HUMAN	D	1520;1573	ENSP00000355045:N1520D;ENSP00000354917:N1573D	ENSP00000354917:N1573D	N	+	1	0	FAM179B	44605688	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	7.279000	0.78599	0.929000	0.37192	0.459000	0.35465	AAT	.	.	none		0.368	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
TAS2R30	259293	hgsc.bcm.edu	37	12	11286093	11286093	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr12:11286093T>G	ENST00000539585.1	-	1	1150	c.751A>C	c.(751-753)Aat>Cat	p.N251H	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	251					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						CTCCCAAAATTACAAACTGAT	0.413																																					p.N251H		Atlas-SNP	.											.	TAS2R30	28	.	0			c.A751C						PASS	.						134.0	142.0	139.0					12																	11286093		2203	4299	6502	SO:0001583	missense	259293	exon1			CAAAATTACAAAC	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.751A>C	12.37:g.11286093T>G	ENSP00000444736:p.Asn251His	170.0	0.0	0		178.0	41.0	0.230337	NM_001097643	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	7.335	0.619790	0.14193	.	.	ENSG00000256188	ENST00000539585	T	0.00737	5.76	2.6	-2.21	0.06973	.	.	.	.	.	T	0.00845	0.0028	L	0.56340	1.77	0.09310	N	1	B	0.17038	0.02	B	0.23716	0.048	T	0.44574	-0.9319	9	0.23891	T	0.37	.	3.172	0.06555	0.4197:0.0:0.2144:0.3658	.	251	P59541	T2R30_HUMAN	H	251	ENSP00000444736:N251H	ENSP00000444736:N251H	N	-	1	0	TAS2R30	11177360	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.332000	0.07904	-0.617000	0.05664	0.260000	0.18958	AAT	.	.	none		0.413	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
ELAVL1	1994	hgsc.bcm.edu	37	19	8046064	8046064	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:8046064C>T	ENST00000407627.2	-	3	308	c.179G>A	c.(178-180)aGc>aAc	p.S60N	ELAVL1_ENST00000596459.1_Missense_Mutation_p.S60N|ELAVL1_ENST00000351593.5_Missense_Mutation_p.S87N|ELAVL1_ENST00000593807.1_Missense_Mutation_p.S60N	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	60	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						ATAGCCCAAGCTGTGTCCTGT	0.527																																					p.S60N		Atlas-SNP	.											.	ELAVL1	44	.	0			c.G179A						PASS	.						164.0	118.0	133.0					19																	8046064		2203	4300	6503	SO:0001583	missense	1994	exon3			CCCAAGCTGTGTC	U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.179G>A	19.37:g.8046064C>T	ENSP00000385269:p.Ser60Asn	90.0	0.0	0		86.0	26.0	0.302326	NM_001419	B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	ENST00000407627.2	37	CCDS12193.1	.	.	.	.	.	.	.	.	.	.	C	35	5.460172	0.96240	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.78481	-1.18;-1.18	5.78	5.78	0.91487	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.78773	0.4336	L	0.61218	1.895	0.80722	D	1	P	0.38729	0.644	B	0.40101	0.319	T	0.80997	-0.1132	10	0.87932	D	0	.	17.4906	0.87702	0.0:1.0:0.0:0.0	.	60	Q15717	ELAV1_HUMAN	N	60;87	ENSP00000385269:S60N;ENSP00000264073:S87N	ENSP00000264073:S87N	S	-	2	0	ELAVL1	7952064	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.225000	0.78051	2.719000	0.93026	0.655000	0.94253	AGC	.	.	none		0.527	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461494.3	NM_001419	
CDH7	1005	hgsc.bcm.edu	37	18	63527021	63527021	+	Silent	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:63527021T>C	ENST00000397968.2	+	10	1998	c.1572T>C	c.(1570-1572)gaT>gaC	p.D524D	CDH7_ENST00000536984.2_Silent_p.D524D|CDH7_ENST00000323011.3_Silent_p.D524D	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	524	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TAACAACGGATGCAACAAATA	0.358																																					p.D524D		Atlas-SNP	.											.	CDH7	362	.	0			c.T1572C						PASS	.						104.0	86.0	92.0					18																	63527021		2203	4299	6502	SO:0001819	synonymous_variant	1005	exon10			AACGGATGCAACA	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1572T>C	18.37:g.63527021T>C		95.0	0.0	0		161.0	19.0	0.118012	NM_004361	Q9H157	Silent	SNP	ENST00000397968.2	37	CCDS11993.1																																																																																			.	.	none		0.358	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
SETD1B	23067	hgsc.bcm.edu	37	12	122248130	122248130	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr12:122248130G>T	ENST00000604567.1	+	6	1347	c.1279G>T	c.(1279-1281)Gag>Tag	p.E427*	SETD1B_ENST00000267197.5_Nonsense_Mutation_p.E427*|SETD1B_ENST00000542440.1_Nonsense_Mutation_p.E427*			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	427	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CGACAGTGGGGAGTTCCGGAG	0.706																																					p.E427X		Atlas-SNP	.											.	SETD1B	105	.	0			c.G1279T						PASS	.						2.0	4.0	3.0					12																	122248130		630	1507	2137	SO:0001587	stop_gained	23067	exon5			AGTGGGGAGTTCC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1279G>T	12.37:g.122248130G>T	ENSP00000474253:p.Glu427*	41.0	0.0	0		40.0	9.0	0.225	NM_015048	F6MFW1	Nonsense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	G	32	5.185059	0.94885	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.242	0.89970	0.0:0.0:1.0:0.0	.	.	.	.	X	427	.	ENSP00000267197:E427X	E	+	1	0	SETD1B	120732513	1.000000	0.71417	0.989000	0.46669	0.266000	0.26442	5.102000	0.64572	2.309000	0.77851	0.467000	0.42956	GAG	.	.	none		0.706	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
FAM205A	259308	hgsc.bcm.edu	37	9	34724155	34724155	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr9:34724155C>A	ENST00000378788.3	-	4	3121	c.3082G>T	c.(3082-3084)Gag>Tag	p.E1028*		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	1028						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						CTTTGAGGCTCAGGGCCACAG	0.582																																					p.E1028X		Atlas-SNP	.											.	FAM205A	45	.	0			c.G3082T						PASS	.						27.0	21.0	23.0					9																	34724155		692	1591	2283	SO:0001587	stop_gained	259308	exon4			GAGGCTCAGGGCC		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.3082G>T	9.37:g.34724155C>A	ENSP00000417711:p.Glu1028*	103.0	0.0	0		128.0	35.0	0.273438	NM_001141917	A8MVW7	Nonsense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570191	0.96540	.	.	ENSG00000205108	ENST00000378788	.	.	.	3.99	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	11.7276	0.51718	0.0:1.0:0.0:0.0	.	.	.	.	X	1028	.	ENSP00000417711:E1028X	E	-	1	0	RP11-195F19.10	34714155	0.001000	0.12720	0.074000	0.20217	0.375000	0.29983	0.774000	0.26675	2.205000	0.71048	0.650000	0.86243	GAG	.	.	none		0.582	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
PLXNB2	23654	hgsc.bcm.edu	37	22	50720155	50720155	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:50720155T>A	ENST00000449103.1	-	21	3502	c.3362A>T	c.(3361-3363)aAg>aTg	p.K1121M	PLXNB2_ENST00000359337.4_Missense_Mutation_p.K1121M|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1121					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTCATCGCCTTGTTCAGATT	0.672																																					p.K1121M		Atlas-SNP	.											.	PLXNB2	172	.	0			c.A3362T						PASS	.						21.0	25.0	24.0					22																	50720155		2147	4255	6402	SO:0001583	missense	23654	exon21			ATCGCCTTGTTCA		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3362A>T	22.37:g.50720155T>A	ENSP00000409171:p.Lys1121Met	69.0	0.0	0		53.0	14.0	0.264151	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.16|14.16	2.453769|2.453769	0.43531|0.43531	.|.	.|.	ENSG00000196576|ENSG00000196576	ENST00000449103;ENST00000359337|ENST00000427829	T;T|.	0.03553|.	3.89;3.89|.	4.47|4.47	4.47|4.47	0.54385|0.54385	Immunoglobulin-like fold (1);|.	0.530450|.	0.16890|.	N|.	0.195334|.	T|T	0.53449|0.53449	0.1797|0.1797	L|L	0.38838|0.38838	1.175|1.175	0.38197|0.38197	D|D	0.940066|0.940066	P|.	0.38473|.	0.633|.	B|.	0.34489|.	0.184|.	T|T	0.54899|0.54899	-0.8224|-0.8224	10|5	0.34782|.	T|.	0.22|.	.|.	10.1523|10.1523	0.42801|0.42801	0.0:0.0:0.1676:0.8324|0.0:0.0:0.1676:0.8324	.|.	1121|.	O15031|.	PLXB2_HUMAN|.	M|W	1121|139	ENSP00000409171:K1121M;ENSP00000352288:K1121M|.	ENSP00000352288:K1121M|.	K|R	-|-	2|1	0|2	PLXNB2|PLXNB2	49062282|49062282	0.800000|0.800000	0.28916|0.28916	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	0.495000|0.495000	0.22483|0.22483	1.882000|1.882000	0.54519|0.54519	0.402000|0.402000	0.26972|0.26972	AAG|AGG	.	.	none		0.672	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	218.0	0.0	0		214.0	29.0	0.135514	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
PRSS33	260429	hgsc.bcm.edu	37	16	2835579	2835579	+	Missense_Mutation	SNP	G	G	A	rs7202954	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr16:2835579G>A	ENST00000293851.5	-	4	470	c.311C>T	c.(310-312)aCg>aTg	p.T104M	PRSS33_ENST00000576886.1_Intron|PRSS33_ENST00000570702.1_Missense_Mutation_p.T104M	NM_152891.2	NP_690851.2	Q8NF86	PRS33_HUMAN	protease, serine, 33	104	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)	p.T104M(1)		prostate(1)	1						CACCGAGAGCGTGCGGGGCGA	0.746													G|||	643	0.128395	0.4145	0.0677	5008	,	,		12173	0.0139		0.005	False		,,,				2504	0.0297				p.T104M	NSCLC(194;489 2153 16702 19171 27758)	Atlas-SNP	.											PRSS33,NS,carcinoma,0,1	PRSS33	7	1	1	Substitution - Missense(1)	prostate(1)	c.C311T						scavenged	.		MET/THR	600,2138		28,544,797	2.0	2.0	2.0		311	0.1	0.0	16	dbSNP_116	2	47,5743		1,45,2849	no	missense	PRSS33	NM_152891.2	81	29,589,3646	AA,AG,GG		0.8117,21.9138,7.5868	possibly-damaging	104/281	2835579	647,7881	1369	2895	4264	SO:0001583	missense	260429	exon4			GAGAGCGTGCGGG	AF536382	CCDS42110.1	16p13.3	2014-09-04			ENSG00000103355	ENSG00000103355		"""Serine peptidases / Serine peptidases"""	30405	protein-coding gene	gene with protein product		613797				12795636	Standard	NM_152891		Approved	EOS	uc002cro.1	Q8NF86	OTTHUMG00000177360	ENST00000293851.5:c.311C>T	16.37:g.2835579G>A	ENSP00000293851:p.Thr104Met	2.0	2.0	1		11.0	6.0	0.545455	NM_152891	A6NNQ3|Q8N171	Missense_Mutation	SNP	ENST00000293851.5	37	CCDS42110.1	217	0.09935897435897435	187	0.3800813008130081	23	0.06353591160220995	6	0.01048951048951049	1	0.0013192612137203166	G	10.39	1.336851	0.24253	0.219138	0.008117	ENSG00000103355	ENST00000293851	D	0.88896	-2.44	4.74	0.141	0.14811	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.637530	0.14568	N	0.311635	T	0.00012	0.0000	L	0.43152	1.355	0.80722	P	0.0	P	0.35612	0.512	B	0.33568	0.166	T	0.03981	-1.0987	9	0.45353	T	0.12	.	2.8287	0.05492	0.0871:0.2745:0.3404:0.298	rs7202954	104	Q8NF86	PRS33_HUMAN	M	104	ENSP00000293851:T104M	ENSP00000293851:T104M	T	-	2	0	PRSS33	2775580	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.357000	0.20199	-0.204000	0.10235	-0.492000	0.04666	ACG	G|0.887;A|0.113	0.113	strong		0.746	PRSS33-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436446.1	NM_152891	
VSIG10L	147645	hgsc.bcm.edu	37	19	51841333	51841333	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:51841333A>G	ENST00000335624.4	-	6	1858	c.1859T>C	c.(1858-1860)cTg>cCg	p.L620P	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	620						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						TCCTGGAGCCAGGGGCCTCCC	0.657																																					p.L620P		Atlas-SNP	.											.	VSIG10L	40	.	0			c.T1859C						PASS	.						28.0	29.0	29.0					19																	51841333		692	1591	2283	SO:0001583	missense	147645	exon6			GGAGCCAGGGGCC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.1859T>C	19.37:g.51841333A>G	ENSP00000335623:p.Leu620Pro	56.0	0.0	0		38.0	10.0	0.263158	NM_001163922		Missense_Mutation	SNP	ENST00000335624.4	37	CCDS54300.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615553	0.66672	.	.	ENSG00000186806	ENST00000335624	T	0.33438	1.41	5.03	5.03	0.67393	Immunoglobulin-like fold (1);	0.424955	0.17586	N	0.168930	T	0.45074	0.1324	M	0.65975	2.015	0.58432	D	0.99999	D	0.58970	0.984	P	0.54372	0.75	T	0.44081	-0.9351	10	0.66056	D	0.02	-3.4381	11.1334	0.48360	1.0:0.0:0.0:0.0	.	620	Q86VR7	VS10L_HUMAN	P	620	ENSP00000335623:L620P	ENSP00000335623:L620P	L	-	2	0	VSIG10L	56533145	1.000000	0.71417	0.891000	0.34965	0.643000	0.38383	4.307000	0.59123	1.899000	0.54978	0.459000	0.35465	CTG	.	.	none		0.657	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	
PDZD8	118987	hgsc.bcm.edu	37	10	119133946	119133946	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr10:119133946G>A	ENST00000334464.5	-	1	1032	c.793C>T	c.(793-795)Ccc>Tcc	p.P265S		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	265					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GTGAGCTGGGGCATGGGCCGC	0.582																																					p.P265S		Atlas-SNP	.											.	PDZD8	85	.	0			c.C793T						PASS	.						64.0	69.0	68.0					10																	119133946		2203	4300	6503	SO:0001583	missense	118987	exon1			GCTGGGGCATGGG	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.793C>T	10.37:g.119133946G>A	ENSP00000334642:p.Pro265Ser	90.0	0.0	0		70.0	16.0	0.228571	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813834	0.50527	.	.	ENSG00000165650	ENST00000334464	D	0.87029	-2.2	4.87	3.96	0.45880	.	0.000000	0.85682	D	0.000000	D	0.91064	0.7188	L	0.54323	1.7	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.89811	0.3982	10	0.37606	T	0.19	-2.6702	14.5263	0.67892	0.0:0.0:0.8523:0.1477	.	265	Q8NEN9	PDZD8_HUMAN	S	265	ENSP00000334642:P265S	ENSP00000334642:P265S	P	-	1	0	PDZD8	119123936	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.425000	0.80255	1.015000	0.39444	0.655000	0.94253	CCC	.	.	none		0.582	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
IRF4	3662	hgsc.bcm.edu	37	6	393329	393329	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:393329G>A	ENST00000380956.4	+	2	303	c.177G>A	c.(175-177)aaG>aaA	p.K59K	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	59					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACGCGGGCAAGCAGGACTACA	0.692			T	IGH@	MM																																p.K59K		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.G177A						PASS	.						29.0	26.0	27.0					6																	393329		2201	4300	6501	SO:0001819	synonymous_variant	3662	exon2			GGGCAAGCAGGAC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.177G>A	6.37:g.393329G>A		81.0	0.0	0		68.0	19.0	0.279412	NM_001195286	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	37	CCDS4469.1																																																																																			.	.	none		0.692	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
C6orf48	50854	hgsc.bcm.edu	37	6	31805113	31805113	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:31805113G>A	ENST00000375640.3	+	3	735	c.8G>A	c.(7-9)aGa>aAa	p.R3K	C6orf48_ENST00000375638.3_Missense_Mutation_p.R3K|C6orf48_ENST00000395788.3_Missense_Mutation_p.R3K|SNORD48_ENST00000364953.1_RNA|C6orf48_ENST00000375633.1_Missense_Mutation_p.R3K|C6orf48_ENST00000375639.2_Missense_Mutation_p.R3K|C6orf48_ENST00000375642.2_Missense_Mutation_p.R3K|C6orf48_ENST00000395789.1_Missense_Mutation_p.R3K|SNORD52_ENST00000364884.1_RNA|C6orf48_ENST00000375641.2_Missense_Mutation_p.R3K|C6orf48_ENST00000375635.2_Missense_Mutation_p.R3K	NM_001040438.1	NP_001035528.1	Q9UBA6	G8_HUMAN	chromosome 6 open reading frame 48	3										breast(1)|large_intestine(1)|lung(1)|skin(1)	4						CTCATGGAGAGAAGCTTTGTA	0.502																																					p.R3K		Atlas-SNP	.											.	C6orf48	8	.	0			c.G8A						PASS	.						219.0	180.0	193.0					6																	31805113		2203	4300	6503	SO:0001583	missense	50854	exon4			TGGAGAGAAGCTT	AJ249732	CCDS34416.1	6p21.33	2011-12-13			ENSG00000204387	ENSG00000204387			19078	protein-coding gene	gene with protein product		605447				8096093	Standard	NM_001287483		Approved	D6S57, G8	uc003rjy.2	Q9UBA6	OTTHUMG00000031175	ENST00000375640.3:c.8G>A	6.37:g.31805113G>A	ENSP00000364791:p.Arg3Lys	258.0	0.0	0		258.0	69.0	0.267442	NM_001040437	Q9BW21|Q9UBA7|Q9UBA8	Missense_Mutation	SNP	ENST00000375640.3	37	CCDS34416.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.554|8.554	0.876186|0.876186	0.17395|0.17395	.|.	.|.	ENSG00000204387|ENSG00000204387	ENST00000375636|ENST00000375640;ENST00000375641;ENST00000375639;ENST00000375638;ENST00000375635;ENST00000375642;ENST00000395789;ENST00000375633;ENST00000395788	.|.	.|.	.|.	3.29|3.29	-1.64|-1.64	0.08318|0.08318	.|.	.|.	.|.	.|.	.|.	T|T	0.11750|0.11750	0.0286|0.0286	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.14438	.|0.01	.|B	.|0.06405	.|0.002	T|T	0.35895|0.35895	-0.9770|-0.9770	4|7	.|0.87932	.|D	.|0	.|.	5.6811|5.6811	0.17776|0.17776	0.4984:0.3626:0.139:0.0|0.4984:0.3626:0.139:0.0	.|.	.|3	.|Q9UBA6	.|G8_HUMAN	K|K	118|3	.|.	.|ENSP00000364784:R3K	E|R	+|+	1|2	0|0	C6orf48|C6orf48	31913092|31913092	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.151000|0.151000	0.16283|0.16283	-0.327000|-0.327000	0.08551|0.08551	-0.165000|-0.165000	0.13383|0.13383	GAA|AGA	.	.	none		0.502	C6orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076332.2	NM_001040437	
GRIN3A	116443	hgsc.bcm.edu	37	9	104357008	104357008	+	Intron	SNP	C	C	T	rs202237297		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr9:104357008C>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.G69S	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCTCCATCACCGTCGGTGTCG	0.572																																					p.G69S		Atlas-SNP	.											.	PPP3R2	38	.	0			c.G205A						PASS	.	C	,SER/GLY	0,4406		0,0,2203	90.0	87.0	88.0		,205	3.8	0.3	9		88	7,8593	5.7+/-21.5	0,7,4293	yes	intron,missense	PPP3R2,GRIN3A	NM_133445.2,NM_147180.2	,56	0,7,6496	TT,TC,CC		0.0814,0.0,0.0538	,probably-damaging	,69/174	104357008	7,12999	2203	4300	6503	SO:0001627	intron_variant	5535	exon1			CATCACCGTCGGT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15366G>A	9.37:g.104357008C>T		76.0	0.0	0		87.0	7.0	0.0804598	NM_147180	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393870	0.62066	0.0	8.14E-4	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.74737	-0.87	3.8	3.8	0.43715	EF-hand-like domain (1);	0.000000	0.40728	N	0.001028	T	0.76147	0.3947	M	0.79258	2.445	0.48236	D	0.999619	P	0.46621	0.881	B	0.43478	0.421	T	0.82016	-0.0666	10	0.87932	D	0	-25.0681	13.968	0.64221	0.0:1.0:0.0:0.0	.	66	Q96LZ3	CANB2_HUMAN	S	69	ENSP00000363939:G69S	ENSP00000363939:G69S	G	-	1	0	PPP3R2	103396829	1.000000	0.71417	0.305000	0.25099	0.163000	0.22366	5.776000	0.68924	2.399000	0.81585	0.563000	0.77884	GGT	.	.	weak		0.572	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
AKAP11	11215	hgsc.bcm.edu	37	13	42876626	42876626	+	Silent	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr13:42876626C>A	ENST00000025301.2	+	8	3919	c.3744C>A	c.(3742-3744)ccC>ccA	p.P1248P		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1248					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTTTAAACCCCTCAGACGAAA	0.368																																					p.P1248P		Atlas-SNP	.											.	AKAP11	146	.	0			c.C3744A						PASS	.						65.0	69.0	68.0					13																	42876626		2203	4300	6503	SO:0001819	synonymous_variant	11215	exon8			AAACCCCTCAGAC	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3744C>A	13.37:g.42876626C>A		104.0	0.0	0		97.0	26.0	0.268041	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																			.	.	none		0.368	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
PCDH15	65217	hgsc.bcm.edu	37	10	55663021	55663021	+	Silent	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr10:55663021A>G	ENST00000320301.6	-	26	3877	c.3483T>C	c.(3481-3483)acT>acC	p.T1161T	PCDH15_ENST00000395430.1_Silent_p.T1161T|PCDH15_ENST00000395433.1_Silent_p.T1139T|PCDH15_ENST00000414778.1_Silent_p.T1166T|PCDH15_ENST00000395432.2_Silent_p.T1124T|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Silent_p.T1168T|PCDH15_ENST00000373965.2_Silent_p.T1168T|PCDH15_ENST00000395438.1_Silent_p.T1161T|PCDH15_ENST00000437009.1_Silent_p.T1090T|PCDH15_ENST00000409834.1_Silent_p.T772T|PCDH15_ENST00000361849.3_Silent_p.T1161T|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000463095.1_5'UTR	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1161	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGAGTACAGAAGTAAACATTC	0.353										HNSCC(58;0.16)																											p.T1166T		Atlas-SNP	.											.	PCDH15	1715	.	0			c.T3498C						PASS	.						85.0	81.0	82.0					10																	55663021		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon27			TACAGAAGTAAAC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3483T>C	10.37:g.55663021A>G		173.0	0.0	0		121.0	29.0	0.239669	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.	.	none		0.353	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131799003	131799003	+	Silent	SNP	C	C	T	rs374604987		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:131799003C>T	ENST00000326016.5	+	9	1824	c.1305C>T	c.(1303-1305)gcC>gcT	p.A435A	ARHGEF4_ENST00000525839.1_Silent_p.A435A|ARHGEF4_ENST00000392953.3_Silent_p.A435A|ARHGEF4_ENST00000409303.1_Silent_p.A375A|ARHGEF4_ENST00000355771.3_Silent_p.A364A|ARHGEF4_ENST00000428230.2_Intron	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	435	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TGCAGCTGGCCGAGCTGCTCA	0.607																																					p.A435A		Atlas-SNP	.											.	ARHGEF4	89	.	0			c.C1305T						PASS	.	C	,	0,4406		0,0,2203	38.0	35.0	36.0		1305,1305	-10.7	0.0	2		36	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	ARHGEF4	NM_015320.2,NM_032995.1	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	435/691,435/671	131799003	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	50649	exon9			GCTGGCCGAGCTG	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1305C>T	2.37:g.131799003C>T		66.0	0.0	0		42.0	9.0	0.214286	NM_032995	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	37	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	C	9.771	1.172725	0.21704	0.0	2.33E-4	ENSG00000136002	ENST00000532720	.	.	.	5.33	-10.7	0.00240	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.6524	0.17625	0.2674:0.4363:0.2018:0.0946	.	.	.	.	X	52	.	.	R	+	1	2	ARHGEF4	131515473	0.000000	0.05858	0.015000	0.15790	0.994000	0.84299	-9.239000	0.00012	-4.865000	0.00029	-0.367000	0.07326	CGA	.	.	weak		0.607	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
UBE2D3	7323	hgsc.bcm.edu	37	4	103720570	103720570	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:103720570C>T	ENST00000453744.2	-	7	905	c.392G>A	c.(391-393)aGa>aAa	p.R131K	UBE2D3_ENST00000394801.4_Missense_Mutation_p.R131K|UBE2D3_ENST00000350435.7_Missense_Mutation_p.R125K|UBE2D3_ENST00000343106.5_Missense_Mutation_p.R131K|UBE2D3_ENST00000502404.1_Missense_Mutation_p.R102K|UBE2D3_ENST00000394803.5_Missense_Mutation_p.R131K|UBE2D3_ENST00000349311.8_Missense_Mutation_p.R131K|UBE2D3_ENST00000505207.1_Missense_Mutation_p.R102K|UBE2D3_ENST00000357194.6_Missense_Mutation_p.R133K|UBE2D3_ENST00000394804.2_Missense_Mutation_p.R131K|UBE2D3_ENST00000338145.3_Missense_Mutation_p.R131K|UBE2D3_ENST00000321805.7_Missense_Mutation_p.R131K|UBE2D3_ENST00000507845.1_Missense_Mutation_p.R102K|UBE2D3_ENST00000504211.1_Missense_Mutation_p.R102K	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	131					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TTACTTATCTCTGTCTGTTTT	0.353																																					p.R133K		Atlas-SNP	.											.	UBE2D3	25	.	0			c.G398A						PASS	.						57.0	57.0	57.0					4																	103720570		2203	4299	6502	SO:0001583	missense	7323	exon6			TTATCTCTGTCTG	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.392G>A	4.37:g.103720570C>T	ENSP00000396901:p.Arg131Lys	512.0	1.0	0.00195312		505.0	137.0	0.271287	NM_181893	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	ENST00000453744.2	37	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178726	0.57692	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000504211;ENST00000357194;ENST00000505207;ENST00000507845;ENST00000502404	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19;1.19	5.89	5.89	0.94794	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.358712	0.35525	N	0.003152	T	0.32071	0.0817	L	0.27053	0.805	0.49582	D	0.999802	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.19148	0.003;0.024;0.002	T	0.03524	-1.1028	10	0.41790	T	0.15	.	20.2361	0.98357	0.0:1.0:0.0:0.0	.	133;131;131	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	K	131;131;131;131;131;131;125;131;131;102;133;102;102;102	ENSP00000396901:R131K;ENSP00000378280:R131K;ENSP00000378282:R131K;ENSP00000378283:R131K;ENSP00000345285:R131K;ENSP00000318494:R131K;ENSP00000337262:R125K;ENSP00000337208:R131K;ENSP00000344069:R131K;ENSP00000426620:R102K;ENSP00000349722:R133K;ENSP00000426586:R102K;ENSP00000424359:R102K;ENSP00000421904:R102K	ENSP00000318494:R131K	R	-	2	0	UBE2D3	103939682	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.584000	0.60971	2.791000	0.96007	0.591000	0.81541	AGA	.	.	none		0.353	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893	
BTG2	7832	hgsc.bcm.edu	37	1	203276261	203276261	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:203276261A>C	ENST00000290551.4	+	2	243	c.172A>C	c.(172-174)Aag>Cag	p.K58Q	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	58					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GTTTCCCGAAAAGCCGTCCAA	0.597																																					p.K58Q		Atlas-SNP	.											.	BTG2	16	.	0			c.A172C						PASS	.						42.0	44.0	43.0					1																	203276261		2203	4300	6503	SO:0001583	missense	7832	exon2			CCCGAAAAGCCGT		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.172A>C	1.37:g.203276261A>C	ENSP00000290551:p.Lys58Gln	57.0	0.0	0		63.0	16.0	0.253968	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629108	0.46944	.	.	ENSG00000159388	ENST00000290551	T	0.23950	1.88	4.53	3.39	0.38822	Anti-proliferative protein (4);	0.065881	0.64402	D	0.000016	T	0.21881	0.0527	L	0.51853	1.615	0.45439	D	0.998419	B	0.30511	0.282	B	0.25506	0.061	T	0.03433	-1.1037	10	0.44086	T	0.13	-25.7358	10.3	0.43646	0.8338:0.1662:0.0:0.0	.	58	P78543	BTG2_HUMAN	Q	58	ENSP00000290551:K58Q	ENSP00000290551:K58Q	K	+	1	0	BTG2	201542884	1.000000	0.71417	0.630000	0.29268	0.848000	0.48234	4.716000	0.61916	0.752000	0.32923	0.260000	0.18958	AAG	.	.	none		0.597	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
PIM1	5292	hgsc.bcm.edu	37	6	37139063	37139063	+	Missense_Mutation	SNP	G	G	A	rs200523275	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37139063G>A	ENST00000373509.5	+	4	776	c.403G>A	c.(403-405)Gaa>Aaa	p.E135K		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CTTCATCACGGAAAGGGGAGC	0.637			T	BCL6	NHL								G|||	2	0.000399361	0.0	0.0	5008	,	,		15869	0.002		0.0	False		,,,				2504	0.0				p.E226K		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,2	PIM1	71	2	0			c.G676A						PASS	.						75.0	88.0	84.0					6																	37139063		2203	4300	6503	SO:0001583	missense	5292	exon4			ATCACGGAAAGGG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.403G>A	6.37:g.37139063G>A	ENSP00000362608:p.Glu135Lys	120.0	0.0	0		125.0	22.0	0.176	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.05	2.719704	0.48728	.	.	ENSG00000137193	ENST00000373509	T	0.64991	-0.13	4.58	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.128681	0.50627	D	0.000105	T	0.32675	0.0837	N	0.03253	-0.375	0.54753	D	0.999988	B	0.23128	0.08	B	0.34093	0.175	T	0.45991	-0.9223	10	0.72032	D	0.01	.	17.1751	0.86839	0.0:0.0:1.0:0.0	.	226	P11309	PIM1_HUMAN	K	135	ENSP00000362608:E135K	ENSP00000362608:E135K	E	+	1	0	PIM1	37247041	1.000000	0.71417	0.929000	0.37066	0.060000	0.15804	9.205000	0.95048	2.371000	0.80710	0.549000	0.68633	GAA	G|1.000;A|0.000	0.000	strong		0.637	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
SEMA4C	54910	hgsc.bcm.edu	37	2	97531445	97531445	+	Silent	SNP	G	G	A	rs139208590	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:97531445G>A	ENST00000305476.5	-	5	510	c.378C>T	c.(376-378)taC>taT	p.Y126Y		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	126	Dominant negative effect on myogenic differentiation. {ECO:0000250}.|Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						TGCCACAGACGTACAGGTGGG	0.632													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		20427	0.0		0.0	False		,,,				2504	0.0				p.Y126Y		Atlas-SNP	.											.	SEMA4C	56	.	0			c.C378T						PASS	.	G		3,4403	6.2+/-15.9	0,3,2200	142.0	126.0	131.0		378	-4.7	0.2	2	dbSNP_134	131	0,8600		0,0,4300	no	coding-synonymous	SEMA4C	NM_017789.4		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		126/834	97531445	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	54910	exon5			ACAGACGTACAGG	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.378C>T	2.37:g.97531445G>A		92.0	0.0	0		93.0	28.0	0.301075	NM_017789	Q32MJ3|Q7Z5X0	Silent	SNP	ENST00000305476.5	37	CCDS2029.1																																																																																			G|1.000;A|0.000	0.000	strong		0.632	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789	
IRF4	3662	hgsc.bcm.edu	37	6	393360	393360	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:393360C>G	ENST00000380956.4	+	2	334	c.208C>G	c.(208-210)Ctc>Gtc	p.L70V	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	70					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GGACGCCGCGCTCTTCAAGGT	0.731			T	IGH@	MM																																p.L70V		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C208G						PASS	.						16.0	15.0	15.0					6																	393360		2194	4295	6489	SO:0001583	missense	3662	exon2			GCCGCGCTCTTCA	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.208C>G	6.37:g.393360C>G	ENSP00000370343:p.Leu70Val	57.0	0.0	0		46.0	14.0	0.304348	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127190	0.94429	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97791	-4.54	4.58	4.58	0.56647	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.117485	0.64402	D	0.000014	D	0.97266	0.9106	L	0.37800	1.135	0.80722	D	1	P;P;P	0.41597	0.756;0.713;0.701	P;P;P	0.59948	0.866;0.789;0.866	D	0.97866	1.0283	10	0.48119	T	0.1	-23.7921	17.6301	0.88104	0.0:1.0:0.0:0.0	.	70;70;70	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	V	70;100	ENSP00000370343:L70V	ENSP00000370343:L70V	L	+	1	0	IRF4	338360	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	5.239000	0.65371	2.399000	0.81585	0.306000	0.20318	CTC	.	.	none		0.731	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
HIST1H2BC	8347	hgsc.bcm.edu	37	6	26123915	26123915	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:26123915C>T	ENST00000314332.5	-	1	223	c.218G>A	c.(217-219)cGc>cAc	p.R73H	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.R73H|HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	73					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						GCCCGCGATGCGCTCAAATAT	0.577																																					p.R73H		Atlas-SNP	.											.	HIST1H2BC	35	.	0			c.G218A						PASS	.						125.0	122.0	123.0					6																	26123915		2203	4300	6503	SO:0001583	missense	8347	exon1			GCGATGCGCTCAA	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.218G>A	6.37:g.26123915C>T	ENSP00000321744:p.Arg73His	126.0	0.0	0		109.0	11.0	0.100917	NM_003526	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	37	CCDS4584.1	.	.	.	.	.	.	.	.	.	.	.	18.43	3.621236	0.66787	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.69561	-0.41;-0.41	5.61	5.61	0.85477	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.50650	0.1628	.	.	.	0.47862	D	0.999531	B	0.23316	0.083	B	0.19148	0.024	T	0.49093	-0.8975	8	0.49607	T	0.09	.	18.9929	0.92801	0.0:1.0:0.0:0.0	.	73	P62807	H2B1C_HUMAN	H	73	ENSP00000321744:R73H;ENSP00000380180:R73H	ENSP00000321744:R73H	R	-	2	0	HIST1H2BC	26231894	1.000000	0.71417	1.000000	0.80357	0.359000	0.29487	7.638000	0.83328	2.799000	0.96334	0.650000	0.86243	CGC	.	.	none		0.577	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022624	32022624	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr3:32022624G>A	ENST00000396556.2	-	1	170	c.48C>T	c.(46-48)agC>agT	p.S16S	OSBPL10_ENST00000438237.2_Silent_p.S16S|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	16					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		tgcggctgctgctgttgctAC	0.791																																					p.S16S		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C48T						PASS	.						2.0	3.0	2.0					3																	32022624		674	1482	2156	SO:0001819	synonymous_variant	114884	exon1			GCTGCTGCTGTTG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.48C>T	3.37:g.32022624G>A		128.0	0.0	0		114.0	38.0	0.333333	NM_017784	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1																																																																																			.	.	none		0.791	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
VPS13A	23230	hgsc.bcm.edu	37	9	79875041	79875041	+	Silent	SNP	A	A	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr9:79875041A>T	ENST00000360280.3	+	23	2588	c.2328A>T	c.(2326-2328)cgA>cgT	p.R776R	VPS13A_ENST00000376636.3_Silent_p.R776R|VPS13A_ENST00000357409.5_Silent_p.R776R|VPS13A_ENST00000376634.4_Silent_p.R776R	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	776					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTTCTTTACGAATCTCAGATA	0.308																																					p.R776R		Atlas-SNP	.											VPS13A_ENST00000376634,colon,carcinoma,+2,3	VPS13A	735	3	0			c.A2328T						PASS	.						47.0	47.0	47.0					9																	79875041		2203	4297	6500	SO:0001819	synonymous_variant	23230	exon23			TTTACGAATCTCA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2328A>T	9.37:g.79875041A>T		223.0	0.0	0		315.0	55.0	0.174603	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	37	CCDS6655.1																																																																																			.	.	none		0.308	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
PIM1	5292	hgsc.bcm.edu	37	6	37138416	37138416	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138416C>T	ENST00000373509.5	+	1	438	c.65C>T	c.(64-66)gCc>gTc	p.A22V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	113					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GACCTGCACGCCACCAAGCTG	0.736			T	BCL6	NHL																																p.A113V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C338T						PASS	.						24.0	26.0	26.0					6																	37138416		2199	4293	6492	SO:0001583	missense	5292	exon1			TGCACGCCACCAA		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.65C>T	6.37:g.37138416C>T	ENSP00000362608:p.Ala22Val	70.0	0.0	0		80.0	12.0	0.15	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562878	0.27915	.	.	ENSG00000137193	ENST00000373509	T	0.69175	-0.38	4.2	3.32	0.38043	.	0.485099	0.18021	N	0.154227	T	0.22551	0.0544	N	0.08118	0	0.28270	N	0.924459	B	0.25441	0.126	B	0.17979	0.02	T	0.05818	-1.0862	10	0.20046	T	0.44	.	10.0767	0.42364	0.0:0.9018:0.0:0.0982	.	113	P11309	PIM1_HUMAN	V	22	ENSP00000362608:A22V	ENSP00000362608:A22V	A	+	2	0	PIM1	37246394	0.226000	0.23696	0.998000	0.56505	0.958000	0.62258	1.274000	0.33132	2.289000	0.77006	0.542000	0.68232	GCC	.	.	none		0.736	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PCBP4	57060	hgsc.bcm.edu	37	3	51994890	51994890	+	Silent	SNP	G	G	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr3:51994890G>T	ENST00000461554.1	-	5	461	c.130C>A	c.(130-132)Cgg>Agg	p.R44R	PCBP4_ENST00000484633.1_Silent_p.R44R|PCBP4_ENST00000471622.1_Silent_p.R44R|RP11-155D18.14_ENST00000489595.2_Silent_p.R44R|PCBP4_ENST00000395013.3_5'UTR|PCBP4_ENST00000428823.2_Silent_p.R44R|PCBP4_ENST00000322099.7_Silent_p.R44R|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000395014.2_5'Flank|PCBP4_ENST00000355852.2_Silent_p.R44R	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	44	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.					cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACCTGCTCCCGGATTCGCTTT	0.562																																					p.R44R		Atlas-SNP	.											.	PCBP4	35	.	0			c.C130A						PASS	.						188.0	203.0	198.0					3																	51994890		2203	4300	6503	SO:0001819	synonymous_variant	57060	exon4			GCTCCCGGATTCG	AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.130C>A	3.37:g.51994890G>T		91.0	0.0	0		73.0	4.0	0.0547945	NM_033008	Q96AH7	Silent	SNP	ENST00000461554.1	37	CCDS2839.1																																																																																			.	.	none		0.562	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348597.1	NM_020418	
C11orf40	143501	hgsc.bcm.edu	37	11	4592708	4592708	+	Missense_Mutation	SNP	C	C	G	rs67037861|rs71280817|rs79804156		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:4592708C>G	ENST00000307616.1	-	4	598	c.599G>C	c.(598-600)tGt>tCt	p.C200S		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	200										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		acgatccatacagtttttccC	0.428																																					p.C200S		Atlas-SNP	.											.	C11orf40	37	.	0			c.G599C						PASS	.						87.0	75.0	79.0					11																	4592708		2133	4180	6313	SO:0001583	missense	143501	exon4			TCCATACAGTTTT		CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.599G>C	11.37:g.4592708C>G	ENSP00000302918:p.Cys200Ser	132.0	0.0	0		125.0	11.0	0.088	NM_144663		Missense_Mutation	SNP	ENST00000307616.1	37	CCDS31354.1	.	.	.	.	.	.	.	.	.	.	C	1.174	-0.640091	0.03557	.	.	ENSG00000171987	ENST00000307616	T	0.54866	0.55	0.56	-1.12	0.09808	.	.	.	.	.	T	0.27524	0.0676	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.17349	-1.0372	8	0.87932	D	0	.	.	.	.	.	200	Q8WZ69	CK040_HUMAN	S	200	ENSP00000302918:C200S	ENSP00000302918:C200S	C	-	2	0	C11orf40	4549284	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-1.580000	0.02121	-0.348000	0.08286	-1.125000	0.01998	TGT	.	.	weak		0.428	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
TRDN	10345	hgsc.bcm.edu	37	6	123869636	123869636	+	Silent	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:123869636A>G	ENST00000398178.3	-	3	375	c.354T>C	c.(352-354)gaT>gaC	p.D118D	TRDN_ENST00000546248.1_Silent_p.D118D|TRDN_ENST00000542443.1_Silent_p.D118D|TRDN_ENST00000334268.4_Silent_p.D118D	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	118					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CATCTTCTTCATCTTCAGATG	0.378																																					p.D118D		Atlas-SNP	.											.	TRDN	88	.	0			c.T354C						PASS	.						61.0	60.0	60.0					6																	123869636		1871	4103	5974	SO:0001819	synonymous_variant	10345	exon3			TTCTTCATCTTCA	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.354T>C	6.37:g.123869636A>G		99.0	0.0	0		103.0	26.0	0.252427	NM_001256022	A5D6W5|F5H2W7|Q6NSB8	Silent	SNP	ENST00000398178.3	37	CCDS55053.1																																																																																			.	.	none		0.378	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
XKR4	114786	hgsc.bcm.edu	37	8	56270330	56270330	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr8:56270330C>T	ENST00000327381.6	+	2	999	c.899C>T	c.(898-900)gCg>gTg	p.A300V		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	300						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TATGAGTATGCGGATGTGAGT	0.453																																					p.A300V		Atlas-SNP	.											XKR4,colon,carcinoma,0,1	XKR4	104	1	0			c.C899T						PASS	.						178.0	159.0	165.0					8																	56270330		2203	4300	6503	SO:0001583	missense	114786	exon2			AGTATGCGGATGT	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.899C>T	8.37:g.56270330C>T	ENSP00000328326:p.Ala300Val	231.0	0.0	0		219.0	56.0	0.255708	NM_052898	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248401	0.59103	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.66280	-0.2	5.96	5.96	0.96718	.	0.054071	0.64402	D	0.000001	T	0.79511	0.4458	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78191	-0.2300	10	0.54805	T	0.06	-14.25	20.4192	0.99033	0.0:1.0:0.0:0.0	.	300	Q5GH76	XKR4_HUMAN	V	300	ENSP00000328326:A300V	ENSP00000328326:A300V	A	+	2	0	XKR4	56432884	1.000000	0.71417	0.984000	0.44739	0.293000	0.27360	7.818000	0.86416	2.831000	0.97527	0.650000	0.86243	GCG	.	.	none		0.453	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
ALOXE3	59344	hgsc.bcm.edu	37	17	8012556	8012556	+	Missense_Mutation	SNP	C	C	T	rs121434232		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:8012556C>T	ENST00000448843.2	-	12	1838	c.1498G>A	c.(1498-1500)Gtc>Atc	p.V500I	ALOXE3_ENST00000380149.1_Missense_Mutation_p.V656I|ALOXE3_ENST00000318227.3_Missense_Mutation_p.V632I	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	500	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.		V -> F (in ARCI3; complete loss of the enzyme activity). {ECO:0000269|PubMed:11773004}.		arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						ATAGCCAGGACGCCGCGGGCC	0.652																																					p.V632I		Atlas-SNP	.											.	ALOXE3	145	.	0			c.G1894A	GRCh37	CM020012	ALOXE3	M	rs121434232	PASS	.						60.0	56.0	57.0					17																	8012556		2203	4300	6503	SO:0001583	missense	59344	exon12			CCAGGACGCCGCG	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1498G>A	17.37:g.8012556C>T	ENSP00000400581:p.Val500Ile	44.0	0.0	0		51.0	16.0	0.313726	NM_001165960	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	ENST00000448843.2	37	CCDS11130.1	.	.	.	.	.	.	.	.	.	.	c	25.8	4.677504	0.88445	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	T;T;T	0.77620	-1.11;-1.11;-1.11	5.06	4.08	0.47627	Lipoxygenase, C-terminal (3);	0.061563	0.64402	D	0.000003	T	0.81688	0.4875	M	0.71296	2.17	0.41900	D	0.990418	P;P;P	0.45594	0.554;0.862;0.862	B;P;P	0.50136	0.312;0.632;0.632	D	0.84169	0.0433	10	0.72032	D	0.01	-22.8779	12.9038	0.58141	0.0:0.9196:0.0:0.0804	.	632;500;500	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	I	656;632;500	ENSP00000369494:V656I;ENSP00000314879:V632I;ENSP00000400581:V500I	ENSP00000314879:V632I	V	-	1	0	ALOXE3	7953281	0.229000	0.23729	0.393000	0.26258	0.960000	0.62799	0.696000	0.25541	1.369000	0.46134	0.556000	0.70494	GTC	.	.	alt		0.652	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1		
MUC16	94025	hgsc.bcm.edu	37	19	8993393	8993393	+	Missense_Mutation	SNP	C	C	A	rs376237412		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:8993393C>A	ENST00000397910.4	-	66	41899	c.41696G>T	c.(41695-41697)aGg>aTg	p.R13899M	MUC16_ENST00000380951.5_Missense_Mutation_p.R540M	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13902	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGACTGTCCCTGTCCAGTGT	0.562																																					p.R13899M		Atlas-SNP	.											.	MUC16	4315	.	0			c.G41696T						PASS	.						157.0	145.0	149.0					19																	8993393		2058	4191	6249	SO:0001583	missense	94025	exon66			CTGTCCCTGTCCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41696G>T	19.37:g.8993393C>A	ENSP00000381008:p.Arg13899Met	115.0	0.0	0		114.0	28.0	0.245614	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.61|12.61	1.988656|1.988656	0.35131|0.35131	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.25579	.|1.79;1.79	3.61|3.61	-6.75|-6.75	0.01738|0.01738	.|.	.|2.513830	.|0.02296	.|U	.|0.070703	T|T	0.46541|0.46541	0.1398|0.1398	M|M	0.74881|0.74881	2.28|2.28	.|.	.|.	.|.	.|P;D	.|0.60575	.|0.79;0.988	.|B;D	.|0.78314	.|0.339;0.991	T|T	0.60752|0.60752	-0.7201|-0.7201	4|9	.|0.66056	.|D	.|0.02	.|.	7.8879|7.8879	0.29661|0.29661	0.0:0.1805:0.1386:0.6809|0.0:0.1805:0.1386:0.6809	.|.	.|21544;13899	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	W|M	739|13899;540	.|ENSP00000381008:R13899M;ENSP00000370338:R540M	.|ENSP00000370338:R540M	G|R	-|-	1|2	0|0	MUC16|MUC16	8854393|8854393	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	-0.619000|-0.619000	0.05572|0.05572	-1.236000|-1.236000	0.02542|0.02542	-1.011000|-1.011000	0.02470|0.02470	GGG|AGG	.	.	alt		0.562	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
IGJ	3512	hgsc.bcm.edu	37	4	71522967	71522967	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:71522967G>A	ENST00000254801.4	-	3	399	c.230C>T	c.(229-231)tCa>tTa	p.S77L	IGJ_ENST00000543780.1_Missense_Mutation_p.S93L|ENAM_ENST00000472903.1_Intron	NM_144646.3	NP_653247.1	P01591	IGJ_HUMAN	immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides	77					adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|dimeric IgA immunoglobulin complex (GO:0071750)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|pentameric IgM immunoglobulin complex (GO:0071756)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7			Lung(101;0.235)			TCTCAATGGTGAGGTGGGATC	0.308																																					p.S77L		Atlas-SNP	.											.	IGJ	13	.	0			c.C230T						PASS	.						103.0	96.0	98.0					4																	71522967		2203	4298	6501	SO:0001583	missense	3512	exon3			AATGGTGAGGTGG	M12759	CCDS3545.1	4q21	2012-10-02			ENSG00000132465	ENSG00000132465		"""Immunoglobulins / IGJ linker"""	5713	protein-coding gene	gene with protein product	"""immunoglobulin J chain"", ""IgJ chain"""	147790				3016707, 2984306	Standard	NM_144646		Approved	IGCJ, JCH	uc003hfn.4	P01591	OTTHUMG00000129909	ENST00000254801.4:c.230C>T	4.37:g.71522967G>A	ENSP00000254801:p.Ser77Leu	91.0	0.0	0		87.0	18.0	0.206897	NM_144646		Missense_Mutation	SNP	ENST00000254801.4	37	CCDS3545.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.506896	0.85282	.	.	ENSG00000132465	ENST00000254801;ENST00000510437;ENST00000543780;ENST00000510614;ENST00000391614	.	.	.	5.5	5.5	0.81552	.	0.000000	0.52532	D	0.000080	T	0.69387	0.3105	L	0.36672	1.1	0.42993	D	0.99449	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.72312	-0.4331	9	0.87932	D	0	.	18.181	0.89777	0.0:0.0:1.0:0.0	.	93;77	D6RHJ6;P01591	.;IGJ_HUMAN	L	77;77;93;86;93	.	ENSP00000254801:S77L	S	-	2	0	IGJ	71741831	1.000000	0.71417	0.991000	0.47740	0.919000	0.55068	4.942000	0.63547	2.588000	0.87417	0.655000	0.94253	TCA	.	.	none		0.308	IGJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252160.1	NM_144646	
IRF4	3662	hgsc.bcm.edu	37	6	393206	393206	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:393206C>G	ENST00000380956.4	+	2	180	c.54C>G	c.(52-54)agC>agG	p.S18R	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	18					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S18R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GCGCGGTGAGCTGCGGCAACG	0.706			T	IGH@	MM																																p.S18R		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	IRF4_ENST00000380956,NS,carcinoma,+2,4	IRF4	65	4	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C54G						scavenged	.						29.0	32.0	31.0					6																	393206		2179	4264	6443	SO:0001583	missense	3662	exon2			GGTGAGCTGCGGC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.54C>G	6.37:g.393206C>G	ENSP00000370343:p.Ser18Arg	89.0	1.0	0.011236		67.0	22.0	0.328358	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064151	0.76187	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97752	-4.52	4.48	3.51	0.40186	Interferon regulatory factor DNA-binding domain (1);	0.429735	0.29579	N	0.011746	D	0.96775	0.8947	L	0.53729	1.69	0.58432	D	0.999998	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.69824	0.893;0.966;0.959	D	0.94663	0.7850	10	0.27785	T	0.31	-18.6481	7.4654	0.27318	0.0:0.7502:0.0:0.2498	.	18;18;18	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	R	18;48	ENSP00000370343:S18R	ENSP00000370343:S18R	S	+	3	2	IRF4	338206	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.305000	0.51873	2.339000	0.79563	0.306000	0.20318	AGC	.	.	none		0.706	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
MMEL1	79258	hgsc.bcm.edu	37	1	2527447	2527447	+	Splice_Site	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:2527447C>A	ENST00000378412.3	-	15	1662		c.e15+1		MMEL1_ENST00000502556.1_Splice_Site|MMEL1_ENST00000288709.6_Splice_Site			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1							endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GAGCCACATACCTTCTCCTGC	0.632																																					.		Atlas-SNP	.											.	MMEL1	64	.	0			c.1500+1G>T						PASS	.						202.0	163.0	176.0					1																	2527447		2203	4300	6503	SO:0001630	splice_region_variant	79258	exon16			CACATACCTTCTC	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1500+1G>T	1.37:g.2527447C>A		120.0	0.0	0		109.0	28.0	0.256881	NM_033467	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Splice_Site	SNP	ENST00000378412.3	37	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754525	0.49362	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7647	0.88475	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MMEL1	2517307	1.000000	0.71417	0.998000	0.56505	0.154000	0.21943	7.444000	0.80532	2.606000	0.88127	0.655000	0.94253	.	.	.	none		0.632	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	Intron
FOXA2	3170	hgsc.bcm.edu	37	20	22562836	22562836	+	Silent	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr20:22562836C>T	ENST00000377115.4	-	3	1207	c.1026G>A	c.(1024-1026)caG>caA	p.Q342Q	FOXA2_ENST00000419308.2_Silent_p.Q348Q	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	342					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					CGGCCTGCTGCTGCTGCCCGG	0.756																																					p.Q348Q		Atlas-SNP	.											.	FOXA2	48	.	0			c.G1044A						PASS	.						14.0	12.0	13.0					20																	22562836		1999	3801	5800	SO:0001819	synonymous_variant	3170	exon2			CTGCTGCTGCTGC	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.1026G>A	20.37:g.22562836C>T		99.0	0.0	0		74.0	20.0	0.27027	NM_021784	Q8WUW4|Q96DF7	Silent	SNP	ENST00000377115.4	37	CCDS13147.1																																																																																			.	.	none		0.756	FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078289.1		
MYH14	79784	hgsc.bcm.edu	37	19	50753007	50753007	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:50753007G>A	ENST00000596571.1	+	12	1559	c.1559G>A	c.(1558-1560)cGt>cAt	p.R520H	MYH14_ENST00000440075.2_Missense_Mutation_p.R528H|MYH14_ENST00000262269.8_Missense_Mutation_p.R528H|MYH14_ENST00000425460.1_Missense_Mutation_p.R528H|MYH14_ENST00000376970.2_Missense_Mutation_p.R520H|MYH14_ENST00000601313.1_Missense_Mutation_p.R528H|MYH14_ENST00000598205.1_Missense_Mutation_p.R528H			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	520	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GAGTACCAGCGTGAGGGCATC	0.622																																					p.R528H		Atlas-SNP	.											MYH14_ENST00000262269,NS,carcinoma,+1,2	MYH14	261	2	0			c.G1583A						PASS	.						177.0	150.0	159.0					19																	50753007		2203	4300	6503	SO:0001583	missense	79784	exon14			ACCAGCGTGAGGG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1559G>A	19.37:g.50753007G>A	ENSP00000472819:p.Arg520His	105.0	0.0	0		96.0	28.0	0.291667	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893565	0.91889	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74	4.37	4.37	0.52481	Myosin head, motor domain (2);	.	.	.	.	D	0.88923	0.6569	M	0.93241	3.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72075	0.976;0.965;0.913	D	0.91720	0.5388	9	0.87932	D	0	.	14.7979	0.69891	0.0:0.0:1.0:0.0	.	528;520;528	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	H	520;528;520;528;520;528	ENSP00000406273:R528H;ENSP00000366169:R520H;ENSP00000407879:R528H;ENSP00000262269:R528H	ENSP00000262269:R528H	R	+	2	0	MYH14	55444819	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.602000	0.82796	2.429000	0.82318	0.655000	0.94253	CGT	.	.	none		0.622	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
FAM47C	442444	hgsc.bcm.edu	37	X	37028925	37028925	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chrX:37028925G>A	ENST00000358047.3	+	1	2494	c.2442G>A	c.(2440-2442)ccG>ccA	p.P814P		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	814										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GTCTCTGCCCGGAGCCTACCA	0.557																																					p.P814P		Atlas-SNP	.											.	FAM47C	267	.	0			c.G2442A						PASS	.						51.0	52.0	51.0					X																	37028925		2202	4300	6502	SO:0001819	synonymous_variant	442444	exon1			CTGCCCGGAGCCT	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2442G>A	X.37:g.37028925G>A		79.0	0.0	0		68.0	35.0	0.514706	NM_001013736	Q6ZU46	Silent	SNP	ENST00000358047.3	37	CCDS35227.1																																																																																			.	.	none		0.557	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
SDK1	221935	hgsc.bcm.edu	37	7	4153851	4153851	+	Silent	SNP	C	C	T	rs549888988	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr7:4153851C>T	ENST00000404826.2	+	25	3907	c.3768C>T	c.(3766-3768)aaC>aaT	p.N1256N	SDK1_ENST00000389531.3_Silent_p.N1256N	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1256	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGGCCTTCAACGCCGTCGGGG	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		16102	0.0		0.0	False		,,,				2504	0.002				p.N1256N		Atlas-SNP	.											.	SDK1	361	.	0			c.C3768T						PASS	.						36.0	35.0	35.0					7																	4153851		2203	4300	6503	SO:0001819	synonymous_variant	221935	exon25			CTTCAACGCCGTC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3768C>T	7.37:g.4153851C>T		101.0	0.0	0		94.0	32.0	0.340426	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																			.	.	none		0.632	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
PIM1	5292	hgsc.bcm.edu	37	6	37138919	37138919	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138919C>T	ENST00000373509.5	+	4	632	c.259C>T	c.(259-261)Ccc>Tcc	p.P87S		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	178					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CACTCGAGTGCCCATGGAAGT	0.657			T	BCL6	NHL																																p.P178S		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C532T						PASS	.						58.0	66.0	63.0					6																	37138919		2203	4300	6503	SO:0001583	missense	5292	exon4			CGAGTGCCCATGG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.259C>T	6.37:g.37138919C>T	ENSP00000362608:p.Pro87Ser	53.0	0.0	0		63.0	11.0	0.174603	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182069	0.78677	.	.	ENSG00000137193	ENST00000373509	T	0.13307	2.6	4.28	3.41	0.39046	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.065293	0.64402	N	0.000006	T	0.15696	0.0378	L	0.52905	1.665	0.58432	D	0.999994	P	0.51537	0.946	P	0.56612	0.802	T	0.01042	-1.1471	10	0.87932	D	0	.	12.2367	0.54520	0.0:0.9151:0.0:0.0849	.	178	P11309	PIM1_HUMAN	S	87	ENSP00000362608:P87S	ENSP00000362608:P87S	P	+	1	0	PIM1	37246897	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.764000	0.68826	1.146000	0.42352	0.549000	0.68633	CCC	.	.	none		0.657	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
KCNT2	343450	hgsc.bcm.edu	37	1	196451484	196451484	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:196451484T>A	ENST00000294725.9	-	4	1216	c.301A>T	c.(301-303)Agt>Tgt	p.S101C	KCNT2_ENST00000367433.5_Missense_Mutation_p.S101C|KCNT2_ENST00000451324.2_De_novo_Start_InFrame|KCNT2_ENST00000367431.4_Missense_Mutation_p.S101C|KCNT2_ENST00000609185.1_Missense_Mutation_p.S101C			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	101					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AAAGGTAGACTTCTGTTCACC	0.289																																					p.S101C		Atlas-SNP	.											.	KCNT2	243	.	0			c.A301T						PASS	.						59.0	55.0	56.0					1																	196451484		2202	4300	6502	SO:0001583	missense	343450	exon4			GTAGACTTCTGTT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.301A>T	1.37:g.196451484T>A	ENSP00000294725:p.Ser101Cys	227.0	0.0	0		229.0	53.0	0.231441	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464348	0.63513	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19105	2.18;2.17;2.43	5.44	4.25	0.50352	.	0.079635	0.53938	D	0.000052	T	0.26376	0.0644	L	0.42245	1.32	0.80722	D	1	D;P;P;D	0.55800	0.973;0.711;0.945;0.973	P;P;P;P	0.51550	0.474;0.673;0.673;0.474	T	0.01099	-1.1452	10	0.48119	T	0.1	-21.5096	11.4097	0.49919	0.1351:0.0:0.0:0.8649	.	101;101;101;101	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	C	101	ENSP00000356403:S101C;ENSP00000356401:S101C;ENSP00000294725:S101C	ENSP00000294725:S101C	S	-	1	0	KCNT2	194718107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.280000	0.43443	2.183000	0.69458	0.533000	0.62120	AGT	.	.	none		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
TNF	7124	hgsc.bcm.edu	37	6	31544592	31544592	+	Splice_Site	SNP	G	G	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:31544592G>C	ENST00000449264.2	+	3	455		c.e3+1			NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	CATGTTGTAGGTAAGAGCTCT	0.483									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												.		Atlas-SNP	.											.	TNF	15	.	0			c.280+1G>C						PASS	.						192.0	191.0	191.0					6																	31544592		1511	2709	4220	SO:0001630	splice_region_variant	7124	exon3	Familial Cancer Database	incl.: Familial Head and Neck Cancer	TTGTAGGTAAGAG	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.280+1G>C	6.37:g.31544592G>C		243.0	0.0	0		164.0	61.0	0.371951	NM_000594	O43647|Q9P1Q2|Q9UIV3	Splice_Site	SNP	ENST00000449264.2	37	CCDS4702.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.666938	0.67814	.	.	ENSG00000232810	ENST00000449264	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1679	0.59581	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNF	31652571	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.530000	0.60595	2.490000	0.84030	0.655000	0.94253	.	.	.	none		0.483	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		Intron
DOCK3	1795	hgsc.bcm.edu	37	3	51315142	51315142	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr3:51315142C>T	ENST00000266037.9	+	26	2803	c.2780C>T	c.(2779-2781)gCg>gTg	p.A927V		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	927					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.A927V(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GCTCAGGAGGCGGTAAGAGGG	0.547																																					p.A927V		Atlas-SNP	.											DOCK3_ENST00000266037,colon,carcinoma,0,1	DOCK3	397	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2780T						PASS	.						42.0	44.0	44.0					3																	51315142		2052	4183	6235	SO:0001583	missense	1795	exon26			AGGAGGCGGTAAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2780C>T	3.37:g.51315142C>T	ENSP00000266037:p.Ala927Val	242.0	0.0	0		255.0	62.0	0.243137	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936315	0.73442	.	.	ENSG00000088538	ENST00000266037	T	0.66460	-0.21	5.25	5.25	0.73442	.	0.203179	0.53938	D	0.000060	T	0.54679	0.1873	L	0.41236	1.265	0.58432	D	0.999996	P	0.47350	0.894	B	0.32864	0.154	T	0.57808	-0.7747	10	0.29301	T	0.29	.	19.2367	0.93864	0.0:1.0:0.0:0.0	.	927	Q8IZD9	DOCK3_HUMAN	V	927	ENSP00000266037:A927V	ENSP00000266037:A927V	A	+	2	0	DOCK3	51290182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.089000	0.71384	2.637000	0.89404	0.585000	0.79938	GCG	.	.	none		0.547	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
MPEG1	219972	hgsc.bcm.edu	37	11	58980009	58980009	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:58980009G>A	ENST00000361050.3	-	1	415	c.330C>T	c.(328-330)agC>agT	p.S110S	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	110	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				AGTAGGAGGTGCTACTCTGGT	0.453																																					p.S110S		Atlas-SNP	.											.	MPEG1	72	.	0			c.C330T						PASS	.						200.0	187.0	191.0					11																	58980009		1918	4125	6043	SO:0001819	synonymous_variant	219972	exon1			GGAGGTGCTACTC	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.330C>T	11.37:g.58980009G>A		121.0	0.0	0		133.0	45.0	0.338346	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	37	CCDS41650.1																																																																																			.	.	none		0.453	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
BAAT	570	hgsc.bcm.edu	37	9	104125078	104125078	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr9:104125078G>A	ENST00000395051.3	-	3	959	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	BAAT_ENST00000259407.2_Missense_Mutation_p.R297C			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	297					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	TCAAAAGTGCGATAGAGCTCT	0.453																																					p.R297C		Atlas-SNP	.											BAAT,NS,carcinoma,+1,2	BAAT	52	2	0			c.C889T						PASS	.						105.0	106.0	105.0					9																	104125078		2203	4300	6503	SO:0001583	missense	570	exon4			AAGTGCGATAGAG	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.889C>T	9.37:g.104125078G>A	ENSP00000378491:p.Arg297Cys	170.0	0.0	0		171.0	31.0	0.181287	NM_001127610	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193049	0.58017	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.32023	1.47;1.47	4.96	-5.2	0.02823	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	2.307260	0.01179	N	0.007052	T	0.27798	0.0684	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	P	0.56916	0.809	T	0.35773	-0.9775	10	0.72032	D	0.01	1.8351	1.2033	0.01890	0.1891:0.3271:0.153:0.3308	.	297	Q14032	BAAT_HUMAN	C	297	ENSP00000259407:R297C;ENSP00000378491:R297C	ENSP00000259407:R297C	R	-	1	0	BAAT	103164899	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.138000	0.01303	-0.582000	0.05929	0.655000	0.94253	CGC	.	.	none		0.453	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053433.1		
IRF4	3662	hgsc.bcm.edu	37	6	393328	393328	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:393328A>G	ENST00000380956.4	+	2	302	c.176A>G	c.(175-177)aAg>aGg	p.K59R	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	59					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CACGCGGGCAAGCAGGACTAC	0.692			T	IGH@	MM																																p.K59R		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.A176G						PASS	.						29.0	26.0	27.0					6																	393328		2201	4300	6501	SO:0001583	missense	3662	exon2			CGGGCAAGCAGGA	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.176A>G	6.37:g.393328A>G	ENSP00000370343:p.Lys59Arg	83.0	0.0	0		68.0	20.0	0.294118	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376789	0.82682	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97328	-4.34	4.58	4.58	0.56647	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.097786	0.64402	D	0.000001	D	0.94318	0.8174	L	0.27944	0.81	0.80722	D	1	P;P;D	0.54207	0.93;0.914;0.965	D;D;D	0.69307	0.945;0.909;0.963	D	0.92833	0.6282	10	0.05959	T	0.93	-29.4556	14.1683	0.65493	1.0:0.0:0.0:0.0	.	59;59;59	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	R	59;89	ENSP00000370343:K59R	ENSP00000370343:K59R	K	+	2	0	IRF4	338328	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.258000	0.89853	1.943000	0.56356	0.254000	0.18369	AAG	.	.	none		0.692	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
UNC80	285175	hgsc.bcm.edu	37	2	210690724	210690724	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:210690724G>A	ENST00000439458.1	+	14	2505	c.2425G>A	c.(2425-2427)Gga>Aga	p.G809R	UNC80_ENST00000272845.6_Missense_Mutation_p.G809R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	809					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TTGTGGTGAAGGACACCGAGG	0.458																																					p.G809R		Atlas-SNP	.											UNC80_ENST00000439458,NS,carcinoma,0,1	UNC80	280	1	0			c.G2425A						PASS	.						128.0	120.0	122.0					2																	210690724		692	1591	2283	SO:0001583	missense	285175	exon14			GGTGAAGGACACC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2425G>A	2.37:g.210690724G>A	ENSP00000391088:p.Gly809Arg	94.0	0.0	0		95.0	28.0	0.294737	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	32	5.166077	0.94768	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.51071	0.72;0.73	5.96	5.96	0.96718	.	.	.	.	.	T	0.68348	0.2991	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68078	-0.5504	9	0.87932	D	0	-5.2129	20.422	0.99049	0.0:0.0:1.0:0.0	.	809	Q8N2C7	UNC80_HUMAN	R	809	ENSP00000391088:G809R;ENSP00000272845:G809R	ENSP00000272845:G809R	G	+	1	0	UNC80	210398969	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.855000	0.99526	2.832000	0.97577	0.655000	0.94253	GGA	.	.	none		0.458	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
PIM1	5292	hgsc.bcm.edu	37	6	37138267	37138267	+	5'UTR	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138267G>A	ENST00000373509.5	+	0	289					NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	acagccccagGCATAGCCTTC	0.697			T	BCL6	NHL																																p.R63R		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G189A						PASS	.																																			SO:0001623	5_prime_UTR_variant	5292	exon1			CCCCAGGCATAGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.-85G>A	6.37:g.37138267G>A		30.0	0.0	0		39.0	9.0	0.230769	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.697	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138609	37138609	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138609G>A	ENST00000373509.5	+	2	516	c.143G>A	c.(142-144)gGc>gAc	p.G48D		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	139					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGCAGCGGCGGCTTCGGCTCG	0.736			T	BCL6	NHL																																p.G139D		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G416A						PASS	.						20.0	30.0	27.0					6																	37138609		2169	4264	6433	SO:0001583	missense	5292	exon2			GCGGCGGCTTCGG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.143G>A	6.37:g.37138609G>A	ENSP00000362608:p.Gly48Asp	99.0	0.0	0		106.0	19.0	0.179245	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111530	0.77210	.	.	ENSG00000137193	ENST00000373509	T	0.16073	2.37	4.64	2.82	0.32997	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.28001	0.0690	H	0.95294	3.65	0.48762	D	0.999708	P	0.43826	0.818	P	0.49387	0.609	T	0.17684	-1.0361	10	0.87932	D	0	.	9.1477	0.36944	0.0781:0.0:0.7761:0.1459	.	139	P11309	PIM1_HUMAN	D	48	ENSP00000362608:G48D	ENSP00000362608:G48D	G	+	2	0	PIM1	37246587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.992000	0.70609	0.485000	0.27652	0.549000	0.68633	GGC	.	.	none		0.736	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PIM1	5292	hgsc.bcm.edu	37	6	37139042	37139042	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37139042G>A	ENST00000373509.5	+	4	755	c.382G>A	c.(382-384)Gat>Aat	p.D128N		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	219					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCCGGTGCAAGATCTCTTCGA	0.622			T	BCL6	NHL																																p.D219N		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G655A						PASS	.						81.0	95.0	91.0					6																	37139042		2203	4300	6503	SO:0001583	missense	5292	exon4			GTGCAAGATCTCT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.382G>A	6.37:g.37139042G>A	ENSP00000362608:p.Asp128Asn	111.0	0.0	0		125.0	57.0	0.456	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857582	0.91433	.	.	ENSG00000137193	ENST00000373509	T	0.15603	2.41	4.28	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	L	0.42008	1.315	0.80722	D	1	D	0.53745	0.962	P	0.62885	0.908	T	0.02081	-1.1217	10	0.87932	D	0	.	16.8746	0.86048	0.0:0.0:1.0:0.0	.	219	P11309	PIM1_HUMAN	N	128	ENSP00000362608:D128N	ENSP00000362608:D128N	D	+	1	0	PIM1	37247020	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	9.149000	0.94659	2.371000	0.80710	0.549000	0.68633	GAT	.	.	none		0.622	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
KIAA1244	57221	hgsc.bcm.edu	37	6	138528237	138528237	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:138528237C>A	ENST00000251691.4	+	3	362	c.196C>A	c.(196-198)Caa>Aaa	p.Q66K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GAAGCTGGCCCAACATGCTTT	0.453																																					p.Q66K		Atlas-SNP	.											.	KIAA1244	236	.	0			c.C196A						PASS	.						91.0	78.0	82.0					6																	138528237		2203	4300	6503	SO:0001583	missense	57221	exon3			CTGGCCCAACATG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.196C>A	6.37:g.138528237C>A	ENSP00000251691:p.Gln66Lys	101.0	0.0	0		85.0	18.0	0.211765	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414067	0.83449	.	.	ENSG00000112379	ENST00000251691	T	0.17370	2.28	5.77	5.77	0.91146	.	.	.	.	.	T	0.22742	0.0549	L	0.29908	0.895	0.58432	D	0.999997	D	0.63880	0.993	D	0.67548	0.952	T	0.01156	-1.1434	9	0.41790	T	0.15	-13.1881	19.9944	0.97379	0.0:1.0:0.0:0.0	.	66	Q5TH69	BIG3_HUMAN	K	66	ENSP00000251691:Q66K	ENSP00000251691:Q66K	Q	+	1	0	KIAA1244	138569930	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.262000	0.78410	2.720000	0.93068	0.557000	0.71058	CAA	.	.	none		0.453	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
GAL3ST1	9514	hgsc.bcm.edu	37	22	30951371	30951371	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:30951371G>A	ENST00000402321.1	-	3	1158	c.841C>T	c.(841-843)Cgc>Tgc	p.R281C	GAL3ST1_ENST00000338911.5_Missense_Mutation_p.R281C|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.R281C|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.R281C|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.R281C|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.R281C|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.R281C			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	281				RR -> LN (in Ref. 1; AA sequence). {ECO:0000305}.	galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						GAGTCGCGGCGGGCGTTGAGC	0.652																																					p.R281C		Atlas-SNP	.											.	GAL3ST1	44	.	0			c.C841T						PASS	.						39.0	44.0	42.0					22																	30951371		2203	4300	6503	SO:0001583	missense	9514	exon4			CGCGGCGGGCGTT	D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.841C>T	22.37:g.30951371G>A	ENSP00000385735:p.Arg281Cys	40.0	0.0	0		31.0	10.0	0.322581	NM_004861	Q96C63	Missense_Mutation	SNP	ENST00000402321.1	37	CCDS13879.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200716	0.79015	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72;1.72	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.61961	0.2389	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71464	-0.4585	10	0.87932	D	0	-8.8903	18.6705	0.91508	0.0:0.0:1.0:0.0	.	281	Q99999	G3ST1_HUMAN	C	281	ENSP00000385825:R281C;ENSP00000385735:R281C;ENSP00000384122:R281C;ENSP00000384388:R281C;ENSP00000343234:R281C;ENSP00000385207:R281C;ENSP00000402587:R281C	ENSP00000343234:R281C	R	-	1	0	GAL3ST1	29281371	1.000000	0.71417	0.995000	0.50966	0.835000	0.47333	4.470000	0.60175	2.523000	0.85059	0.561000	0.74099	CGC	.	.	none		0.652	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321745.1	NM_004861	
STOML2	30968	hgsc.bcm.edu	37	9	35100654	35100654	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr9:35100654C>T	ENST00000356493.5	-	9	936	c.874G>A	c.(874-876)Gac>Aac	p.D292N	RP11-182N22.8_ENST00000431804.1_RNA|STOML2_ENST00000487490.1_5'Flank|STOML2_ENST00000452248.2_Missense_Mutation_p.D247N	NM_013442.1	NP_038470.1	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	292					CD4-positive, alpha-beta T cell activation (GO:0035710)|cellular calcium ion homeostasis (GO:0006874)|interleukin-2 production (GO:0032623)|lipid localization (GO:0010876)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|mitochondrial calcium ion transport (GO:0006851)|mitochondrial protein processing (GO:0034982)|mitochondrion organization (GO:0007005)|positive regulation of cardiolipin metabolic process (GO:1900210)|positive regulation of mitochondrial DNA replication (GO:0090297)|positive regulation of mitochondrial membrane potential (GO:0010918)|protein oligomerization (GO:0051259)|stress-induced mitochondrial fusion (GO:1990046)|T cell receptor signaling pathway (GO:0050852)	cytoskeleton (GO:0005856)|extrinsic component of plasma membrane (GO:0019897)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	cardiolipin binding (GO:1901612)|receptor binding (GO:0005102)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	16			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTGTTGGAGTCCTTGGCCAGT	0.542																																					p.D292N		Atlas-SNP	.											.	STOML2	27	.	0			c.G874A						PASS	.						215.0	190.0	199.0					9																	35100654		2203	4300	6503	SO:0001583	missense	30968	exon9			TGGAGTCCTTGGC	AF190167	CCDS6577.1, CCDS69588.1, CCDS75830.1	9p13.1	2008-02-05			ENSG00000165283	ENSG00000165283			14559	protein-coding gene	gene with protein product		608292				10713127, 17121834	Standard	NM_001287031		Approved	SLP-2, HSPC108	uc003zwi.3	Q9UJZ1	OTTHUMG00000019851	ENST00000356493.5:c.874G>A	9.37:g.35100654C>T	ENSP00000348886:p.Asp292Asn	113.0	0.0	0		129.0	12.0	0.0930233	NM_013442	B4E1K7|D3DRN3|O60376|Q53G29|Q96FY2|Q9P042	Missense_Mutation	SNP	ENST00000356493.5	37	CCDS6577.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325674	0.60743	.	.	ENSG00000165283	ENST00000356493;ENST00000452248	D;D	0.98090	-3.44;-4.71	5.51	5.51	0.81932	.	0.237450	0.43110	D	0.000605	D	0.94771	0.8312	N	0.24115	0.695	0.54753	D	0.999986	B;B	0.26318	0.006;0.146	B;B	0.28465	0.004;0.09	D	0.92340	0.5881	9	.	.	.	-17.448	19.403	0.94639	0.0:1.0:0.0:0.0	.	247;292	B4E1K7;Q9UJZ1	.;STML2_HUMAN	N	292;247	ENSP00000348886:D292N;ENSP00000395743:D247N	.	D	-	1	0	STOML2	35090654	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.893000	0.69798	2.590000	0.87494	0.563000	0.77884	GAC	.	.	none		0.542	STOML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052273.1	NM_013442	
EIF3A	8661	hgsc.bcm.edu	37	10	120824953	120824953	+	Silent	SNP	A	A	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr10:120824953A>C	ENST00000369144.3	-	7	1207	c.1080T>G	c.(1078-1080)ggT>ggG	p.G360G	EIF3A_ENST00000541549.1_Silent_p.G326G	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		GGGCTTGAAGACCTAGTAGTG	0.418																																					p.G360G		Atlas-SNP	.											.	EIF3A	142	.	0			c.T1080G						PASS	.						135.0	127.0	130.0					10																	120824953		2203	4300	6503	SO:0001819	synonymous_variant	8661	exon7			TTGAAGACCTAGT	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1080T>G	10.37:g.120824953A>C		136.0	0.0	0		129.0	35.0	0.271318	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Silent	SNP	ENST00000369144.3	37	CCDS7608.1																																																																																			.	.	none		0.418	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
VPS13B	157680	hgsc.bcm.edu	37	8	100887760	100887760	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr8:100887760C>T	ENST00000358544.2	+	62	12046	c.11935C>T	c.(11935-11937)Cct>Tct	p.P3979S	VPS13B_ENST00000357162.2_Missense_Mutation_p.P3954S|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3979					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AATACCATGCCCTGTGGTGGC	0.478																																					p.P3979S	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.C11935T						PASS	.						152.0	130.0	137.0					8																	100887760		2203	4300	6503	SO:0001583	missense	157680	exon62			CCATGCCCTGTGG	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.11935C>T	8.37:g.100887760C>T	ENSP00000351346:p.Pro3979Ser	172.0	0.0	0		162.0	61.0	0.376543	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	3.563	-0.089224	0.07097	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.67171	-0.25;-0.25	5.65	3.84	0.44239	.	0.292622	0.31949	N	0.006813	T	0.44932	0.1317	N	0.14661	0.345	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.002	T	0.20605	-1.0270	10	0.10902	T	0.67	.	11.2147	0.48819	0.0:0.8027:0.1284:0.0689	.	3954;3979	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	S	3954;3979	ENSP00000349685:P3954S;ENSP00000351346:P3979S	ENSP00000349685:P3954S	P	+	1	0	VPS13B	100956936	0.012000	0.17670	0.980000	0.43619	0.612000	0.37316	1.690000	0.37711	0.729000	0.32403	0.655000	0.94253	CCT	.	.	none		0.478	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
PRKCH	5583	hgsc.bcm.edu	37	14	61857975	61857975	+	Silent	SNP	G	G	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr14:61857975G>T	ENST00000332981.5	+	2	781	c.396G>T	c.(394-396)gtG>gtT	p.V132V	PRKCH_ENST00000555082.1_5'UTR	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	132					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		AAGTATTTGTGGTAATAACCC	0.338																																					p.V132V	Melanoma(135;863 1779 8064 14443 26348)	Atlas-SNP	.											.	PRKCH	89	.	0			c.G396T						PASS	.						87.0	85.0	86.0					14																	61857975		2203	4300	6503	SO:0001819	synonymous_variant	5583	exon2			ATTTGTGGTAATA	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.396G>T	14.37:g.61857975G>T		106.0	0.0	0		106.0	29.0	0.273585	NM_006255	B4DJN5|Q16246|Q8NE03	Silent	SNP	ENST00000332981.5	37	CCDS9752.1																																																																																			.	.	none		0.338	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
ZNF677	342926	hgsc.bcm.edu	37	19	53740528	53740528	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:53740528C>G	ENST00000598513.1	-	5	1602	c.1452G>C	c.(1450-1452)gaG>gaC	p.E484D	ZNF677_ENST00000333952.4_Missense_Mutation_p.E484D	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E484D(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TGTAAGGTTTCTCTCCAGTAT	0.358																																					p.E484D		Atlas-SNP	.											ZNF677,colon,carcinoma,0,2	ZNF677	94	2	1	Substitution - Missense(1)	large_intestine(1)	c.G1452C						PASS	.						70.0	69.0	70.0					19																	53740528		2203	4300	6503	SO:0001583	missense	342926	exon5			AGGTTTCTCTCCA	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1452G>C	19.37:g.53740528C>G	ENSP00000469391:p.Glu484Asp	139.0	0.0	0		139.0	46.0	0.330935	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720032	0.48728	.	.	ENSG00000197928	ENST00000333952	T	0.26810	1.71	2.21	1.06	0.20224	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35677	N	0.003049	T	0.23926	0.0579	L	0.37630	1.12	0.24758	N	0.992942	P	0.49185	0.92	P	0.50192	0.634	T	0.06499	-1.0823	10	0.72032	D	0.01	.	6.2797	0.21001	0.0:0.8126:0.0:0.1874	.	484	Q86XU0	ZN677_HUMAN	D	484	ENSP00000334394:E484D	ENSP00000334394:E484D	E	-	3	2	ZNF677	58432340	0.810000	0.29049	0.999000	0.59377	0.915000	0.54546	0.297000	0.19101	0.413000	0.25759	-0.345000	0.07892	GAG	.	.	none		0.358	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
CDH20	28316	hgsc.bcm.edu	37	18	59203733	59203733	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:59203733A>C	ENST00000262717.4	+	8	1677	c.1279A>C	c.(1279-1281)Att>Ctt	p.I427L	CDH20_ENST00000536675.2_Missense_Mutation_p.I427L|CDH20_ENST00000538374.1_Missense_Mutation_p.I427L			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	427	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				CAGATACTCCATTGATAGAAG	0.423																																					p.I427L		Atlas-SNP	.											.	CDH20	117	.	0			c.A1279C						PASS	.						220.0	201.0	207.0					18																	59203733		2203	4300	6503	SO:0001583	missense	28316	exon7			TACTCCATTGATA	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1279A>C	18.37:g.59203733A>C	ENSP00000262717:p.Ile427Leu	126.0	0.0	0		252.0	41.0	0.162698	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.405638	0.62288	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.55413	0.52;0.52;0.52	5.36	5.36	0.76844	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.49847	0.1581	L	0.45137	1.4	0.58432	D	0.999996	B	0.21753	0.06	B	0.31101	0.124	T	0.46105	-0.9215	10	0.41790	T	0.15	.	15.641	0.77001	1.0:0.0:0.0:0.0	.	427	Q9HBT6	CAD20_HUMAN	L	427	ENSP00000444767:I427L;ENSP00000442226:I427L;ENSP00000262717:I427L	ENSP00000262717:I427L	I	+	1	0	CDH20	57354713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.669000	0.91163	2.158000	0.67659	0.523000	0.50628	ATT	.	.	none		0.423	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
PDZD8	118987	hgsc.bcm.edu	37	10	119133982	119133982	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr10:119133982A>G	ENST00000334464.5	-	1	996	c.757T>C	c.(757-759)Ttc>Ctc	p.F253L		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	253					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		CGCACCTCGAAGTCGATCAGC	0.597																																					p.F253L		Atlas-SNP	.											.	PDZD8	85	.	0			c.T757C						PASS	.						57.0	58.0	57.0					10																	119133982		2203	4300	6503	SO:0001583	missense	118987	exon1			CCTCGAAGTCGAT	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.757T>C	10.37:g.119133982A>G	ENSP00000334642:p.Phe253Leu	92.0	0.0	0		70.0	14.0	0.2	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	A	4.086	0.014013	0.07959	.	.	ENSG00000165650	ENST00000334464	D	0.84370	-1.84	4.87	3.72	0.42706	.	0.063697	0.64402	D	0.000005	T	0.69744	0.3145	N	0.16478	0.41	0.49299	D	0.999774	B	0.15930	0.015	B	0.15052	0.012	T	0.57306	-0.7834	10	0.20046	T	0.44	-9.6398	6.3359	0.21296	0.7806:0.0:0.0778:0.1416	.	253	Q8NEN9	PDZD8_HUMAN	L	253	ENSP00000334642:F253L	ENSP00000334642:F253L	F	-	1	0	PDZD8	119123972	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.781000	0.68964	0.677000	0.31305	0.533000	0.62120	TTC	.	.	none		0.597	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
INTS12	57117	hgsc.bcm.edu	37	4	106621116	106621116	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:106621116G>A	ENST00000451321.2	-	2	526	c.47C>T	c.(46-48)gCa>gTa	p.A16V	INTS12_ENST00000394735.1_Missense_Mutation_p.A16V|INTS12_ENST00000340139.5_Missense_Mutation_p.A16V	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	16					snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		GAAACCTAGTGCTTTCAAAAA	0.398																																					p.A16V		Atlas-SNP	.											.	INTS12	35	.	0			c.C47T						PASS	.						123.0	133.0	130.0					4																	106621116		2203	4300	6503	SO:0001583	missense	57117	exon3			CCTAGTGCTTTCA		CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.47C>T	4.37:g.106621116G>A	ENSP00000415433:p.Ala16Val	112.0	0.0	0		113.0	27.0	0.238938	NM_020395	B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	ENST00000451321.2	37	CCDS3671.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464285	0.63513	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321;ENST00000503746;ENST00000420368;ENST00000416543;ENST00000433009;ENST00000510876;ENST00000515819	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.9	5.9	0.94986	.	0.098342	0.64402	D	0.000001	T	0.65688	0.2715	L	0.56769	1.78	0.54753	D	0.999987	D	0.76494	0.999	P	0.62491	0.903	T	0.65647	-0.6117	10	0.72032	D	0.01	-15.9342	20.2789	0.98501	0.0:0.0:1.0:0.0	.	16	Q96CB8	INT12_HUMAN	V	16;16;16;16;16;16;16;29;16	ENSP00000378221:A16V;ENSP00000340737:A16V;ENSP00000415433:A16V;ENSP00000423618:A16V;ENSP00000412317:A16V;ENSP00000396309:A16V;ENSP00000396729:A16V;ENSP00000422856:A29V;ENSP00000422048:A16V	ENSP00000340737:A16V	A	-	2	0	INTS12	106840565	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	4.588000	0.60999	2.788000	0.95919	0.650000	0.86243	GCA	.	.	none		0.398	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
PLCB1	23236	hgsc.bcm.edu	37	20	8130945	8130945	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr20:8130945C>A	ENST00000338037.6	+	2	131	c.104C>A	c.(103-105)tCa>tAa	p.S35*	PLCB1_ENST00000378641.3_Nonsense_Mutation_p.S35*|PLCB1_ENST00000378637.2_Nonsense_Mutation_p.S35*	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	35					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TTCTAGGACTCAACTATTGTT	0.328																																					p.V35D		Atlas-SNP	.											.	PLCB1	394	.	0			c.T104A						PASS	.						73.0	71.0	72.0					20																	8130945		2203	4291	6494	SO:0001587	stop_gained	23236	exon2			AGGACTCAACTAT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.104C>A	20.37:g.8130945C>A	ENSP00000338185:p.Ser35*	311.0	0.0	0		263.0	61.0	0.231939	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	42	9.746884	0.99253	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098	.	.	.	5.76	5.76	0.90799	.	0.148595	0.45126	D	0.000393	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5213	0.90954	0.0:1.0:0.0:0.0	.	.	.	.	X	35;35;35;34	.	ENSP00000338185:S35X	S	+	2	0	PLCB1	8078945	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.576000	0.67437	2.715000	0.92844	0.561000	0.74099	TCA	.	.	none		0.328	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
HS6ST3	266722	hgsc.bcm.edu	37	13	96743654	96743654	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr13:96743654G>A	ENST00000376705.2	+	1	562	c.538G>A	c.(538-540)Ggt>Agt	p.G180S		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	180					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CTGCAAAGCGGGTCAGAAGAA	0.637																																					p.G180S		Atlas-SNP	.											.	HS6ST3	54	.	0			c.G538A						PASS	.						32.0	30.0	31.0					13																	96743654		2203	4300	6503	SO:0001583	missense	266722	exon1			AAAGCGGGTCAGA	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.538G>A	13.37:g.96743654G>A	ENSP00000365895:p.Gly180Ser	22.0	0.0	0		35.0	15.0	0.428571	NM_153456	Q5W0L0|Q68CW6	Missense_Mutation	SNP	ENST00000376705.2	37	CCDS9481.1	.	.	.	.	.	.	.	.	.	.	g	19.57	3.852748	0.71719	.	.	ENSG00000185352	ENST00000376705	T	0.44083	0.93	5.29	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.65995	0.2745	M	0.85542	2.76	0.47183	D	0.999344	D	0.89917	1.0	D	0.97110	1.0	T	0.68834	-0.5304	10	0.59425	D	0.04	-15.837	12.193	0.54282	0.0:0.1303:0.7341:0.1357	.	180	Q8IZP7	H6ST3_HUMAN	S	180	ENSP00000365895:G180S	ENSP00000365895:G180S	G	+	1	0	HS6ST3	95541655	1.000000	0.71417	0.943000	0.38184	0.809000	0.45718	7.241000	0.78201	0.586000	0.29626	0.645000	0.84053	GGT	.	.	none		0.637	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
HAS2	3037	hgsc.bcm.edu	37	8	122641110	122641110	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr8:122641110G>A	ENST00000303924.4	-	2	1008	c.471C>T	c.(469-471)ccC>ccT	p.P157P		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	157					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CTGTCTCACCGGGACCCTTTT	0.433																																					p.P157P		Atlas-SNP	.											.	HAS2	87	.	0			c.C471T						PASS	.						324.0	290.0	302.0					8																	122641110		2203	4300	6503	SO:0001819	synonymous_variant	3037	exon2			CTCACCGGGACCC	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.471C>T	8.37:g.122641110G>A		213.0	0.0	0		172.0	42.0	0.244186	NM_005328	Q32MM3	Silent	SNP	ENST00000303924.4	37	CCDS6335.1																																																																																			.	.	none		0.433	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
PTMA	5757	hgsc.bcm.edu	37	2	232577559	232577559	+	Nonstop_Mutation	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:232577559T>C	ENST00000341369.7	+	5	525	c.334T>C	c.(334-336)Tag>Cag	p.*112Q	PTMA_ENST00000409683.1_Nonstop_Mutation_p.*108Q|PTMA_ENST00000410064.1_Nonstop_Mutation_p.*137Q|PTMA_ENST00000409115.3_Nonstop_Mutation_p.*111Q|PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409321.1_Nonstop_Mutation_p.*132Q	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	0					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.*111Q(1)		lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		CGAGGATGACTAGACAGCAAA	0.488																																					p.X112Q		Atlas-SNP	.											PTMA,NS,carcinoma,0,2	PTMA	12	2	1	Nonstop extension(1)	lung(1)	c.T334C						scavenged	.						31.0	33.0	32.0					2																	232577559		1827	4058	5885	SO:0001578	stop_lost	5757	exon5			GATGACTAGACAG		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.334T>C	2.37:g.232577559T>C	ENSP00000344547:p.*112Glnext*9	53.0	1.0	0.0188679		50.0	3.0	0.06	NM_001099285	Q15249|Q15592	Missense_Mutation	SNP	ENST00000341369.7	37	CCDS42833.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.401486	0.62288	.	.	ENSG00000187514	ENST00000409321;ENST00000409115;ENST00000341369;ENST00000409683;ENST00000410064;ENST00000358839	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5441	0.61693	0.0:0.0:0.0:1.0	.	.	.	.	Q	132;111;112;108;137;136	.	.	X	+	1	0	PTMA	232285803	0.998000	0.40836	1.000000	0.80357	0.978000	0.69477	5.170000	0.64990	1.855000	0.53841	0.448000	0.29417	TAG	.	.	none		0.488	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332553.1		
MAGEL2	54551	hgsc.bcm.edu	37	15	23889331	23889331	+	Nonsense_Mutation	SNP	G	G	A	rs368965952		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr15:23889331G>A	ENST00000532292.1	-	1	1844	c.1750C>T	c.(1750-1752)Cga>Tga	p.R584*		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	467					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		AGGAATGCTCGAGGGCCCCAG	0.507																																					p.R1187X		Atlas-SNP	.											.	MAGEL2	108	.	0			c.C3559T						PASS	.						52.0	53.0	53.0					15																	23889331		1908	4117	6025	SO:0001587	stop_gained	54551	exon1			ATGCTCGAGGGCC	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1750C>T	15.37:g.23889331G>A	ENSP00000433433:p.Arg584*	97.0	0.0	0		87.0	26.0	0.298851	NM_019066		Nonsense_Mutation	SNP	ENST00000532292.1	37																																																																																				.	.	alt		0.507	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
FKBP5	2289	hgsc.bcm.edu	37	6	35610531	35610531	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:35610531T>G	ENST00000539068.1	-	2	273	c.71A>C	c.(70-72)gAt>gCt	p.D24A	FKBP5_ENST00000540787.1_Intron|FKBP5_ENST00000542713.1_Missense_Mutation_p.D24A|FKBP5_ENST00000536438.1_Missense_Mutation_p.D24A|FKBP5_ENST00000357266.4_Missense_Mutation_p.D24A	NM_001145776.1	NP_001139248.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5	24					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						GGAGGTAATATCCTCTCCCTG	0.438																																					p.D24A		Atlas-SNP	.											.	FKBP5	64	.	0			c.A71C						PASS	.						196.0	191.0	192.0					6																	35610531		2203	4300	6503	SO:0001583	missense	2289	exon3			GTAATATCCTCTC	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000539068.1:c.71A>C	6.37:g.35610531T>G	ENSP00000441205:p.Asp24Ala	228.0	0.0	0		278.0	111.0	0.399281	NM_001145775	F5H7R1|Q59EB8|Q5TGM6	Missense_Mutation	SNP	ENST00000539068.1	37	CCDS4808.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.54|17.54|17.54	3.415111|3.415111|3.415111	0.62511|0.62511|0.62511	.|.|.	.|.|.	ENSG00000096060|ENSG00000096060|ENSG00000096060	ENST00000543400|ENST00000536438;ENST00000357266;ENST00000539068;ENST00000337746;ENST00000542713|ENST00000373875	.|D;D;D;T|.	.|0.83250|.	.|-1.7;-1.7;-1.7;-1.44|.	5.95|5.95|5.95	5.95|5.95|5.95	0.96441|0.96441|0.96441	.|.|.	.|0.108693|.	.|0.64402|.	.|D|.	.|0.000006|.	.|T|T	.|0.61974|0.61974	.|0.2390|0.2390	M|M|M	0.63843|0.63843|0.63843	1.955|1.955|1.955	0.54753|0.54753|0.54753	D|D|D	0.999985|0.999985|0.999985	.|B;B|.	.|0.26512|.	.|0.001;0.151|.	.|B;B|.	.|0.20184|.	.|0.002;0.028|.	.|T|T	.|0.62163|0.62163	.|-0.6912|-0.6912	.|10|6	.|0.54805|0.34782	.|T|T	.|0.06|0.22	.|-2.376|-2.376	13.9469|13.9469|13.9469	0.64091|0.64091|0.64091	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|24;24|.	.|F5H7R1;Q13451|.	.|.;FKBP5_HUMAN|.	.|A|L	-1|24|23	.|ENSP00000444810:D24A;ENSP00000349811:D24A;ENSP00000441205:D24A;ENSP00000442340:D24A|.	.|ENSP00000338160:D24A|ENSP00000362982:I23L	.|D|I	-|-|-	.|2|1	.|0|0	FKBP5|FKBP5|FKBP5	35718509|35718509|35718509	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.903000|0.903000|0.903000	0.53119|0.53119|0.53119	6.180000|6.180000|6.180000	0.71981|0.71981|0.71981	2.279000|2.279000|2.279000	0.76181|0.76181|0.76181	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	.|GAT|ATA	.	.	none		0.438	FKBP5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040309.2		
NR3C2	4306	hgsc.bcm.edu	37	4	149002555	149002555	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:149002555G>A	ENST00000358102.3	-	9	3257	c.2895C>T	c.(2893-2895)agC>agT	p.S965S	NR3C2_ENST00000355292.3_Silent_p.S969S|NR3C2_ENST00000511528.1_Silent_p.S969S|NR3C2_ENST00000344721.4_Silent_p.S965S|NR3C2_ENST00000512865.1_Silent_p.S848S	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	965	Steroid-binding.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S965S(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GCAGCTGGTCGCTGATGATCT	0.577																																					p.S965S	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											NR3C2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	NR3C2	94	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C2895T						PASS	.						65.0	60.0	62.0					4																	149002555		2203	4300	6503	SO:0001819	synonymous_variant	4306	exon9			CTGGTCGCTGATG	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2895C>T	4.37:g.149002555G>A		110.0	0.0	0		103.0	36.0	0.349515	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	CCDS3772.1																																																																																			.	.	none		0.577	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
SRGAP1	57522	hgsc.bcm.edu	37	12	64485076	64485076	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr12:64485076A>C	ENST00000355086.3	+	12	1981	c.1457A>C	c.(1456-1458)aAg>aCg	p.K486T	RP11-196H14.2_ENST00000535594.1_RNA|SRGAP1_ENST00000543397.1_Intron|SRGAP1_ENST00000357825.3_Intron	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	486	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTTCCCCCTAAGCCCCAGAAA	0.428																																					p.K486T		Atlas-SNP	.											.	SRGAP1	146	.	0			c.A1457C						PASS	.						85.0	87.0	86.0					12																	64485076		2203	4300	6503	SO:0001583	missense	57522	exon12			CCCCTAAGCCCCA	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1457A>C	12.37:g.64485076A>C	ENSP00000347198:p.Lys486Thr	73.0	0.0	0		61.0	11.0	0.180328	NM_020762	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294486	0.60086	.	.	ENSG00000196935	ENST00000355086	T	0.08720	3.06	5.75	5.75	0.90469	.	0.000000	0.36591	U	0.002508	T	0.08714	0.0216	L	0.49126	1.545	0.80722	D	1	P	0.37781	0.608	B	0.27608	0.081	T	0.21177	-1.0253	9	.	.	.	.	15.5468	0.76108	1.0:0.0:0.0:0.0	.	486	Q7Z6B7	SRGP1_HUMAN	T	486	ENSP00000347198:K486T	.	K	+	2	0	SRGAP1	62771343	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.299000	0.59073	2.326000	0.78906	0.533000	0.62120	AAG	.	.	none		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
TTLL6	284076	hgsc.bcm.edu	37	17	46847276	46847276	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:46847276T>C	ENST00000393382.3	-	14	2365	c.2224A>G	c.(2224-2226)Aaa>Gaa	p.K742E	TTLL6_ENST00000433608.2_Missense_Mutation_p.K435E	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						AGAAAAGATTTTAACATTTTC	0.468																																					p.K742E		Atlas-SNP	.											.	TTLL6	113	.	0			c.A2224G						PASS	.						85.0	85.0	85.0					17																	46847276		2203	4300	6503	SO:0001583	missense	284076	exon14			AAGATTTTAACAT	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.2224A>G	17.37:g.46847276T>C	ENSP00000377043:p.Lys742Glu	440.0	0.0	0		420.0	120.0	0.285714	NM_001130918		Missense_Mutation	SNP	ENST00000393382.3	37	CCDS45724.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872466	0.33069	.	.	ENSG00000170703	ENST00000440941;ENST00000305326;ENST00000433608;ENST00000393382	T	0.19394	2.15	3.94	1.63	0.23807	.	7739.210000	0.00166	U	0.000000	T	0.25419	0.0618	L	0.59436	1.845	0.09310	N	1	P;P	0.43094	0.799;0.728	B;B	0.39339	0.162;0.297	T	0.27905	-1.0060	10	0.46703	T	0.11	.	8.1135	0.30928	0.0:0.0:0.4101:0.5899	.	694;435	Q8N841;G5E937	TTLL6_HUMAN;.	E	742;435;420;694	ENSP00000399211:K420E	ENSP00000302547:K435E	K	-	1	0	TTLL6	44202275	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.571000	0.23669	0.308000	0.22923	0.533000	0.62120	AAA	.	.	none		0.468	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346939.3	NM_173623	
AKR1B15	441282	hgsc.bcm.edu	37	7	134260279	134260279	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr7:134260279A>T	ENST00000457545.2	+	7	881	c.621A>T	c.(619-621)aaA>aaT	p.K207N	AKR1B15_ENST00000423958.1_Missense_Mutation_p.K179N	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	207							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						TGAAATATAAACCAGTGACTA	0.468																																					p.K207N		Atlas-SNP	.											.	AKR1B15	105	.	0			c.A621T						PASS	.						69.0	75.0	73.0					7																	134260279		2202	4300	6502	SO:0001583	missense	441282	exon7			ATATAAACCAGTG		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.621A>T	7.37:g.134260279A>T	ENSP00000389289:p.Lys207Asn	103.0	0.0	0		92.0	40.0	0.434783	NM_001080538	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	A	15.77	2.930250	0.52866	.	.	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.28069	1.63;1.63	3.82	-4.68	0.03309	NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.46658	0.1404	H	0.94847	3.59	0.49130	D	0.999758	P;P	0.51653	0.609;0.947	B;P	0.44860	0.286;0.462	T	0.71646	-0.4530	9	0.87932	D	0	.	15.1895	0.73032	0.1808:0.0:0.8192:0.0	.	179;207	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	N	207;179	ENSP00000389289:K207N;ENSP00000397009:K179N	ENSP00000397009:K179N	K	+	3	2	AKR1B15	133910819	0.067000	0.21026	0.376000	0.26042	0.690000	0.40134	-0.684000	0.05173	-0.911000	0.03843	-0.451000	0.05528	AAA	.	.	none		0.468	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
ZNF425	155054	hgsc.bcm.edu	37	7	148801430	148801430	+	Silent	SNP	C	C	T	rs575584712		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr7:148801430C>T	ENST00000378061.2	-	4	1665	c.1533G>A	c.(1531-1533)tcG>tcA	p.S511S		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	511					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GCGTGAGCCGCGACTGCTGAG	0.627													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18036	0.0		0.0	False		,,,				2504	0.0				p.S511S		Atlas-SNP	.											ZNF425,NS,carcinoma,0,1	ZNF425	99	1	0			c.G1533A						PASS	.						48.0	39.0	42.0					7																	148801430		2203	4300	6503	SO:0001819	synonymous_variant	155054	exon4			GAGCCGCGACTGC	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1533G>A	7.37:g.148801430C>T		84.0	0.0	0		74.0	27.0	0.364865	NM_001001661	B3KPM1|Q08AG3	Silent	SNP	ENST00000378061.2	37	CCDS34773.1																																																																																			.	.	none		0.627	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140	
MTNR1B	4544	hgsc.bcm.edu	37	11	92703057	92703057	+	Missense_Mutation	SNP	G	G	A	rs148309052		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:92703057G>A	ENST00000257068.2	+	1	172	c.166G>A	c.(166-168)Gtg>Atg	p.V56M		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	56					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	CGTGGACGTCGTGGGCAACCT	0.692																																					p.V56M		Atlas-SNP	.											.	MTNR1B	75	.	0			c.G166A						PASS	.	G	MET/VAL	0,4396		0,0,2198	35.0	28.0	30.0		166	-1.4	0.0	11	dbSNP_134	30	2,8588		0,2,4293	no	missense	MTNR1B	NM_005959.3	21	0,2,6491	AA,AG,GG		0.0233,0.0,0.0154	benign	56/363	92703057	2,12984	2198	4295	6493	SO:0001583	missense	4544	exon1			GACGTCGTGGGCA	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.166G>A	11.37:g.92703057G>A	ENSP00000257068:p.Val56Met	57.0	0.0	0		52.0	11.0	0.211538	NM_005959		Missense_Mutation	SNP	ENST00000257068.2	37	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	G	4.668	0.124122	0.08931	0.0	2.33E-4	ENSG00000134640	ENST00000257068	T	0.40225	1.04	4.57	-1.37	0.09056	.	0.534882	0.16009	N	0.233911	T	0.19967	0.0480	L	0.29908	0.895	0.19775	N	0.999956	P	0.35982	0.531	B	0.26310	0.068	T	0.09185	-1.0686	10	0.34782	T	0.22	-0.2663	3.6257	0.08112	0.1518:0.353:0.3793:0.1159	.	56	P49286	MTR1B_HUMAN	M	56	ENSP00000257068:V56M	ENSP00000257068:V56M	V	+	1	0	MTNR1B	92342705	0.012000	0.17670	0.023000	0.16930	0.042000	0.13812	0.085000	0.14912	-0.236000	0.09753	-0.142000	0.14014	GTG	G|1.000;A|0.000	0.000	weak		0.692	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230278	23230278	+	Silent	SNP	G	G	A	rs544778929	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:23230278G>A	ENST00000526893.1	+	1	319	c.45G>A	c.(43-45)gaG>gaA	p.E15E	IGLL5_ENST00000531372.1_Silent_p.E15E|IGLL5_ENST00000532223.2_Silent_p.E15E|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	15						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCCCTGAGGAGCTGGGCCCTG	0.672													G|||	6	0.00119808	0.0023	0.0029	5008	,	,		13267	0.0		0.0	False		,,,				2504	0.001				p.E15E		Atlas-SNP	.											IGLL5,NS,lymphoid_neoplasm,0,1	IGLL5	26	1	0			c.G45A						scavenged	.																																			SO:0001819	synonymous_variant	100423062	exon1			TGAGGAGCTGGGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.45G>A	22.37:g.23230278G>A		171.0	1.0	0.00584795		103.0	35.0	0.339806	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
CPAMD8	27151	hgsc.bcm.edu	37	19	17081795	17081795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:17081795G>A	ENST00000443236.1	-	18	2291	c.2260C>T	c.(2260-2262)Cag>Tag	p.Q754*	CPAMD8_ENST00000388925.4_Missense_Mutation_p.A496V	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	707						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCACCGTCCTGCCGGTGGTTC	0.627																																					p.Q754X		Atlas-SNP	.											CPAMD8,right_upper_lobe,carcinoma,+1,1	CPAMD8	192	1	0			c.C2260T						PASS	.						56.0	61.0	59.0					19																	17081795		2069	4191	6260	SO:0001587	stop_gained	27151	exon18			CGTCCTGCCGGTG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2260C>T	19.37:g.17081795G>A	ENSP00000402505:p.Gln754*	43.0	0.0	0		43.0	11.0	0.255814	NM_015692	Q8NC09|Q9ULD7	Nonsense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.759309|7.759309	0.98474|0.98474	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000388925|ENST00000291440	T|.	0.54071|.	0.59|.	3.18|3.18	3.18|3.18	0.36537|0.36537	.|.	.|0.227351	.|0.29178	.|U	.|0.012906	T|.	0.37571|.	0.1008|.	.|.	.|.	.|.	0.36263|0.36263	D|D	0.854687|0.854687	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31392|.	-0.9945|.	6|.	0.39692|0.06365	T|T	0.17|0.9	.|.	14.3292|14.3292	0.66541|0.66541	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	V|X	496|754	ENSP00000373577:A496V|.	ENSP00000373577:A496V|ENSP00000291440:Q754X	A|Q	-|-	2|1	0|0	CPAMD8|CPAMD8	16942795|16942795	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.933000|0.933000	0.57130|0.57130	6.082000|6.082000	0.71318|0.71318	1.331000|1.331000	0.45412|0.45412	0.650000|0.650000	0.86243|0.86243	GCA|CAG	.	.	none		0.627	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
ANKHD1	54882	hgsc.bcm.edu	37	5	139818110	139818110	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr5:139818110G>A	ENST00000360839.2	+	3	679	c.525G>A	c.(523-525)ctG>ctA	p.L175L	ANKHD1_ENST00000394722.3_Silent_p.L164L|ANKHD1_ENST00000297183.6_Silent_p.L175L|ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.L175L|ANKHD1_ENST00000394723.3_Silent_p.L175L	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	175			L -> M (in dbSNP:rs17850570). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGAGACTGACATCCTCAG	0.473																																					p.L175L		Atlas-SNP	.											.	ANKHD1	233	.	0			c.G525A						PASS	.						212.0	189.0	197.0					5																	139818110		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon3			GAGACTGACATCC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.525G>A	5.37:g.139818110G>A		127.0	0.0	0		109.0	19.0	0.174312	NM_024668	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1																																																																																			.	.	none		0.473	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
CCDC47	57003	hgsc.bcm.edu	37	17	61833644	61833644	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:61833644G>C	ENST00000225726.5	-	8	1286	c.904C>G	c.(904-906)Ctg>Gtg	p.L302V	CCDC47_ENST00000403162.3_Missense_Mutation_p.L302V|CCDC47_ENST00000582252.1_Missense_Mutation_p.L302V	NM_020198.2	NP_064583.2	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47	302					calcium ion homeostasis (GO:0055074)|ER overload response (GO:0006983)|osteoblast differentiation (GO:0001649)|post-embryonic development (GO:0009791)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	18						ATCTCTGACAGGATGGCCAAA	0.438																																					p.L302V		Atlas-SNP	.											.	CCDC47	34	.	0			c.C904G						PASS	.						118.0	110.0	113.0					17																	61833644		2203	4300	6503	SO:0001583	missense	57003	exon8			CTGACAGGATGGC	AF226054	CCDS11643.1	17q23.3	2005-12-19				ENSG00000108588			24856	protein-coding gene	gene with protein product						12477932	Standard	NM_020198		Approved	GK001	uc002jbs.4	Q96A33		ENST00000225726.5:c.904C>G	17.37:g.61833644G>C	ENSP00000225726:p.Leu302Val	159.0	0.0	0		171.0	40.0	0.233918	NM_020198	B2RAS8|D3DU20|Q96D00|Q96JZ7|Q9H3E4|Q9NRG3	Missense_Mutation	SNP	ENST00000225726.5	37	CCDS11643.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369969	0.24771	.	.	ENSG00000108588	ENST00000225726;ENST00000403162	.	.	.	5.54	3.45	0.39498	.	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	L	0.49350	1.555	0.58432	D	0.999999	D;P	0.67145	0.996;0.788	D;P	0.75484	0.986;0.448	T	0.64901	-0.6298	9	0.44086	T	0.13	-11.4654	9.1184	0.36773	0.2579:0.0:0.7421:0.0	.	302;302	Q96A33-2;Q96A33	.;CCD47_HUMAN	V	302	.	ENSP00000225726:L302V	L	-	1	2	CCDC47	59187376	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.121000	0.50438	1.392000	0.46585	0.655000	0.94253	CTG	.	.	none		0.438	CCDC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444016.2	NM_020198	
MAEA	10296	hgsc.bcm.edu	37	4	1326571	1326571	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:1326571C>T	ENST00000303400.4	+	6	746	c.683C>T	c.(682-684)gCa>gTa	p.A228V	MAEA_ENST00000505177.2_Missense_Mutation_p.A266V|MAEA_ENST00000264750.6_Missense_Mutation_p.A187V|MAEA_ENST00000505839.1_Missense_Mutation_p.A180V|MAEA_ENST00000510794.1_Missense_Mutation_p.A227V|MAEA_ENST00000512289.1_3'UTR|MAEA_ENST00000514708.1_Silent_p.S161S|MAEA_ENST00000452175.2_Missense_Mutation_p.A149V	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	228					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	TTCAGCCAAGCAGAAGGGAGC	0.517																																					p.A228V		Atlas-SNP	.											.	MAEA	39	.	0			c.C683T						PASS	.						50.0	44.0	46.0					4																	1326571		2203	4300	6503	SO:0001583	missense	10296	exon6			GCCAAGCAGAAGG	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.683C>T	4.37:g.1326571C>T	ENSP00000302830:p.Ala228Val	136.0	0.0	0		122.0	40.0	0.327869	NM_001017405	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196643	0.58126	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000264750;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000510794;ENST00000505839	T;T;T;T;T;T	0.43688	0.95;0.94;0.98;0.96;0.98;0.94	5.35	5.35	0.76521	Ran binding protein-like, CRA domain (1);	0.000000	0.85682	D	0.000000	T	0.37183	0.0994	L	0.27053	0.805	0.80722	D	1	B;B;B;B	0.29766	0.071;0.256;0.2;0.073	B;B;B;B	0.33960	0.05;0.173;0.047;0.065	T	0.17592	-1.0364	10	0.44086	T	0.13	-15.0804	19.04	0.92995	0.0:1.0:0.0:0.0	.	227;266;187;228	B4DVN3;E7ESC7;Q7L5Y9-3;Q7L5Y9	.;.;.;MAEA_HUMAN	V	228;266;187;207;160;149;227;180	ENSP00000302830:A228V;ENSP00000422215:A266V;ENSP00000264750:A187V;ENSP00000426903:A160V;ENSP00000411415:A149V;ENSP00000426807:A227V	ENSP00000264750:A187V	A	+	2	0	MAEA	1316571	1.000000	0.71417	0.963000	0.40424	0.989000	0.77384	7.433000	0.80362	2.487000	0.83934	0.655000	0.94253	GCA	.	.	none		0.517	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
SHANK2	22941	hgsc.bcm.edu	37	11	70332437	70332437	+	Missense_Mutation	SNP	C	C	T	rs555445178		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:70332437C>T	ENST00000423696.2	-	15	2860	c.2824G>A	c.(2824-2826)Gcc>Acc	p.A942T	SHANK2_ENST00000409161.1_Missense_Mutation_p.A725T|SHANK2_ENST00000449833.2_Missense_Mutation_p.A726T|SHANK2_ENST00000338508.4_Missense_Mutation_p.A1322T			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	942					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AGCTTAGTGGCGTCCACGGTG	0.592																																					p.A733T		Atlas-SNP	.											.	SHANK2	340	.	0			c.G2197A						PASS	.						119.0	105.0	110.0					11																	70332437		2200	4294	6494	SO:0001583	missense	22941	exon10			TAGTGGCGTCCAC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2824G>A	11.37:g.70332437C>T	ENSP00000394536:p.Ala942Thr	114.0	0.0	0		86.0	26.0	0.302326	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	C	1.958	-0.439660	0.04636	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26	4.98	0.842	0.18927	.	0.465316	0.25863	N	0.027802	T	0.07818	0.0196	N	0.13043	0.29	0.09310	N	0.999999	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.08055	0.003;0.003;0.002	T	0.41413	-0.9510	10	0.10902	T	0.67	.	8.9408	0.35729	0.0:0.455:0.0:0.545	.	942;1321;726	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	T	726;725;600;1322;942;960;945	ENSP00000399423:A726T;ENSP00000386491:A725T;ENSP00000402944:A600T;ENSP00000345193:A1322T;ENSP00000394536:A942T;ENSP00000294018:A945T	ENSP00000294018:A945T	A	-	1	0	SHANK2	70010085	0.010000	0.17322	0.079000	0.20413	0.912000	0.54170	0.683000	0.25349	-0.107000	0.12088	0.561000	0.74099	GCC	.	.	none		0.592	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
PPP2R2B	5521	hgsc.bcm.edu	37	5	145979852	145979852	+	Splice_Site	SNP	A	A	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr5:145979852A>C	ENST00000394413.3	-	7	1531		c.e7+1		PPP2R2B_ENST00000508545.2_Splice_Site|PPP2R2B_ENST00000453001.1_Splice_Site|PPP2R2B_ENST00000336640.6_Splice_Site|PPP2R2B_ENST00000394409.3_Splice_Site|PPP2R2B_ENST00000394410.2_Splice_Site|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000394414.1_Splice_Site|PPP2R2B_ENST00000504198.1_Splice_Site|PPP2R2B_ENST00000356826.3_Splice_Site|PPP2R2B_ENST00000530902.1_Splice_Site|PPP2R2B_ENST00000394411.4_Splice_Site			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGGTTCTATACCTGGTAAGT	0.483																																					.		Atlas-SNP	.											.	PPP2R2B	271	.	0			c.927+2T>G						PASS	.						153.0	150.0	151.0					5																	145979852		2203	4300	6503	SO:0001630	splice_region_variant	5521	exon9			TTCTATACCTGGT	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.960+1T>G	5.37:g.145979852A>C		210.0	0.0	0		131.0	36.0	0.274809	NM_001271948	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Splice_Site	SNP	ENST00000394413.3	37	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825202	0.71143	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409;ENST00000512984	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8924	0.79309	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AC011357.1	145960045	1.000000	0.71417	0.994000	0.49952	0.838000	0.47535	9.287000	0.95975	2.219000	0.72066	0.533000	0.62120	.	.	.	none		0.483	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678	Intron
NLRP9	338321	hgsc.bcm.edu	37	19	56244737	56244737	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:56244737C>T	ENST00000332836.2	-	2	487	c.460G>A	c.(460-462)Gat>Aat	p.D154N		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	154	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CCAATTCCATCAGGACCTTCC	0.408																																					p.D154N		Atlas-SNP	.											.	NLRP9	163	.	0			c.G460A						PASS	.						84.0	80.0	81.0					19																	56244737		2203	4300	6503	SO:0001583	missense	338321	exon2			TTCCATCAGGACC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.460G>A	19.37:g.56244737C>T	ENSP00000331857:p.Asp154Asn	163.0	0.0	0		138.0	41.0	0.297101	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	6.868	0.529542	0.13127	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.61392	0.11	2.63	-5.25	0.02781	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.43853	0.1266	N	0.22421	0.69	0.09310	N	1	B	0.29432	0.244	B	0.41135	0.348	T	0.51585	-0.8687	9	0.33141	T	0.24	.	7.3965	0.26939	0.0:0.2139:0.574:0.2121	.	154	Q7RTR0	NALP9_HUMAN	N	154	ENSP00000331857:D154N	ENSP00000331857:D154N	D	-	1	0	NLRP9	60936549	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.209000	0.09358	-1.401000	0.02058	-0.178000	0.13098	GAT	.	.	none		0.408	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
UNC80	285175	hgsc.bcm.edu	37	2	210694100	210694100	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:210694100G>A	ENST00000439458.1	+	15	2703	c.2623G>A	c.(2623-2625)Gac>Aac	p.D875N	UNC80_ENST00000272845.6_Missense_Mutation_p.D870N	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	875					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCCGGTCACTGACAGTAAGTA	0.438																																					p.D875N		Atlas-SNP	.											.	UNC80	280	.	0			c.G2623A						PASS	.						161.0	130.0	139.0					2																	210694100		692	1591	2283	SO:0001583	missense	285175	exon15			GTCACTGACAGTA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2623G>A	2.37:g.210694100G>A	ENSP00000391088:p.Asp875Asn	166.0	0.0	0		131.0	40.0	0.305344	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	32	5.165172	0.94768	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.30182	1.54;1.54	5.95	5.95	0.96441	.	0.120088	0.53938	D	0.000043	T	0.49864	0.1582	L	0.43152	1.355	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.13818	-1.0495	10	0.29301	T	0.29	-25.3721	20.3931	0.98965	0.0:0.0:1.0:0.0	.	875	Q8N2C7	UNC80_HUMAN	N	875;870	ENSP00000391088:D875N;ENSP00000272845:D870N	ENSP00000272845:D870N	D	+	1	0	UNC80	210402345	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	GAC	.	.	none		0.438	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
POSTN	10631	hgsc.bcm.edu	37	13	38158888	38158888	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr13:38158888A>G	ENST00000379747.4	-	8	1190	c.1073T>C	c.(1072-1074)aTc>aCc	p.I358T	POSTN_ENST00000541481.1_Missense_Mutation_p.I358T|POSTN_ENST00000379743.4_Missense_Mutation_p.I358T|POSTN_ENST00000379742.4_Missense_Mutation_p.I358T|POSTN_ENST00000379749.4_Missense_Mutation_p.I358T|POSTN_ENST00000541179.1_Missense_Mutation_p.I358T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	358	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AATCAAATGGATCACACCATT	0.313																																					p.I358T		Atlas-SNP	.											POSTN,colon,carcinoma,0,1	POSTN	161	1	0			c.T1073C						scavenged	.						235.0	199.0	212.0					13																	38158888		2203	4300	6503	SO:0001583	missense	10631	exon8			AAATGGATCACAC	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1073T>C	13.37:g.38158888A>G	ENSP00000369071:p.Ile358Thr	234.0	2.0	0.00854701		217.0	59.0	0.271889	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193128	0.78902	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5;-3.5;-3.5	5.41	5.41	0.78517	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.98074	0.9365	H	0.95712	3.71	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	0.998;0.995;1.0;0.997;0.987;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.997;0.995;0.999;0.995;0.976;0.979;0.999	D	0.99395	1.0926	10	0.87932	D	0	.	15.1264	0.72486	1.0:0.0:0.0:0.0	.	358;358;358;358;358;358;358	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	T	358	ENSP00000437959:I358T;ENSP00000369073:I358T;ENSP00000369071:I358T;ENSP00000369067:I358T;ENSP00000369066:I358T;ENSP00000437953:I358T	ENSP00000369066:I358T	I	-	2	0	POSTN	37056888	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.926000	0.92839	2.043000	0.60533	0.533000	0.62120	ATC	.	.	none		0.313	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
SDPR	8436	hgsc.bcm.edu	37	2	192700851	192700851	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:192700851G>A	ENST00000304141.4	-	2	1405	c.1076C>T	c.(1075-1077)gCg>gTg	p.A359V		NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			CCTGGAGGTCGCCTTCTCAGC	0.567																																					p.A359V		Atlas-SNP	.											SDPR,right_upper_lobe,carcinoma,+1,1	SDPR	67	1	0			c.C1076T						scavenged	.						124.0	118.0	120.0					2																	192700851		2203	4300	6503	SO:0001583	missense	8436	exon2			GAGGTCGCCTTCT	AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.1076C>T	2.37:g.192700851G>A	ENSP00000305675:p.Ala359Val	136.0	1.0	0.00735294		154.0	43.0	0.279221	NM_004657		Missense_Mutation	SNP	ENST00000304141.4	37	CCDS2313.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.271428	0.23221	.	.	ENSG00000168497	ENST00000304141	T	0.64438	-0.1	4.99	-8.5	0.00927	.	2.243020	0.01630	N	0.023474	T	0.46092	0.1375	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.21518	-1.0243	10	0.39692	T	0.17	-0.367	2.1987	0.03917	0.3415:0.0673:0.271:0.3202	.	359	O95810	SDPR_HUMAN	V	359	ENSP00000305675:A359V	ENSP00000305675:A359V	A	-	2	0	SDPR	192409096	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.817000	0.04472	-2.474000	0.00527	-1.119000	0.02030	GCG	.	.	none		0.567	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334791.2	NM_004657	
CRYBG3	131544	hgsc.bcm.edu	37	3	97607289	97607289	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr3:97607289C>T	ENST00000182096.4	+	6	1614	c.1550C>T	c.(1549-1551)cCg>cTg	p.P517L		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2465							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TCATTACATCCGCTTCAAATG	0.373																																					p.P2465L		Atlas-SNP	.											CRYBG3,NS,carcinoma,-1,1	CRYBG3	86	1	0			c.C7394T						scavenged	.						49.0	45.0	46.0					3																	97607289		1824	4083	5907	SO:0001583	missense	131544	exon9			TACATCCGCTTCA			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1550C>T	3.37:g.97607289C>T	ENSP00000182096:p.Pro517Leu	261.0	2.0	0.00766284		276.0	50.0	0.181159	NM_153605	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37		.	.	.	.	.	.	.	.	.	.	C	22.3	4.276340	0.80580	.	.	ENSG00000080200	ENST00000182096	D	0.81579	-1.51	5.54	5.54	0.83059	Beta/gamma crystallin (2);Gamma-crystallin-related (1);	0.536580	0.18498	N	0.139438	T	0.78641	0.4315	L	0.54323	1.7	0.80722	D	1	P	0.43431	0.807	B	0.39185	0.293	T	0.81762	-0.0784	10	0.72032	D	0.01	.	17.2707	0.87101	0.0:1.0:0.0:0.0	.	517	Q68DQ2	CRBG3_HUMAN	L	517	ENSP00000182096:P517L	ENSP00000182096:P517L	P	+	2	0	CRYBG3	99089979	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.933000	0.63484	2.611000	0.88343	0.655000	0.94253	CCG	.	.	none		0.373	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
ITGB4	3691	hgsc.bcm.edu	37	17	73727034	73727034	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr17:73727034G>A	ENST00000200181.3	+	9	1268	c.1081G>A	c.(1081-1083)Gag>Aag	p.E361K	ITGB4_ENST00000579662.1_Missense_Mutation_p.E361K|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000339591.3_Missense_Mutation_p.E361K|ITGB4_ENST00000450894.3_Missense_Mutation_p.E361K|ITGB4_ENST00000449880.2_Missense_Mutation_p.E361K	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	361					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCTGCTGGAGGAGGCCTTCAA	0.612																																					p.E361K		Atlas-SNP	.											.	ITGB4	165	.	0			c.G1081A						PASS	.						84.0	84.0	84.0					17																	73727034		2203	4300	6503	SO:0001583	missense	3691	exon9			CTGGAGGAGGCCT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1081G>A	17.37:g.73727034G>A	ENSP00000200181:p.Glu361Lys	36.0	0.0	0		37.0	8.0	0.216216	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148655	0.37923	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.97752	-4.52;-4.52;-4.52	5.42	5.42	0.78866	Integrin beta subunit, N-terminal (2);	0.679936	0.14303	N	0.328121	D	0.94525	0.8237	L	0.28556	0.865	0.09310	N	1	B;B;B;B	0.33448	0.081;0.2;0.238;0.412	B;B;B;B	0.34242	0.061;0.047;0.114;0.178	D	0.88349	0.2980	10	0.24483	T	0.36	.	12.1854	0.54236	0.1235:0.0:0.8765:0.0	.	361;361;361;361	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	K	277;361;361;361	ENSP00000200181:E361K;ENSP00000344079:E361K;ENSP00000400217:E361K	ENSP00000200181:E361K	E	+	1	0	ITGB4	71238629	0.214000	0.23563	1.000000	0.80357	0.949000	0.60115	1.951000	0.40333	2.545000	0.85829	0.557000	0.71058	GAG	.	.	none		0.612	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
PLK5	126520	hgsc.bcm.edu	37	19	1535205	1535205	+	Missense_Mutation	SNP	G	G	C	rs265282	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:1535205G>C	ENST00000334770.4	+	13	1856	c.967G>C	c.(967-969)Gga>Cga	p.G323R	PLK5_ENST00000454744.2_Missense_Mutation_p.G323R			Q496M5	PLK5_HUMAN	polo-like kinase 5	323	POLO box.			G -> R (in Ref. 2; ABD83663). {ECO:0000305}.	cellular response to growth factor stimulus (GO:0071363)|defense response to tumor cell (GO:0002357)|G2 DNA damage checkpoint (GO:0031572)|mitotic nuclear division (GO:0007067)|positive regulation of neuron projection development (GO:0010976)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)										CCCCACCACCGGACAGCACCT	0.677													C|||	2543	0.507788	0.6808	0.3991	5008	,	,		15787	0.629		0.2207	False		,,,				2504	0.5215				p.G323R		Atlas-SNP	.											.	PLK5	1	.	0			c.G967C						PASS	.																																			SO:0001583	missense	126520	exon14			ACCACCGGACAGC	DQ424898	CCDS59328.1	19p13.3	2012-11-19	2011-07-14	2011-07-14	ENSG00000185988	ENSG00000185988			27001	protein-coding gene	gene with protein product			"""polo-like kinase 5 pseudogene"", ""polo-like kinase 5, pseudogene"""	PLK5P		21245385	Standard	NM_001243079		Approved	SgK384ps	uc002ltf.3	Q496M5	OTTHUMG00000180073	ENST00000334770.4:c.967G>C	19.37:g.1535205G>C	ENSP00000466248:p.Gly323Arg	0.0	0.0	.		6.0	6.0	1	NM_001243079	B3KNR4|Q1ZYM0	Missense_Mutation	SNP	ENST00000334770.4	37	CCDS59328.1																																																																																			G|0.681;C|0.319	0.319	strong		0.677	PLK5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449628.1	NR_026557	
PPP2R2C	5522	hgsc.bcm.edu	37	4	6325285	6325285	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:6325285C>T	ENST00000382599.4	-	9	1304	c.1088G>A	c.(1087-1089)cGc>cAc	p.R363H	PPP2R2C_ENST00000507294.1_Missense_Mutation_p.R356H|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.R356H|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.R363H|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.R346H			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	363					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						ATCGAACATGCGGAAGAAGTT	0.617																																					p.R363H		Atlas-SNP	.											.	PPP2R2C	63	.	0			c.G1088A						PASS	.						55.0	48.0	51.0					4																	6325285		2202	4300	6502	SO:0001583	missense	5522	exon9			AACATGCGGAAGA	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1088G>A	4.37:g.6325285C>T	ENSP00000372042:p.Arg363His	93.0	0.0	0		65.0	17.0	0.261538	NM_181876	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	C	17.53	3.413163	0.62511	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	4.45	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	L	0.39147	1.195	0.80722	D	1	B;P;B;B	0.35793	0.037;0.521;0.037;0.347	B;B;B;B	0.26864	0.074;0.074;0.074;0.074	T	0.05517	-1.0880	10	0.24483	T	0.36	-43.8669	16.2691	0.82606	0.0:1.0:0.0:0.0	.	356;363;346;363	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	H	363;356;346;363;356	ENSP00000335083:R363H;ENSP00000423649:R356H;ENSP00000422374:R346H;ENSP00000372042:R363H;ENSP00000425247:R356H	ENSP00000335083:R363H	R	-	2	0	PPP2R2C	6376186	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.711000	0.74675	2.304000	0.77564	0.555000	0.69702	CGC	.	.	none		0.617	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
NFYA	4800	hgsc.bcm.edu	37	6	41060751	41060751	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:41060751A>G	ENST00000341376.6	+	8	1016	c.815A>G	c.(814-816)tAc>tGc	p.Y272C	NFYA_ENST00000353205.5_Missense_Mutation_p.Y243C|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	272					cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCAAACAATACCACCGTATT	0.478																																					p.Y272C		Atlas-SNP	.											.	NFYA	33	.	0			c.A815G						PASS	.						108.0	102.0	104.0					6																	41060751		2203	4300	6503	SO:0001583	missense	4800	exon8			AACAATACCACCG		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.815A>G	6.37:g.41060751A>G	ENSP00000345702:p.Tyr272Cys	76.0	0.0	0		127.0	53.0	0.417323	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.674529	0.88445	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.88	5.88	0.94601	CCAAT-binding factor, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.83036	0.5167	M	0.91038	3.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.87194	0.2236	9	0.87932	D	0	0.0035	15.4635	0.75381	1.0:0.0:0.0:0.0	.	243;272	P23511-2;P23511	.;NFYA_HUMAN	C	272;243	.	ENSP00000345702:Y272C	Y	+	2	0	NFYA	41168729	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.237000	0.95368	2.250000	0.74265	0.533000	0.62120	TAC	.	.	none		0.478	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
OR7G1	125962	hgsc.bcm.edu	37	19	9226244	9226244	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:9226244G>C	ENST00000541538.1	-	1	195	c.196C>G	c.(196-198)Ctc>Gtc	p.L66V	OR7G1_ENST00000293614.1_Missense_Mutation_p.L66V	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						GTAAAGGAGAGATTAAAGAGA	0.493																																					p.L66V		Atlas-SNP	.											.	OR7G1	53	.	0			c.C196G						PASS	.						162.0	159.0	160.0					19																	9226244		2203	4300	6503	SO:0001583	missense	125962	exon1			AGGAGAGATTAAA		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.196C>G	19.37:g.9226244G>C	ENSP00000444134:p.Leu66Val	107.0	0.0	0		135.0	42.0	0.311111	NM_001005192	Q6IFJ5|Q96RA1	Missense_Mutation	SNP	ENST00000541538.1	37	CCDS32898.2	.	.	.	.	.	.	.	.	.	.	g	12.27	1.888842	0.33348	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.00587	6.38;6.38	2.98	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31566	U	0.007425	T	0.03959	0.0111	H	0.98866	4.355	0.26521	N	0.974429	D	0.60160	0.987	P	0.58721	0.844	T	0.13098	-1.0522	10	0.87932	D	0	.	7.8169	0.29265	0.1236:0.0:0.8764:0.0	.	66	Q8NGA0	OR7G1_HUMAN	V	66	ENSP00000293614:L66V;ENSP00000444134:L66V	ENSP00000293614:L66V	L	-	1	0	OR7G1	9087244	0.000000	0.05858	0.405000	0.26409	0.111000	0.19643	-0.465000	0.06680	1.978000	0.57642	0.411000	0.27672	CTC	.	.	none		0.493	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1		
MDGA1	266727	hgsc.bcm.edu	37	6	37605198	37605198	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37605198G>A	ENST00000434837.3	-	17	3992	c.2814C>T	c.(2812-2814)tcC>tcT	p.S938S	MDGA1_ENST00000297153.7_Silent_p.S942S	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	938					brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						GCTGTGGGCTGGACTGGCAGG	0.652																																					p.S938S		Atlas-SNP	.											.	MDGA1	104	.	0			c.C2814T						PASS	.						38.0	43.0	41.0					6																	37605198		2029	4182	6211	SO:0001819	synonymous_variant	266727	exon17			TGGGCTGGACTGG	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2814C>T	6.37:g.37605198G>A		94.0	0.0	0		105.0	47.0	0.447619	NM_153487	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	37	CCDS47417.1																																																																																			.	.	none		0.652	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
LRRC7	57554	hgsc.bcm.edu	37	1	70501838	70501838	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:70501838T>C	ENST00000035383.5	+	17	1946	c.1916T>C	c.(1915-1917)aTt>aCt	p.I639T	LRRC7_ENST00000310961.5_Missense_Mutation_p.I644T|LRRC7_ENST00000415775.2_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	639						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GAAATGAGGATTGGGGAACTT	0.413																																					p.I639T		Atlas-SNP	.											.	LRRC7	400	.	0			c.T1916C						PASS	.						95.0	97.0	96.0					1																	70501838		2203	4300	6503	SO:0001583	missense	57554	exon17			TGAGGATTGGGGA		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1916T>C	1.37:g.70501838T>C	ENSP00000035383:p.Ile639Thr	136.0	0.0	0		153.0	46.0	0.300654	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061856	0.55432	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.55052	0.54;0.63	6.06	6.06	0.98353	.	0.050444	0.85682	D	0.000000	T	0.29061	0.0722	L	0.29908	0.895	0.80722	D	1	P	0.36282	0.546	B	0.32980	0.156	T	0.25813	-1.0121	10	0.52906	T	0.07	.	15.8056	0.78506	0.0:0.0:0.0:1.0	.	639	Q96NW7	LRRC7_HUMAN	T	644;639;462	ENSP00000309245:I644T;ENSP00000035383:I639T	ENSP00000035383:I639T	I	+	2	0	LRRC7	70274426	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.426000	0.66476	2.323000	0.78572	0.528000	0.53228	ATT	.	.	none		0.413	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
CRYBB3	1417	hgsc.bcm.edu	37	22	25603042	25603042	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:25603042C>T	ENST00000215855.2	+	6	579	c.499C>T	c.(499-501)Cgt>Tgt	p.R167C	CRYBB3_ENST00000404334.1_3'UTR	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	167	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						CCCCGGCTACCGTGGGCGCCA	0.642																																					p.P167S		Atlas-SNP	.											.	CRYBB3	13	.	0			c.C499T						PASS	.						64.0	57.0	59.0					22																	25603042		2201	4299	6500	SO:0001583	missense	1417	exon6			GGCTACCGTGGGC		CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.499C>T	22.37:g.25603042C>T	ENSP00000215855:p.Arg167Cys	68.0	0.0	0		73.0	17.0	0.232877	NM_004076	Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	37	CCDS13830.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987958	0.74589	.	.	ENSG00000100053	ENST00000215855	T	0.78707	-1.2	4.87	4.87	0.63330	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.86091	0.5850	M	0.81112	2.525	0.80722	D	1	D	0.62365	0.991	P	0.61940	0.896	D	0.87862	0.2665	10	0.87932	D	0	.	11.7789	0.52001	0.1759:0.8241:0.0:0.0	.	167	P26998	CRBB3_HUMAN	C	167	ENSP00000215855:R167C	ENSP00000215855:R167C	R	+	1	0	CRYBB3	23933042	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.684000	0.37649	2.223000	0.72356	0.561000	0.74099	CGT	.	.	none		0.642	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076	
RFX2	5990	hgsc.bcm.edu	37	19	6016117	6016117	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:6016117G>A	ENST00000303657.5	-	7	912	c.763C>T	c.(763-765)Cgg>Tgg	p.R255W	RFX2_ENST00000592546.1_Missense_Mutation_p.R230W|RFX2_ENST00000359161.3_Missense_Mutation_p.R255W|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						CCCAGCCGCCGCGTTCTCAGC	0.577																																					p.R255W	Colon(38;171 817 19800 47433 48051)	Atlas-SNP	.											.	RFX2	60	.	0			c.C763T						PASS	.						72.0	67.0	68.0					19																	6016117		2203	4300	6503	SO:0001583	missense	5990	exon7			GCCGCCGCGTTCT		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.763C>T	19.37:g.6016117G>A	ENSP00000306335:p.Arg255Trp	54.0	0.0	0		69.0	20.0	0.289855	NM_000635	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570825	0.65765	.	.	ENSG00000087903	ENST00000303657;ENST00000359161	D	0.92348	-3.02	4.55	2.16	0.27623	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.85682	D	0.000000	D	0.96688	0.8919	H	0.94698	3.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96970	0.9708	10	0.87932	D	0	-29.2202	12.3587	0.55190	0.0:0.0:0.6993:0.3007	.	230;255	P48378-2;P48378	.;RFX2_HUMAN	W	255;230	ENSP00000306335:R255W	ENSP00000306335:R255W	R	-	1	2	RFX2	5967117	1.000000	0.71417	0.918000	0.36340	0.578000	0.36192	5.299000	0.65716	0.996000	0.38943	0.561000	0.74099	CGG	.	.	none		0.577	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635	
MPEG1	219972	hgsc.bcm.edu	37	11	58978697	58978697	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr11:58978697C>T	ENST00000361050.3	-	1	1727	c.1642G>A	c.(1642-1644)Gat>Aat	p.D548N		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	548						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GCCCCTAAATCTCTGGATATA	0.557																																					p.D548N		Atlas-SNP	.											.	MPEG1	72	.	0			c.G1642A						PASS	.						40.0	43.0	42.0					11																	58978697		1844	4086	5930	SO:0001583	missense	219972	exon1			CTAAATCTCTGGA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1642G>A	11.37:g.58978697C>T	ENSP00000354335:p.Asp548Asn	77.0	0.0	0		64.0	16.0	0.25	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	C	4.924	0.171623	0.09391	.	.	ENSG00000197629	ENST00000361050	T	0.22539	1.95	5.83	4.74	0.60224	.	0.250875	0.28560	N	0.014904	T	0.20210	0.0486	L	0.48362	1.52	0.09310	N	1	B	0.18310	0.027	B	0.17433	0.018	T	0.07888	-1.0749	10	0.44086	T	0.13	-21.4942	12.7616	0.57367	0.0:0.9095:0.0:0.0905	.	548	Q2M385	MPEG1_HUMAN	N	548	ENSP00000354335:D548N	ENSP00000354335:D548N	D	-	1	0	MPEG1	58735273	0.182000	0.23173	0.069000	0.20011	0.065000	0.16274	0.596000	0.24044	2.767000	0.95098	0.655000	0.94253	GAT	.	.	none		0.557	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
FEM1B	10116	hgsc.bcm.edu	37	15	68583506	68583506	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr15:68583506G>A	ENST00000306917.4	+	2	2425	c.1810G>A	c.(1810-1812)Gca>Aca	p.A604T		NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	604					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GGCTGCCCGAGCAGTTCGGGC	0.408																																					p.A604T		Atlas-SNP	.											.	FEM1B	38	.	0			c.G1810A						PASS	.						57.0	57.0	57.0					15																	68583506		2200	4298	6498	SO:0001583	missense	10116	exon2			GCCCGAGCAGTTC		CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.1810G>A	15.37:g.68583506G>A	ENSP00000307298:p.Ala604Thr	135.0	0.0	0		109.0	26.0	0.238532	NM_015322	O43146	Missense_Mutation	SNP	ENST00000306917.4	37	CCDS10228.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773911	0.69992	.	.	ENSG00000169018	ENST00000306917	T	0.45276	0.9	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	L	0.33339	1.005	0.80722	D	1	P	0.40660	0.726	B	0.34590	0.186	T	0.10730	-1.0617	10	0.40728	T	0.16	-34.5384	18.7742	0.91904	0.0:0.0:1.0:0.0	.	604	Q9UK73	FEM1B_HUMAN	T	604	ENSP00000307298:A604T	ENSP00000307298:A604T	A	+	1	0	FEM1B	66370560	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.793000	0.99091	2.685000	0.91497	0.491000	0.48974	GCA	.	.	none		0.408	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257065.1		
ZNF707	286075	hgsc.bcm.edu	37	8	144775926	144775926	+	Silent	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr8:144775926C>T	ENST00000532205.1	+	8	1241	c.342C>T	c.(340-342)gcC>gcT	p.A114A	ZNF707_ENST00000532158.1_Silent_p.A114A|ZNF707_ENST00000358656.4_Silent_p.A114A|RP11-429J17.2_ENST00000531565.1_RNA|ZNF707_ENST00000418203.2_Silent_p.A114A|ZNF707_ENST00000454097.1_Silent_p.A114A			Q96C28	ZN707_HUMAN	zinc finger protein 707	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GAGAAAGAGCCAGGGAAGGAA	0.582																																					p.A114A		Atlas-SNP	.											.	ZNF707	21	.	0			c.C342T						PASS	.						55.0	60.0	59.0					8																	144775926		2012	4175	6187	SO:0001819	synonymous_variant	286075	exon6			AAGAGCCAGGGAA	AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.342C>T	8.37:g.144775926C>T		102.0	0.0	0		111.0	27.0	0.243243	NM_001100598	A8K317|B3KNY1|D3DWK7	Silent	SNP	ENST00000532205.1	37	CCDS47932.1	.	.	.	.	.	.	.	.	.	.	C	1.036	-0.680439	0.03353	.	.	ENSG00000181135	ENST00000530574	T	0.01548	4.78	1.76	0.866	0.19079	.	.	.	.	.	T	0.02230	0.0069	.	.	.	0.21105	N	0.99979	.	.	.	.	.	.	T	0.47873	-0.9083	6	0.44086	T	0.13	.	6.2605	0.20897	0.0:0.8249:0.0:0.1751	.	.	.	.	L	111	ENSP00000436362:P111L	ENSP00000436362:P111L	P	+	2	0	ZNF707	144847914	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.747000	0.26290	0.300000	0.22699	-0.253000	0.11424	CCA	.	.	none		0.582	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382197.1	NM_173831	
ZNF648	127665	hgsc.bcm.edu	37	1	182026466	182026466	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:182026466G>A	ENST00000339948.3	-	2	887	c.680C>T	c.(679-681)gCg>gTg	p.A227V		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GCTGTTCCGCGCTTTTGCCAG	0.701																																					p.A227V	NSCLC(71;908 1374 5429 20458 35642)	Atlas-SNP	.											.	ZNF648	111	.	0			c.C680T						PASS	.						19.0	21.0	21.0					1																	182026466		2197	4292	6489	SO:0001583	missense	127665	exon2			TTCCGCGCTTTTG	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.680C>T	1.37:g.182026466G>A	ENSP00000344129:p.Ala227Val	69.0	0.0	0		64.0	20.0	0.3125	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	G	9.025	0.985833	0.18889	.	.	ENSG00000179930	ENST00000339948	T	0.08008	3.14	2.77	-5.54	0.02544	.	.	.	.	.	T	0.03348	0.0097	N	0.12746	0.255	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.39603	-0.9606	9	0.48119	T	0.1	.	1.1984	0.01880	0.3631:0.2567:0.2507:0.1295	.	227	Q5T619	ZN648_HUMAN	V	227	ENSP00000344129:A227V	ENSP00000344129:A227V	A	-	2	0	ZNF648	180293089	0.000000	0.05858	0.002000	0.10522	0.031000	0.12232	-0.098000	0.11024	-1.907000	0.01087	-0.150000	0.13652	GCG	.	.	none		0.701	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
FN1	2335	hgsc.bcm.edu	37	2	216257691	216257691	+	Intron	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:216257691G>A	ENST00000359671.1	-	25	4062				FN1_ENST00000323926.6_Silent_p.G1344G|FN1_ENST00000354785.4_Silent_p.G1344G|FN1_ENST00000432072.2_Silent_p.G1344G|FN1_ENST00000443816.1_Intron|FN1_ENST00000356005.4_Intron|FN1_ENST00000421182.1_Intron|FN1_ENST00000357867.4_Intron|FN1_ENST00000446046.1_Intron|FN1_ENST00000357009.2_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000336916.4_Intron|FN1_ENST00000346544.3_Intron			P02751	FINC_HUMAN	fibronectin 1						acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CACTCTCGCCGCCATTAATGA	0.463																																					p.G1344G		Atlas-SNP	.											.	FN1	521	.	0			c.C4032T						PASS	.						71.0	71.0	71.0					2																	216257691		1917	4131	6048	SO:0001627	intron_variant	2335	exon25			CTCGCCGCCATTA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3797-1154C>T	2.37:g.216257691G>A		135.0	0.0	0		126.0	31.0	0.246032	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																				.	.	none		0.463	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
ZSCAN25	221785	hgsc.bcm.edu	37	7	99219100	99219100	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr7:99219100G>A	ENST00000394152.2	+	5	819	c.492G>A	c.(490-492)ggG>ggA	p.G164G	ZSCAN25_ENST00000466948.1_Intron|ZSCAN25_ENST00000334715.3_Silent_p.G164G|ZSCAN25_ENST00000262941.6_Silent_p.G164G	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	164					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGAATGGGGGATGCCCCCTG	0.627																																					p.G164G		Atlas-SNP	.											.	.	.	.	0			c.G492A						PASS	.						65.0	61.0	62.0					7																	99219100		2203	4300	6503	SO:0001819	synonymous_variant	221785	exon5			ATGGGGGATGCCC	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.492G>A	7.37:g.99219100G>A		55.0	0.0	0		83.0	31.0	0.373494	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	ENST00000394152.2	37	CCDS5671.2																																																																																			.	.	none		0.627	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
TMEM54	113452	hgsc.bcm.edu	37	1	33363889	33363889	+	Silent	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:33363889C>T	ENST00000373463.3	-	2	167	c.48G>A	c.(46-48)gtG>gtA	p.V16V	TMEM54_ENST00000475208.1_5'UTR|TMEM54_ENST00000329151.5_Silent_p.V16V	NM_033504.2	NP_277039.1	Q969K7	TMM54_HUMAN	transmembrane protein 54	16						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TCTTCATCAGCACCTTCCGGA	0.632																																					p.V16V		Atlas-SNP	.											.	TMEM54	12	.	0			c.G48A						PASS	.						92.0	80.0	84.0					1																	33363889		2203	4300	6503	SO:0001819	synonymous_variant	113452	exon2			CATCAGCACCTTC		CCDS371.1	1p35-p34	2008-02-05			ENSG00000121900	ENSG00000121900			24143	protein-coding gene	gene with protein product						9500206	Standard	NM_033504		Approved	CAC-1	uc001bwi.1	Q969K7	OTTHUMG00000004016	ENST00000373463.3:c.48G>A	1.37:g.33363889C>T		90.0	0.0	0		68.0	21.0	0.308824	NM_033504	Q6UV18|Q8IVD0|Q9UM12	Silent	SNP	ENST00000373463.3	37	CCDS371.1																																																																																			.	.	none		0.632	TMEM54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011474.1	NM_033504	
FAT4	79633	hgsc.bcm.edu	37	4	126242688	126242688	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:126242688G>A	ENST00000394329.3	+	1	5135	c.5122G>A	c.(5122-5124)Gat>Aat	p.D1708N		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1708	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTACCTGGTGGATGTTTATGC	0.398																																					p.D1708N		Atlas-SNP	.											.	FAT4	1752	.	0			c.G5122A						PASS	.						77.0	74.0	75.0					4																	126242688		1888	4124	6012	SO:0001583	missense	79633	exon1			CTGGTGGATGTTT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5122G>A	4.37:g.126242688G>A	ENSP00000377862:p.Asp1708Asn	147.0	0.0	0		126.0	26.0	0.206349	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971544	0.92919	.	.	ENSG00000196159	ENST00000394329	T	0.37411	1.2	5.27	5.27	0.74061	Cadherin (3);Cadherin-like (1);	0.000000	0.35378	U	0.003259	T	0.24044	0.0582	N	0.20845	0.615	0.80722	D	1	P	0.38922	0.651	B	0.32677	0.15	T	0.04373	-1.0956	10	0.18710	T	0.47	.	18.9064	0.92464	0.0:0.0:1.0:0.0	.	1708	Q6V0I7	FAT4_HUMAN	N	1708	ENSP00000377862:D1708N	ENSP00000377862:D1708N	D	+	1	0	FAT4	126462138	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.666000	0.83877	2.466000	0.83321	0.655000	0.94253	GAT	.	.	none		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
KLHL14	57565	hgsc.bcm.edu	37	18	30350266	30350266	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:30350266G>A	ENST00000359358.4	-	2	727	c.289C>T	c.(289-291)Cag>Tag	p.Q97*	KLHL14_ENST00000358095.4_Nonsense_Mutation_p.Q97*|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	97	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						ggcggcggctgctgctgctgt	0.736																																					p.Q97X		Atlas-SNP	.											.	KLHL14	92	.	0			c.C289T						PASS	.						13.0	19.0	17.0					18																	30350266		2140	4213	6353	SO:0001587	stop_gained	57565	exon2			GCGGCTGCTGCTG	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.289C>T	18.37:g.30350266G>A	ENSP00000352314:p.Gln97*	165.0	0.0	0		204.0	38.0	0.186275	NM_020805	A6NNW1|B4DHA0|Q8WU41	Nonsense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136803	0.77662	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	.	.	.	4.14	4.14	0.48551	.	0.341802	0.26338	N	0.024957	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	11.7742	0.51977	0.0:0.0:1.0:0.0	.	.	.	.	X	97	.	ENSP00000350808:Q97X	Q	-	1	0	KLHL14	28604264	0.999000	0.42202	0.955000	0.39395	0.984000	0.73092	0.703000	0.25646	2.141000	0.66446	0.460000	0.39030	CAG	.	.	none		0.736	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
HIST1H2AI	8329	hgsc.bcm.edu	37	6	27776072	27776072	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:27776072G>A	ENST00000358739.3	+	1	174	c.85G>A	c.(85-87)Ggc>Agc	p.G29S	HIST1H2BL_ENST00000377401.2_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	29						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						GTTTCCCGTAGGCCGAGTGCA	0.652																																					p.G29S		Atlas-SNP	.											.	HIST1H2AI	9	.	0			c.G85A						PASS	.						30.0	37.0	34.0					6																	27776072		2184	4292	6476	SO:0001583	missense	8329	exon1			CCCGTAGGCCGAG	Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.85G>A	6.37:g.27776072G>A	ENSP00000351589:p.Gly29Ser	224.0	0.0	0		272.0	20.0	0.0735294	NM_003509	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000358739.3	37	CCDS4626.1	.	.	.	.	.	.	.	.	.	.	.	18.23	3.577988	0.65878	.	.	ENSG00000196747	ENST00000358739	T	0.44083	0.93	4.53	4.53	0.55603	.	0.000000	0.41001	D	0.000970	T	0.54647	0.1871	.	.	.	0.47905	D	0.999543	.	.	.	.	.	.	T	0.61128	-0.7125	7	0.87932	D	0	.	17.2005	0.86904	0.0:0.0:1.0:0.0	.	.	.	.	S	29	ENSP00000351589:G29S	ENSP00000351589:G29S	G	+	1	0	HIST1H2AI	27884051	1.000000	0.71417	0.998000	0.56505	0.144000	0.21451	8.900000	0.92551	2.458000	0.83093	0.556000	0.70494	GGC	.	.	none		0.652	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040152.1	NM_003509	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230279	23230279	+	Silent	SNP	C	C	T	rs564743210	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:23230279C>T	ENST00000526893.1	+	1	320	c.46C>T	c.(46-48)Ctg>Ttg	p.L16L	IGLL5_ENST00000531372.1_Silent_p.L16L|IGLL5_ENST00000532223.2_Silent_p.L16L|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	16						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCCTGAGGAGCTGGGCCCTGG	0.667													C|||	3	0.000599042	0.0023	0.0	5008	,	,		13145	0.0		0.0	False		,,,				2504	0.0				p.L16L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C46T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GAGGAGCTGGGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.46C>T	22.37:g.23230279C>T		166.0	0.0	0		102.0	34.0	0.333333	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
DGKD	8527	hgsc.bcm.edu	37	2	234363499	234363499	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:234363499T>A	ENST00000264057.2	+	19	2367	c.2355T>A	c.(2353-2355)gaT>gaA	p.D785E	DGKD_ENST00000409813.3_Missense_Mutation_p.D741E	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	785					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	ACAAGCGCGATGAGCACCCAG	0.478																																					p.D785E		Atlas-SNP	.											.	DGKD	106	.	0			c.T2355A						PASS	.						141.0	118.0	126.0					2																	234363499		2203	4300	6503	SO:0001583	missense	8527	exon19			GCGCGATGAGCAC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2355T>A	2.37:g.234363499T>A	ENSP00000264057:p.Asp785Glu	46.0	0.0	0		53.0	10.0	0.188679	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	T	0.034	-1.317972	0.01320	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.26223	1.75;1.75	3.57	-4.83	0.03161	Diacylglycerol kinase, accessory domain (2);	0.000000	0.64402	D	0.000003	T	0.04634	0.0126	N	0.00303	-1.675	0.35588	D	0.806807	B;B;B	0.26081	0.001;0.141;0.005	B;B;B	0.28139	0.013;0.086;0.085	T	0.36866	-0.9730	10	0.02654	T	1	.	12.6652	0.56837	0.0:0.1334:0.0:0.8666	.	669;741;785	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	E	785;741	ENSP00000264057:D785E;ENSP00000386455:D741E	ENSP00000264057:D785E	D	+	3	2	DGKD	234028238	0.000000	0.05858	0.342000	0.25602	0.228000	0.25075	-2.627000	0.00874	-1.028000	0.03321	-0.304000	0.09214	GAT	.	.	none		0.478	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
KANK2	25959	hgsc.bcm.edu	37	19	11289041	11289041	+	Silent	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:11289041C>T	ENST00000586659.1	-	6	1814	c.1500G>A	c.(1498-1500)caG>caA	p.Q500Q	KANK2_ENST00000589359.1_Silent_p.Q508Q|KANK2_ENST00000355150.5_Silent_p.Q500Q|KANK2_ENST00000589894.1_Silent_p.Q500Q|KANK2_ENST00000432929.2_Silent_p.Q508Q			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	500					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CCCCCACGAACTGGAGGCTCC	0.652																																					p.Q508Q		Atlas-SNP	.											.	KANK2	47	.	0			c.G1524A						PASS	.						18.0	21.0	20.0					19																	11289041		2203	4297	6500	SO:0001819	synonymous_variant	25959	exon4			CACGAACTGGAGG	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1500G>A	19.37:g.11289041C>T		63.0	0.0	0		82.0	20.0	0.243902	NM_015493	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	ENST00000586659.1	37	CCDS12255.1																																																																																			.	.	none		0.652	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
MESP2	145873	hgsc.bcm.edu	37	15	90320149	90320149	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr15:90320149G>A	ENST00000341735.3	+	1	561	c.561G>A	c.(559-561)ggG>ggA	p.G187G	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	187	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaggggcaggggcaag	0.781																																					p.G187G		Atlas-SNP	.											.	MESP2	20	.	0			c.G561A						PASS	.						2.0	3.0	3.0					15																	90320149		1334	3199	4533	SO:0001819	synonymous_variant	145873	exon1			GCAGGGGCAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.561G>A	15.37:g.90320149G>A		43.0	0.0	0		26.0	11.0	0.423077	NM_001039958	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																			.	.	none		0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26157108	26157108	+	Missense_Mutation	SNP	G	G	A	rs201935674	byFrequency	TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:26157108G>A	ENST00000304218.3	+	1	550	c.490G>A	c.(490-492)Gct>Act	p.A164T	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	164					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.A164P(1)		NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GCCGGCTGCAGCTGCTGGAGC	0.597													G|||	2	0.000399361	0.0	0.0	5008	,	,		12111	0.0		0.002	False		,,,				2504	0.0				p.A164T		Atlas-SNP	.											HIST1H1E,NS,lymphoid_neoplasm,-1,3	HIST1H1E	69	3	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G490A						PASS	.						15.0	21.0	19.0					6																	26157108		2192	4287	6479	SO:0001583	missense	3008	exon1			GCTGCAGCTGCTG	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.490G>A	6.37:g.26157108G>A	ENSP00000307705:p.Ala164Thr	102.0	0.0	0		70.0	20.0	0.285714	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	.	13.33	2.206374	0.39003	.	.	ENSG00000168298	ENST00000304218	T	0.04862	3.54	5.49	5.49	0.81192	.	0.133164	0.49916	D	0.000129	T	0.04543	0.0124	L	0.37697	1.125	0.49798	D	0.99982	P	0.48911	0.917	P	0.51297	0.665	T	0.11324	-1.0592	10	0.02654	T	1	-2.5382	18.7205	0.91691	0.0:0.0:1.0:0.0	.	164	P10412	H14_HUMAN	T	164	ENSP00000307705:A164T	ENSP00000307705:A164T	A	+	1	0	HIST1H1E	26265087	0.970000	0.33590	0.822000	0.32727	0.970000	0.65996	2.285000	0.43487	2.723000	0.93209	0.655000	0.94253	GCT	G|0.999;A|0.001	0.001	strong		0.597	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
TGIF1	7050	hgsc.bcm.edu	37	18	3451989	3451989	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:3451989G>A	ENST00000330513.5	+	1	315	c.12G>A	c.(10-12)gcG>gcA	p.A4A	TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	4					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TGGTTCTAGCGCAGAGCCGGG	0.652																																					p.A4A		Atlas-SNP	.											.	TGIF1	41	.	0			c.G12A						PASS	.						31.0	35.0	34.0					18																	3451989		2203	4300	6503	SO:0001819	synonymous_variant	7050	exon1			TCTAGCGCAGAGC	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.12G>A	18.37:g.3451989G>A		152.0	0.0	0		226.0	28.0	0.123894	NM_170695	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Silent	SNP	ENST00000330513.5	37	CCDS11834.1																																																																																			.	.	none		0.652	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
FOXC1	2296	hgsc.bcm.edu	37	6	1610821	1610821	+	Nonsense_Mutation	SNP	C	C	G	rs372857241		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:1610821C>G	ENST00000380874.2	+	1	141	c.141C>G	c.(139-141)taC>taG	p.Y47*		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	47					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		TGAGCGTGTACTCGCACCCTG	0.751																																					p.Y47X	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.C141G						PASS	.						10.0	11.0	10.0					6																	1610821		2182	4269	6451	SO:0001587	stop_gained	2296	exon1			CGTGTACTCGCAC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.141C>G	6.37:g.1610821C>G	ENSP00000370256:p.Tyr47*	39.0	0.0	0		32.0	10.0	0.3125	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Nonsense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	c	36	5.748035	0.96882	.	.	ENSG00000054598	ENST00000541209;ENST00000380874	.	.	.	3.33	3.33	0.38152	.	0.000000	0.64402	U	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7782	0.69746	0.0:1.0:0.0:0.0	.	.	.	.	X	47	.	ENSP00000370256:Y47X	Y	+	3	2	FOXC1	1555820	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.697000	0.37784	1.842000	0.53543	0.457000	0.33378	TAC	.	.	alt		0.751	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138392	37138392	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138392C>T	ENST00000373509.5	+	1	414	c.41C>T	c.(40-42)gCc>gTc	p.A14V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	105					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CACCTGCGCGCCGCGCCCTGC	0.716			T	BCL6	NHL																																p.A105V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,right_lower_lobe,carcinoma,-1,1	PIM1	71	1	0			c.C314T						scavenged	.						27.0	28.0	28.0					6																	37138392		2201	4297	6498	SO:0001583	missense	5292	exon1			TGCGCGCCGCGCC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.41C>T	6.37:g.37138392C>T	ENSP00000362608:p.Ala14Val	79.0	1.0	0.0126582		98.0	30.0	0.306122	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936460	0.52972	.	.	ENSG00000137193	ENST00000373509	T	0.69435	-0.4	4.2	4.2	0.49525	.	0.605746	0.14689	N	0.304266	T	0.21186	0.0510	N	0.08118	0	0.32695	N	0.513601	P	0.38020	0.615	B	0.24006	0.05	T	0.02844	-1.1103	10	0.16420	T	0.52	.	12.2313	0.54490	0.1706:0.8294:0.0:0.0	.	105	P11309	PIM1_HUMAN	V	14	ENSP00000362608:A14V	ENSP00000362608:A14V	A	+	2	0	PIM1	37246370	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.287000	0.51732	2.289000	0.77006	0.542000	0.68232	GCC	.	.	none		0.716	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PIM1	5292	hgsc.bcm.edu	37	6	37139203	37139203	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37139203G>A	ENST00000373509.5	+	4	916	c.543G>A	c.(541-543)gaG>gaA	p.E181E		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	272	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.E181D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	ATCGCGGCGAGCTCAAGCTCA	0.637			T	BCL6	NHL																																p.E272E		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G816A						PASS	.						32.0	33.0	32.0					6																	37139203		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			CGGCGAGCTCAAG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.543G>A	6.37:g.37139203G>A		85.0	0.0	0		96.0	21.0	0.21875	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.637	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
CCDC178	374864	hgsc.bcm.edu	37	18	30950118	30950118	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr18:30950118G>A	ENST00000383096.3	-	6	426	c.244C>T	c.(244-246)Cga>Tga	p.R82*	CCDC178_ENST00000406524.2_Nonsense_Mutation_p.R82*|CCDC178_ENST00000579947.1_Nonsense_Mutation_p.R82*|CCDC178_ENST00000579916.1_Nonsense_Mutation_p.R82*|CCDC178_ENST00000403303.1_Nonsense_Mutation_p.R82*|CCDC178_ENST00000402325.1_Nonsense_Mutation_p.R82*|CCDC178_ENST00000583930.1_Nonsense_Mutation_p.R82*|CCDC178_ENST00000300227.8_Nonsense_Mutation_p.R82*			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	82																	CTGTGACGTCGACATGGGTAG	0.368																																					p.R82X		Atlas-SNP	.											.	.	.	.	0			c.C244T						PASS	.						74.0	66.0	69.0					18																	30950118		2203	4300	6503	SO:0001587	stop_gained	374864	exon5			GACGTCGACATGG	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.244C>T	18.37:g.30950118G>A	ENSP00000372576:p.Arg82*	126.0	0.0	0		129.0	41.0	0.317829	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Nonsense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148756	0.57151	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4729	14.8979	0.70656	0.0:0.0:1.0:0.0	.	.	.	.	X	82	.	ENSP00000300227:R82X	R	-	1	2	C18orf34	29204116	0.978000	0.34361	0.949000	0.38748	0.248000	0.25809	1.567000	0.36407	2.589000	0.87451	0.555000	0.69702	CGA	.	.	none		0.368	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
DSPP	1834	hgsc.bcm.edu	37	4	88533881	88533881	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr4:88533881A>T	ENST00000282478.7	+	3	576	c.543A>T	c.(541-543)gaA>gaT	p.E181D	DSPP_ENST00000399271.1_Missense_Mutation_p.E181D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	181					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		TTGTCCAAGAAGATGGACCTC	0.408																																					p.E181D		Atlas-SNP	.											.	DSPP	174	.	0			c.A543T						PASS	.						113.0	110.0	111.0					4																	88533881		2033	4191	6224	SO:0001583	missense	1834	exon4			CCAAGAAGATGGA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.543A>T	4.37:g.88533881A>T	ENSP00000282478:p.Glu181Asp	141.0	0.0	0		124.0	42.0	0.33871	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.504048	0.44558	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.94417	-3.42;-3.42	4.94	-0.955	0.10356	.	0.000000	0.33515	N	0.004829	D	0.86243	0.5886	L	0.34521	1.04	0.09310	N	1	B	0.27229	0.172	B	0.23716	0.048	T	0.76008	-0.3116	10	0.51188	T	0.08	-12.5992	1.7214	0.02912	0.4096:0.2621:0.0771:0.2512	.	181	Q9NZW4	DSPP_HUMAN	D	181	ENSP00000382213:E181D;ENSP00000282478:E181D	ENSP00000282478:E181D	E	+	3	2	DSPP	88752905	0.300000	0.24435	0.021000	0.16686	0.237000	0.25408	0.236000	0.17967	0.036000	0.15547	0.455000	0.32223	GAA	.	.	none		0.408	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
IGLL5	100423062	hgsc.bcm.edu	37	22	23235887	23235887	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr22:23235887C>G	ENST00000526893.1	+	2	488	c.214C>G	c.(214-216)Ctc>Gtc	p.L72V	IGLL5_ENST00000531372.1_Intron|IGLJ1_ENST00000390320.2_RNA|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.L73V	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	72						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CAGGCTCCTGCTCCAGCCCAG	0.657																																					p.L72V		Atlas-SNP	.											.	IGLL5	26	.	0			c.C214G						PASS	.						39.0	43.0	42.0					22																	23235887		691	1590	2281	SO:0001583	missense	100423062	exon2			CTCCTGCTCCAGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.214C>G	22.37:g.23235887C>G	ENSP00000431254:p.Leu72Val	49.0	0.0	0		28.0	13.0	0.464286	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	8.638	0.895344	0.17613	.	.	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.00571	6.5;6.5	2.5	-2.87	0.05700	.	.	.	.	.	T	0.00468	0.0015	L	0.50333	1.59	0.09310	N	1	B	0.28026	0.198	B	0.24541	0.054	T	0.39781	-0.9597	9	0.54805	T	0.06	.	3.482	0.07606	0.0:0.3311:0.3656:0.3033	.	72	B9A064	IGLL5_HUMAN	V	73;72	ENSP00000436353:L73V;ENSP00000431254:L72V	ENSP00000417505:L6V	L	+	1	0	IGLL5	21565887	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.207000	0.03008	-0.350000	0.08262	0.491000	0.48974	CTC	.	.	none		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
TMEM168	64418	hgsc.bcm.edu	37	7	112415375	112415375	+	Splice_Site	SNP	T	T	C			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr7:112415375T>C	ENST00000312814.6	-	3	1689		c.e3-2		TMEM168_ENST00000454074.1_Splice_Site|TMEM168_ENST00000480969.1_Splice_Site	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168							integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						ATTTGTTGGCTAAAAGAAATC	0.338																																					.		Atlas-SNP	.											.	TMEM168	84	.	0			c.1129-2A>G						PASS	.						59.0	54.0	56.0					7																	112415375		2203	4300	6503	SO:0001630	splice_region_variant	64418	exon4			GTTGGCTAAAAGA		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1129-2A>G	7.37:g.112415375T>C		67.0	0.0	0		72.0	4.0	0.0555556	NM_022484	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Splice_Site	SNP	ENST00000312814.6	37	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.262067	0.80358	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000418785;ENST00000441474	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.556	0.76192	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM168	112202611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.101000	0.76997	2.146000	0.66826	0.533000	0.62120	.	.	.	none		0.338	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484	Intron
OR2L8	391190	hgsc.bcm.edu	37	1	248112303	248112303	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:248112303C>G	ENST00000357191.3	+	1	144	c.144C>G	c.(142-144)atC>atG	p.I48M	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCTTCTCATCTTCTTGGACA	0.418																																					p.I48M		Atlas-SNP	.											OR2L8,right_lower_lobe,carcinoma,0,1	OR2L8	92	1	0			c.C144G						PASS	.						337.0	303.0	314.0					1																	248112303		2203	4300	6503	SO:0001583	missense	391190	exon1			TCTCATCTTCTTG	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.144C>G	1.37:g.248112303C>G	ENSP00000349719:p.Ile48Met	405.0	0.0	0		358.0	99.0	0.276536	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351760	0.24512	.	.	ENSG00000196936	ENST00000357191	T	0.08458	3.09	1.48	1.48	0.22813	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.30135	0.0755	M	0.93106	3.38	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.11155	-1.0599	9	0.87932	D	0	.	2.7963	0.05402	0.4476:0.3804:0.0:0.172	.	48	Q8NGY9	OR2L8_HUMAN	M	48	ENSP00000349719:I48M	ENSP00000349719:I48M	I	+	3	3	OR2L8	246178926	0.000000	0.05858	0.013000	0.15412	0.267000	0.26476	-4.229000	0.00270	0.803000	0.34113	0.298000	0.19748	ATC	.	.	none		0.418	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
HTRA2	27429	hgsc.bcm.edu	37	2	74756626	74756626	+	5'UTR	SNP	C	C	T			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr2:74756626C>T	ENST00000258080.3	+	0	123				AUP1_ENST00000377526.3_Splice_Site_p.R17R|HTRA2_ENST00000352222.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2						adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CACCCGGAAGCCTGGGGGCGA	0.662																																					p.R17R		Atlas-SNP	.											.	AUP1	29	.	0			c.G51A						PASS	.						21.0	33.0	29.0					2																	74756626		2093	4161	6254	SO:0001623	5_prime_UTR_variant	550	exon2			CGGAAGCCTGGGG		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.-508C>T	2.37:g.74756626C>T		91.0	0.0	0		93.0	21.0	0.225806	NM_181575	Q9HBZ4|Q9P0Y3|Q9P0Y4	Silent	SNP	ENST00000258080.3	37	CCDS1951.1																																																																																			.	.	none		0.662	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
PIM1	5292	hgsc.bcm.edu	37	6	37138908	37138908	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr6:37138908G>A	ENST00000373509.5	+	4	621	c.248G>A	c.(247-249)gGc>gAc	p.G83D		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	174					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CAGCCTAATGGCACTCGAGTG	0.662			T	BCL6	NHL																																p.G174D		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	0			c.G521A						PASS	.						50.0	57.0	54.0					6																	37138908		2203	4300	6503	SO:0001583	missense	5292	exon4			CTAATGGCACTCG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.248G>A	6.37:g.37138908G>A	ENSP00000362608:p.Gly83Asp	54.0	0.0	0		61.0	14.0	0.229508	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506654	0.64410	.	.	ENSG00000137193	ENST00000373509	T	0.64991	-0.13	4.28	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.315172	0.28327	N	0.015753	T	0.38026	0.1025	N	0.25485	0.75	0.58432	D	0.999999	B	0.18166	0.026	B	0.20184	0.028	T	0.34304	-0.9834	10	0.45353	T	0.12	.	16.8746	0.86048	0.0:0.0:1.0:0.0	.	174	P11309	PIM1_HUMAN	D	83	ENSP00000362608:G83D	ENSP00000362608:G83D	G	+	2	0	PIM1	37246886	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.484000	0.81180	2.371000	0.80710	0.549000	0.68633	GGC	.	.	none		0.662	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
RGS6	9628	hgsc.bcm.edu	37	14	72943455	72943455	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr14:72943455G>A	ENST00000553530.1	+	11	906	c.699G>A	c.(697-699)gtG>gtA	p.V233V	RGS6_ENST00000406236.4_Silent_p.V233V|RGS6_ENST00000402788.2_Silent_p.V233V|RGS6_ENST00000556437.1_Silent_p.V233V|RGS6_ENST00000434263.2_Silent_p.V164V|RGS6_ENST00000555571.1_Silent_p.V233V|RGS6_ENST00000553525.1_Silent_p.V233V|RGS6_ENST00000404301.2_Silent_p.V233V|RGS6_ENST00000407322.4_Silent_p.V233V|RGS6_ENST00000355512.6_Silent_p.V233V|RGS6_ENST00000554782.1_Silent_p.V94V|RGS6_ENST00000343854.6_Silent_p.V233V	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	233					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CCTAGTCCGTGTATGGCGTGA	0.507																																					p.V233V	Ovarian(143;1926 2468 21071 48641)	Atlas-SNP	.											RGS6,NS,carcinoma,+1,1	RGS6	92	1	0			c.G699A						PASS	.						117.0	100.0	106.0					14																	72943455		2203	4300	6503	SO:0001819	synonymous_variant	9628	exon11			GTCCGTGTATGGC	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.699G>A	14.37:g.72943455G>A		112.0	0.0	0		92.0	13.0	0.141304	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	ENST00000553530.1	37	CCDS9808.1																																																																																			.	.	none		0.507	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220326665	220326665	+	Silent	SNP	G	G	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:220326665G>A	ENST00000358951.2	-	33	3845	c.3729C>T	c.(3727-3729)ccC>ccT	p.P1243P		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	1243					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CAAAAGGAGTGGGTGTGGCCT	0.468																																					p.P1243P		Atlas-SNP	.											.	RAB3GAP2	120	.	0			c.C3729T						PASS	.						211.0	202.0	205.0					1																	220326665		2203	4300	6503	SO:0001819	synonymous_variant	25782	exon33			AGGAGTGGGTGTG	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.3729C>T	1.37:g.220326665G>A		295.0	0.0	0		284.0	72.0	0.253521	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	37	CCDS31028.1																																																																																			.	.	none		0.468	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
ADAMTS1	9510	hgsc.bcm.edu	37	21	28214839	28214839	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr21:28214839C>A	ENST00000284984.3	-	2	1350	c.896G>T	c.(895-897)cGt>cTt	p.R299L		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	299	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		AACTGAATTACGAATGCTGGG	0.517																																					p.R299L		Atlas-SNP	.											.	ADAMTS1	131	.	0			c.G896T						PASS	.						101.0	84.0	89.0					21																	28214839		2203	4300	6503	SO:0001583	missense	9510	exon2			GAATTACGAATGC	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.896G>T	21.37:g.28214839C>A	ENSP00000284984:p.Arg299Leu	120.0	0.0	0		139.0	40.0	0.28777	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.76|15.76	2.928654|2.928654	0.52759|0.52759	.|.	.|.	ENSG00000154734|ENSG00000154734	ENST00000284984;ENST00000517777;ENST00000517452|ENST00000451462	T;T;T|.	0.63580|.	-0.05;-0.05;-0.05|.	5.44|5.44	5.44|5.44	0.79542|0.79542	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);|.	.|.	.|.	.|.	.|.	T|T	0.50326|0.50326	0.1609|0.1609	N|N	0.12611|0.12611	0.24|0.24	0.58432|0.58432	D|D	0.999996|0.999996	B|.	0.19817|.	0.039|.	B|.	0.16289|.	0.015|.	T|T	0.42916|0.42916	-0.9423|-0.9423	9|5	0.40728|.	T|.	0.16|.	.|.	19.4587|19.4587	0.94906|0.94906	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	299|.	Q9UHI8|.	ATS1_HUMAN|.	L|L	299;37;61|81	ENSP00000284984:R299L;ENSP00000429557:R37L;ENSP00000431065:R61L|.	ENSP00000284984:R299L|.	R|V	-|-	2|1	0|0	ADAMTS1|ADAMTS1	27136710|27136710	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	5.510000|5.510000	0.67018|0.67018	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	CGT|GTA	.	.	none		0.517	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	216.0	0.0	0		203.0	28.0	0.137931	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
VCAM1	7412	hgsc.bcm.edu	37	1	101200181	101200181	+	Missense_Mutation	SNP	C	C	T	rs369761581		TCGA-FF-A7CQ-01A-11D-A382-10	TCGA-FF-A7CQ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2e4fe50f-0ee6-46c2-9795-2e2c1c8a86bf	5f7ab27c-4bb5-430c-a173-433d42f767d5	g.chr1:101200181C>T	ENST00000294728.2	+	8	2017	c.1916C>T	c.(1915-1917)gCg>gTg	p.A639V	VCAM1_ENST00000370119.4_Missense_Mutation_p.A577V|VCAM1_ENST00000370115.1_Missense_Mutation_p.A440V|VCAM1_ENST00000347652.2_Missense_Mutation_p.A547V	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	639	Ig-like C2-type 7.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AAGAAAAAAGCGGAGACAGGA	0.418																																					p.A639V		Atlas-SNP	.											VCAM1,NS,carcinoma,0,1	VCAM1	111	1	0			c.C1916T						PASS	.	C	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	82.0	85.0	84.0		1640,1730,1916	4.0	0.9	1		84	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	VCAM1	NM_080682.2,NM_001199834.1,NM_001078.3	64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	547/648,577/678,639/740	101200181	1,13005	2203	4300	6503	SO:0001583	missense	7412	exon8			AAAAAGCGGAGAC	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1916C>T	1.37:g.101200181C>T	ENSP00000294728:p.Ala639Val	161.0	0.0	0		165.0	47.0	0.284848	NM_001078	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.237173	0.22711	0.0	1.16E-4	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.87	4.0	0.46444	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.656371	0.16226	N	0.223805	T	0.24005	0.0581	L	0.28192	0.835	0.09310	N	1	B;P;B	0.35411	0.372;0.5;0.032	B;B;B	0.30401	0.069;0.115;0.053	T	0.07309	-1.0779	10	0.59425	D	0.04	-8.8298	5.0828	0.14666	0.1619:0.6436:0.0:0.1945	.	577;547;639	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	V	577;547;639;440	ENSP00000359137:A577V;ENSP00000304611:A547V;ENSP00000294728:A639V;ENSP00000359133:A440V	ENSP00000294728:A639V	A	+	2	0	VCAM1	100972769	0.001000	0.12720	0.908000	0.35775	0.636000	0.38137	0.201000	0.17276	0.922000	0.37019	0.655000	0.94253	GCG	.	.	none		0.418	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
