#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFAIP3	7128	hgsc.bcm.edu	37	6	138192658	138192659	+	Splice_Site	INS	-	-	GG	rs146004919		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:138192658_138192659insGG	ENST00000237289.4	+	2	360_361	c.294_295insGG	c.(295-297)ggt>GGggt	p.G99fs		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	99	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.G99fs*2(1)|p.?(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TGAAAACGAACGGTAAGACTTG	0.495			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.N98fs	GBM(130;153 1739 22295 28918 47987)	Pindel,Atlas-Indel	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	27	Whole gene deletion(25)|Insertion - Frameshift(1)|Unknown(1)	haematopoietic_and_lymphoid_tissue(27)	c.294_295insGG						PASS	.																																			SO:0001630	splice_region_variant	7128	exon2			.	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.295+1->GG	6.37:g.138192659_138192660dupGG		46.0	0.0	.		18.0	10.0	0.556	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Frame_Shift_Ins	INS	ENST00000237289.4	37	CCDS5187.1																																																																																			.	.	none		0.495	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		Frame_Shift_Ins
KRT2	3849	hgsc.bcm.edu	37	12	53045603	53045604	+	In_Frame_Ins	INS	-	-	AAGCCGCTGCCACCTCCA	rs369691469		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:53045603_53045604insAAGCCGCTGCCACCTCCA	ENST00000309680.3	-	1	344_345	c.323_324insTGGAGGTGGCAGCGGCTT	c.(322-324)ttc>ttTGGAGGTGGCAGCGGCTTc	p.108_108F>FGGGSGF		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	108	Head.			F -> FGGGSGF (in Ref. 1; AAC83410 and 2; AAB81946). {ECO:0000305}.	epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		caccaccactgaagccgctgcc	0.629																																					p.F108delinsFGGGSGF		Atlas-Indel	.											.	KRT2	94	.	0			c.324_325insTGGAGGTGGCAGCGGCTT						PASS	.			94,555,3563		2,3,87,30,492,1492						-7.4	0.2		dbSNP_126	33	1,1614,6567		0,0,1,206,1202,2682	no	codingComplex	KRT2	NM_000423.2		2,3,88,236,1694,4174	A1A1,A1A2,A1R,A2A2,A2R,RR		19.7385,15.4084,18.2669				95,2169,10130				SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.306_323dupTGGAGGTGGCAGCGGCTT	12.37:g.53045603_53045604insAAGCCGCTGCCACCTCCA	ENSP00000310861:p.GlyGlyGlySerGlyPhe108dup	61.0	0.0	0		60.0	21.0	0.35	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	37	CCDS8835.1																																																																																			.	.	none		0.629	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
NOTCH2	4853	hgsc.bcm.edu	37	1	120529632	120529635	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	ACAA	ACAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:120529632_120529635delACAA	ENST00000256646.2	-	5	1041_1044	c.822_825delTTGT	c.(820-825)gtttgtfs	p.VC274fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	274	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCCATCCACACAAACCCCTCCAT	0.471			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.275_276del		Pindel,Atlas-Indel	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.823_826del						PASS	.																																			SO:0001589	frameshift_variant	4853	exon5	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	.	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.822_825delTTGT	1.37:g.120529632_120529635delACAA	ENSP00000256646:p.Val274fs	69.0	0.0	.		77.0	25.0	0.325	NM_024408	Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	ENST00000256646.2	37	CCDS908.1																																																																																			.	.	none		0.471	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
SLC6A14	11254	hgsc.bcm.edu	37	X	115584299	115584299	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:115584299delC	ENST00000371900.4	+	9	1365	c.1277delC	c.(1276-1278)gctfs	p.A426fs		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	426					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TCTCAGTTTGCTTCGATTGGT	0.378																																					p.A426fs		Pindel,Atlas-Indel	.											.	SLC6A14	56	.	0			c.1276delG						PASS	.						159.0	134.0	142.0					X																	115584299		2203	4300	6503	SO:0001589	frameshift_variant	11254	exon9			.	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1277delC	X.37:g.115584299delC	ENSP00000360967:p.Ala426fs	162.0	0.0	.		113.0	64.0	0.566	NM_007231	Q5H942	Frame_Shift_Del	DEL	ENST00000371900.4	37	CCDS14570.1																																																																																			.	.	none		0.378	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
NCAPD2	9918	hgsc.bcm.edu	37	12	6635472	6635473	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:6635472_6635473insC	ENST00000315579.5	+	20	3300_3301	c.2501_2502insC	c.(2500-2505)caccccfs	p.HP834fs	NCAPD2_ENST00000545962.1_Frame_Shift_Ins_p.HP789fs|NCAPD2_ENST00000542492.1_3'UTR	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	834					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GGCAAACGTCACCCCCCCTTCC	0.574																																					p.H834fs		Pindel,Atlas-Indel	.											.	NCAPD2	99	.	0			c.2501_2502insC						PASS	.																																			SO:0001589	frameshift_variant	9918	exon20			.	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2508dupC	12.37:g.6635479_6635479dupC	ENSP00000325017:p.His834fs	55.0	0.0	.		73.0	23.0	0.315	NM_014865	D3DUR4|Q8N6U3	Frame_Shift_Ins	INS	ENST00000315579.5	37	CCDS8548.1																																																																																			.	.	none		0.574	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
VEZF1	7716	hgsc.bcm.edu	37	17	56058015	56058016	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:56058015_56058016insT	ENST00000581208.1	-	4	964_965	c.924_925insA	c.(922-927)catgggfs	p.G309fs	VEZF1_ENST00000584396.1_Frame_Shift_Ins_p.G300fs	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	309					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						TGGCTCTGCCCATGAGTCTTTA	0.436																																					p.G309fs		Atlas-Indel	.											.	VEZF1	50	.	0			c.925_926insA						PASS	.																																			SO:0001589	frameshift_variant	7716	exon4			.	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.924_925insA	17.37:g.56058015_56058016insT	ENSP00000462337:p.Gly309fs	277.0	0.0	0		200.0	37.0	0.185	NM_007146		Frame_Shift_Ins	INS	ENST00000581208.1	37	CCDS32687.1																																																																																			.	.	none		0.436	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
GPR26	2849	hgsc.bcm.edu	37	10	125426000	125426002	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr10:125426000_125426002delTGC	ENST00000284674.1	+	1	130_132	c.77_79delTGC	c.(76-81)gtgctg>gtg	p.L28del		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	28					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				AACGCGCTGGTGCTGCTCTGCCT	0.709																																					p.26_26del		Pindel,Atlas-Indel	.											.	GPR26	47	.	0			c.76_78del						PASS	.																																			SO:0001651	inframe_deletion	2849	exon1			.		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.77_79delTGC	10.37:g.125426003_125426005delTGC	ENSP00000284674:p.Leu28del	81.0	0.0	.		70.0	24.0	0.343	NM_153442	Q2M2E2	In_Frame_Del	DEL	ENST00000284674.1	37	CCDS7636.1																																																																																			.	.	none		0.709	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1		
HIST1H3B	8358	hgsc.bcm.edu	37	6	26031883	26031883	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:26031883delC	ENST00000244661.2	-	1	405	c.406delG	c.(406-408)gcgfs	p.A136fs		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	136					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						TACATTTACGCTCTTTCTCCG	0.448																																					p.A136fs		Pindel,Atlas-Indel	.											HIST1H3B,NS,lymphoid_neoplasm,-1,3	HIST1H3B	59	3	0			c.407delC						PASS	.						55.0	59.0	57.0					6																	26031883		2203	4300	6503	SO:0001589	frameshift_variant	8358	exon1			.	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.406delG	6.37:g.26031883delC	ENSP00000244661:p.Ala136fs	85.0	0.0	.		95.0	35.0	0.368	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	ENST00000244661.2	37	CCDS4573.1																																																																																			.	.	none		0.448	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
TUBA3D	113457	hgsc.bcm.edu	37	2	132238015	132238015	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:132238015T>A	ENST00000321253.6	+	4	856	c.749T>A	c.(748-750)gTg>gAg	p.V250E		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	250					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		GCCCTGAATGTGGACTTGACG	0.577																																					p.V250E	Ovarian(137;2059 2432 35543 39401)	Atlas-SNP	.											.	TUBA3D	60	.	0			c.T749A						PASS	.						82.0	116.0	105.0					2																	132238015		2022	4288	6310	SO:0001583	missense	113457	exon4			TGAATGTGGACTT	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.749T>A	2.37:g.132238015T>A	ENSP00000326042:p.Val250Glu	133.0	0.0	0		140.0	62.0	0.442857	NM_080386	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000321253.6	37	CCDS33290.1	.	.	.	.	.	.	.	.	.	.	t	9.448	1.089784	0.20390	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	D	0.84944	-1.92	2.24	2.24	0.28232	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.41194	U	0.000924	D	0.93976	0.8071	H	0.98068	4.14	0.46774	D	0.999198	D	0.67145	0.996	D	0.74023	0.982	D	0.93074	0.6485	10	0.87932	D	0	.	8.0376	0.30502	0.0:0.0:0.0:1.0	.	250	Q13748	TBA3C_HUMAN	E	250	ENSP00000326042:V250E	ENSP00000326042:V250E	V	+	2	0	TUBA3D	131954485	1.000000	0.71417	0.967000	0.41034	0.146000	0.21551	6.744000	0.74854	1.023000	0.39654	0.163000	0.16589	GTG	.	.	none		0.577	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
CCDC180	100499483	hgsc.bcm.edu	37	9	100071801	100071801	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr9:100071801G>A	ENST00000357054.1	+	17	1659	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	CCDC180_ENST00000411667.2_Missense_Mutation_p.E103K|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.E103K|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000529487.1_Missense_Mutation_p.E103K|CCDC180_ENST00000395220.1_Missense_Mutation_p.E242K			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	242						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GGAGACTCCTGAAGGGGAGGT	0.587																																					p.E103K		Atlas-SNP	.											.	.	.	.	0			c.G307A						PASS	.						90.0	76.0	81.0					9																	100071801		2203	4300	6503	SO:0001583	missense	0	exon3			ACTCCTGAAGGGG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.724G>A	9.37:g.100071801G>A	ENSP00000349562:p.Glu242Lys	76.0	0.0	0		71.0	35.0	0.492958	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	G	11.03	1.520367	0.27211	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.19394	2.98;2.15;2.99;2.62;2.99	4.71	1.65	0.23941	.	0.386006	0.19087	N	0.123067	T	0.27134	0.0665	M	0.65975	2.015	0.09310	N	1	D;P;D;P	0.54207	0.965;0.884;0.965;0.884	P;P;P;P	0.58077	0.832;0.482;0.832;0.482	T	0.17992	-1.0351	10	0.07482	T	0.82	-4.6043	4.0123	0.09627	0.215:0.1986:0.5864:0.0	.	103;242;103;242	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	K	242;242;103;103;126;103	ENSP00000349562:E242K;ENSP00000378646:E242K;ENSP00000364348:E103K;ENSP00000414000:E103K;ENSP00000434727:E103K	ENSP00000349562:E242K	E	+	1	0	C9orf174	99111622	0.049000	0.20398	0.401000	0.26359	0.065000	0.16274	0.405000	0.21015	1.128000	0.42052	-0.258000	0.10820	GAA	.	.	none		0.587	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
KRT19	3880	hgsc.bcm.edu	37	17	39681516	39681516	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:39681516C>T	ENST00000361566.3	-	2	490	c.430G>A	c.(430-432)Gcc>Acc	p.A144T	KRT15_ENST00000254043.3_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	144	Coil 1B.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				TCAATGGTGGCACCAAGAATC	0.537																																					p.A144T		Atlas-SNP	.											.	KRT19	41	.	0			c.G430A						PASS	.						106.0	102.0	104.0					17																	39681516		2203	4300	6503	SO:0001583	missense	3880	exon2			TGGTGGCACCAAG		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.430G>A	17.37:g.39681516C>T	ENSP00000355124:p.Ala144Thr	75.0	0.0	0		54.0	34.0	0.62963	NM_002276	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	ENST00000361566.3	37	CCDS11399.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528656	0.85706	.	.	ENSG00000171345	ENST00000361566;ENST00000455635	D;D	0.88975	-2.45;-2.45	5.0	5.0	0.66597	Filament (1);	0.000000	0.46758	D	0.000268	D	0.92018	0.7471	L	0.54908	1.71	0.80722	D	1	D;P	0.76494	0.999;0.857	D;P	0.68943	0.961;0.732	D	0.88520	0.3095	10	0.13108	T	0.6	.	18.4827	0.90818	0.0:1.0:0.0:0.0	.	307;144	B4DE59;P08727	.;K1C19_HUMAN	T	144;113	ENSP00000355124:A144T;ENSP00000408759:A113T	ENSP00000355124:A144T	A	-	1	0	KRT19	36935042	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	4.663000	0.61532	2.599000	0.87857	0.561000	0.74099	GCC	.	.	none		0.537	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1	NM_002276	
CDH22	64405	hgsc.bcm.edu	37	20	44845551	44845551	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr20:44845551G>A	ENST00000372262.3	-	4	1152	c.752C>T	c.(751-753)gCg>gTg	p.A251V	CDH22_ENST00000537909.1_Missense_Mutation_p.A251V|CDH22_ENST00000474438.1_5'UTR	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	251	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CAGCTGACCCGCCATGTCTGT	0.637																																					p.A251V		Atlas-SNP	.											.	CDH22	112	.	0			c.C752T						PASS	.						93.0	80.0	84.0					20																	44845551		2203	4300	6503	SO:0001583	missense	64405	exon5			TGACCCGCCATGT	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.752C>T	20.37:g.44845551G>A	ENSP00000361336:p.Ala251Val	33.0	0.0	0		28.0	12.0	0.428571	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	g	18.36	3.606840	0.66558	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.59638	0.25;0.25	4.17	4.17	0.49024	Cadherin (5);Cadherin-like (1);	0.185956	0.46145	N	0.000310	T	0.62744	0.2453	M	0.80422	2.495	0.44890	D	0.997901	P	0.47962	0.903	B	0.43838	0.433	T	0.67436	-0.5671	10	0.33141	T	0.24	.	16.2392	0.82399	0.0:0.0:1.0:0.0	.	251	Q9UJ99	CAD22_HUMAN	V	251	ENSP00000361336:A251V;ENSP00000437790:A251V	ENSP00000361336:A251V	A	-	2	0	CDH22	44278958	0.996000	0.38824	0.986000	0.45419	0.995000	0.86356	2.338000	0.43957	2.379000	0.81126	0.525000	0.51046	GCG	.	.	none		0.637	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
SLC6A14	11254	hgsc.bcm.edu	37	X	115584183	115584183	+	Splice_Site	SNP	T	T	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:115584183T>A	ENST00000371900.4	+	9	1249	c.1161T>A	c.(1159-1161)ggT>ggA	p.G387G		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	387					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GTTTCGTAGGTTTTGATTTGG	0.318																																					p.G387G		Atlas-SNP	.											.	SLC6A14	56	.	0			c.T1161A						PASS	.						131.0	114.0	120.0					X																	115584183		2203	4300	6503	SO:0001630	splice_region_variant	11254	exon9			CGTAGGTTTTGAT	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1160-1T>A	X.37:g.115584183T>A		157.0	1.0	0.00636943		111.0	91.0	0.81982	NM_007231	Q5H942	Silent	SNP	ENST00000371900.4	37	CCDS14570.1																																																																																			.	.	none		0.318	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		Silent
SMAD7	4092	hgsc.bcm.edu	37	18	46448230	46448230	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr18:46448230C>T	ENST00000262158.2	-	4	1079	c.793G>A	c.(793-795)Gca>Aca	p.A265T	SMAD7_ENST00000589634.1_Missense_Mutation_p.A264T|SMAD7_ENST00000591805.1_Missense_Mutation_p.A50T|SMAD7_ENST00000585986.1_5'UTR	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	265	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					TCCCAGTATGCCACCACGCAC	0.537																																					p.A265T		Atlas-SNP	.											.	SMAD7	22	.	0			c.G793A						PASS	.						51.0	56.0	54.0					18																	46448230		2201	4299	6500	SO:0001583	missense	4092	exon4			AGTATGCCACCAC	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.793G>A	18.37:g.46448230C>T	ENSP00000262158:p.Ala265Thr	42.0	0.0	0		46.0	21.0	0.456522	NM_005904	B7Z773|K7EQ10|O14740|Q6DK23	Missense_Mutation	SNP	ENST00000262158.2	37	CCDS11936.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602452	0.87157	.	.	ENSG00000101665	ENST00000545051;ENST00000262158	D	0.98937	-5.25	5.62	5.62	0.85841	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.102280	0.64402	D	0.000002	D	0.98905	0.9629	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.91635	0.954;0.999	D	0.99900	1.1158	10	0.87932	D	0	.	17.8377	0.88704	0.0:1.0:0.0:0.0	.	265;77	O15105;B3KYA8	SMAD7_HUMAN;.	T	50;265	ENSP00000262158:A265T	ENSP00000262158:A265T	A	-	1	0	SMAD7	44702228	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.643000	0.89663	0.591000	0.81541	GCA	.	.	none		0.537	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255906.1	NM_005904	
ZNF454	285676	hgsc.bcm.edu	37	5	178391738	178391738	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:178391738G>T	ENST00000320129.3	+	5	636	c.333G>T	c.(331-333)aaG>aaT	p.K111N	ZNF454_ENST00000519564.1_Missense_Mutation_p.K111N	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		GGACAATAAAGGAAAGATTCA	0.453																																					p.K111N		Atlas-SNP	.											.	ZNF454	99	.	0			c.G333T						PASS	.						66.0	65.0	66.0					5																	178391738		2203	4300	6503	SO:0001583	missense	285676	exon5			AATAAAGGAAAGA	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.333G>T	5.37:g.178391738G>T	ENSP00000326249:p.Lys111Asn	173.0	0.0	0		160.0	151.0	0.94375	NM_001178089	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822243	0.16678	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.08008	3.14;3.14	4.94	4.08	0.47627	.	0.376195	0.19376	N	0.115794	T	0.04318	0.0119	N	0.08118	0	0.09310	N	0.999996	P	0.37781	0.608	B	0.37943	0.261	T	0.41858	-0.9485	10	0.18710	T	0.47	-13.6803	8.7625	0.34683	0.101:0.0:0.899:0.0	.	111	Q8N9F8	ZN454_HUMAN	N	111	ENSP00000326249:K111N;ENSP00000430354:K111N	ENSP00000326249:K111N	K	+	3	2	ZNF454	178324344	0.074000	0.21230	0.230000	0.23976	0.066000	0.16364	0.745000	0.26259	1.304000	0.44892	0.650000	0.86243	AAG	.	.	none		0.453	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
KRI1	65095	hgsc.bcm.edu	37	19	10671051	10671051	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:10671051T>C	ENST00000312962.6	-	9	774	c.755A>G	c.(754-756)aAc>aGc	p.N252S	KRI1_ENST00000361821.5_Missense_Mutation_p.N248S|KRI1_ENST00000537964.1_5'Flank	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	246	Glu-rich.			E -> G (in Ref. 1; BAB14357). {ECO:0000305}.		nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			ATAGCGTTTGTTGAGGATGTA	0.547																																					p.N252S		Atlas-SNP	.											.	KRI1	65	.	0			c.A755G						PASS	.						81.0	68.0	72.0					19																	10671051		2203	4300	6503	SO:0001583	missense	65095	exon9			CGTTTGTTGAGGA		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.755A>G	19.37:g.10671051T>C	ENSP00000320917:p.Asn252Ser	32.0	0.0	0		24.0	6.0	0.25	NM_023008	Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Missense_Mutation	SNP	ENST00000312962.6	37	CCDS12242.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.1|26.1	4.707279|4.707279	0.89018|0.89018	.|.	.|.	ENSG00000129347|ENSG00000129347	ENST00000312962;ENST00000361821;ENST00000541101|ENST00000543682	T;T|.	0.11712|.	2.91;2.75|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.096297|.	0.64402|.	D|.	0.000002|.	T|T	0.60418|0.60418	0.2267|0.2267	L|L	0.42686|0.42686	1.345|1.345	0.51233|0.51233	D|D	0.99991|0.99991	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.68039|.	0.955;0.955|.	T|T	0.57849|0.57849	-0.7740|-0.7740	10|5	0.26408|.	T|.	0.33|.	-68.9122|-68.9122	14.3212|14.3212	0.66487|0.66487	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	252;248|.	Q8N9T8;D3YTE0|.	KRI1_HUMAN;.|.	S|A	252;248;252|190	ENSP00000320917:N252S;ENSP00000355366:N248S|.	ENSP00000320917:N252S|.	N|T	-|-	2|1	0|0	KRI1|KRI1	10532051|10532051	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.214000|4.214000	0.58527|0.58527	2.035000|2.035000	0.60131|0.60131	0.460000|0.460000	0.39030|0.39030	AAC|ACA	.	.	none		0.547	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	NM_023008	
SUPT5H	6829	hgsc.bcm.edu	37	19	39950582	39950582	+	Silent	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:39950582C>A	ENST00000599117.1	+	11	973	c.606C>A	c.(604-606)gcC>gcA	p.A202A	SUPT5H_ENST00000359191.6_Silent_p.A198A|SUPT5H_ENST00000598725.1_Silent_p.A202A|SUPT5H_ENST00000402194.2_Silent_p.A198A|SUPT5H_ENST00000432763.2_Silent_p.A202A			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	202	Interaction with SUPT4H1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGTTCATTGCCTACCAGTTCA	0.537																																					p.A202A		Atlas-SNP	.											.	SUPT5H	119	.	0			c.C606A						PASS	.						97.0	82.0	87.0					19																	39950582		2203	4300	6503	SO:0001819	synonymous_variant	6829	exon9			CATTGCCTACCAG	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.606C>A	19.37:g.39950582C>A		52.0	0.0	0		33.0	17.0	0.515152	NM_003169	O43279|Q59G52|Q99639	Silent	SNP	ENST00000599117.1	37	CCDS12536.1																																																																																			.	.	none		0.537	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
COL4A1	1282	hgsc.bcm.edu	37	13	110831690	110831690	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr13:110831690C>T	ENST00000375820.4	-	30	2393	c.2272G>A	c.(2272-2274)Ggg>Agg	p.G758R		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	758	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCAATGCTCCCCTTCTCCCCG	0.587																																					p.G758R		Atlas-SNP	.											.	COL4A1	372	.	0			c.G2272A						PASS	.						79.0	82.0	81.0					13																	110831690		2203	4300	6503	SO:0001583	missense	1282	exon30			TGCTCCCCTTCTC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2272G>A	13.37:g.110831690C>T	ENSP00000364979:p.Gly758Arg	78.0	0.0	0		72.0	68.0	0.944444	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078077	0.76528	.	.	ENSG00000187498	ENST00000375820	D	0.99353	-5.77	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.99648	0.9870	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97434	1.0017	10	0.87932	D	0	.	18.0343	0.89294	0.0:1.0:0.0:0.0	.	758	P02462	CO4A1_HUMAN	R	758	ENSP00000364979:G758R	ENSP00000364979:G758R	G	-	1	0	COL4A1	109629691	1.000000	0.71417	0.986000	0.45419	0.351000	0.29236	6.933000	0.75874	2.328000	0.79073	0.655000	0.94253	GGG	.	.	none		0.587	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
TYRO3	7301	hgsc.bcm.edu	37	15	41859646	41859646	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr15:41859646C>T	ENST00000263798.3	+	7	1096	c.872C>T	c.(871-873)gCc>gTc	p.A291V	TYRO3_ENST00000559066.1_Missense_Mutation_p.A246V	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	291	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTGGTGCCTGCCACCAACTAC	0.622																																					p.A291V		Atlas-SNP	.											.	TYRO3	169	.	0			c.C872T						PASS	.						95.0	97.0	97.0					15																	41859646		2203	4300	6503	SO:0001583	missense	7301	exon7			TGCCTGCCACCAA	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.872C>T	15.37:g.41859646C>T	ENSP00000263798:p.Ala291Val	65.0	0.0	0		70.0	34.0	0.485714	NM_006293	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864830	0.51482	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.57595	0.39	4.64	4.64	0.57946	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42294	D	0.000740	T	0.41396	0.1157	L	0.29908	0.895	0.33717	D	0.616478	P	0.46578	0.88	B	0.42462	0.388	T	0.50608	-0.8808	10	0.18710	T	0.47	-16.5648	14.5246	0.67878	0.0:1.0:0.0:0.0	.	291	Q06418	TYRO3_HUMAN	V	223;291	ENSP00000263798:A291V	ENSP00000263798:A291V	A	+	2	0	TYRO3	39646938	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.491000	0.45303	2.417000	0.82017	0.655000	0.94253	GCC	.	.	none		0.622	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
GHSR	2693	hgsc.bcm.edu	37	3	172163205	172163205	+	Nonsense_Mutation	SNP	G	G	A	rs148371213		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr3:172163205G>A	ENST00000241256.2	-	2	889	c.847C>T	c.(847-849)Cga>Tga	p.R283*		NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	283					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AATAAATATCGCCCTACGTGG	0.488																																					p.R283X	Esophageal Squamous(93;641 1401 20883 29581 34638)	Atlas-SNP	.											.	GHSR	104	.	0			c.C847T						PASS	.	G	stop/ARG	0,4406		0,0,2203	63.0	64.0	64.0		847	3.8	0.9	3	dbSNP_134	64	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	GHSR	NM_198407.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		283/367	172163205	2,13004	2203	4300	6503	SO:0001587	stop_gained	2693	exon2			AATATCGCCCTAC	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.847C>T	3.37:g.172163205G>A	ENSP00000241256:p.Arg283*	85.0	0.0	0		84.0	41.0	0.488095	NM_198407	Q14D12|Q6ISR8|Q92848|Q96RJ7	Nonsense_Mutation	SNP	ENST00000241256.2	37	CCDS3218.1	.	.	.	.	.	.	.	.	.	.	G	33	5.290630	0.95546	0.0	2.33E-4	ENSG00000121853	ENST00000241256	.	.	.	5.64	3.76	0.43208	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2887	14.1574	0.65426	0.0:0.0:0.6792:0.3208	.	.	.	.	X	283	.	ENSP00000241256:R283X	R	-	1	2	GHSR	173645899	1.000000	0.71417	0.886000	0.34754	0.789000	0.44602	3.165000	0.50778	0.843000	0.35070	0.650000	0.86243	CGA	G|1.000;A|0.000	0.000	weak		0.488	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122	
PXDN	7837	hgsc.bcm.edu	37	2	1680761	1680761	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:1680761G>A	ENST00000252804.4	-	8	836	c.786C>T	c.(784-786)acC>acT	p.T262T	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	262	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGAAGTACACGGTGTTCCCCG	0.547																																					p.T262T		Atlas-SNP	.											.	PXDN	255	.	0			c.C786T						PASS	.						65.0	73.0	70.0					2																	1680761		1993	4173	6166	SO:0001819	synonymous_variant	7837	exon8			GTACACGGTGTTC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.786C>T	2.37:g.1680761G>A		176.0	0.0	0		160.0	71.0	0.44375	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.453|3.453	-0.111536|-0.111536	0.06881|0.06881	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000433670|ENST00000447941	.|.	.|.	.|.	4.77|4.77	-9.54|-9.54	0.00572|0.00572	.|.	.|.	.|.	.|.	.|.	T|T	0.30947|0.30947	0.0781|0.0781	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39418|0.39418	-0.9615|-0.9615	4|4	.|.	.|.	.|.	-26.0331|-26.0331	0.3493|0.3493	0.00346|0.00346	0.3348:0.2419:0.1617:0.2616|0.3348:0.2419:0.1617:0.2616	.|.	.|.	.|.	.|.	L|C	258|186	.|.	.|.	P|R	-|-	2|1	0|0	PXDN|PXDN	1659768|1659768	0.000000|0.000000	0.05858|0.05858	0.500000|0.500000	0.27589|0.27589	0.539000|0.539000	0.34962|0.34962	-3.664000|-3.664000	0.00399|0.00399	-2.386000|-2.386000	0.00590|0.00590	-1.553000|-1.553000	0.00894|0.00894	CCG|CGT	.	.	none		0.547	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
CARD11	84433	hgsc.bcm.edu	37	7	2987283	2987283	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr7:2987283C>T	ENST00000396946.4	-	3	549	c.146G>A	c.(145-147)tGt>tAt	p.C49Y	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	49	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.C42Y(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AATGACCTTACACTGACGCAG	0.527			Mis		DLBCL																																p.C49Y		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	CARD11,colon,carcinoma,+1,2	CARD11	339	2	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G146A						scavenged	.						281.0	212.0	236.0					7																	2987283		2203	4300	6503	SO:0001583	missense	84433	exon3			ACCTTACACTGAC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.146G>A	7.37:g.2987283C>T	ENSP00000380150:p.Cys49Tyr	200.0	1.0	0.005		227.0	54.0	0.237885	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807258	0.90623	.	.	ENSG00000198286	ENST00000396946;ENST00000356408	T;T	0.21031	2.03;2.03	5.31	5.31	0.75309	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.85682	D	0.000000	T	0.50633	0.1627	M	0.80183	2.485	0.80722	D	1	D	0.65815	0.995	D	0.69654	0.965	T	0.55704	-0.8099	10	0.87932	D	0	-43.4909	19.0497	0.93038	0.0:1.0:0.0:0.0	.	49	Q9BXL7	CAR11_HUMAN	Y	49	ENSP00000380150:C49Y;ENSP00000348779:C49Y	ENSP00000348779:C49Y	C	-	2	0	CARD11	2953809	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.267000	0.78462	2.516000	0.84829	0.556000	0.70494	TGT	.	.	none		0.527	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
NRD1	4898	hgsc.bcm.edu	37	1	52306079	52306079	+	Missense_Mutation	SNP	T	T	A	rs62648104		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:52306079T>A	ENST00000354831.7	-	2	638	c.449A>T	c.(448-450)gAg>gTg	p.E150V	NRD1_ENST00000352171.7_Missense_Mutation_p.E150V|NRD1_ENST00000539524.1_Missense_Mutation_p.E18V|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_Missense_Mutation_p.E18V	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ttcttcttcctccacctcctc	0.378																																					p.E150V		Atlas-SNP	.											.	NRD1	89	.	0			c.A449T						PASS	.						163.0	138.0	146.0					1																	52306079		2203	4300	6503	SO:0001583	missense	4898	exon2			TCTTCCTCCACCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.449A>T	1.37:g.52306079T>A	ENSP00000346890:p.Glu150Val	346.0	0.0	0		414.0	40.0	0.0966184	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.056	-0.194350	0.06259	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.38240	1.31;3.15;1.15;1.22	5.25	2.92	0.33932	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.525899	0.19688	N	0.108344	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23650	0.062;0.089;0.01	B;B;B	0.17098	0.017;0.007;0.007	T	0.14755	-1.0461	10	0.38643	T	0.18	-0.0317	5.1939	0.15225	0.0:0.1704:0.2022:0.6274	rs62648104	150;150;150	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	V	150;150;18;150;18	ENSP00000262679:E150V;ENSP00000346890:E150V;ENSP00000444416:E18V;ENSP00000442262:E18V	ENSP00000262679:E150V	E	-	2	0	NRD1	52078667	0.129000	0.22400	0.012000	0.15200	0.145000	0.21501	0.870000	0.28010	0.317000	0.23160	0.454000	0.30748	GAG	T|0.024;A|0.976	0.976	weak		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
SSTR1	6751	hgsc.bcm.edu	37	14	38679760	38679760	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr14:38679760C>T	ENST00000267377.2	+	3	1783	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M		NM_001049.2	NP_001040.1	P30872	SSR1_HUMAN	somatostatin receptor 1	389					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glutamate receptor signaling pathway (GO:0007215)|negative regulation of cell proliferation (GO:0008285)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)|Pasireotide(DB06663)	TCCCGGATCACGACGCTCTGA	0.657																																					p.T389M		Atlas-SNP	.											.	SSTR1	66	.	0			c.C1166T						PASS	.						20.0	21.0	20.0					14																	38679760		2201	4299	6500	SO:0001583	missense	6751	exon3			GGATCACGACGCT		CCDS9666.1	14q13	2012-08-08			ENSG00000139874	ENSG00000139874		"""GPCR / Class A : Somatostatin receptors"""	11330	protein-coding gene	gene with protein product		182451				8449518	Standard	NM_001049		Approved		uc001wul.1	P30872	OTTHUMG00000140249	ENST00000267377.2:c.1166C>T	14.37:g.38679760C>T	ENSP00000267377:p.Thr389Met	37.0	0.0	0		42.0	13.0	0.309524	NM_001049		Missense_Mutation	SNP	ENST00000267377.2	37	CCDS9666.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402583	0.42613	.	.	ENSG00000139874	ENST00000267377	T	0.71341	-0.56	4.97	3.01	0.34805	.	0.297808	0.23327	N	0.049396	T	0.53867	0.1823	N	0.22421	0.69	0.35543	D	0.803255	P	0.50066	0.931	B	0.37422	0.249	T	0.69510	-0.5126	10	0.87932	D	0	.	13.6077	0.62056	0.0:0.6722:0.3278:0.0	.	389	P30872	SSR1_HUMAN	M	389	ENSP00000267377:T389M	ENSP00000267377:T389M	T	+	2	0	SSTR1	37749511	0.997000	0.39634	0.873000	0.34254	0.617000	0.37484	3.465000	0.53064	1.290000	0.44636	0.561000	0.74099	ACG	.	.	none		0.657	SSTR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409930.2		
KLF2	10365	hgsc.bcm.edu	37	19	16436026	16436026	+	Splice_Site	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:16436026G>A	ENST00000248071.5	+	2	182		c.e2-1		KLF2_ENST00000592003.1_Intron|CTD-2562J15.6_ENST00000588799.1_RNA	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2						cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						GTCGCCCGCAGCGCTGGCCGC	0.721																																					.		Atlas-SNP	.											.	KLF2	10	.	0			c.76-1G>A						PASS	.						2.0	2.0	2.0					19																	16436026		1274	2633	3907	SO:0001630	splice_region_variant	10365	exon2			CCCGCAGCGCTGG	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.76-1G>A	19.37:g.16436026G>A		83.0	0.0	0		70.0	28.0	0.4	NM_016270	Q6IPC4|Q9UJS5|Q9UKR6	Splice_Site	SNP	ENST00000248071.5	37	CCDS12343.1	.	.	.	.	.	.	.	.	.	.	G	1.494	-0.553859	0.03996	.	.	ENSG00000127528	ENST00000248071	.	.	.	2.41	1.33	0.21861	.	.	.	.	.	.	.	.	.	.	.	0.19575	N	0.999965	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5609	0.27851	0.0:0.0:0.745:0.255	.	.	.	.	.	-1	.	.	.	+	.	.	KLF2	16297026	1.000000	0.71417	0.983000	0.44433	0.017000	0.09413	3.047000	0.49854	0.231000	0.21079	-1.767000	0.00664	.	.	.	none		0.721	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460562.1		Intron
GABBR1	2550	hgsc.bcm.edu	37	6	29578720	29578720	+	Silent	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:29578720G>T	ENST00000377034.4	-	14	2024	c.1689C>A	c.(1687-1689)tcC>tcA	p.S563S	GABBR1_ENST00000377012.4_Silent_p.S446S|GABBR1_ENST00000377016.4_Silent_p.S501S|GABBR1_ENST00000355973.3_Silent_p.S446S|GABBR1_ENST00000376977.3_Silent_p.S563S	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	563					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TATCTGTTTTGGACCAGGAAA	0.458																																					p.S563S		Atlas-SNP	.											.	GABBR1	95	.	0			c.C1689A						PASS	.						190.0	151.0	165.0					6																	29578720		1511	2709	4220	SO:0001819	synonymous_variant	2550	exon14			TGTTTTGGACCAG	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1689C>A	6.37:g.29578720G>T		90.0	0.0	0		84.0	11.0	0.130952	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1																																																																																			.	.	none		0.458	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
C19orf80	55908	hgsc.bcm.edu	37	19	11350375	11350375	+	Missense_Mutation	SNP	C	C	T	rs368909299		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:11350375C>T	ENST00000252453.8	+	1	81	c.62C>T	c.(61-63)gCg>gTg	p.A21V	C19orf80_ENST00000591200.1_Intron|DOCK6_ENST00000294618.7_Intron|DOCK6_ENST00000319867.7_5'Flank	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	21					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						CCTGCCTCAGCGGCCCCCATG	0.642																																					p.A21V		Atlas-SNP	.											.	C19orf80	8	.	0			c.C62T						PASS	.	C	,VAL/ALA	0,3976		0,0,1988	26.0	28.0	28.0		,62	-1.0	0.0	19		28	1,8303		0,1,4151	no	intron,missense	C19orf80,DOCK6	NM_020812.2,NM_018687.6	,64	0,1,6139	TT,TC,CC		0.012,0.0,0.0081	,benign	,21/199	11350375	1,12279	1988	4152	6140	SO:0001583	missense	55908	exon1			CCTCAGCGGCCCC		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.62C>T	19.37:g.11350375C>T	ENSP00000252453:p.Ala21Val	108.0	0.0	0		81.0	25.0	0.308642	NM_018687	Q9NQZ1	Missense_Mutation	SNP	ENST00000252453.8	37	CCDS54220.1	.	.	.	.	.	.	.	.	.	.	C	7.645	0.681793	0.14907	0.0	1.2E-4	ENSG00000130173	ENST00000252453	T	0.29917	1.55	3.95	-0.984	0.10259	.	1.345480	0.05125	N	0.491383	T	0.08758	0.0217	N	0.01576	-0.805	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.25813	-1.0121	10	0.02654	T	1	-25.4118	3.7785	0.08671	0.1661:0.3986:0.0:0.4353	.	21	Q6UXH0	TD26_HUMAN	V	21	ENSP00000252453:A21V	ENSP00000252453:A21V	A	+	2	0	C19orf80	11211375	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.032000	0.13732	-0.346000	0.08312	-0.657000	0.03884	GCG	.	.	weak		0.642	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
CEP104	9731	hgsc.bcm.edu	37	1	3742332	3742332	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:3742332T>C	ENST00000378230.3	-	18	2678	c.2354A>G	c.(2353-2355)cAc>cGc	p.H785R		NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	785						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CTGTTTGCAGTGGTCACATCT	0.507																																					p.H785R		Atlas-SNP	.											.	CEP104	79	.	0			c.A2354G						PASS	.						117.0	102.0	107.0					1																	3742332		2203	4300	6503	SO:0001583	missense	9731	exon18			TTGCAGTGGTCAC	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.2354A>G	1.37:g.3742332T>C	ENSP00000367476:p.His785Arg	90.0	0.0	0		57.0	26.0	0.45614	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.82|13.82	2.352613|2.352613	0.41700|0.41700	.|.	.|.	ENSG00000116198|ENSG00000116198	ENST00000378230|ENST00000438539	T|.	0.31247|.	1.5|.	4.84|4.84	2.5|2.5	0.30297|0.30297	.|.	0.537894|.	0.19901|.	N|.	0.103507|.	T|T	0.63534|0.63534	0.2519|0.2519	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	P|.	0.46220|.	0.874|.	P|.	0.45712|.	0.491|.	T|T	0.58261|0.58261	-0.7667|-0.7667	10|5	0.45353|.	T|.	0.12|.	.|.	8.4447|8.4447	0.32834|0.32834	0.0:0.1613:0.0:0.8387|0.0:0.1613:0.0:0.8387	.|.	785|.	O60308|.	CE104_HUMAN|.	R|A	785|82	ENSP00000367476:H785R|.	ENSP00000367476:H785R|.	H|T	-|-	2|1	0|0	CEP104|CEP104	3732192|3732192	1.000000|1.000000	0.71417|0.71417	0.385000|0.385000	0.26158|0.26158	0.725000|0.725000	0.41563|0.41563	3.962000|3.962000	0.56766|0.56766	0.225000|0.225000	0.20959|0.20959	0.533000|0.533000	0.62120|0.62120	CAC|ACT	.	.	none		0.507	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
ID3	3399	hgsc.bcm.edu	37	1	23885712	23885712	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:23885712A>G	ENST00000374561.5	-	1	573	c.206T>C	c.(205-207)aTc>aCc	p.I69T	ID3_ENST00000486541.1_5'UTR	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein	69	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GCGCTGTAGGATTTCCACCTG	0.627																																					p.I69T		Atlas-SNP	.											.	ID3	29	.	0			c.T206C						PASS	.						59.0	64.0	62.0					1																	23885712		2203	4300	6503	SO:0001583	missense	3399	exon1			TGTAGGATTTCCA	X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.206T>C	1.37:g.23885712A>G	ENSP00000363689:p.Ile69Thr	130.0	0.0	0		112.0	61.0	0.544643	NM_002167	A8K1T8|O75641	Missense_Mutation	SNP	ENST00000374561.5	37	CCDS237.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.401635	0.83120	.	.	ENSG00000117318	ENST00000374561	D	0.98633	-5.04	5.6	5.6	0.85130	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98707	0.9566	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99886	1.1123	10	0.87932	D	0	-20.0651	14.6048	0.68469	1.0:0.0:0.0:0.0	.	69	Q02535	ID3_HUMAN	T	69	ENSP00000363689:I69T	ENSP00000363689:I69T	I	-	2	0	ID3	23758299	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.126000	0.65437	0.482000	0.46254	ATC	.	.	none		0.627	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008904.1	NM_002167	
DAB1	1600	hgsc.bcm.edu	37	1	57481087	57481087	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:57481087C>T	ENST00000371231.1	-	13	1046	c.1012G>A	c.(1012-1014)Gct>Act	p.A338T	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.A305T|DAB1_ENST00000439789.2_Missense_Mutation_p.A219T|DAB1_ENST00000420954.2_Missense_Mutation_p.A303T|DAB1_ENST00000371236.2_Missense_Mutation_p.A305T|DAB1_ENST00000414851.2_Missense_Mutation_p.A287T			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	338					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGGAGGACAGCGCCCATTGCA	0.577																																					p.A305T		Atlas-SNP	.											.	DAB1	129	.	0			c.G913A						PASS	.						24.0	27.0	26.0					1																	57481087		2199	4292	6491	SO:0001583	missense	1600	exon14			GGACAGCGCCCAT	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1012G>A	1.37:g.57481087C>T	ENSP00000360275:p.Ala338Thr	73.0	0.0	0		59.0	5.0	0.0847458	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		.	.	.	.	.	.	.	.	.	.	C	13.22	2.173250	0.38413	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231;ENST00000371232	T;T;T;T;T;T;T	0.54675	0.63;0.63;0.78;0.66;1.79;0.76;0.56	5.54	3.7	0.42460	.	0.145096	0.64402	N	0.000008	T	0.29783	0.0744	N	0.14661	0.345	0.58432	D	0.999996	P;B;B;B;P	0.42078	0.77;0.005;0.014;0.014;0.77	B;B;B;B;B	0.32149	0.141;0.052;0.015;0.008;0.141	T	0.05989	-1.0852	10	0.30078	T	0.28	-23.0659	12.5109	0.56005	0.0:0.8654:0.0:0.1346	.	287;338;305;219;303	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	T	305;305;305;303;287;219;338;219	ENSP00000360280:A305T;ENSP00000360278:A305T;ENSP00000395296:A303T;ENSP00000387581:A287T;ENSP00000409328:A219T;ENSP00000360275:A338T;ENSP00000360276:A219T	ENSP00000360275:A338T	A	-	1	0	DAB1	57253675	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.349000	0.44054	0.915000	0.36847	-0.133000	0.14855	GCT	.	.	none		0.577	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
MUC21	394263	hgsc.bcm.edu	37	6	30954870	30954870	+	Silent	SNP	T	T	C	rs9262377		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:30954870T>C	ENST00000376296.3	+	2	1159	c.918T>C	c.(916-918)agT>agC	p.S306S	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	306	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTGAGTCCAGTACGACCTCCA	0.597																																					p.S306S		Atlas-SNP	.											MUC21,rectum,carcinoma,0,1	MUC21	98	1	0			c.T918C						scavenged	.						171.0	164.0	167.0					6																	30954870		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			GTCCAGTACGACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.918T>C	6.37:g.30954870T>C		30.0	1.0	0.0333333		45.0	5.0	0.111111	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			.	.	weak		0.597	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
SLC19A3	80704	hgsc.bcm.edu	37	2	228564154	228564154	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:228564154T>G	ENST00000258403.3	-	3	348	c.277A>C	c.(277-279)Acc>Ccc	p.T93P	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.T89P	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	93					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	AGCAGCCAGGTAATGATGAAA	0.522																																					p.T93P		Atlas-SNP	.											.	SLC19A3	62	.	0			c.A277C						PASS	.						154.0	153.0	153.0					2																	228564154		2203	4300	6503	SO:0001583	missense	80704	exon3			GCCAGGTAATGAT	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.277A>C	2.37:g.228564154T>G	ENSP00000258403:p.Thr93Pro	97.0	0.0	0		101.0	44.0	0.435644	NM_025243		Missense_Mutation	SNP	ENST00000258403.3	37	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678458	0.68042	.	.	ENSG00000135917	ENST00000258403;ENST00000541617;ENST00000456524	T;T;T	0.80909	-1.43;-1.43;0.3	5.91	2.01	0.26516	Major facilitator superfamily domain, general substrate transporter (1);	0.282882	0.44483	D	0.000455	D	0.89553	0.6748	M	0.89904	3.07	0.42819	D	0.99398	P;D	0.64830	0.915;0.994	P;D	0.69142	0.812;0.962	D	0.88648	0.3180	10	0.56958	D	0.05	-16.2265	11.0935	0.48130	0.4754:0.0:0.0:0.5246	.	89;93	F5H2M8;Q9BZV2	.;S19A3_HUMAN	P	93;89;93	ENSP00000258403:T93P;ENSP00000445519:T89P;ENSP00000399001:T93P	ENSP00000258403:T93P	T	-	1	0	SLC19A3	228272398	0.421000	0.25465	0.038000	0.18304	0.965000	0.64279	2.170000	0.42443	0.088000	0.17205	0.533000	0.62120	ACC	.	.	none		0.522	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
DOCK7	85440	hgsc.bcm.edu	37	1	62962115	62962115	+	Silent	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:62962115G>T	ENST00000340370.5	-	37	4742	c.4725C>A	c.(4723-4725)ggC>ggA	p.G1575G	DOCK7_ENST00000251157.5_Silent_p.G1597G	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1606					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TCTGAGATGTGCCCACCAAGG	0.358																																					p.G1597G		Atlas-SNP	.											.	DOCK7	184	.	0			c.C4791A						PASS	.						85.0	84.0	85.0					1																	62962115		2203	4300	6503	SO:0001819	synonymous_variant	85440	exon38			AGATGTGCCCACC		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4725C>A	1.37:g.62962115G>T		247.0	1.0	0.00404858		248.0	105.0	0.423387	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	G	9.022	0.985117	0.18889	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.97	0.57	0.17347	.	.	.	.	.	T	0.43255	0.1239	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22243	-1.0222	4	.	.	.	.	2.6339	0.04952	0.2263:0.3704:0.296:0.1073	.	.	.	.	N	769	.	.	H	-	1	0	DOCK7	62734703	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	0.554000	0.23407	0.111000	0.17947	0.585000	0.79938	CAC	.	.	none		0.358	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
MT-ND5	4540	hgsc.bcm.edu	37	M	13531	13531	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrM:13531G>A	ENST00000361567.2	+	1	1195	c.1195G>A	c.(1195-1197)Gca>Aca	p.A399T	MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	399					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCATCGAAACCGCAAACATAT	0.468																																					p.A399T		Atlas-SNP	.											.	.	.	.	0			c.G1195A						PASS	.																																			SO:0001583	missense	0	exon1			GAAACCGCAAACA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1195G>A	M.37:g.13531G>A	ENSP00000354813:p.Ala399Thr	21.0	0.0	0		14.0	12.0	0.857143	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																				.	.	none		0.468	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	15873	15873	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrM:15873T>C	ENST00000361789.2	+	1	1127	c.1127T>C	c.(1126-1128)aTa>aCa	p.I376T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	376					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TGAAAACAAAATACTCAAATG	0.368																																					p.M376T		Atlas-SNP	.											.	.	.	.	0			c.T1127C						PASS	.																																			SO:0001583	missense	0	exon1			ACAAAATACTCAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.1127T>C	M.37:g.15873T>C	ENSP00000354554:p.Ile376Thr	19.0	0.0	0		22.0	14.0	0.636364	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																				.	.	none		0.368	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SLC29A2	3177	hgsc.bcm.edu	37	11	66133453	66133453	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:66133453T>C	ENST00000357440.2	-	10	1241	c.1013A>G	c.(1012-1014)aAc>aGc	p.N338S	SLC29A2_ENST00000311161.7_Silent_p.Q293Q|SLC29A2_ENST00000546034.1_Missense_Mutation_p.N338S|SLC29A2_ENST00000544554.1_Missense_Mutation_p.N338S	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	338					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GTCCATGATGTTGAAGAGGAG	0.572																																					p.N338S		Atlas-SNP	.											.	SLC29A2	24	.	0			c.A1013G						PASS	.						107.0	101.0	103.0					11																	66133453		2200	4295	6495	SO:0001583	missense	3177	exon10			ATGATGTTGAAGA	X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.1013A>G	11.37:g.66133453T>C	ENSP00000350024:p.Asn338Ser	89.0	0.0	0		58.0	23.0	0.396552	NM_001532	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Missense_Mutation	SNP	ENST00000357440.2	37	CCDS8137.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.803190	0.90623	.	.	ENSG00000174669	ENST00000357440;ENST00000544554;ENST00000546034	T;T;T	0.80738	-1.41;-1.41;-1.41	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.88485	0.6449	M	0.72118	2.19	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.89435	0.3719	10	0.66056	D	0.02	-24.3104	13.6825	0.62493	0.0:0.0:0.0:1.0	.	338	Q14542	S29A2_HUMAN	S	338	ENSP00000350024:N338S;ENSP00000439456:N338S;ENSP00000440329:N338S	ENSP00000350024:N338S	N	-	2	0	SLC29A2	65890029	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	6.135000	0.71696	2.123000	0.65237	0.529000	0.55759	AAC	.	.	none		0.572	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402093.1	NM_001532	
TMEM132C	92293	hgsc.bcm.edu	37	12	129189698	129189698	+	Missense_Mutation	SNP	G	G	A	rs116496800	byFrequency	TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:129189698G>A	ENST00000435159.2	+	9	2185	c.2185G>A	c.(2185-2187)Gac>Aac	p.D729N	TMEM132C_ENST00000315208.8_Missense_Mutation_p.D345N|TMEM132C_ENST00000537538.1_Missense_Mutation_p.D114N	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	729						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GGACATCTACGACACCAAGGA	0.637													G|||	18	0.00359425	0.0129	0.0	5008	,	,		17133	0.0		0.0	False		,,,				2504	0.001				p.D729N		Atlas-SNP	.											.	TMEM132C	142	.	0			c.G2185A						PASS	.	G	ASN/ASP	8,1376		0,8,684	57.0	58.0	57.0		2185	4.8	1.0	12	dbSNP_132	57	0,3182		0,0,1591	yes	missense	TMEM132C	NM_001136103.2	23	0,8,2275	AA,AG,GG		0.0,0.578,0.1752	probably-damaging	729/1109	129189698	8,4558	692	1591	2283	SO:0001583	missense	92293	exon9			ATCTACGACACCA	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2185G>A	12.37:g.129189698G>A	ENSP00000410852:p.Asp729Asn	59.0	0.0	0		55.0	25.0	0.454545	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	19.72	3.880080	0.72294	0.00578	0.0	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.15718	2.4;2.4;2.4	4.84	4.84	0.62591	.	0.000000	0.64402	D	0.000011	T	0.33177	0.0854	M	0.69185	2.1	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.10965	-1.0607	10	0.40728	T	0.16	.	17.9558	0.89068	0.0:0.0:1.0:0.0	.	729	Q8N3T6	T132C_HUMAN	N	729;345;114	ENSP00000410852:D729N;ENSP00000324458:D345N;ENSP00000438477:D114N	ENSP00000324458:D345N	D	+	1	0	TMEM132C	127755651	1.000000	0.71417	0.956000	0.39512	0.932000	0.56968	5.082000	0.64450	2.230000	0.72887	0.655000	0.94253	GAC	G|0.997;A|0.003	0.003	strong		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
EPHA2	1969	hgsc.bcm.edu	37	1	16475116	16475116	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:16475116C>T	ENST00000358432.5	-	3	734	c.580G>A	c.(580-582)Gtc>Atc	p.V194I	EPHA2_ENST00000461614.1_5'UTR	NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	194	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Mediates interaction with CLDN4.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	TAGACACGGACGGAGAGCAGC	0.647																																					p.V194I		Atlas-SNP	.											.	EPHA2	102	.	0			c.G580A						PASS	.						63.0	61.0	62.0					1																	16475116		2203	4300	6503	SO:0001583	missense	1969	exon3			CACGGACGGAGAG	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.580G>A	1.37:g.16475116C>T	ENSP00000351209:p.Val194Ile	30.0	0.0	0		41.0	21.0	0.512195	NM_004431	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193575	0.58017	.	.	ENSG00000142627	ENST00000358432	T	0.05513	3.43	5.14	5.14	0.70334	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.49305	D	0.000150	T	0.14013	0.0339	M	0.68317	2.08	0.58432	D	0.999996	P;P	0.41978	0.767;0.674	P;B	0.44946	0.465;0.353	T	0.00423	-1.1748	10	0.87932	D	0	.	16.0881	0.81073	0.0:1.0:0.0:0.0	.	194;194	B5A968;P29317	.;EPHA2_HUMAN	I	194	ENSP00000351209:V194I	ENSP00000351209:V194I	V	-	1	0	EPHA2	16347703	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	6.023000	0.70848	2.393000	0.81446	0.561000	0.74099	GTC	.	.	none		0.647	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
EML1	2009	hgsc.bcm.edu	37	14	100402447	100402447	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr14:100402447G>A	ENST00000262233.6	+	18	2130	c.1991G>A	c.(1990-1992)cGa>cAa	p.R664Q	EML1_ENST00000327921.9_Missense_Mutation_p.R652Q|EML1_ENST00000334192.4_Missense_Mutation_p.R683Q	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	664	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				AAGTACACGCGAGTGGGCAAG	0.463																																					p.R683Q		Atlas-SNP	.											.	EML1	97	.	0			c.G2048A						PASS	.						103.0	100.0	101.0					14																	100402447		2203	4300	6503	SO:0001583	missense	2009	exon19			ACACGCGAGTGGG	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.1991G>A	14.37:g.100402447G>A	ENSP00000262233:p.Arg664Gln	136.0	0.0	0		134.0	61.0	0.455224	NM_001008707	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	37	CCDS32155.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274587	0.59649	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.39406	1.08;1.08;1.08	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69124	0.3076	M	0.92317	3.295	0.51767	D	0.999939	D;P;D	0.71674	0.998;0.94;0.979	P;P;P	0.57244	0.816;0.507;0.487	T	0.78881	-0.2029	10	0.87932	D	0	-16.2349	17.709	0.88316	0.0:0.0:1.0:0.0	.	652;664;683	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	Q	652;664;683;683	ENSP00000327384:R652Q;ENSP00000262233:R664Q;ENSP00000334314:R683Q	ENSP00000262233:R664Q	R	+	2	0	EML1	99472200	0.997000	0.39634	0.071000	0.20095	0.038000	0.13279	7.691000	0.84191	2.429000	0.82318	0.561000	0.74099	CGA	.	.	none		0.463	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	NM_001008707	
HVCN1	84329	hgsc.bcm.edu	37	12	111089042	111089042	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:111089042C>T	ENST00000356742.5	-	5	1376	c.623G>A	c.(622-624)cGg>cAg	p.R208Q	HVCN1_ENST00000242607.8_Missense_Mutation_p.R208Q|HVCN1_ENST00000548312.1_Missense_Mutation_p.R208Q|HVCN1_ENST00000439744.2_Missense_Mutation_p.R188Q			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	208					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						CCGGGCCACCCGCCACAGCCG	0.607																																					p.R208Q		Atlas-SNP	.											HVCN1,caecum,carcinoma,-1,2	HVCN1	38	2	0			c.G623A						PASS	.						64.0	54.0	57.0					12																	111089042		2203	4300	6503	SO:0001583	missense	84329	exon6			GCCACCCGCCACA	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.623G>A	12.37:g.111089042C>T	ENSP00000349181:p.Arg208Gln	71.0	0.0	0		87.0	35.0	0.402299	NM_032369	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	37	CCDS31900.1	.	.	.	.	.	.	.	.	.	.	c	37	6.074823	0.97262	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000439744	D;D;D;D	0.98777	-5.13;-5.13;-5.13;-5.13	5.61	5.61	0.85477	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99435	0.9800	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.98591	1.0654	10	0.87932	D	0	-30.045	19.6266	0.95679	0.0:1.0:0.0:0.0	.	208;208	Q96D96;Q96D96-3	HVCN1_HUMAN;.	Q	208;208;208;188	ENSP00000449601:R208Q;ENSP00000242607:R208Q;ENSP00000349181:R208Q;ENSP00000412052:R188Q	ENSP00000242607:R208Q	R	-	2	0	HVCN1	109573425	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.792000	0.85828	2.648000	0.89879	0.556000	0.70494	CGG	.	.	none		0.607	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	NM_032369	
COL4A3	1285	hgsc.bcm.edu	37	2	228125811	228125811	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:228125811C>T	ENST00000396578.3	+	20	1290	c.1128C>T	c.(1126-1128)ccC>ccT	p.P376P	AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	376	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CCAGTGGTCCCCCCGGAGTTC	0.383																																					p.P376P		Atlas-SNP	.											.	COL4A3	293	.	0			c.C1128T						PASS	.						76.0	77.0	77.0					2																	228125811		1809	4076	5885	SO:0001819	synonymous_variant	1285	exon20			TGGTCCCCCCGGA		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.1128C>T	2.37:g.228125811C>T		81.0	0.0	0		72.0	31.0	0.430556	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	ENST00000396578.3	37	CCDS42829.1																																																																																			.	.	none		0.383	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
ABCC11	85320	hgsc.bcm.edu	37	16	48209258	48209258	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr16:48209258G>A	ENST00000394747.1	-	25	3958	c.3609C>T	c.(3607-3609)ggC>ggT	p.G1203G	ABCC11_ENST00000394748.1_Silent_p.G1203G|ABCC11_ENST00000356608.2_Silent_p.G1203G|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000353782.5_Silent_p.G1203G	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1203	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AAATGTCCACGCCGTCAATGA	0.607																																					p.G1203G		Atlas-SNP	.											ABCC11,right_upper_lobe,carcinoma,-2,1	ABCC11	177	1	0			c.C3609T						scavenged	.						72.0	60.0	64.0					16																	48209258		2201	4300	6501	SO:0001819	synonymous_variant	85320	exon25			GTCCACGCCGTCA	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3609C>T	16.37:g.48209258G>A		77.0	1.0	0.012987		95.0	45.0	0.473684	NM_033151	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1																																																																																			.	.	none		0.607	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
ZIC1	7545	hgsc.bcm.edu	37	3	147128137	147128137	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr3:147128137C>A	ENST00000282928.4	+	1	967	c.238C>A	c.(238-240)Cac>Aac	p.H80N		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	80	Poly-His.				adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CCTGGGCCATCACCATCACCC	0.687																																					p.H80N		Atlas-SNP	.											.	ZIC1	141	.	0			c.C238A						PASS	.						13.0	16.0	15.0					3																	147128137		2147	4278	6425	SO:0001583	missense	7545	exon1			GGCCATCACCATC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.238C>A	3.37:g.147128137C>A	ENSP00000282928:p.His80Asn	60.0	0.0	0		54.0	14.0	0.259259	NM_003412	Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700350	0.68501	.	.	ENSG00000152977	ENST00000282928	D	0.86497	-2.13	3.51	3.51	0.40186	.	0.000000	0.85682	D	0.000000	D	0.91150	0.7213	L	0.53249	1.67	0.80722	D	1	D	0.61697	0.99	D	0.77004	0.989	D	0.91653	0.5336	10	0.52906	T	0.07	.	15.2119	0.73230	0.0:1.0:0.0:0.0	.	80	Q15915	ZIC1_HUMAN	N	80	ENSP00000282928:H80N	ENSP00000282928:H80N	H	+	1	0	ZIC1	148610827	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	5.752000	0.68728	1.806000	0.52798	0.442000	0.29010	CAC	.	.	none		0.687	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
THOC1	9984	hgsc.bcm.edu	37	18	216549	216549	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr18:216549C>T	ENST00000261600.6	-	19	1546	c.1539G>A	c.(1537-1539)caG>caA	p.Q513Q		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	513					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TTTTAAACTGCTGGTTGGTTG	0.393																																					p.Q513Q		Atlas-SNP	.											.	THOC1	43	.	0			c.G1539A						PASS	.						188.0	190.0	189.0					18																	216549		1841	4093	5934	SO:0001819	synonymous_variant	9984	exon19			AAACTGCTGGTTG	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1539G>A	18.37:g.216549C>T		252.0	0.0	0		100.0	79.0	0.79	NM_005131	B2RBP6|Q15219|Q64I72|Q64I73	Silent	SNP	ENST00000261600.6	37	CCDS45820.1																																																																																			.	.	none		0.393	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440348.5	NM_005131	
MBD5	55777	hgsc.bcm.edu	37	2	149226791	149226791	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:149226791C>T	ENST00000407073.1	+	9	2276	c.1279C>T	c.(1279-1281)Cag>Tag	p.Q427*	MBD5_ENST00000404807.1_Nonsense_Mutation_p.Q427*	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	427					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ACAAAGAGTTCAGCATTCAGC	0.498																																					p.Q427X		Atlas-SNP	.											.	MBD5	164	.	0			c.C1279T						PASS	.						113.0	110.0	111.0					2																	149226791		2203	4300	6503	SO:0001587	stop_gained	55777	exon9			AGAGTTCAGCATT	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.1279C>T	2.37:g.149226791C>T	ENSP00000386049:p.Gln427*	138.0	0.0	0		130.0	51.0	0.392308	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Nonsense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	C	47	12.983514	0.99711	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	.	.	.	5.18	5.18	0.71444	.	0.230777	0.30658	N	0.009142	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-0.0931	19.0722	0.93143	0.0:1.0:0.0:0.0	.	.	.	.	X	427	.	ENSP00000384672:Q427X	Q	+	1	0	MBD5	148943261	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.384000	0.79751	2.595000	0.87683	0.655000	0.94253	CAG	.	.	none		0.498	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
APOBEC3D	140564	hgsc.bcm.edu	37	22	39421643	39421643	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr22:39421643C>T	ENST00000216099.8	+	4	979	c.572C>T	c.(571-573)gCa>gTa	p.A191V	APOBEC3D_ENST00000427494.2_Intron|APOBEC3D_ENST00000381568.4_Missense_Mutation_p.A191V	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	191					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					GACAATTATGCATCCCTGCAC	0.517																																					p.A191V		Atlas-SNP	.											.	APOBEC3D	61	.	0			c.C572T						PASS	.						325.0	281.0	296.0					22																	39421643		2203	4300	6503	SO:0001583	missense	140564	exon4			ATTATGCATCCCT	BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.572C>T	22.37:g.39421643C>T	ENSP00000216099:p.Ala191Val	192.0	0.0	0		160.0	66.0	0.4125	NM_152426	Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Missense_Mutation	SNP	ENST00000216099.8	37	CCDS46709.1	.	.	.	.	.	.	.	.	.	.	.	9.818	1.184973	0.21870	.	.	ENSG00000243811	ENST00000381568;ENST00000216099	T;T	0.66638	-0.22;-0.22	2.44	-4.88	0.03113	APOBEC-like, C-terminal (1);	.	.	.	.	T	0.59729	0.2215	N	0.19112	0.55	0.09310	N	0.999994	D	0.76494	0.999	D	0.83275	0.996	T	0.51490	-0.8699	9	0.30078	T	0.28	.	2.9123	0.05740	0.1786:0.1616:0.5051:0.1547	.	191	Q96AK3	ABC3D_HUMAN	V	191	ENSP00000370980:A191V;ENSP00000216099:A191V	ENSP00000216099:A191V	A	+	2	0	APOBEC3D	37751589	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.396000	0.07278	-1.845000	0.01176	-1.262000	0.01453	GCA	.	.	none		0.517	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426	
PSAPL1	768239	hgsc.bcm.edu	37	4	7436077	7436077	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr4:7436077T>A	ENST00000319098.4	-	1	623	c.530A>T	c.(529-531)cAg>cTg	p.Q177L	SORCS2_ENST00000507866.2_Intron|SORCS2_ENST00000329016.9_Intron|SORCS2_ENST00000511199.1_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	177					sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				lung(4)	4						TTCAGGCGCCTGGCGGGGGTG	0.622																																					p.Q177L		Atlas-SNP	.											.	PSAPL1	51	.	0			c.A530T						PASS	.						11.0	13.0	13.0					4																	7436077		1953	4127	6080	SO:0001583	missense	768239	exon1			GGCGCCTGGCGGG	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.530A>T	4.37:g.7436077T>A	ENSP00000317445:p.Gln177Leu	81.0	0.0	0		64.0	21.0	0.328125	NM_001085382	A0A184|Q8N7T4	Missense_Mutation	SNP	ENST00000319098.4	37	CCDS47009.1	.	.	.	.	.	.	.	.	.	.	T	9.837	1.190078	0.21954	.	.	ENSG00000178597	ENST00000319098	T	0.67523	-0.27	3.47	-6.94	0.01633	.	.	.	.	.	T	0.49779	0.1577	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.29488	-1.0010	9	0.39692	T	0.17	.	6.3621	0.21435	0.1233:0.0972:0.6172:0.1623	.	177	Q6NUJ1	SAPL1_HUMAN	L	177	ENSP00000317445:Q177L	ENSP00000317445:Q177L	Q	-	2	0	PSAPL1	7486978	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.527000	0.06200	-1.985000	0.00984	-0.496000	0.04628	CAG	.	.	none		0.622	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1		
ABCC1	4363	hgsc.bcm.edu	37	16	16146585	16146585	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr16:16146585T>C	ENST00000399410.3	+	11	1560	c.1385T>C	c.(1384-1386)cTg>cCg	p.L462P	ABCC1_ENST00000351154.5_Missense_Mutation_p.L462P|ABCC1_ENST00000399408.2_Missense_Mutation_p.L462P|ABCC1_ENST00000349029.5_Missense_Mutation_p.L462P|ABCC1_ENST00000346370.5_Missense_Mutation_p.L462P|ABCC1_ENST00000345148.5_Missense_Mutation_p.L462P	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	462	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CCTTAGAATCTGGGCCCTTCC	0.552																																					p.L462P		Atlas-SNP	.											.	ABCC1	156	.	0			c.T1385C						PASS	.						126.0	127.0	127.0					16																	16146585		2108	4218	6326	SO:0001583	missense	4363	exon11			AGAATCTGGGCCC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1385T>C	16.37:g.16146585T>C	ENSP00000382342:p.Leu462Pro	124.0	0.0	0		127.0	52.0	0.409449	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085088	0.55861	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	5.12	5.12	0.69794	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.073654	0.56097	D	0.000030	D	0.96756	0.8941	H	0.96015	3.755	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.994;0.986;0.999;0.992;0.99	D	0.97898	1.0301	10	0.87932	D	0	-15.4369	14.0882	0.64973	0.0:0.0:0.0:1.0	.	462;462;462;462;462;462;462	P33527-6;P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;.;MRP1_HUMAN;.	P	462;462;462;462;462;462;136	ENSP00000382342:L462P;ENSP00000382340:L462P;ENSP00000263019:L462P;ENSP00000263017:L462P;ENSP00000263014:L462P;ENSP00000263016:L462P	ENSP00000263014:L462P	L	+	2	0	ABCC1	16054086	1.000000	0.71417	1.000000	0.80357	0.129000	0.20672	7.659000	0.83766	1.913000	0.55393	0.402000	0.26972	CTG	.	.	none		0.552	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274360	39274360	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:39274360A>T	ENST00000391413.2	-	1	246	c.208T>A	c.(208-210)Tgc>Agc	p.C70S		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	70	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CTGGAGATGCAGCATCTGGGG	0.667																																					p.C70S		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,0,1	KRTAP4-11	94	1	0			c.T208A						scavenged	.						7.0	12.0	11.0					17																	39274360		677	1580	2257	SO:0001583	missense	653240	exon1			AGATGCAGCATCT	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.208T>A	17.37:g.39274360A>T	ENSP00000375232:p.Cys70Ser	68.0	0.0	0		85.0	4.0	0.0470588	NM_033059	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	13.38	2.219303	0.39201	.	.	ENSG00000212721	ENST00000391413	T	0.02280	4.36	3.77	1.34	0.21922	.	0.000000	0.36972	U	0.002304	T	0.04770	0.0129	M	0.90252	3.1	0.23636	N	0.997233	B	0.17268	0.021	B	0.17722	0.019	T	0.23048	-1.0199	10	0.54805	T	0.06	.	4.9719	0.14119	0.7038:0.1861:0.1101:0.0	.	70	Q9BYQ6	KR411_HUMAN	S	70	ENSP00000375232:C70S	ENSP00000375232:C70S	C	-	1	0	KRTAP4-11	36527886	0.844000	0.29557	0.494000	0.27515	0.120000	0.20174	1.052000	0.30429	0.644000	0.30656	0.496000	0.49642	TGC	.	.	none		0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KIAA1549L	25758	hgsc.bcm.edu	37	11	33667420	33667420	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:33667420C>T	ENST00000321505.4	+	16	4887	c.4707C>T	c.(4705-4707)caC>caT	p.H1569H	KIAA1549L_ENST00000389726.3_Silent_p.H1575H			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1569						integral component of membrane (GO:0016021)											CCGCGGGCCACGCAGGCCAGA	0.682																																					p.H1569H		Atlas-SNP	.											.	.	.	.	0			c.C4707T						PASS	.						21.0	26.0	24.0					11																	33667420		2111	4216	6327	SO:0001819	synonymous_variant	25758	exon16			GGGCCACGCAGGC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4707C>T	11.37:g.33667420C>T		126.0	0.0	0		128.0	64.0	0.5	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2																																																																																			.	.	none		0.682	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
HELZ	9931	hgsc.bcm.edu	37	17	65116527	65116527	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:65116527G>A	ENST00000358691.5	-	27	3998	c.3832C>T	c.(3832-3834)Cga>Tga	p.R1278*	HELZ_ENST00000580168.1_Nonsense_Mutation_p.R1279*	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1278						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TTACCATTTCGATTTTGCTCA	0.418																																					p.R1278X		Atlas-SNP	.											.	HELZ	160	.	0			c.C3832T						PASS	.						251.0	216.0	227.0					17																	65116527		1990	4185	6175	SO:0001587	stop_gained	9931	exon27			CATTTCGATTTTG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3832C>T	17.37:g.65116527G>A	ENSP00000351524:p.Arg1278*	437.0	0.0	0		446.0	195.0	0.43722	NM_014877	I6L9H4	Nonsense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	43	10.302058	0.99379	.	.	ENSG00000198265	ENST00000358691	.	.	.	5.78	4.8	0.61643	.	0.055330	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0796	16.2698	0.82608	0.0:0.0:0.8664:0.1336	.	.	.	.	X	1278	.	ENSP00000351524:R1278X	R	-	1	2	HELZ	62546989	1.000000	0.71417	0.954000	0.39281	0.821000	0.46438	1.433000	0.34947	1.430000	0.47334	0.655000	0.94253	CGA	.	.	none		0.418	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
LRRTM4	80059	hgsc.bcm.edu	37	2	77745577	77745577	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:77745577G>T	ENST00000409093.1	-	3	1754	c.1418C>A	c.(1417-1419)tCt>tAt	p.S473Y	LRRTM4_ENST00000409282.1_Missense_Mutation_p.S474Y|LRRTM4_ENST00000409088.3_Missense_Mutation_p.S473Y|LRRTM4_ENST00000409911.1_Missense_Mutation_p.S474Y|LRRTM4_ENST00000409884.1_Missense_Mutation_p.S473Y			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	473					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TTGTCTTTCAGACTCTCTGGC	0.468																																					p.S473Y		Atlas-SNP	.											.	LRRTM4	334	.	0			c.C1418A						PASS	.						82.0	81.0	82.0					2																	77745577		1898	4120	6018	SO:0001583	missense	80059	exon3			CTTTCAGACTCTC	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1418C>A	2.37:g.77745577G>T	ENSP00000386357:p.Ser473Tyr	191.0	0.0	0		141.0	43.0	0.304965	NM_024993	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492072	0.44352	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	5.68	5.68	0.88126	.	0.330675	0.33457	N	0.004881	T	0.75882	0.3910	L	0.43152	1.355	0.41973	D	0.990766	P;P;P	0.46395	0.877;0.811;0.877	B;P;P	0.48227	0.367;0.571;0.504	T	0.78800	-0.2062	10	0.87932	D	0	.	18.3564	0.90358	0.0:0.0:1.0:0.0	.	474;473;473	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	Y	474;473;473;473;474	ENSP00000387228:S474Y;ENSP00000387297:S473Y;ENSP00000386357:S473Y;ENSP00000386236:S473Y;ENSP00000386286:S474Y	ENSP00000386236:S473Y	S	-	2	0	LRRTM4	77599085	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.308000	0.72820	2.670000	0.90874	0.655000	0.94253	TCT	.	.	none		0.468	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
RGS3	5998	hgsc.bcm.edu	37	9	116346320	116346320	+	Silent	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr9:116346320G>T	ENST00000374140.2	+	21	2837	c.2628G>T	c.(2626-2628)tcG>tcT	p.S876S	RP11-168K11.2_ENST00000428429.1_RNA|RGS3_ENST00000342620.5_Intron|RGS3_ENST00000462143.1_Silent_p.S197S|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000374134.3_Silent_p.S197S|RGS3_ENST00000343817.5_Silent_p.S595S|RGS3_ENST00000350696.5_Silent_p.S876S	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	876					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						AGGGCTGCTCGGGAGATgagg	0.657																																					p.S876S		Atlas-SNP	.											.	RGS3	251	.	0			c.G2628T						PASS	.						75.0	65.0	69.0					9																	116346320		2203	4299	6502	SO:0001819	synonymous_variant	5998	exon21			CTGCTCGGGAGAT	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2628G>T	9.37:g.116346320G>T		64.0	0.0	0		74.0	22.0	0.297297	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Silent	SNP	ENST00000374140.2	37	CCDS43869.1																																																																																			.	.	none		0.657	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
PDE4A	5141	hgsc.bcm.edu	37	19	10571742	10571742	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:10571742T>A	ENST00000352831.6	+	11	1538	c.1428T>A	c.(1426-1428)gaT>gaA	p.D476E	PDE4A_ENST00000380702.2_Missense_Mutation_p.D454E|PDE4A_ENST00000344979.3_Missense_Mutation_p.D237E|PDE4A_ENST00000293683.5_Missense_Mutation_p.D450E|PDE4A_ENST00000592685.1_Missense_Mutation_p.D454E|PDE4A_ENST00000440014.2_Missense_Mutation_p.D415E	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	476	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	ACGATGTGGATCACCCTGGGG	0.612																																					p.D476E		Atlas-SNP	.											.	PDE4A	236	.	0			c.T1428A						PASS	.						50.0	43.0	45.0					19																	10571742		2203	4300	6503	SO:0001583	missense	5141	exon11			TGTGGATCACCCT		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1428T>A	19.37:g.10571742T>A	ENSP00000270474:p.Asp476Glu	36.0	0.0	0		81.0	30.0	0.37037	NM_001111307	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.915647	0.52546	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68	4.15	3.08	0.35506	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	T	0.80037	0.4550	M	0.74467	2.265	0.58432	D	0.999996	B;D;D;P;P	0.63046	0.062;0.992;0.992;0.47;0.695	B;P;D;B;B	0.68943	0.021;0.81;0.961;0.164;0.253	T	0.79685	-0.1700	10	0.87932	D	0	.	7.8314	0.29344	0.0:0.8623:0.0:0.1377	.	142;237;415;450;476	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	E	454;476;450;415;237;142	ENSP00000370078:D454E;ENSP00000270474:D476E;ENSP00000293683:D450E;ENSP00000394754:D415E;ENSP00000341007:D237E	ENSP00000293683:D450E	D	+	3	2	PDE4A	10432742	0.999000	0.42202	0.998000	0.56505	0.831000	0.47069	0.703000	0.25646	0.867000	0.35654	0.454000	0.30748	GAT	.	.	none		0.612	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
ANXA11	311	hgsc.bcm.edu	37	10	81932570	81932570	+	Silent	SNP	A	A	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr10:81932570A>T	ENST00000438331.1	-	4	530	c.48T>A	c.(46-48)gcT>gcA	p.A16A	ANXA11_ENST00000372231.3_Silent_p.A16A|ANXA11_ENST00000535999.1_Silent_p.A16A|ANXA11_ENST00000360615.4_Silent_p.A16A|ANXA11_ENST00000463657.1_5'Flank|ANXA11_ENST00000265447.4_Silent_p.A16A|ANXA11_ENST00000422982.3_Silent_p.A16A|ANXA11_ENST00000537102.1_5'UTR	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	16					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TACCTGGTGCAGCTGGTGGGT	0.592																																					p.A16A		Atlas-SNP	.											.	ANXA11	32	.	0			c.T48A						PASS	.						78.0	79.0	79.0					10																	81932570		2203	4300	6503	SO:0001819	synonymous_variant	311	exon3			TGGTGCAGCTGGT	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.48T>A	10.37:g.81932570A>T		55.0	0.0	0		46.0	6.0	0.130435	NM_145868	B4DVE7	Silent	SNP	ENST00000438331.1	37	CCDS7364.1																																																																																			.	.	none		0.592	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869	
DNER	92737	hgsc.bcm.edu	37	2	230312065	230312065	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:230312065C>T	ENST00000341772.4	-	8	1587	c.1453G>A	c.(1453-1455)Gtg>Atg	p.V485M		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	485	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CTGGTGCCCACGCTGCGGCAC	0.552																																					p.V485M		Atlas-SNP	.											.	DNER	129	.	0			c.G1453A						PASS	.						41.0	38.0	39.0					2																	230312065		2202	4299	6501	SO:0001583	missense	92737	exon8			TGCCCACGCTGCG	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1453G>A	2.37:g.230312065C>T	ENSP00000345229:p.Val485Met	262.0	0.0	0		209.0	111.0	0.5311	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855442	0.51376	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.87729	-2.29	4.94	2.97	0.34412	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.182021	0.48767	D	0.000169	D	0.84138	0.5406	N	0.16130	0.375	0.47994	D	0.999568	D	0.76494	0.999	D	0.66847	0.947	T	0.81052	-0.1107	10	0.31617	T	0.26	.	8.7086	0.34369	0.0:0.6322:0.2908:0.077	.	485	Q8NFT8	DNER_HUMAN	M	485;203	ENSP00000345229:V485M	ENSP00000345229:V485M	V	-	1	0	DNER	230020309	0.978000	0.34361	0.996000	0.52242	0.924000	0.55760	1.900000	0.39828	1.188000	0.43014	0.655000	0.94253	GTG	.	.	none		0.552	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
SYNDIG1	79953	hgsc.bcm.edu	37	20	24565617	24565617	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr20:24565617C>T	ENST00000376862.3	+	3	1239	c.606C>T	c.(604-606)taC>taT	p.Y202Y	SYNDIG1_ENST00000482637.1_3'UTR	NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	202					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						CAGCCTTCTACTTGTCCCATG	0.617																																					p.Y202Y		Atlas-SNP	.											.	SYNDIG1	58	.	0			c.C606T						PASS	.						137.0	124.0	128.0					20																	24565617		2203	4300	6503	SO:0001819	synonymous_variant	79953	exon3			CTTCTACTTGTCC	AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.606C>T	20.37:g.24565617C>T		131.0	0.0	0		105.0	52.0	0.495238	NM_024893	Q6IA30|Q9H514	Silent	SNP	ENST00000376862.3	37	CCDS13164.1																																																																																			.	.	none		0.617	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893	
CDH2	1000	hgsc.bcm.edu	37	18	25572711	25572711	+	Missense_Mutation	SNP	C	C	T	rs200263846		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr18:25572711C>T	ENST00000269141.3	-	9	1675	c.1252G>A	c.(1252-1254)Gca>Aca	p.A418T	CDH2_ENST00000399380.3_Missense_Mutation_p.A387T	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	418	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTGTACACTGCGTTCCAGGCT	0.502																																					p.A418T		Atlas-SNP	.											.	CDH2	194	.	0			c.G1252A						PASS	.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	229.0	176.0	194.0		1252	5.4	0.6	18		194	0,8600		0,0,4300	no	missense	CDH2	NM_001792.3	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	418/907	25572711	1,13005	2203	4300	6503	SO:0001583	missense	1000	exon9			ACACTGCGTTCCA	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1252G>A	18.37:g.25572711C>T	ENSP00000269141:p.Ala418Thr	155.0	0.0	0		152.0	12.0	0.0789474	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262284	0.80358	2.27E-4	0.0	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.54279	0.58;0.58	5.39	5.39	0.77823	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.74748	-0.3560	10	0.54805	T	0.06	.	19.5228	0.95192	0.0:1.0:0.0:0.0	.	387;418	A8MWK3;P19022	.;CADH2_HUMAN	T	418;387	ENSP00000269141:A418T;ENSP00000382312:A387T	ENSP00000269141:A418T	A	-	1	0	CDH2	23826709	1.000000	0.71417	0.551000	0.28230	0.257000	0.26127	6.052000	0.71080	2.674000	0.91012	0.655000	0.94253	GCA	.	.	weak		0.502	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
IZUMO2	126123	hgsc.bcm.edu	37	19	50657864	50657864	+	Missense_Mutation	SNP	C	C	T	rs189762069		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:50657864C>T	ENST00000293405.3	-	6	616	c.616G>A	c.(616-618)Gtg>Atg	p.V206M		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	206						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CACGAGACCACGATGACCACG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		13120	0.001		0.0	False		,,,				2504	0.0				p.V206M		Atlas-SNP	.											.	IZUMO2	26	.	0			c.G616A						PASS	.	C	MET/VAL	1,4263		0,1,2131	117.0	135.0	129.0		616	-0.5	0.0	19		129	0,8488		0,0,4244	yes	missense	IZUMO2	NM_152358.2	21	0,1,6375	TT,TC,CC		0.0,0.0235,0.0078	probably-damaging	206/222	50657864	1,12751	2132	4244	6376	SO:0001583	missense	126123	exon6			AGACCACGATGAC	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.616G>A	19.37:g.50657864C>T	ENSP00000293405:p.Val206Met	37.0	0.0	0		32.0	13.0	0.40625	NM_152358	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Missense_Mutation	SNP	ENST00000293405.3	37	CCDS12792.2	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	C	11.80	1.747698	0.30955	2.35E-4	0.0	ENSG00000161652	ENST00000293405	T	0.53640	0.61	3.32	-0.489	0.12052	.	.	.	.	.	T	0.35595	0.0937	L	0.29908	0.895	0.09310	N	1	D	0.63880	0.993	P	0.46253	0.509	T	0.23797	-1.0178	9	0.62326	D	0.03	.	6.0335	0.19692	0.0:0.5467:0.313:0.1403	.	206	Q6UXV1	IZUM2_HUMAN	M	206	ENSP00000293405:V206M	ENSP00000293405:V206M	V	-	1	0	IZUMO2	55349676	0.025000	0.19082	0.006000	0.13384	0.356000	0.29392	-0.553000	0.06012	0.009000	0.14813	0.305000	0.20034	GTG	C|0.999;T|0.001	0.001	strong		0.577	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
PTPRF	5792	hgsc.bcm.edu	37	1	44085859	44085859	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:44085859C>T	ENST00000359947.4	+	30	5545	c.5205C>T	c.(5203-5205)atC>atT	p.I1735I	PTPRF_ENST00000372413.3_Silent_p.I1726I|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_Silent_p.I1735I|PTPRF_ENST00000438120.1_Silent_p.I1726I|PTPRF_ENST00000422171.2_Silent_p.I1094I	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1735	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCACCATCATCGTCATGCTGA	0.612																																					p.I1735I		Atlas-SNP	.											.	PTPRF	172	.	0			c.C5205T						PASS	.						128.0	121.0	123.0					1																	44085859		2203	4300	6503	SO:0001819	synonymous_variant	5792	exon30			CATCATCGTCATG	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5205C>T	1.37:g.44085859C>T		198.0	0.0	0		176.0	81.0	0.460227	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.027|7.027	0.559821|0.559821	0.13436|0.13436	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	4.97|4.97	1.84|1.84	0.25277|0.25277	.|.	.|.	.|.	.|.	.|.	T|T	0.53948|0.53948	0.1828|0.1828	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.46582|0.46582	-0.9181|-0.9181	4|4	.|.	.|.	.|.	.|.	6.315|6.315	0.21186|0.21186	0.0:0.4855:0.3251:0.1893|0.0:0.4855:0.3251:0.1893	.|.	.|.	.|.	.|.	C|L	1119;1160|1381	.|.	.|.	R|S	+|+	1|2	0|0	PTPRF|PTPRF	43858446|43858446	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.303000|0.303000	0.19210|0.19210	0.769000|0.769000	0.33313|0.33313	0.563000|0.563000	0.77884|0.77884	CGT|TCG	.	.	none		0.612	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
DCHS1	8642	hgsc.bcm.edu	37	11	6652558	6652558	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:6652558G>A	ENST00000299441.3	-	8	4167	c.3756C>T	c.(3754-3756)atC>atT	p.I1252I	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1252	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGTGTACAAGATGGTCCCAT	0.592																																					p.I1252I		Atlas-SNP	.											.	DCHS1	277	.	0			c.C3756T						PASS	.						221.0	175.0	190.0					11																	6652558		2201	4296	6497	SO:0001819	synonymous_variant	8642	exon8			GTACAAGATGGTC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3756C>T	11.37:g.6652558G>A		114.0	0.0	0		139.0	11.0	0.0791367	NM_003737	O15098	Silent	SNP	ENST00000299441.3	37	CCDS7771.1																																																																																			.	.	none		0.592	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OSBPL6	114880	hgsc.bcm.edu	37	2	179255816	179255816	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:179255816C>A	ENST00000190611.4	+	22	2694	c.2318C>A	c.(2317-2319)tCt>tAt	p.S773Y	OSBPL6_ENST00000409045.3_Missense_Mutation_p.S742Y|OSBPL6_ENST00000392505.2_Missense_Mutation_p.S798Y|OSBPL6_ENST00000359685.3_Missense_Mutation_p.S737Y|OSBPL6_ENST00000315022.2_Missense_Mutation_p.S777Y|OSBPL6_ENST00000409631.1_Missense_Mutation_p.S737Y	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	773					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TATTGGAATTCTAACATGAAT	0.428																																					p.S798Y		Atlas-SNP	.											OSBPL6,NS,carcinoma,-1,1	OSBPL6	178	1	0			c.C2393A						PASS	.						129.0	127.0	128.0					2																	179255816		2203	4300	6503	SO:0001583	missense	114880	exon23			GGAATTCTAACAT	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2318C>A	2.37:g.179255816C>A	ENSP00000190611:p.Ser773Tyr	184.0	0.0	0		158.0	75.0	0.474684	NM_001201480	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259546	0.80246	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.61324	0.2338	M	0.84219	2.685	0.80722	D	1	D;D;D;D;D	0.89917	0.957;0.994;0.958;1.0;0.997	P;D;P;D;D	0.87578	0.905;0.963;0.867;0.998;0.973	T	0.67585	-0.5633	10	0.87932	D	0	-11.6467	18.8281	0.92127	0.0:1.0:0.0:0.0	.	742;777;737;798;773	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	Y	798;737;742;773;737;777	ENSP00000376293:S798Y;ENSP00000352713:S737Y;ENSP00000387248:S742Y;ENSP00000190611:S773Y;ENSP00000386885:S737Y;ENSP00000318723:S777Y	ENSP00000190611:S773Y	S	+	2	0	OSBPL6	178964062	1.000000	0.71417	0.983000	0.44433	0.698000	0.40448	7.625000	0.83145	2.514000	0.84764	0.462000	0.41574	TCT	.	.	none		0.428	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
HOXA9	3205	hgsc.bcm.edu	37	7	27204938	27204938	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr7:27204938C>T	ENST00000343483.6	-	1	211	c.139G>A	c.(139-141)Gag>Aag	p.E47K	HOXA9_ENST00000497089.1_Intron|HOXA9_ENST00000396345.1_Missense_Mutation_p.E47K|RP1-170O19.20_ENST00000470747.4_Intron|RP1-170O19.20_ENST00000465941.1_Intron	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	47					endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						TCGGGGTGCTCGGCCAGCGTC	0.731			T	"""NUP98, MSI2"""	AML*																																p.E47K		Atlas-SNP	.		Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	.	HOXA9	20	.	0			c.G139A						PASS	.						8.0	9.0	9.0					7																	27204938		2092	4040	6132	SO:0001583	missense	3205	exon1			GGTGCTCGGCCAG		CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.139G>A	7.37:g.27204938C>T	ENSP00000343619:p.Glu47Lys	61.0	0.0	0		58.0	21.0	0.362069	NM_152739	O43369|O43429|Q99820	Missense_Mutation	SNP	ENST00000343483.6	37	CCDS5409.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406924	0.83230	.	.	ENSG00000078399	ENST00000343483;ENST00000242050;ENST00000396345	D	0.93811	-3.29	5.46	4.58	0.56647	Hox9, N-terminal activation domain (1);	0.210905	0.32884	N	0.005532	D	0.96380	0.8819	M	0.87097	2.86	0.80722	D	1	D	0.67145	0.996	P	0.61070	0.883	D	0.96715	0.9528	10	0.72032	D	0.01	.	14.1396	0.65311	0.0:0.9275:0.0:0.0725	.	47	P31269	HXA9_HUMAN	K	47;41;47	ENSP00000343619:E47K	ENSP00000242050:E41K	E	-	1	0	HOXA9	27171463	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.325000	0.59234	1.308000	0.44962	0.655000	0.94253	GAG	.	.	none		0.731	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358706.2		
MYO5C	55930	hgsc.bcm.edu	37	15	52487626	52487626	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr15:52487626G>A	ENST00000261839.7	-	40	5185	c.5024C>T	c.(5023-5025)cCt>cTt	p.P1675L	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1675	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GTCATCTATAGGTGTGTATGA	0.353																																					p.P1675L		Atlas-SNP	.											.	MYO5C	162	.	0			c.C5024T						PASS	.						83.0	82.0	82.0					15																	52487626		1853	4081	5934	SO:0001583	missense	55930	exon40			TCTATAGGTGTGT	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.5024C>T	15.37:g.52487626G>A	ENSP00000261839:p.Pro1675Leu	189.0	0.0	0		221.0	99.0	0.447964	NM_018728	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	G	31	5.063602	0.93898	.	.	ENSG00000128833	ENST00000261839	D	0.90133	-2.62	5.62	5.62	0.85841	Dilute (1);Dil domain (1);	0.000000	0.85682	D	0.000000	D	0.95714	0.8606	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95790	0.8824	10	0.87932	D	0	.	19.661	0.95871	0.0:0.0:1.0:0.0	.	1675	Q9NQX4	MYO5C_HUMAN	L	1675	ENSP00000261839:P1675L	ENSP00000261839:P1675L	P	-	2	0	MYO5C	50274918	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.869000	0.99810	2.659000	0.90383	0.655000	0.94253	CCT	.	.	none		0.353	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
SHANK1	50944	hgsc.bcm.edu	37	19	51170329	51170329	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:51170329C>T	ENST00000293441.1	-	22	4906	c.4888G>A	c.(4888-4890)Gag>Aag	p.E1630K	SHANK1_ENST00000391813.1_Missense_Mutation_p.E1017K|SHANK1_ENST00000391814.1_Missense_Mutation_p.E1638K|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000359082.3_Missense_Mutation_p.E1621K	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1630					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GTGGCCACCTCGCTGTCATAG	0.741																																					p.E1630K		Atlas-SNP	.											.	SHANK1	210	.	0			c.G4888A						PASS	.						7.0	8.0	8.0					19																	51170329		2135	4176	6311	SO:0001583	missense	50944	exon22			CCACCTCGCTGTC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.4888G>A	19.37:g.51170329C>T	ENSP00000293441:p.Glu1630Lys	37.0	0.0	0		47.0	26.0	0.553191	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514991	0.27123	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.45668	1.02;1.48;1.0;0.89	2.39	1.29	0.21616	.	0.428107	0.19862	U	0.104406	T	0.37348	0.1000	N	0.13235	0.315	0.40588	D	0.981464	P;D	0.76494	0.875;0.999	B;P	0.61132	0.176;0.884	T	0.30534	-0.9975	10	0.59425	D	0.04	.	7.5315	0.27685	0.0:0.8515:0.0:0.1485	.	1630;1017	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	K	1630;1017;1621;1638	ENSP00000293441:E1630K;ENSP00000375689:E1017K;ENSP00000351984:E1621K;ENSP00000375690:E1638K	ENSP00000293441:E1630K	E	-	1	0	SHANK1	55862141	0.879000	0.30193	0.999000	0.59377	0.763000	0.43281	1.238000	0.32707	1.043000	0.40175	0.205000	0.17691	GAG	.	.	none		0.741	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
NEK7	140609	hgsc.bcm.edu	37	1	198288596	198288596	+	Missense_Mutation	SNP	G	G	A	rs114884409		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:198288596G>A	ENST00000367385.4	+	10	1195	c.853G>A	c.(853-855)Gtc>Atc	p.V285I	NEK7_ENST00000538004.1_Missense_Mutation_p.V285I	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	285	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.V285I(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						GCGACCAGACGTCACCTATGT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		20820	0.001		0.0	False		,,,				2504	0.0				p.V285I		Atlas-SNP	.											NEK7,NS,carcinoma,0,1	NEK7	42	1	1	Substitution - Missense(1)	stomach(1)	c.G853A						PASS	.						109.0	99.0	102.0					1																	198288596		2203	4300	6503	SO:0001583	missense	140609	exon10			CCAGACGTCACCT	AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.853G>A	1.37:g.198288596G>A	ENSP00000356355:p.Val285Ile	108.0	0.0	0		118.0	40.0	0.338983	NM_133494	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	37	CCDS1394.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.544	-0.852228	0.02651	.	.	ENSG00000151414	ENST00000367385;ENST00000538004	T;T	0.38887	1.11;1.11	5.54	3.25	0.37280	Serine/threonine-protein kinase-like domain (1);Serine-threonine/tyrosine-protein kinase (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.101356	0.64402	N	0.000003	T	0.11836	0.0288	N	0.01109	-1.01	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.25328	-1.0135	10	0.02654	T	1	.	7.8419	0.29403	0.7675:0.0:0.2325:0.0	.	285	Q8TDX7	NEK7_HUMAN	I	285	ENSP00000356355:V285I;ENSP00000444621:V285I	ENSP00000356355:V285I	V	+	1	0	NEK7	196555219	1.000000	0.71417	0.998000	0.56505	0.334000	0.28698	3.529000	0.53532	0.407000	0.25591	-0.312000	0.09012	GTC	G|0.999;A|0.001	0.001	strong		0.388	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
KRT25	147183	hgsc.bcm.edu	37	17	38906791	38906791	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:38906791G>C	ENST00000312150.4	-	6	1076	c.1016C>G	c.(1015-1017)gCg>gGg	p.A339G		NM_181534.3	NP_853512.1			keratin 25									p.A339V(1)		endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CTGGATCTGCGCCAGCTGCGC	0.562																																					p.A339G		Atlas-SNP	.											KRT25,NS,carcinoma,0,4	KRT25	63	4	1	Substitution - Missense(1)	prostate(1)	c.C1016G						PASS	.						138.0	140.0	139.0					17																	38906791		2203	4300	6503	SO:0001583	missense	147183	exon6			ATCTGCGCCAGCT	AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.1016C>G	17.37:g.38906791G>C	ENSP00000310573:p.Ala339Gly	184.0	0.0	0		180.0	66.0	0.366667	NM_181534		Missense_Mutation	SNP	ENST00000312150.4	37	CCDS11373.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374955	0.61735	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.88586	-2.4	5.52	5.52	0.82312	Filament (1);	0.213774	0.33040	N	0.005356	D	0.83760	0.5324	L	0.28192	0.835	0.09310	N	1	B	0.15141	0.012	B	0.22753	0.041	T	0.75042	-0.3457	10	0.54805	T	0.06	.	15.7677	0.78141	0.0:0.0:0.8633:0.1367	.	339	Q7Z3Z0	K1C25_HUMAN	G	268;339	ENSP00000310573:A339G	ENSP00000310573:A339G	A	-	2	0	KRT25	36160317	0.243000	0.23878	0.929000	0.37066	0.713000	0.41058	3.072000	0.50049	2.566000	0.86566	0.655000	0.94253	GCG	.	.	none		0.562	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534	
MTNR1B	4544	hgsc.bcm.edu	37	11	92714681	92714681	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:92714681C>A	ENST00000257068.2	+	2	298	c.292C>A	c.(292-294)Ctc>Atc	p.L98I		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	98					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	CCCGCTAATCCTCGTGGCCAT	0.567																																					p.L98I		Atlas-SNP	.											.	MTNR1B	75	.	0			c.C292A						PASS	.						217.0	213.0	214.0					11																	92714681		2201	4298	6499	SO:0001583	missense	4544	exon2			CTAATCCTCGTGG	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.292C>A	11.37:g.92714681C>A	ENSP00000257068:p.Leu98Ile	123.0	0.0	0		139.0	10.0	0.0719424	NM_005959		Missense_Mutation	SNP	ENST00000257068.2	37	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856263	0.71834	.	.	ENSG00000134640	ENST00000257068	T	0.44083	0.93	3.97	3.97	0.46021	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.64305	0.2586	M	0.74258	2.255	0.58432	D	0.999991	P	0.51351	0.944	D	0.70227	0.968	T	0.68322	-0.5439	10	0.52906	T	0.07	-25.9064	16.6059	0.84828	0.0:1.0:0.0:0.0	.	98	P49286	MTR1B_HUMAN	I	98	ENSP00000257068:L98I	ENSP00000257068:L98I	L	+	1	0	MTNR1B	92354329	1.000000	0.71417	0.824000	0.32777	0.966000	0.64601	5.183000	0.65065	2.220000	0.72140	0.491000	0.48974	CTC	.	.	none		0.567	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		
CYYR1	116159	hgsc.bcm.edu	37	21	27938630	27938630	+	Missense_Mutation	SNP	G	G	A	rs79874795	byFrequency	TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr21:27938630G>A	ENST00000299340.4	-	2	474	c.131C>T	c.(130-132)aCg>aTg	p.T44M	CYYR1_ENST00000435845.2_Missense_Mutation_p.T152M|CYYR1_ENST00000400043.3_Missense_Mutation_p.T44M|AP001597.1_ENST00000357401.3_RNA	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	44						integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						ACAGTAGGGCGTGGTTCCATC	0.423													G|||	44	0.00878594	0.0318	0.0014	5008	,	,		18472	0.001		0.0	False		,,,				2504	0.0				p.T44M		Atlas-SNP	.											.	CYYR1	38	.	0			c.C131T						PASS	.	G	MET/THR	103,4303	79.9+/-118.3	2,99,2102	143.0	122.0	129.0		131	4.1	0.3	21	dbSNP_131	129	0,8600		0,0,4300	yes	missense	CYYR1	NM_052954.2	81	2,99,6402	AA,AG,GG		0.0,2.3377,0.7919	probably-damaging	44/155	27938630	103,12903	2203	4300	6503	SO:0001583	missense	116159	exon2			TAGGGCGTGGTTC	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.131C>T	21.37:g.27938630G>A	ENSP00000299340:p.Thr44Met	108.0	0.0	0		102.0	57.0	0.558824	NM_052954	A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Missense_Mutation	SNP	ENST00000299340.4	37	CCDS13578.1	12	0.005494505494505495	11	0.022357723577235773	1	0.0027624309392265192	0	0.0	0	0.0	G	16.74	3.207186	0.58343	0.023377	0.0	ENSG00000166265	ENST00000299340;ENST00000435845;ENST00000400043	T;T;T	0.34275	1.37;1.37;1.37	5.05	4.09	0.47781	.	0.293803	0.38381	N	0.001715	T	0.28830	0.0715	L	0.44542	1.39	0.09310	N	1	D;D	0.69078	0.997;0.997	P;P	0.58077	0.742;0.832	T	0.09952	-1.0651	10	0.62326	D	0.03	-12.2221	13.1121	0.59278	0.0:0.1628:0.8372:0.0	.	44;44	Q96J86-2;Q96J86	.;CYYR1_HUMAN	M	44;152;44	ENSP00000299340:T44M;ENSP00000401313:T152M;ENSP00000382918:T44M	ENSP00000299340:T44M	T	-	2	0	CYYR1	26860501	1.000000	0.71417	0.274000	0.24659	0.976000	0.68499	4.318000	0.59190	2.731000	0.93534	0.591000	0.81541	ACG	G|0.994;A|0.006	0.006	strong		0.423	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954	
GNS	2799	hgsc.bcm.edu	37	12	65153012	65153012	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:65153012G>A	ENST00000258145.3	-	1	215	c.45C>T	c.(43-45)agC>agT	p.S15S	GNS_ENST00000542058.1_Silent_p.S15S|RP11-629N8.3_ENST00000434563.3_RNA|snoU13_ENST00000458789.1_RNA|GNS_ENST00000543646.1_Silent_p.S15S	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	15					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		GGTGGCGGGGGCTGCCCCGCC	0.751																																					p.S15S		Atlas-SNP	.											.	GNS	41	.	0			c.C45T						PASS	.						3.0	4.0	4.0					12																	65153012		1794	3465	5259	SO:0001819	synonymous_variant	2799	exon1			GCGGGGGCTGCCC		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.45C>T	12.37:g.65153012G>A		44.0	0.0	0		32.0	14.0	0.4375	NM_002076	B4DYH8|Q53F05	Silent	SNP	ENST00000258145.3	37	CCDS8970.1																																																																																			.	.	none		0.751	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2		
ARC	23237	hgsc.bcm.edu	37	8	143695095	143695095	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr8:143695095C>T	ENST00000356613.2	-	1	1738	c.538G>A	c.(538-540)Gct>Act	p.A180T	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				AGCTCGCCAGCGGCTGGGGGC	0.736																																					p.A180T		Atlas-SNP	.											.	ARC	34	.	0			c.G538A						PASS	.						4.0	7.0	6.0					8																	143695095		1831	3772	5603	SO:0001583	missense	23237	exon1			CGCCAGCGGCTGG	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.538G>A	8.37:g.143695095C>T	ENSP00000349022:p.Ala180Thr	20.0	0.0	0		21.0	17.0	0.809524	NM_015193	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000356613.2	37	CCDS34950.1	.	.	.	.	.	.	.	.	.	.	c	2.551	-0.304065	0.05495	.	.	ENSG00000198576	ENST00000356613	T	0.30448	1.53	4.55	0.643	0.17770	.	0.623272	0.12914	N	0.428666	T	0.10852	0.0265	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34875	-0.9811	10	0.15066	T	0.55	.	5.5167	0.16910	0.0:0.5043:0.1484:0.3473	.	180	Q7LC44	ARC_HUMAN	T	180	ENSP00000349022:A180T	ENSP00000349022:A180T	A	-	1	0	ARC	143692097	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.311000	0.08124	0.043000	0.15746	-0.461000	0.05368	GCT	.	.	none		0.736	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
CPT1B	1375	hgsc.bcm.edu	37	22	51012005	51012005	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr22:51012005G>A	ENST00000360719.2	-	10	1247	c.1110C>T	c.(1108-1110)gaC>gaT	p.D370D	CPT1B_ENST00000395650.2_Silent_p.D370D|CPT1B_ENST00000434492.2_Silent_p.D167D|CPT1B_ENST00000440709.1_Intron|CPT1B_ENST00000312108.7_Silent_p.D370D|CPT1B_ENST00000457250.1_Silent_p.D336D|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000405237.3_Silent_p.D370D	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	370					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GTGGGGAGGGGTCGTCCAGGA	0.607																																					p.D370D	Esophageal Squamous(170;988 1933 25577 30295 48163)	Atlas-SNP	.											.	CPT1B	61	.	0			c.C1110T						PASS	.						59.0	60.0	60.0					22																	51012005		2203	4300	6503	SO:0001819	synonymous_variant	1375	exon10			GGAGGGGTCGTCC	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1110C>T	22.37:g.51012005G>A		30.0	0.0	0		37.0	17.0	0.459459	NM_001145135	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	ENST00000360719.2	37	CCDS14098.1																																																																																			.	.	none		0.607	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246	
ANKS1A	23294	hgsc.bcm.edu	37	6	34957033	34957033	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:34957033G>A	ENST00000360359.3	+	9	1380	c.1242G>A	c.(1240-1242)ccG>ccA	p.P414P	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	414					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.P414P(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CAAAGCCACCGCCCGATGAAG	0.413																																					p.P414P		Atlas-SNP	.											ANKS1A,NS,carcinoma,0,1	ANKS1A	123	1	1	Substitution - coding silent(1)	lung(1)	c.G1242A						PASS	.						163.0	160.0	161.0					6																	34957033		2203	4300	6503	SO:0001819	synonymous_variant	23294	exon9			GCCACCGCCCGAT	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1242G>A	6.37:g.34957033G>A		152.0	0.0	0		142.0	67.0	0.471831	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	ENST00000360359.3	37	CCDS4798.1																																																																																			.	.	none		0.413	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
TRAPPC8	22878	hgsc.bcm.edu	37	18	29511319	29511319	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr18:29511319C>T	ENST00000283351.4	-	2	660	c.325G>A	c.(325-327)Gca>Aca	p.A109T	TRAPPC8_ENST00000582513.1_Missense_Mutation_p.A109T|TRAPPC8_ENST00000582539.1_Missense_Mutation_p.A55T|TRAPPC8_ENST00000584876.1_5'UTR	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	109					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TAATCTCCTGCTGTAATCACA	0.408																																					p.A109T		Atlas-SNP	.											.	TRAPPC8	126	.	0			c.G325A						PASS	.						129.0	123.0	125.0					18																	29511319		2203	4300	6503	SO:0001583	missense	22878	exon2			CTCCTGCTGTAAT	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.325G>A	18.37:g.29511319C>T	ENSP00000283351:p.Ala109Thr	196.0	0.0	0		188.0	90.0	0.478723	NM_014939	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315881	0.60524	.	.	ENSG00000153339	ENST00000283351	T	0.08807	3.05	5.98	5.98	0.97165	.	0.062021	0.64402	D	0.000005	T	0.09379	0.0231	L	0.40543	1.245	0.51012	D	0.999907	B;B	0.20780	0.048;0.048	B;B	0.21360	0.012;0.034	T	0.25572	-1.0128	10	0.11485	T	0.65	.	18.6326	0.91366	0.0:1.0:0.0:0.0	.	109;109	Q6PCC9;Q9Y2L5	.;TPPC8_HUMAN	T	109	ENSP00000283351:A109T	ENSP00000283351:A109T	A	-	1	0	TRAPPC8	27765317	1.000000	0.71417	0.921000	0.36526	0.990000	0.78478	6.733000	0.74796	2.838000	0.97847	0.591000	0.81541	GCA	.	.	none		0.408	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
BTG1	694	hgsc.bcm.edu	37	12	92539174	92539174	+	Missense_Mutation	SNP	C	C	G	rs200623021		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:92539174C>G	ENST00000256015.3	-	1	499	c.138G>C	c.(136-138)gaG>gaC	p.E46D	C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000546975.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	46					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.E46D(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGCCAGCAGCTCCTGCAGGC	0.701			T	MYC	BCLL																																p.E46D		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	BTG1,NS,lymphoid_neoplasm,0,1	BTG1	30	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G138C						PASS	.						29.0	32.0	31.0					12																	92539174		2201	4299	6500	SO:0001583	missense	694	exon1			CAGCAGCTCCTGC		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.138G>C	12.37:g.92539174C>G	ENSP00000256015:p.Glu46Asp	124.0	0.0	0		132.0	68.0	0.515152	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062147	0.36373	.	.	ENSG00000133639	ENST00000256015	T	0.23552	1.9	3.6	1.62	0.23740	Anti-proliferative protein (3);	0.185807	0.46145	D	0.000307	T	0.18718	0.0449	L	0.39245	1.2	0.42552	D	0.993111	B	0.06786	0.001	B	0.09377	0.004	T	0.06972	-1.0797	10	0.30854	T	0.27	-8.7689	9.9123	0.41413	0.0:0.8212:0.0:0.1788	.	46	P62324	BTG1_HUMAN	D	46	ENSP00000256015:E46D	ENSP00000256015:E46D	E	-	3	2	BTG1	91063305	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.415000	0.34748	0.663000	0.31027	0.455000	0.32223	GAG	C|1.000;T|0.000	.	alt		0.701	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
THAP6	152815	hgsc.bcm.edu	37	4	76452235	76452235	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr4:76452235C>T	ENST00000311638.3	+	5	548	c.480C>T	c.(478-480)ggC>ggT	p.G160G	THAP6_ENST00000507557.1_Intron|THAP6_ENST00000380837.3_Silent_p.G118G|THAP6_ENST00000507885.1_Intron|THAP6_ENST00000507556.1_Intron|THAP6_ENST00000504190.1_Intron|THAP6_ENST00000514480.1_Silent_p.G160G|THAP6_ENST00000502620.1_Intron	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	160						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATGTGATCGGCGAGCTAGAGG	0.353																																					p.G160G		Atlas-SNP	.											THAP6,NS,carcinoma,0,1	THAP6	14	1	0			c.C480T						PASS	.						70.0	70.0	70.0					4																	76452235		2203	4300	6503	SO:0001819	synonymous_variant	152815	exon5			GATCGGCGAGCTA	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.480C>T	4.37:g.76452235C>T		207.0	0.0	0		225.0	95.0	0.422222	NM_144721	B4E146|Q5HYJ7|Q5JPC6	Silent	SNP	ENST00000311638.3	37	CCDS3568.1																																																																																			.	.	none		0.353	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721	
CDIPT	10423	hgsc.bcm.edu	37	16	29870830	29870830	+	Silent	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr16:29870830G>T	ENST00000219789.6	-	5	1307	c.429C>A	c.(427-429)acC>acA	p.T143T	CDIPT_ENST00000570016.1_Silent_p.T143T|CDIPT_ENST00000563415.1_Intron|CDIPT_ENST00000561555.1_Silent_p.T167T|CDIPT_ENST00000566113.1_Silent_p.T98T|CDIPT_ENST00000569956.1_Silent_p.T143T|CDIPT_ENST00000567459.1_5'Flank	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase	143					CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						CAGCACACAAGGTGAACAGAG	0.572																																					p.T143T		Atlas-SNP	.											.	CDIPT	15	.	0			c.C429A						PASS	.						86.0	71.0	76.0					16																	29870830		2197	4300	6497	SO:0001819	synonymous_variant	10423	exon5			ACACAAGGTGAAC	AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144	ENST00000219789.6:c.429C>A	16.37:g.29870830G>T		90.0	0.0	0		95.0	5.0	0.0526316	NM_006319	B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	Silent	SNP	ENST00000219789.6	37	CCDS10657.1																																																																																			.	.	none		0.572	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255147.3	NM_006319	
EPHA8	2046	hgsc.bcm.edu	37	1	22915717	22915717	+	Intron	SNP	G	G	A	rs199679973		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:22915717G>A	ENST00000166244.3	+	5	1387				EPHA8_ENST00000374644.4_Missense_Mutation_p.V445I|EPHA8_ENST00000538803.1_Missense_Mutation_p.V445I	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.V445I(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAGAAACTCCGTCCCGCAGCG	0.667																																					p.V445I		Atlas-SNP	.											EPHA8_ENST00000374644,colon,carcinoma,0,1	EPHA8	221	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1333A						PASS	.						35.0	35.0	35.0					1																	22915717		2203	4300	6503	SO:0001627	intron_variant	2046	exon5			AACTCCGTCCCGC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1315+18G>A	1.37:g.22915717G>A		80.0	0.0	0		72.0	34.0	0.472222	NM_001006943	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450212	0.26074	.	.	ENSG00000070886	ENST00000374644;ENST00000538803	T;T	0.01304	5.03;5.03	4.52	0.0827	0.14430	.	.	.	.	.	T	0.00845	0.0028	.	.	.	0.09310	N	1	B	0.26935	0.164	B	0.14023	0.01	T	0.48479	-0.9032	7	.	.	.	.	2.9702	0.05920	0.1737:0.1401:0.5431:0.1431	.	445	P29322-2	.	I	445	ENSP00000363775:V445I;ENSP00000440274:V445I	.	V	+	1	0	EPHA8	22788304	0.000000	0.05858	0.006000	0.13384	0.026000	0.11368	0.211000	0.17474	0.225000	0.20959	0.436000	0.28706	GTC	G|0.999;A|0.001	0.001	weak		0.667	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
TFR2	7036	hgsc.bcm.edu	37	7	100226979	100226979	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr7:100226979G>A	ENST00000462107.1	-	11	1574	c.1287C>T	c.(1285-1287)atC>atT	p.I429I	TFR2_ENST00000544242.1_5'UTR|TFR2_ENST00000431692.1_Missense_Mutation_p.R344W|TFR2_ENST00000223051.3_Silent_p.I429I			Q9UP52	TFR2_HUMAN	transferrin receptor 2	429					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TCTGGGCCCCGATGACAACGT	0.612																																					p.I429I		Atlas-SNP	.											.	TFR2	53	.	0			c.C1287T						PASS	.						85.0	74.0	77.0					7																	100226979		2203	4300	6503	SO:0001819	synonymous_variant	7036	exon10			GGCCCCGATGACA	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1287C>T	7.37:g.100226979G>A		37.0	0.0	0		33.0	22.0	0.666667	NM_003227	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635636	0.29068	.	.	ENSG00000106327	ENST00000431692	T	0.57595	0.39	4.39	-7.68	0.01268	.	.	.	.	.	T	0.48589	0.1508	.	.	.	0.25491	N	0.987645	.	.	.	.	.	.	T	0.59451	-0.7452	6	0.87932	D	0	-13.3063	10.2135	0.43156	0.7308:0.105:0.1641:0.0	.	.	.	.	W	344	ENSP00000413905:R344W	ENSP00000413905:R344W	R	-	1	2	TFR2	100064915	0.002000	0.14202	0.842000	0.33263	0.867000	0.49689	-1.543000	0.02194	-1.638000	0.01529	-0.291000	0.09656	CGG	.	.	none		0.612	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
PCDHA3	56145	hgsc.bcm.edu	37	5	140180941	140180941	+	Silent	SNP	G	G	A	rs201478898	byFrequency	TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:140180941G>A	ENST00000522353.2	+	1	159	c.159G>A	c.(157-159)ggG>ggA	p.G53G	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA3_ENST00000532566.2_Silent_p.G53G|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	53	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGACCTGGGGCTGGAGCTGG	0.637																																					p.G53G		Atlas-SNP	.											PCDHA3_ENST00000522353,NS,haematopoietic_neoplasm,0,2	PCDHA3	396	2	0			c.G159A						scavenged	.																																			SO:0001819	synonymous_variant	56145	exon1			CCTGGGGCTGGAG	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.159G>A	5.37:g.140180941G>A		82.0	2.0	0.0243902		102.0	13.0	0.127451	NM_031497	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1																																																																																			G|0.926;A|0.074	0.074	strong		0.637	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PRSS16	10279	hgsc.bcm.edu	37	6	27219672	27219672	+	Silent	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:27219672G>A	ENST00000230582.3	+	8	876	c.861G>A	c.(859-861)gcG>gcA	p.A287A	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_Intron	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	287					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TGTTGGGGGCGCTGCAGGCAC	0.701																																					p.A287A	NSCLC(178;1118 2105 17078 23587 44429)	Atlas-SNP	.											.	PRSS16	66	.	0			c.G861A						PASS	.						15.0	18.0	17.0					6																	27219672		2176	4276	6452	SO:0001819	synonymous_variant	10279	exon8			GGGGGCGCTGCAG	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.861G>A	6.37:g.27219672G>A		132.0	0.0	0		142.0	63.0	0.443662	NM_005865	O75416	Silent	SNP	ENST00000230582.3	37	CCDS4623.1																																																																																			.	.	none		0.701	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
LRP1B	53353	hgsc.bcm.edu	37	2	141571285	141571285	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:141571285A>G	ENST00000389484.3	-	32	6271	c.5300T>C	c.(5299-5301)tTa>tCa	p.L1767S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1767					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GATTACTTCTAAATTACCACC	0.353										TSP Lung(27;0.18)																											p.L1767S	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T5300C						PASS	.						169.0	148.0	155.0					2																	141571285		2203	4299	6502	SO:0001583	missense	53353	exon32			ACTTCTAAATTAC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5300T>C	2.37:g.141571285A>G	ENSP00000374135:p.Leu1767Ser	289.0	0.0	0		278.0	96.0	0.345324	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.695623	0.68386	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91792	-2.91	5.83	5.83	0.93111	Six-bladed beta-propeller, TolB-like (1);	0.098626	0.40554	N	0.001061	D	0.90665	0.7072	L	0.39898	1.24	0.43971	D	0.996656	D	0.54047	0.964	P	0.49140	0.601	D	0.88943	0.3381	10	0.23891	T	0.37	.	16.1982	0.82046	1.0:0.0:0.0:0.0	.	1767	Q9NZR2	LRP1B_HUMAN	S	1767;1705	ENSP00000374135:L1767S	ENSP00000374135:L1767S	L	-	2	0	LRP1B	141287755	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.282000	0.95840	2.226000	0.72624	0.533000	0.62120	TTA	.	.	none		0.353	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ASB12	142689	hgsc.bcm.edu	37	X	63444983	63444983	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:63444983C>T	ENST00000396130.2	-	1	520	c.521G>A	c.(520-522)gGc>gAc	p.G174D	ASB12_ENST00000362002.2_Missense_Mutation_p.G183D|MTMR8_ENST00000453546.1_Missense_Mutation_p.G558D			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	174					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						ATAGAGGGGGCCAGAACATGA	0.562																																					p.G183D		Atlas-SNP	.											.	ASB12	102	.	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)	c.G548A						PASS	.						76.0	68.0	71.0					X																	63444983		2203	4300	6503	SO:0001583	missense	142689	exon2			AGGGGGCCAGAAC	AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.521G>A	X.37:g.63444983C>T	ENSP00000379435:p.Gly174Asp	90.0	0.0	0		71.0	64.0	0.901408	NM_130388	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	ENST00000396130.2	37		.	.	.	.	.	.	.	.	.	.	C	20.9	4.066306	0.76187	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.76578	0.01;0.04;-1.03	4.0	4.0	0.46444	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.80691	0.4671	L	0.27053	0.805	0.36377	D	0.861693	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85746	0.1340	10	0.66056	D	0.02	-2.8088	14.2368	0.65932	0.0:1.0:0.0:0.0	.	558;174	B4DQL0;Q8WXK4	.;ASB12_HUMAN	D	183;174;183;558	ENSP00000355195:G183D;ENSP00000379435:G174D;ENSP00000394003:G558D	ENSP00000354626:G183D	G	-	2	0	ASB12;MTMR8	63361708	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.023000	0.76437	1.986000	0.57962	0.468000	0.43344	GGC	.	.	none		0.562	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
TFAP2B	7021	hgsc.bcm.edu	37	6	50791293	50791293	+	Silent	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:50791293C>A	ENST00000393655.3	+	2	424	c.255C>A	c.(253-255)ccC>ccA	p.P85P	TFAP2B_ENST00000489228.1_3'UTR|TFAP2B_ENST00000263046.4_Silent_p.P94P	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	85	Gln/Pro-rich (transactivation domain).				aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					GCCAGGACCCCTACTCCCACG	0.687																																					p.P85P	Pancreas(116;1373 2332 5475 10752)	Atlas-SNP	.											.	TFAP2B	91	.	0			c.C255A						PASS	.						65.0	71.0	69.0					6																	50791293		2203	4300	6503	SO:0001819	synonymous_variant	7021	exon2			GGACCCCTACTCC	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.255C>A	6.37:g.50791293C>A		160.0	0.0	0		121.0	56.0	0.46281	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Silent	SNP	ENST00000393655.3	37	CCDS4934.2																																																																																			.	.	none		0.687	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
P2RY8	286530	hgsc.bcm.edu	37	X	1585333	1585333	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:1585333C>T	ENST00000381297.4	-	2	329	c.119G>A	c.(118-120)gGc>gAc	p.G40D	P2RY8_ENST00000460672.1_5'UTR	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAAGAGGTTGCCCGGGATGCT	0.677			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.G40D		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.G119A						PASS	.						45.0	46.0	46.0					X																	1585333		2203	4296	6499	SO:0001583	missense	286530	exon2			AGGTTGCCCGGGA	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.119G>A	X.37:g.1585333C>T	ENSP00000370697:p.Gly40Asp	84.0	0.0	0		40.0	34.0	0.85	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	c	12.05	1.820917	0.32237	.	.	ENSG00000182162	ENST00000381297	T	0.57107	0.42	2.1	2.1	0.27182	GPCR, rhodopsin-like superfamily (1);	0.165149	0.39274	U	0.001406	T	0.73505	0.3595	M	0.89478	3.035	0.19575	N	0.999967	D	0.89917	1.0	D	0.79784	0.993	T	0.66256	-0.5969	10	0.54805	T	0.06	.	12.2776	0.54744	0.0:1.0:0.0:0.0	.	40	Q86VZ1	P2RY8_HUMAN	D	40	ENSP00000370697:G40D	ENSP00000370697:G40D	G	-	2	0	P2RY8	1545333	0.995000	0.38212	0.099000	0.21106	0.036000	0.12997	4.100000	0.57762	0.637000	0.30526	0.279000	0.19357	GGC	.	.	none		0.677	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
DLGAP3	58512	hgsc.bcm.edu	37	1	35351360	35351360	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:35351360G>A	ENST00000373347.1	-	7	1901	c.1633C>T	c.(1633-1635)Ccg>Tcg	p.P545S	DLGAP3_ENST00000235180.4_Missense_Mutation_p.P545S			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	545					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CTTCCCGGCGGGATGGGGGGC	0.756																																					p.P545S		Atlas-SNP	.											.	DLGAP3	107	.	0			c.C1633T						PASS	.						2.0	3.0	2.0					1																	35351360		1432	3197	4629	SO:0001583	missense	58512	exon5			CCGGCGGGATGGG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1633C>T	1.37:g.35351360G>A	ENSP00000362444:p.Pro545Ser	52.0	0.0	0		45.0	20.0	0.444444	NM_001080418	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	G	34	5.393254	0.96009	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.59224	0.28;0.28	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.77961	0.4209	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.80155	-0.1500	10	0.56958	D	0.05	-13.9072	18.8995	0.92437	0.0:0.0:1.0:0.0	.	545	O95886	DLGP3_HUMAN	S	545	ENSP00000362444:P545S;ENSP00000235180:P545S	ENSP00000235180:P545S	P	-	1	0	DLGAP3	35123947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.369000	0.79578	2.684000	0.91462	0.561000	0.74099	CCG	.	.	none		0.756	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
MAF1	84232	hgsc.bcm.edu	37	8	145160665	145160665	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr8:145160665G>T	ENST00000322428.5	+	2	483	c.79G>T	c.(79-81)Ggc>Tgc	p.G27C	MAF1_ENST00000532522.1_Missense_Mutation_p.G27C|MAF1_ENST00000534585.1_Missense_Mutation_p.G27C|SHARPIN_ENST00000398712.2_5'Flank|KIAA1875_ENST00000323662.8_5'Flank|SHARPIN_ENST00000533948.1_5'Flank	NM_032272.4	NP_115648.2	Q9H063	MAF1_HUMAN	MAF1 homolog (S. cerevisiae)	27					negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)			central_nervous_system(1)|lung(8)|urinary_tract(1)	10	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCACATCATTGGCAGGTGAGG	0.572																																					p.G27C		Atlas-SNP	.											.	MAF1	16	.	0			c.G79T						PASS	.						67.0	65.0	66.0					8																	145160665		2203	4300	6503	SO:0001583	missense	84232	exon2			ATCATTGGCAGGT		CCDS6416.1	8q24.3	2012-10-29			ENSG00000179632	ENSG00000179632			24966	protein-coding gene	gene with protein product		610210				11230166, 11438659	Standard	NM_032272		Approved	DKFZp586G1123	uc003zbc.1	Q9H063	OTTHUMG00000165244	ENST00000322428.5:c.79G>T	8.37:g.145160665G>T	ENSP00000318604:p.Gly27Cys	38.0	0.0	0		49.0	43.0	0.877551	NM_032272	D3DWL4	Missense_Mutation	SNP	ENST00000322428.5	37	CCDS6416.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281555	0.59758	.	.	ENSG00000179632	ENST00000322428;ENST00000534585;ENST00000532522;ENST00000527572;ENST00000527058	T;T;T	0.56103	0.59;0.48;0.59	4.94	4.94	0.65067	.	0.061031	0.64402	D	0.000004	T	0.69797	0.3151	M	0.88704	2.975	0.80722	D	1	D	0.55172	0.97	P	0.53861	0.736	T	0.76063	-0.3096	10	0.54805	T	0.06	-43.3794	13.6671	0.62403	0.0:0.0:1.0:0.0	.	27	Q9H063	MAF1_HUMAN	C	27	ENSP00000318604:G27C;ENSP00000433979:G27C;ENSP00000436720:G27C	ENSP00000318604:G27C	G	+	1	0	MAF1	145232653	1.000000	0.71417	0.998000	0.56505	0.301000	0.27625	5.450000	0.66626	2.285000	0.76669	0.462000	0.41574	GGC	.	.	none		0.572	MAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382910.1	NM_032272	
NDUFS1	4719	hgsc.bcm.edu	37	2	207017231	207017231	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:207017231C>T	ENST00000233190.6	-	3	331	c.65G>A	c.(64-66)cGa>cAa	p.R22Q	NDUFS1_ENST00000432169.1_Intron|NDUFS1_ENST00000423725.1_Intron|NDUFS1_ENST00000455934.2_Missense_Mutation_p.R36Q|NDUFS1_ENST00000449699.1_Missense_Mutation_p.R22Q|NDUFS1_ENST00000457011.1_Intron|NDUFS1_ENST00000440274.1_Missense_Mutation_p.R22Q	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	22					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGCAGTTGTTCGAACTGACCA	0.388																																					p.R36Q		Atlas-SNP	.											NDUFS1,NS,carcinoma,-1,3	NDUFS1	82	3	0			c.G107A						PASS	.						110.0	92.0	98.0					2																	207017231		2203	4300	6503	SO:0001583	missense	4719	exon3			GTTGTTCGAACTG		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.65G>A	2.37:g.207017231C>T	ENSP00000233190:p.Arg22Gln	210.0	0.0	0		209.0	84.0	0.401914	NM_001199984	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	ENST00000233190.6	37	CCDS2366.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397368	0.83120	.	.	ENSG00000023228	ENST00000233190;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000454195	D;D;D;D;T	0.88664	-2.32;-2.41;-2.32;-2.32;-1.18	5.9	5.9	0.94986	.	0.318441	0.28332	N	0.015736	D	0.86138	0.5861	M	0.63169	1.94	0.80722	D	1	B;P;B	0.42993	0.063;0.797;0.028	B;B;B	0.26969	0.022;0.075;0.007	D	0.87780	0.2611	10	0.62326	D	0.03	.	20.2723	0.98479	0.0:1.0:0.0:0.0	.	22;36;22	E7ENF3;B4DJA0;P28331	.;.;NDUS1_HUMAN	Q	22;22;36;22;22	ENSP00000233190:R22Q;ENSP00000409766:R22Q;ENSP00000392709:R36Q;ENSP00000399912:R22Q;ENSP00000389413:R22Q	ENSP00000233190:R22Q	R	-	2	0	NDUFS1	206725476	1.000000	0.71417	0.999000	0.59377	0.839000	0.47603	6.841000	0.75374	2.793000	0.96121	0.563000	0.77884	CGA	.	.	none		0.388	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
CPNE2	221184	hgsc.bcm.edu	37	16	57171163	57171163	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr16:57171163C>G	ENST00000535318.2	+	15	1632	c.1271C>G	c.(1270-1272)gCg>gGg	p.A424G	CPNE2_ENST00000537605.1_Missense_Mutation_p.A322G|CPNE2_ENST00000565874.1_Missense_Mutation_p.A424G|CPNE2_ENST00000290776.8_Missense_Mutation_p.A424G|CPNE2_ENST00000565951.1_Intron			Q96FN4	CPNE2_HUMAN	copine II	424	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				GCCCGGTTTGCGGCCCAGGCC	0.622																																					p.A424G		Atlas-SNP	.											.	CPNE2	48	.	0			c.C1271G						PASS	.						84.0	55.0	65.0					16																	57171163		2198	4300	6498	SO:0001583	missense	221184	exon14			GGTTTGCGGCCCA		CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.1271C>G	16.37:g.57171163C>G	ENSP00000439018:p.Ala424Gly	78.0	0.0	0		58.0	30.0	0.517241	NM_152727	Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	ENST00000535318.2	37	CCDS10774.1	.	.	.	.	.	.	.	.	.	.	C	36	5.784801	0.96937	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	T;T;T	0.28255	1.62;1.62;1.62	5.88	5.88	0.94601	von Willebrand factor, type A (1);Copine (1);	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.73173	-0.4066	10	0.72032	D	0.01	-30.9625	20.2422	0.98381	0.0:1.0:0.0:0.0	.	424;424	A8K8A4;Q96FN4	.;CPNE2_HUMAN	G	424;322;424	ENSP00000290776:A424G;ENSP00000445468:A322G;ENSP00000439018:A424G	ENSP00000290776:A424G	A	+	2	0	CPNE2	55728664	1.000000	0.71417	0.980000	0.43619	0.917000	0.54804	7.788000	0.85771	2.782000	0.95742	0.655000	0.94253	GCG	.	.	none		0.622	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432986.2	NM_152727	
C2orf81	388963	hgsc.bcm.edu	37	2	74642291	74642291	+	Missense_Mutation	SNP	A	A	G	rs116859876	byFrequency	TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:74642291A>G	ENST00000517883.1	-	1	1419	c.728T>C	c.(727-729)gTg>gCg	p.V243A	C2orf81_ENST00000290390.5_Missense_Mutation_p.V311A			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	304										endometrium(3)|kidney(1)	4						GGCGCCGCCCACAGAGGGGTA	0.711																																					p.V311A		Atlas-SNP	.											.	C2orf81	23	.	0			c.T932C						PASS	.						9.0	13.0	12.0					2																	74642291		690	1587	2277	SO:0001583	missense	388963	exon4			CCGCCCACAGAGG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.728T>C	2.37:g.74642291A>G	ENSP00000431103:p.Val243Ala	82.0	0.0	0		86.0	11.0	0.127907	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	37		89	0.04075091575091575	42	0.08536585365853659	6	0.016574585635359115	39	0.06818181818181818	2	0.002638522427440633	a	0.382	-0.928405	0.02359	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.08	-8.16	0.01061	.	5.711590	0.00357	N	0.000021	T	0.00468	0.0015	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16424	-1.0403	9	0.09843	T	0.71	0.784	0.986	0.01446	0.1694:0.1757:0.2237:0.4311	.	311	G3XAA6	.	A	243;311	.	ENSP00000290390:V311A	V	-	2	0	C2orf81	74495799	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.588000	0.02106	-3.820000	0.00103	-0.499000	0.04595	GTG	A|0.959;G|0.041	0.041	strong		0.711	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
FNTB	2342	hgsc.bcm.edu	37	14	65520040	65520040	+	Missense_Mutation	SNP	C	C	T	rs374785351		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr14:65520040C>T	ENST00000246166.2	+	10	1274	c.1040C>T	c.(1039-1041)gCg>gTg	p.A347V	CHURC1-FNTB_ENST00000549987.1_Missense_Mutation_p.A382V|MAX_ENST00000341653.2_Intron|FNTB_ENST00000542227.1_Missense_Mutation_p.A301V|FNTB_ENST00000447296.2_Missense_Mutation_p.A381V	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	347					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CAGTGCCCTGCGGGGGGGCTT	0.597																																					p.A408V		Atlas-SNP	.											FNTB,rectum,carcinoma,-1,1	.	.	1	0			c.C1223T						PASS	.	C	,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	34.0	34.0	34.0		,1040,1223,902	5.3	0.1	14		34	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,missense,missense	FNTB,MAX,CHURC1-FNTB	NM_197957.2,NM_002028.3,NM_001202559.1,NM_001202558.1	,64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,benign,benign,benign	,347/438,408/499,301/392	65520040	1,13005	2203	4300	6503	SO:0001583	missense	100529261	exon12			GCCCTGCGGGGGG		CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.1040C>T	14.37:g.65520040C>T	ENSP00000246166:p.Ala347Val	53.0	0.0	0		59.0	26.0	0.440678	NM_001202559	B2RDX6|B4E1A0	Missense_Mutation	SNP	ENST00000246166.2	37	CCDS9769.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986392	0.35036	0.0	1.16E-4	ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000125954;ENSG00000257365	ENST00000542227;ENST00000549987;ENST00000447296;ENST00000448390;ENST00000246166	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.31	5.31	0.75309	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.369639	0.31051	N	0.008345	T	0.19846	0.0477	N	0.15975	0.35	0.80722	D	1	B;B;P;B	0.42123	0.046;0.37;0.771;0.227	B;B;B;B	0.21151	0.011;0.016;0.027;0.033	T	0.07539	-1.0767	10	0.33141	T	0.24	-7.8543	12.9217	0.58237	0.1624:0.8376:0.0:0.0	.	350;301;381;347	Q86TX8;B4E1A0;B4DL54;P49356	.;.;.;FNTB_HUMAN	V	301;382;381;103;347	ENSP00000443140:A301V;ENSP00000447121:A382V;ENSP00000406393:A381V;ENSP00000399362:A103V;ENSP00000246166:A347V	ENSP00000246166:A347V	A	+	2	0	FNTB;AL139022.1	64589793	0.055000	0.20627	0.094000	0.20943	0.797000	0.45037	2.346000	0.44027	2.767000	0.95098	0.561000	0.74099	GCG	.	.	weak		0.597	FNTB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000286392.1	NM_002028	
TRIM46	80128	hgsc.bcm.edu	37	1	155145757	155145757	+	5'Flank	SNP	G	G	A	rs551900242		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:155145757G>A	ENST00000334634.4	+	0	0				TRIM46_ENST00000368385.4_5'Flank|TRIM46_ENST00000392451.2_5'Flank|KRTCAP2_ENST00000490672.1_5'UTR|RP11-201K10.3_ENST00000473363.2_Intron|KRTCAP2_ENST00000295682.4_Missense_Mutation_p.R8W|TRIM46_ENST00000543729.1_5'Flank|TRIM46_ENST00000368382.1_5'Flank|TRIM46_ENST00000545012.1_5'Flank|TRIM46_ENST00000368383.3_5'Flank	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGCTGAACCGGGTGCGGTTA	0.637											OREG0013854	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R8W		Atlas-SNP	.											.	KRTCAP2	15	.	0			c.C22T						PASS	.						35.0	33.0	34.0					1																	155145757		2203	4300	6503	SO:0001631	upstream_gene_variant	200185	exon1			TGAACCGGGTGCG		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680		1.37:g.155145757G>A	Exception_encountered	98.0	0.0	0	1768	92.0	83.0	0.902174	NM_173852	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150951	0.38021	.	.	ENSG00000163463	ENST00000295682	T	0.52295	0.67	5.7	0.335	0.15953	.	1.897460	0.02605	N	0.101423	T	0.10252	0.0251	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.04013	0.001;0.001	T	0.21075	-1.0256	10	0.87932	D	0	8.0E-4	2.6567	0.05014	0.1567:0.2687:0.4403:0.1343	.	8;8	B3KNA5;Q8N6L1	.;KTAP2_HUMAN	W	8	ENSP00000295682:R8W	ENSP00000295682:R8W	R	-	1	2	KRTCAP2	153412381	0.169000	0.23002	0.002000	0.10522	0.000000	0.00434	-0.175000	0.09825	-0.102000	0.12197	-0.899000	0.02877	CGG	.	.	none		0.637	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058	
MYH8	4626	hgsc.bcm.edu	37	17	10293802	10293802	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:10293802C>T	ENST00000403437.2	-	40	5877	c.5783G>A	c.(5782-5784)cGa>cAa	p.R1928Q	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1928					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GTGAACCTCTCGGCTCTTCAC	0.473									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.R1928Q		Atlas-SNP	.											.	MYH8	346	.	0			c.G5783A						PASS	.						149.0	142.0	145.0					17																	10293802		2203	4300	6503	SO:0001583	missense	4626	exon40	Familial Cancer Database	Carney Complex Variant	ACCTCTCGGCTCT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5783G>A	17.37:g.10293802C>T	ENSP00000384330:p.Arg1928Gln	327.0	0.0	0		325.0	145.0	0.446154	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792275	0.90453	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.83755	-1.76	5.05	4.09	0.47781	Myosin tail (1);	0.000000	0.35903	U	0.002906	D	0.89167	0.6638	M	0.94142	3.5	0.50039	D	0.999841	P	0.46277	0.875	P	0.45971	0.499	D	0.91641	0.5327	10	0.72032	D	0.01	.	13.789	0.63128	0.0:0.926:0.0:0.074	.	1928	P13535	MYH8_HUMAN	Q	1928	ENSP00000384330:R1928Q	ENSP00000252173:R1928Q	R	-	2	0	MYH8	10234527	1.000000	0.71417	0.990000	0.47175	0.862000	0.49288	5.827000	0.69300	1.353000	0.45828	0.650000	0.86243	CGA	.	.	none		0.473	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
MYD88	4615	hgsc.bcm.edu	37	3	38182292	38182292	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr3:38182292G>A	ENST00000495303.1	+	2	417	c.412G>A	c.(412-414)Gca>Aca	p.A138T	MYD88_ENST00000424893.1_Missense_Mutation_p.S198N|MYD88_ENST00000443433.2_Missense_Mutation_p.A183T|MYD88_ENST00000417037.2_Missense_Mutation_p.S251N|MYD88_ENST00000396334.3_Missense_Mutation_p.S243N|MYD88_ENST00000481122.1_3'UTR	NM_001172566.1	NP_001166037.1	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	0	Intermediate domain. {ECO:0000250}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)	p.S243N(7)		breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TACCTGCAGAGCAAGGAATGT	0.552			Mis		ABC-DLBCL																																p.S251N		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	MYD88,NS,lymphoid_neoplasm,0,8	MYD88	900	8	7	Substitution - Missense(7)	haematopoietic_and_lymphoid_tissue(7)	c.G752A						PASS	.						175.0	167.0	170.0					3																	38182292		2203	4300	6503	SO:0001583	missense	4615	exon4			TGCAGAGCAAGGA	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000495303.1:c.412G>A	3.37:g.38182292G>A	ENSP00000417848:p.Ala138Thr	130.0	0.0	0		124.0	53.0	0.427419	NM_001172567	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000495303.1	37	CCDS54568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.725497|4.725497	0.89298|0.89298	.|.	.|.	ENSG00000172936|ENSG00000172936	ENST00000495303;ENST00000443433|ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158	.|T;T;T;T	.|0.36878	.|1.23;1.23;1.23;1.23	5.74|5.74	5.74|5.74	0.90152|0.90152	.|Toll/interleukin-1 receptor homology (TIR) domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63943|0.63943	0.2554|0.2554	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P;P|D;D;D	0.45348|0.89917	0.856;0.7|0.999;1.0;0.999	B;B|D;D;D	0.33890|0.97110	0.172;0.172|0.999;0.999;1.0	T|T	0.63466|0.63466	-0.6631|-0.6631	7|9	0.72032|0.54805	D|T	0.01|0.06	-26.8793|-26.8793	19.2995|19.2995	0.94138|0.94138	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138;183|185;230;219	B4DQ60;B4DQ72|Q99836-2;Q99836;B4E3D6	.;.|.;MYD88_HUMAN;.	T|N	138;183|251;243;198;250;219	.|ENSP00000401399:S251N;ENSP00000379625:S243N;ENSP00000389979:S198N;ENSP00000391753:S250N	ENSP00000390565:A183T|ENSP00000379625:S243N	A|S	+|+	1|2	0|0	MYD88|MYD88	38157296|38157296	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	9.285000|9.285000	0.95894|0.95894	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GCA|AGC	.	.	none		0.552	MYD88-008	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000342700.1	NM_002468	
SH3GLB2	56904	hgsc.bcm.edu	37	9	131790419	131790419	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr9:131790419C>T	ENST00000372564.3	-	1	160	c.15G>A	c.(13-15)atG>atA	p.M5I	SH3GLB2_ENST00000416629.1_Missense_Mutation_p.M5I|SH3GLB2_ENST00000372559.1_Missense_Mutation_p.M5I|SH3GLB2_ENST00000372554.4_Missense_Mutation_p.M5I|SH3GLB2_ENST00000417224.1_Missense_Mutation_p.M5I	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	5	Membrane-binding amphipathic helix. {ECO:0000250}.					cytoplasm (GO:0005737)				NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						CCAGCTTCTTCATGTTGAAGT	0.781																																					p.M5I		Atlas-SNP	.											.	SH3GLB2	32	.	0			c.G15A						PASS	.						5.0	4.0	5.0					9																	131790419		1641	3025	4666	SO:0001583	missense	56904	exon1			CTTCTTCATGTTG	AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.15G>A	9.37:g.131790419C>T	ENSP00000361645:p.Met5Ile	28.0	0.0	0		41.0	17.0	0.414634	NM_020145	A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509061	0.64410	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.16324	2.35;2.35;2.37;2.36;2.38	4.19	3.29	0.37713	.	0.109396	0.64402	D	0.000007	T	0.14013	0.0339	L	0.36672	1.1	0.37175	D	0.903204	B;B	0.14438	0.01;0.003	B;B	0.15052	0.009;0.012	T	0.07693	-1.0759	10	0.51188	T	0.08	.	10.6936	0.45886	0.0:0.9034:0.0:0.0966	.	5;5	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	I	5	ENSP00000361645:M5I;ENSP00000361640:M5I;ENSP00000361634:M5I;ENSP00000402566:M5I;ENSP00000388282:M5I	ENSP00000361634:M5I	M	-	3	0	SH3GLB2	130830240	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.778000	0.38614	0.964000	0.38108	0.544000	0.68410	ATG	.	.	none		0.781	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2		
EPHA5	2044	hgsc.bcm.edu	37	4	66356412	66356412	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr4:66356412C>T	ENST00000273854.3	-	5	1685	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000511294.1_Missense_Mutation_p.R362Q|EPHA5_ENST00000354839.4_Missense_Mutation_p.R362Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GATGGCATTCCGAGGAGCAGA	0.398										TSP Lung(17;0.13)																											p.R362Q		Atlas-SNP	.											.	EPHA5	315	.	0			c.G1085A						PASS	.						45.0	44.0	44.0					4																	66356412		2203	4300	6503	SO:0001583	missense	2044	exon5			GCATTCCGAGGAG	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1085G>A	4.37:g.66356412C>T	ENSP00000273854:p.Arg362Gln	146.0	0.0	0		120.0	55.0	0.458333	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450707	0.43531	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.57273	0.41;0.41;0.41	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000052	T	0.68155	0.2970	L	0.53780	1.695	0.53688	D	0.999976	D;P;D;P	0.76494	0.999;0.659;0.998;0.568	D;B;D;B	0.67382	0.951;0.153;0.918;0.024	T	0.60352	-0.7280	10	0.26408	T	0.33	.	20.1859	0.98214	0.0:1.0:0.0:0.0	.	362;362;362;362	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	362	ENSP00000273854:R362Q;ENSP00000346899:R362Q;ENSP00000427638:R362Q	ENSP00000273854:R362Q	R	-	2	0	EPHA5	66039007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.058000	0.57463	2.777000	0.95525	0.591000	0.81541	CGG	.	.	none		0.398	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
DGCR8	54487	hgsc.bcm.edu	37	22	20077332	20077332	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr22:20077332C>T	ENST00000351989.3	+	4	1450	c.1021C>T	c.(1021-1023)Cgg>Tgg	p.R341W	DGCR8_ENST00000383024.2_Missense_Mutation_p.R341W|DGCR8_ENST00000407755.1_Missense_Mutation_p.R341W	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	341	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with NCL.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GGGAAGCATACGGGTAGGGGA	0.547																																					p.R341W		Atlas-SNP	.											.	DGCR8	53	.	0			c.C1021T						PASS	.						140.0	127.0	131.0					22																	20077332		2203	4300	6503	SO:0001583	missense	54487	exon4			AGCATACGGGTAG	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1021C>T	22.37:g.20077332C>T	ENSP00000263209:p.Arg341Trp	117.0	0.0	0		130.0	59.0	0.453846	NM_001190326	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454739	0.84209	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.53640	0.66;0.61;0.61	5.68	3.51	0.40186	.	0.048535	0.85682	D	0.000000	T	0.66005	0.2746	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.981	T	0.68250	-0.5458	10	0.87932	D	0	-10.7924	6.7678	0.23576	0.3527:0.5557:0.0:0.0916	.	341;341	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	W	341	ENSP00000263209:R341W;ENSP00000372488:R341W;ENSP00000384726:R341W	ENSP00000263209:R341W	R	+	1	2	DGCR8	18457332	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.304000	0.51866	1.401000	0.46761	0.650000	0.86243	CGG	.	.	none		0.547	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		
SLCO6A1	133482	hgsc.bcm.edu	37	5	101834271	101834271	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:101834271C>T	ENST00000506729.1	-	1	449	c.278G>A	c.(277-279)tGc>tAc	p.C93Y	RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.C93Y|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.C93Y|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.C93Y|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.C93Y			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	93	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GCTGACTAAGCAGCCCAAACC	0.502																																					p.C93Y		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.G278A						PASS	.						105.0	107.0	106.0					5																	101834271		2203	4300	6503	SO:0001583	missense	133482	exon1			ACTAAGCAGCCCA	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.278G>A	5.37:g.101834271C>T	ENSP00000421339:p.Cys93Tyr	121.0	0.0	0		125.0	49.0	0.392	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871154	0.33069	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.47177	0.91;0.91;0.93;0.85;0.85	3.52	2.6	0.31112	.	0.609562	0.14883	N	0.292850	T	0.49115	0.1538	L	0.32530	0.975	0.09310	N	1	D;D;D	0.89917	0.998;1.0;0.996	P;D;P	0.68192	0.904;0.956;0.804	T	0.33650	-0.9860	10	0.11794	T	0.64	.	8.6	0.33738	0.0:0.7635:0.2365:0.0	.	93;93;93	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	Y	93	ENSP00000421339:C93Y;ENSP00000369135:C93Y;ENSP00000373671:C93Y;ENSP00000421990:C93Y;ENSP00000369138:C93Y	ENSP00000369135:C93Y	C	-	2	0	SLCO6A1	101862170	0.002000	0.14202	0.007000	0.13788	0.004000	0.04260	0.712000	0.25779	0.994000	0.38892	0.484000	0.47621	TGC	.	.	none		0.502	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
RITA1	84934	hgsc.bcm.edu	37	12	113624824	113624824	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:113624824C>T	ENST00000548278.1	+	3	965	c.273C>T	c.(271-273)acC>acT	p.T91T	RP11-545P7.4_ENST00000552525.1_RNA|DDX54_ENST00000306014.5_5'Flank|C12orf52_ENST00000552495.1_Silent_p.T115T|DDX54_ENST00000314045.7_5'Flank|C12orf52_ENST00000549621.1_Silent_p.T91T	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		91					negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)	p.L92F(1)		large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						GCACCCCCACCCTCACACCAA	0.562																																					p.T91T		Atlas-SNP	.											.	C12orf52	19	.	1	Substitution - Missense(1)	lung(1)	c.C273T						PASS	.						35.0	39.0	37.0					12																	113624824		2197	4296	6493	SO:0001819	synonymous_variant	84934	exon3			CCCCACCCTCACA																												ENST00000548278.1:c.273C>T	12.37:g.113624824C>T		36.0	0.0	0		56.0	23.0	0.410714	NM_032848	B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Silent	SNP	ENST00000548278.1	37	CCDS9166.1																																																																																			.	.	none		0.562	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405239.1		
DAB1	1600	hgsc.bcm.edu	37	1	57480789	57480789	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:57480789T>G	ENST00000371231.1	-	13	1344	c.1310A>C	c.(1309-1311)gAc>gCc	p.D437A	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.D404A|DAB1_ENST00000439789.2_Missense_Mutation_p.D318A|DAB1_ENST00000420954.2_Missense_Mutation_p.D402A|DAB1_ENST00000371236.2_Missense_Mutation_p.D404A|DAB1_ENST00000414851.2_Missense_Mutation_p.D386A			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	437					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CCTGGGCTTGTCGGTCTGTGG	0.607																																					p.D404A		Atlas-SNP	.											.	DAB1	129	.	0			c.A1211C						PASS	.						76.0	72.0	74.0					1																	57480789		2203	4300	6503	SO:0001583	missense	1600	exon14			GGCTTGTCGGTCT	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1310A>C	1.37:g.57480789T>G	ENSP00000360275:p.Asp437Ala	126.0	0.0	0		98.0	38.0	0.387755	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		.	.	.	.	.	.	.	.	.	.	T	13.46	2.242995	0.39697	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.56611	0.45;0.45;0.48;0.52;1.56;0.5	5.54	4.41	0.53225	.	0.250480	0.47093	D	0.000257	T	0.32585	0.0834	N	0.08118	0	0.38346	D	0.944219	B;B;B;B;B	0.29988	0.264;0.002;0.023;0.006;0.007	B;B;B;B;B	0.29785	0.107;0.017;0.029;0.009;0.029	T	0.29761	-1.0001	10	0.48119	T	0.1	-22.3082	11.5505	0.50719	0.0:0.0695:0.0:0.9305	.	386;437;404;318;402	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	A	404;404;404;402;386;318;437	ENSP00000360280:D404A;ENSP00000360278:D404A;ENSP00000395296:D402A;ENSP00000387581:D386A;ENSP00000409328:D318A;ENSP00000360275:D437A	ENSP00000360275:D437A	D	-	2	0	DAB1	57253377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.749000	0.47492	1.114000	0.41781	0.528000	0.53228	GAC	.	.	none		0.607	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
MAP4K3	8491	hgsc.bcm.edu	37	2	39552696	39552696	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:39552696T>A	ENST00000263881.3	-	12	1205	c.881A>T	c.(880-882)cAt>cTt	p.H294L	MAP4K3_ENST00000536018.1_5'UTR|RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000437545.1_Missense_Mutation_p.H231L|MAP4K3_ENST00000341681.5_Missense_Mutation_p.H294L	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	294					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GTAAGTGGAATGATCTGGATT	0.353																																					p.H294L		Atlas-SNP	.											.	MAP4K3	109	.	0			c.A881T						PASS	.						107.0	105.0	106.0					2																	39552696		2203	4300	6503	SO:0001583	missense	8491	exon12			GTGGAATGATCTG	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.881A>T	2.37:g.39552696T>A	ENSP00000263881:p.His294Leu	253.0	1.0	0.00395257		252.0	102.0	0.404762	NM_001270425	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	CCDS1803.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375916	0.82682	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.25250	1.81;1.81;1.81	5.86	5.86	0.93980	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.31451	0.0797	M	0.71581	2.175	0.80722	D	1	B;B	0.12630	0.0;0.006	B;B	0.12837	0.003;0.008	T	0.05920	-1.0856	9	.	.	.	.	16.2405	0.82405	0.0:0.0:0.0:1.0	.	294;294	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	L	294;231;294	ENSP00000263881:H294L;ENSP00000416958:H231L;ENSP00000345434:H294L	.	H	-	2	0	MAP4K3	39406200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.509000	0.81698	2.238000	0.73509	0.477000	0.44152	CAT	.	.	none		0.353	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618	
XIRP2	129446	hgsc.bcm.edu	37	2	168100213	168100213	+	Missense_Mutation	SNP	C	C	T	rs548985321		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:168100213C>T	ENST00000409195.1	+	9	2400	c.2311C>T	c.(2311-2313)Cgg>Tgg	p.R771W	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R771W|XIRP2_ENST00000409273.1_Missense_Mutation_p.R549W|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	596					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.R771W(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGAACAGCACGGTGGATGTT	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		19204	0.0		0.0	False		,,,				2504	0.001				p.R771W		Atlas-SNP	.											XIRP2,colon,carcinoma,0,1	XIRP2	914	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2311T						PASS	.						72.0	67.0	69.0					2																	168100213		1863	4091	5954	SO:0001583	missense	129446	exon9			ACAGCACGGTGGA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2311C>T	2.37:g.168100213C>T	ENSP00000386840:p.Arg771Trp	222.0	0.0	0		150.0	68.0	0.453333	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296005	0.60086	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.39229	1.09;1.09;1.09	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	M	0.77486	2.375	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.66492	-0.5910	10	0.87932	D	0	-10.5946	10.2698	0.43477	0.135:0.7957:0.0:0.0693	.	596;596;549	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	W	771;771;549	ENSP00000386840:R771W;ENSP00000295237:R771W;ENSP00000387255:R549W	ENSP00000295237:R771W	R	+	1	2	XIRP2	167808459	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	1.731000	0.38135	2.810000	0.96702	0.650000	0.86243	CGG	.	.	none		0.388	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
NLRP5	126206	hgsc.bcm.edu	37	19	56538497	56538497	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:56538497G>A	ENST00000390649.3	+	7	898	c.898G>A	c.(898-900)Gtg>Atg	p.V300M		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	300	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CAGAAGGATCGTGCTGTGCTG	0.572																																					p.V300M		Atlas-SNP	.											.	NLRP5	217	.	0			c.G898A						PASS	.						47.0	53.0	51.0					19																	56538497		2103	4219	6322	SO:0001583	missense	126206	exon7			AGGATCGTGCTGT	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.898G>A	19.37:g.56538497G>A	ENSP00000375063:p.Val300Met	72.0	0.0	0		75.0	30.0	0.4	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	0.069	-1.205920	0.01568	.	.	ENSG00000171487	ENST00000390649	D	0.81908	-1.55	3.35	-0.145	0.13436	NACHT nucleoside triphosphatase (1);	1.025170	0.07825	N	0.960488	T	0.57917	0.2086	N	0.04116	-0.275	0.09310	N	1	B	0.30634	0.288	B	0.30782	0.12	T	0.51718	-0.8670	10	0.02654	T	1	.	5.3187	0.15870	0.2998:0.5492:0.151:0.0	.	300	P59047	NALP5_HUMAN	M	300	ENSP00000375063:V300M	ENSP00000375063:V300M	V	+	1	0	NLRP5	61230309	1.000000	0.71417	0.001000	0.08648	0.007000	0.05969	1.986000	0.40677	-0.028000	0.13850	-0.302000	0.09304	GTG	.	.	none		0.572	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
STRN	6801	hgsc.bcm.edu	37	2	37193498	37193498	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:37193498C>T	ENST00000263918.4	-	1	117	c.109G>A	c.(109-111)Gcg>Acg	p.A37T	STRN_ENST00000379213.2_Intron	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	37					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				gccgcagccgccccgtcgccg	0.751																																					p.A37T		Atlas-SNP	.											.	STRN	71	.	0			c.G109A						PASS	.						3.0	3.0	3.0					2																	37193498		1371	3032	4403	SO:0001583	missense	6801	exon1			CAGCCGCCCCGTC	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.109G>A	2.37:g.37193498C>T	ENSP00000263918:p.Ala37Thr	52.0	0.0	0		65.0	27.0	0.415385	NM_003162	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	37	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.261212	0.80246	.	.	ENSG00000115808	ENST00000263918	T	0.64618	-0.11	3.47	3.47	0.39725	.	0.423459	0.19848	N	0.104710	T	0.36771	0.0979	N	0.08118	0	0.80722	D	1	B	0.28470	0.213	B	0.21151	0.033	T	0.21724	-1.0237	10	0.25751	T	0.34	-0.3364	10.1491	0.42782	0.0:0.7949:0.2051:0.0	.	37	O43815	STRN_HUMAN	T	37	ENSP00000263918:A37T	ENSP00000263918:A37T	A	-	1	0	STRN	37047002	0.987000	0.35691	0.998000	0.56505	0.984000	0.73092	3.812000	0.55628	1.747000	0.51819	0.484000	0.47621	GCG	.	.	none		0.751	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		
MED16	10025	hgsc.bcm.edu	37	19	880103	880103	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:880103C>T	ENST00000589119.1	-	7	1186	c.1187G>A	c.(1186-1188)cGg>cAg	p.R396Q	MED16_ENST00000312090.6_Missense_Mutation_p.R396Q|MED16_ENST00000325464.1_Missense_Mutation_p.R396Q|MED16_ENST00000269814.4_Missense_Mutation_p.R396Q|MED16_ENST00000395808.3_Missense_Mutation_p.R396Q|MED16_ENST00000606828.1_Intron			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	396					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTGAGAGCCGGTGCACGAT	0.721																																					p.R396Q		Atlas-SNP	.											.	MED16	61	.	0			c.G1187A						PASS	.						20.0	21.0	21.0					19																	880103		2169	4279	6448	SO:0001583	missense	10025	exon8			GAGAGCCGGTGCA	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1187G>A	19.37:g.880103C>T	ENSP00000464810:p.Arg396Gln	102.0	0.0	0		98.0	37.0	0.377551	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	32	5.154168	0.94645	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	3.94	3.94	0.45596	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65831	0.2729	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.998	D;D;D;D;D	0.79108	0.986;0.988;0.986;0.986;0.992	T	0.69720	-0.5069	10	0.54805	T	0.06	-6.181	15.3215	0.74126	0.0:1.0:0.0:0.0	.	396;396;396;396;396	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	396;396;396;396;396;252;157;155;396	ENSP00000325612:R396Q;ENSP00000308528:R396Q;ENSP00000379153:R396Q;ENSP00000269814:R396Q	ENSP00000269814:R396Q	R	-	2	0	MED16	831103	1.000000	0.71417	0.994000	0.49952	0.760000	0.43138	6.990000	0.76225	1.910000	0.55303	0.561000	0.74099	CGG	.	.	none		0.721	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
DSEL	92126	hgsc.bcm.edu	37	18	65178778	65178778	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr18:65178778G>T	ENST00000310045.7	-	2	4571	c.3098C>A	c.(3097-3099)tCg>tAg	p.S1033*	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1023					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TGCCCTCATCGAAGCTCCTAA	0.408																																					p.S1033X		Atlas-SNP	.											DSEL,colon,carcinoma,0,2	DSEL	196	2	0			c.C3098A						PASS	.						81.0	86.0	84.0					18																	65178778		2203	4300	6503	SO:0001587	stop_gained	92126	exon2			CTCATCGAAGCTC	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3098C>A	18.37:g.65178778G>T	ENSP00000310565:p.Ser1033*	87.0	0.0	0		81.0	32.0	0.395062	NM_032160	Q17RH1|Q6P5Z3	Nonsense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	G	51	18.544858	0.99907	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	.	.	.	4.94	4.94	0.65067	.	0.084010	0.50627	U	0.000119	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1601	18.2215	0.89903	0.0:0.0:1.0:0.0	.	.	.	.	X	1033;1023	.	ENSP00000310565:S1033X	S	-	2	0	DSEL	63329758	1.000000	0.71417	0.820000	0.32676	0.993000	0.82548	9.733000	0.98818	2.292000	0.77174	0.558000	0.71614	TCG	.	.	none		0.408	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
KMT2C	58508	hgsc.bcm.edu	37	7	151896389	151896389	+	Silent	SNP	C	C	T	rs200269228		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr7:151896389C>T	ENST00000262189.6	-	27	4466	c.4248G>A	c.(4246-4248)tcG>tcA	p.S1416S	KMT2C_ENST00000355193.2_Silent_p.S1416S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1416					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGTTGGAGCCGAGGATGAAC	0.333													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16515	0.0		0.0	False		,,,				2504	0.0				p.S1416S		Atlas-SNP	.											.	MLL3	1564	.	0			c.G4248A						PASS	.						72.0	71.0	71.0					7																	151896389		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon27			TGGAGCCGAGGAT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4248G>A	7.37:g.151896389C>T		218.0	0.0	0		198.0	79.0	0.39899	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1																																																																																			C|1.000;T|0.000	0.000	strong		0.333	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ARID2	196528	hgsc.bcm.edu	37	12	46244016	46244016	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr12:46244016C>T	ENST00000334344.6	+	15	2282	c.2110C>T	c.(2110-2112)Caa>Taa	p.Q704*	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Nonsense_Mutation_p.Q314*|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Nonsense_Mutation_p.Q555*	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	704					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GACTGTCATTCAAAGTAAAGC	0.428			"""N, S, F"""		hepatocellular carcinoma																																p.Q704X		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	ARID2,lower_third,carcinoma,0,1	ARID2	311	1	0			c.C2110T						PASS	.						143.0	138.0	139.0					12																	46244016		2203	4300	6503	SO:0001587	stop_gained	196528	exon15			GTCATTCAAAGTA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2110C>T	12.37:g.46244016C>T	ENSP00000335044:p.Gln704*	211.0	0.0	0		182.0	78.0	0.428571	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	40	8.047537	0.98627	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	.	.	.	5.79	5.79	0.91817	.	0.344788	0.32204	N	0.006435	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-5.712	20.0413	0.97592	0.0:1.0:0.0:0.0	.	.	.	.	X	704;555;314	.	ENSP00000335044:Q704X	Q	+	1	0	ARID2	44530283	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.036000	0.70948	2.751000	0.94390	0.650000	0.86243	CAA	.	.	none		0.428	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
OR2T4	127074	hgsc.bcm.edu	37	1	248525640	248525640	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr1:248525640T>C	ENST00000366475.1	+	1	758	c.758T>C	c.(757-759)aTc>aCc	p.I253T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TATTTACTCATCCTCCTCACC	0.517																																					p.I253T		Atlas-SNP	.											OR2T4,brain,glioma,+1,1	OR2T4	126	1	0			c.T758C						scavenged	.						135.0	130.0	132.0					1																	248525640		2203	4300	6503	SO:0001583	missense	127074	exon1			TACTCATCCTCCT	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.758T>C	1.37:g.248525640T>C	ENSP00000355431:p.Ile253Thr	12.0	2.0	0.166667		64.0	28.0	0.4375	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.315398	0.23908	.	.	ENSG00000196944	ENST00000366475	T	0.00402	7.56	3.09	1.94	0.25998	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.01523	0.0049	H	0.95151	3.63	0.33277	D	0.561816	D	0.89917	1.0	D	0.85130	0.997	T	0.11299	-1.0593	10	0.87932	D	0	.	7.6506	0.28346	0.0:0.1075:0.0:0.8925	.	253	Q8NH00	OR2T4_HUMAN	T	253	ENSP00000355431:I253T	ENSP00000355431:I253T	I	+	2	0	OR2T4	246592263	1.000000	0.71417	0.061000	0.19648	0.014000	0.08584	4.666000	0.61554	0.295000	0.22570	-0.361000	0.07541	ATC	.	.	none		0.517	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
PRDM9	56979	hgsc.bcm.edu	37	5	23526712	23526712	+	Silent	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:23526712T>C	ENST00000296682.3	+	11	1697	c.1515T>C	c.(1513-1515)aaT>aaC	p.N505N		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	505					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAAAGTGAATCCAGGGAACA	0.438										HNSCC(3;0.000094)																											p.N505N		Atlas-SNP	.											.	PRDM9	344	.	0			c.T1515C						PASS	.						78.0	76.0	77.0					5																	23526712		1987	4170	6157	SO:0001819	synonymous_variant	56979	exon11			AGTGAATCCAGGG	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1515T>C	5.37:g.23526712T>C		98.0	0.0	0		85.0	45.0	0.529412	NM_020227	B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	CCDS43307.1																																																																																			.	.	none		0.438	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
DCDC1	341019	hgsc.bcm.edu	37	11	30915852	30915852	+	Silent	SNP	G	G	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:30915852G>T	ENST00000597505.1	-	33	4835	c.4836C>A	c.(4834-4836)ggC>ggA	p.G1612G	DCDC1_ENST00000406071.2_Silent_p.G350G			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTTCGGTCCAGCCTCCTTCAA	0.498																																					p.G719G		Atlas-SNP	.											.	DCDC5	137	.	0			c.C2157A						PASS	.						75.0	77.0	77.0					11																	30915852		1914	4127	6041	SO:0001819	synonymous_variant	100506627	exon16			GGTCCAGCCTCCT	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4836C>A	11.37:g.30915852G>T		186.0	0.0	0		177.0	80.0	0.451977	NM_020869	A6PVL6|B7WNX6|Q6ZU04	Silent	SNP	ENST00000597505.1	37																																																																																				.	.	none		0.498	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
PLXDC2	84898	hgsc.bcm.edu	37	10	20432282	20432282	+	Silent	SNP	A	A	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr10:20432282A>T	ENST00000377252.4	+	5	1441	c.600A>T	c.(598-600)gcA>gcT	p.A200A	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Silent_p.A151A	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	200					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						AGTACATAGCACCTTTAATGG	0.358																																					p.A200A		Atlas-SNP	.											PLXDC2,NS,carcinoma,+1,2	PLXDC2	108	2	0			c.A600T						scavenged	.						173.0	163.0	166.0					10																	20432282		2203	4300	6503	SO:0001819	synonymous_variant	84898	exon5			CATAGCACCTTTA	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.600A>T	10.37:g.20432282A>T		215.0	2.0	0.00930233		210.0	83.0	0.395238	NM_032812	Q96E59|Q96PD9|Q96SU9	Silent	SNP	ENST00000377252.4	37	CCDS7132.1																																																																																			.	.	none		0.358	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
WDPCP	51057	hgsc.bcm.edu	37	2	63661025	63661025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:63661025G>A	ENST00000272321.7	-	9	1206	c.679C>T	c.(679-681)Cga>Tga	p.R227*	WDPCP_ENST00000398544.3_Nonsense_Mutation_p.R68*|WDPCP_ENST00000409120.1_Nonsense_Mutation_p.R35*|WDPCP_ENST00000409199.1_Nonsense_Mutation_p.R35*|WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_Nonsense_Mutation_p.R227*	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	227					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GCTAGATGTCGCTCTGTTGTC	0.393																																					p.R227X		Atlas-SNP	.											WDPCP,colon,carcinoma,+1,3	WDPCP	79	3	0			c.C679T						scavenged	.						73.0	70.0	71.0					2																	63661025		1885	4097	5982	SO:0001587	stop_gained	51057	exon9			GATGTCGCTCTGT		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.679C>T	2.37:g.63661025G>A	ENSP00000272321:p.Arg227*	222.0	1.0	0.0045045		163.0	64.0	0.392638	NM_015910	Q53RW4|Q7Z2Z3	Nonsense_Mutation	SNP	ENST00000272321.7	37	CCDS42688.1	.	.	.	.	.	.	.	.	.	.	G	57	29.697367	0.99976	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544;ENST00000409562	.	.	.	5.43	3.64	0.41730	.	0.062767	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8926	11.2324	0.48920	0.1489:0.0:0.8511:0.0	.	.	.	.	X	227;35;35;68;227	.	ENSP00000272321:R227X	R	-	1	2	WDPCP	63514529	1.000000	0.71417	0.134000	0.22075	0.811000	0.45836	3.598000	0.54038	0.674000	0.31244	0.563000	0.77884	CGA	.	.	none		0.393	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
UGT1A6	54578	hgsc.bcm.edu	37	2	234652351	234652351	+	Intron	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:234652351G>A	ENST00000305139.6	+	2	1000				UGT1A3_ENST00000482026.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A6_ENST00000406651.1_Intron|DNAJB3_ENST00000449667.1_RNA|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CTCCGCCCCCGCCTCGCCATA	0.627																																					p.A71V		Atlas-SNP	.											.	.	.	.	0			c.C212T						PASS	.						97.0	108.0	105.0					2																	234652351		2007	4180	6187	SO:0001627	intron_variant	414061	exon1			GCCCCCGCCTCGC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-23329G>A	2.37:g.234652351G>A		107.0	0.0	0		97.0	41.0	0.42268	NM_001001394	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	ENST00000305139.6	37	CCDS2507.1																																																																																			.	.	none		0.627	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130988.1	NM_205862	
GPATCH2L	55668	hgsc.bcm.edu	37	14	76620825	76620825	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr14:76620825G>A	ENST00000261530.7	+	2	185	c.119G>A	c.(118-120)cGg>cAg	p.R40Q	GPATCH2L_ENST00000557263.1_Missense_Mutation_p.R40Q|GPATCH2L_ENST00000556663.1_Missense_Mutation_p.R40Q|GPATCH2L_ENST00000312858.5_Missense_Mutation_p.R40Q	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	40	Arg-rich.																CGGCAGCTTCGGAAACGCCGA	0.587																																					p.R40Q		Atlas-SNP	.											.	.	.	.	0			c.G119A						PASS	.						48.0	48.0	48.0					14																	76620825		2203	4300	6503	SO:0001583	missense	55668	exon2			AGCTTCGGAAACG	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.119G>A	14.37:g.76620825G>A	ENSP00000261530:p.Arg40Gln	99.0	0.0	0		71.0	34.0	0.478873	NM_017926	B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Missense_Mutation	SNP	ENST00000261530.7	37	CCDS9848.1	.	.	.	.	.	.	.	.	.	.	G	36	5.619242	0.96649	.	.	ENSG00000089916	ENST00000336993;ENST00000557542;ENST00000557263;ENST00000312858;ENST00000261530;ENST00000556663	T;T;T;T	0.61392	0.19;0.18;0.11;0.19	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	L	0.56199	1.76	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.81914	0.995;0.964;0.99	T	0.74928	-0.3497	10	0.66056	D	0.02	-16.1396	19.2547	0.93941	0.0:0.0:1.0:0.0	.	40;40;40	Q9NWQ4-1;Q9NWQ4-4;Q9NWQ4	.;.;CN118_HUMAN	Q	40	ENSP00000451587:R40Q;ENSP00000323775:R40Q;ENSP00000261530:R40Q;ENSP00000450657:R40Q	ENSP00000261530:R40Q	R	+	2	0	C14orf118	75690578	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.378000	0.97191	2.553000	0.86117	0.561000	0.74099	CGG	.	.	none		0.587	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926	
PCDH1	5097	hgsc.bcm.edu	37	5	141243763	141243763	+	Missense_Mutation	SNP	G	G	C	rs374090402		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:141243763G>C	ENST00000394536.3	-	3	2272	c.2133C>G	c.(2131-2133)aaC>aaG	p.N711K	PCDH1_ENST00000456271.1_Missense_Mutation_p.N699K|PCDH1_ENST00000287008.3_Missense_Mutation_p.N711K|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000536585.1_Missense_Mutation_p.N689K|PCDH1_ENST00000503492.1_Intron	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	711	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TATAGGGTGCGTTGTCATTCT	0.567																																					p.N711K	Ovarian(132;1609 1739 4190 14731 45037)	Atlas-SNP	.											.	PCDH1	119	.	0			c.C2133G						PASS	.						146.0	130.0	135.0					5																	141243763		2203	4300	6503	SO:0001583	missense	5097	exon3			GGGTGCGTTGTCA	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2133C>G	5.37:g.141243763G>C	ENSP00000378043:p.Asn711Lys	85.0	0.0	0		60.0	17.0	0.283333	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	g	7.871	0.728137	0.15507	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.31247	1.5;4.66;4.66;4.66;4.66	5.25	-8.9	0.00782	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.53938	D	0.000057	T	0.61135	0.2323	H	0.95437	3.67	0.44469	D	0.997404	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81540	-0.0886	10	0.87932	D	0	.	18.2689	0.90062	0.3802:0.0:0.6198:0.0	.	711;711	Q08174;Q08174-2	PCDH1_HUMAN;.	K	711;711;699;722;689	ENSP00000287008:N711K;ENSP00000378043:N711K;ENSP00000403497:N699K;ENSP00000350122:N722K;ENSP00000438825:N689K	ENSP00000287008:N711K	N	-	3	2	PCDH1	141223947	0.000000	0.05858	0.098000	0.21074	0.327000	0.28475	-1.247000	0.02893	-2.573000	0.00466	-1.884000	0.00543	AAC	.	.	alt		0.567	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
NDP	4693	hgsc.bcm.edu	37	X	43809178	43809178	+	Missense_Mutation	SNP	C	C	T	rs104894867		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:43809178C>T	ENST00000378062.5	-	3	676	c.269G>A	c.(268-270)cGt>cAt	p.R90H	NDP-AS1_ENST00000435093.1_RNA|NDP_ENST00000470584.1_5'UTR	NM_000266.3	NP_000257.1	Q00604	NDP_HUMAN	Norrie disease (pseudoglioma)	90	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.		R -> C (in ND). {ECO:0000269|PubMed:14635119}.|R -> P (in ND). {ECO:0000269|PubMed:1307245}.		canonical Wnt signaling pathway (GO:0060070)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extracellular matrix-cell signaling (GO:0035426)|nervous system development (GO:0007399)|placenta development (GO:0001890)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|vacuole organization (GO:0007033)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	frizzled binding (GO:0005109)|growth factor activity (GO:0008083)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(2)	3						ACAGGAGGAACGGAAGGGTTG	0.642											OREG0019744	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R90H		Atlas-SNP	.											.	NDP	12	.	0			c.G269A	GRCh37	CI056488|CM920503	NDP	I|M	rs104894867	PASS	.						60.0	42.0	48.0					X																	43809178		2203	4298	6501	SO:0001583	missense	4693	exon3			GAGGAACGGAAGG	X65882	CCDS14262.1	Xp11.4-p11.3	2013-02-26			ENSG00000124479	ENSG00000124479		"""Endogenous ligands"""	7678	protein-coding gene	gene with protein product		300658	"""exudative vitreoretinopathy 2 (X-linked)"""	EVR2		8252044	Standard	NM_000266		Approved	norrin	uc004dga.3	Q00604	OTTHUMG00000021391	ENST00000378062.5:c.269G>A	X.37:g.43809178C>T	ENSP00000367301:p.Arg90His	95.0	0.0	0	919	74.0	69.0	0.932432	NM_000266	B2R8K6|Q5JYH5	Missense_Mutation	SNP	ENST00000378062.5	37	CCDS14262.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633579	0.87660	.	.	ENSG00000124479	ENST00000378062	D	0.90900	-2.75	5.96	5.96	0.96718	Cystine knot (1);Cystine knot, C-terminal (2);	0.063268	0.64402	D	0.000007	D	0.89921	0.6855	N	0.14661	0.345	0.47441	D	0.999423	D	0.71674	0.998	P	0.56788	0.806	D	0.91752	0.5413	10	0.72032	D	0.01	-23.3466	19.3572	0.94420	0.0:1.0:0.0:0.0	.	90	Q00604	NDP_HUMAN	H	90	ENSP00000367301:R90H	ENSP00000367301:R90H	R	-	2	0	NDP	43694122	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.656000	0.54467	2.524000	0.85096	0.600000	0.82982	CGT	.	.	alt		0.642	NDP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056309.1	NM_000266	
MRVI1	10335	hgsc.bcm.edu	37	11	10655535	10655535	+	Silent	SNP	G	G	A	rs373779712		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:10655535G>A	ENST00000436272.1	-	2	360	c.282C>T	c.(280-282)acC>acT	p.T94T	MRVI1_ENST00000532037.1_5'UTR|MRVI1_ENST00000558540.1_Intron|MRVI1_ENST00000424001.1_Intron|MRVI1_ENST00000527509.2_Silent_p.T12T|MRVI1_ENST00000421747.1_Silent_p.T94T|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000423302.2_Silent_p.T103T|MRVI1_ENST00000531107.1_Silent_p.T94T|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000541483.1_Silent_p.T103T|MRVI1_ENST00000552103.1_Silent_p.T12T|MRVI1_ENST00000547195.1_Silent_p.T12T			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	94					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GGTTTTTGTCGGTTTCTCCTT	0.468																																					p.T103T		Atlas-SNP	.											.	MRVI1	113	.	0			c.C309T						PASS	.	G	,,,,,	1,3817		0,1,1908	82.0	79.0	80.0		282,36,,309,,309	-7.2	0.0	11		80	0,8256		0,0,4128	no	coding-synonymous,coding-synonymous,intron,coding-synonymous,utr-5,coding-synonymous	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	,,,,,	0,1,6036	AA,AG,GG		0.0,0.0262,0.0083	,,,,,	94/905,12/822,,103/707,,103/913	10655535	1,12073	1909	4128	6037	SO:0001819	synonymous_variant	10335	exon3			TTTGTCGGTTTCT	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.282C>T	11.37:g.10655535G>A		249.0	0.0	0		202.0	74.0	0.366337	NM_001206880	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	ENST00000436272.1	37																																																																																				.	.	weak		0.468	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
PSAPL1	768239	hgsc.bcm.edu	37	4	7436076	7436076	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr4:7436076C>A	ENST00000319098.4	-	1	624	c.531G>T	c.(529-531)caG>caT	p.Q177H	SORCS2_ENST00000507866.2_Intron|SORCS2_ENST00000329016.9_Intron|SORCS2_ENST00000511199.1_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	177					sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				lung(4)	4						CTTCAGGCGCCTGGCGGGGGT	0.622																																					p.Q177H		Atlas-SNP	.											.	PSAPL1	51	.	0			c.G531T						PASS	.						11.0	13.0	13.0					4																	7436076		1955	4126	6081	SO:0001583	missense	768239	exon1			AGGCGCCTGGCGG	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.531G>T	4.37:g.7436076C>A	ENSP00000317445:p.Gln177His	81.0	0.0	0		63.0	21.0	0.333333	NM_001085382	A0A184|Q8N7T4	Missense_Mutation	SNP	ENST00000319098.4	37	CCDS47009.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023559	0.35701	.	.	ENSG00000178597	ENST00000319098	T	0.67698	-0.28	3.47	0.512	0.16994	.	.	.	.	.	T	0.46946	0.1419	L	0.34521	1.04	0.09310	N	1	P	0.46277	0.875	B	0.38327	0.271	T	0.42120	-0.9470	9	0.56958	D	0.05	.	2.3999	0.04399	0.2405:0.4839:0.0:0.2756	.	177	Q6NUJ1	SAPL1_HUMAN	H	177	ENSP00000317445:Q177H	ENSP00000317445:Q177H	Q	-	3	2	PSAPL1	7486977	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.100000	0.15231	0.235000	0.21160	0.561000	0.74099	CAG	.	.	none		0.622	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1		
SEC24C	9632	hgsc.bcm.edu	37	10	75526107	75526107	+	Splice_Site	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr10:75526107G>A	ENST00000339365.2	+	13	1769		c.e13-1		SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Splice_Site|SEC24C_ENST00000546025.1_Splice_Site|SEC24C_ENST00000345254.4_Splice_Site|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					ACCTTCTACAGGGAGGGTGGG	0.498																																					.		Atlas-SNP	.											.	SEC24C	86	.	0			c.1608-1G>A						PASS	.						91.0	73.0	79.0					10																	75526107		2203	4300	6503	SO:0001630	splice_region_variant	9632	exon13			TCTACAGGGAGGG	D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1608-1G>A	10.37:g.75526107G>A		86.0	0.0	0		85.0	30.0	0.352941	NM_004922	B4DZT4|Q8WV25	Splice_Site	SNP	ENST00000339365.2	37	CCDS7332.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982734	0.74474	.	.	ENSG00000176986	ENST00000546025;ENST00000345254;ENST00000339365;ENST00000411652	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3409	0.98764	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24C	75196113	1.000000	0.71417	0.999000	0.59377	0.878000	0.50629	9.869000	0.99810	2.814000	0.96858	0.655000	0.94253	.	.	.	none		0.498	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048679.1		Intron
VEZF1	7716	hgsc.bcm.edu	37	17	56058016	56058016	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:56058016A>T	ENST00000581208.1	-	4	964	c.924T>A	c.(922-924)caT>caA	p.H308Q	VEZF1_ENST00000584396.1_Missense_Mutation_p.H299Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	308					angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						GGCTCTGCCCATGAGTCTTTA	0.438																																					p.H308Q		Atlas-SNP	.											VEZF1,NS,carcinoma,-2,1	VEZF1	50	1	0			c.T924A						scavenged	.						172.0	138.0	149.0					17																	56058016		2203	4300	6503	SO:0001583	missense	7716	exon4			CTGCCCATGAGTC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.924T>A	17.37:g.56058016A>T	ENSP00000462337:p.His308Gln	280.0	1.0	0.00357143		197.0	37.0	0.187817	NM_007146		Missense_Mutation	SNP	ENST00000581208.1	37	CCDS32687.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.634518	0.67130	.	.	ENSG00000136451	ENST00000258963	.	.	.	5.69	0.944	0.19537	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.80586	0.4651	H	0.94734	3.575	0.58432	D	0.999996	D	0.69078	0.997	D	0.64144	0.922	T	0.81265	-0.1011	9	0.87932	D	0	-2.1035	10.2282	0.43238	0.6257:0.0:0.3743:0.0	.	308	Q14119	VEZF1_HUMAN	Q	308	.	ENSP00000258963:H308Q	H	-	3	2	VEZF1	53413015	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	1.069000	0.30641	-0.115000	0.11915	-0.269000	0.10298	CAT	.	.	none		0.438	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
CCNC	892	hgsc.bcm.edu	37	6	99998133	99998133	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr6:99998133T>G	ENST00000520429.1	-	8	936	c.491A>C	c.(490-492)cAg>cCg	p.Q164P	CCNC_ENST00000518714.1_Missense_Mutation_p.Q164P|CCNC_ENST00000369220.4_Missense_Mutation_p.Q164P|CCNC_ENST00000521017.1_5'Flank|CCNC_ENST00000523985.1_Missense_Mutation_p.Q79P|CCNC_ENST00000523799.1_Missense_Mutation_p.Q79P|CCNC_ENST00000520371.1_Missense_Mutation_p.Q164P	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C	164					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		GCCCATGTCCTGCACATACTG	0.338																																					p.Q164P	GBM(57;273 1020 40094 44454 49348)	Atlas-SNP	.											.	CCNC	23	.	0			c.A491C						PASS	.						141.0	118.0	126.0					6																	99998133		2203	4300	6503	SO:0001583	missense	892	exon8			ATGTCCTGCACAT		CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.491A>C	6.37:g.99998133T>G	ENSP00000428982:p.Gln164Pro	155.0	0.0	0		83.0	67.0	0.807229	NM_005190	B4DPZ1|Q9H543	Missense_Mutation	SNP	ENST00000520429.1	37	CCDS34502.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661964	0.67700	.	.	ENSG00000112237	ENST00000520429;ENST00000369220;ENST00000520371;ENST00000523799;ENST00000486428;ENST00000523985;ENST00000518714;ENST00000524049	T;T;T;T;T;T;T;T	0.33654	1.84;1.83;1.83;1.42;1.4;1.42;1.83;1.44	5.63	5.63	0.86233	Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	M	0.71920	2.185	0.80722	D	1	P;P	0.36171	0.541;0.541	B;B	0.30029	0.11;0.11	T	0.07481	-1.0770	9	.	.	.	-5.2956	16.1988	0.82053	0.0:0.0:0.0:1.0	.	164;164	Q7Z4L3;P24863	.;CCNC_HUMAN	P	164;164;164;79;110;79;164;79	ENSP00000428982:Q164P;ENSP00000358222:Q164P;ENSP00000430381:Q164P;ENSP00000430014:Q79P;ENSP00000430077:Q110P;ENSP00000430119:Q79P;ENSP00000430294:Q164P;ENSP00000427885:Q79P	.	Q	-	2	0	CCNC	100104854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.994000	0.88315	2.284000	0.76573	0.529000	0.55759	CAG	.	.	none		0.338	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041613.2	NM_005190	
PHLDB3	653583	hgsc.bcm.edu	37	19	44006279	44006279	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr19:44006279G>A	ENST00000292140.5	-	3	730	c.370C>T	c.(370-372)Cgc>Tgc	p.R124C	PHLDB3_ENST00000599242.1_Missense_Mutation_p.R124C	NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	124							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TTCCTCTGGCGCTGTAGCTCC	0.657																																					p.R124C		Atlas-SNP	.											Q96HZ0_HUMAN,rectum,carcinoma,0,4	PHLDB3	30	4	0			c.C370T						PASS	.						26.0	28.0	27.0					19																	44006279		2202	4295	6497	SO:0001583	missense	653583	exon3			TCTGGCGCTGTAG		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.370C>T	19.37:g.44006279G>A	ENSP00000292140:p.Arg124Cys	132.0	0.0	0		125.0	61.0	0.488	NM_198850	Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	CCDS12621.2	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483661	0.84854	.	.	ENSG00000176531	ENST00000292140	T	0.47528	0.84	4.11	4.11	0.48088	.	0.938103	0.08873	N	0.881237	T	0.62732	0.2452	L	0.47716	1.5	0.39113	D	0.961502	D;D	0.89917	1.0;1.0	D;P	0.72338	0.977;0.848	T	0.59558	-0.7432	10	0.72032	D	0.01	.	12.2619	0.54655	0.0:0.0:1.0:0.0	.	124;124	Q6NSJ2-2;Q6NSJ2	.;PHLB3_HUMAN	C	124	ENSP00000292140:R124C	ENSP00000292140:R124C	R	-	1	0	PHLDB3	48698119	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.602000	0.61098	2.040000	0.60383	0.306000	0.20318	CGC	.	.	none		0.657	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2		
SIX6	4990	hgsc.bcm.edu	37	14	60976600	60976600	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr14:60976600G>A	ENST00000327720.5	+	1	932	c.484G>A	c.(484-486)Gcc>Acc	p.A162T		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	162					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		ACGTGAGCTCGCCCAGGCAAC	0.597																																					p.A162T		Atlas-SNP	.											.	SIX6	27	.	0			c.G484A						PASS	.						48.0	42.0	44.0					14																	60976600		2201	4300	6501	SO:0001583	missense	4990	exon1			GAGCTCGCCCAGG	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.484G>A	14.37:g.60976600G>A	ENSP00000328596:p.Ala162Thr	88.0	0.0	0		91.0	42.0	0.461538	NM_007374	Q6NT42|Q9P1X8	Missense_Mutation	SNP	ENST00000327720.5	37	CCDS9747.1	.	.	.	.	.	.	.	.	.	.	G	34	5.296643	0.95574	.	.	ENSG00000184302	ENST00000327720	D	0.98164	-4.76	5.38	5.38	0.77491	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99533	0.9833	H	0.99675	4.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97712	1.0191	10	0.72032	D	0.01	.	18.3062	0.90182	0.0:0.0:1.0:0.0	.	162	O95475	SIX6_HUMAN	T	162	ENSP00000328596:A162T	ENSP00000328596:A162T	A	+	1	0	SIX6	60046353	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.657000	0.98554	2.804000	0.96469	0.462000	0.41574	GCC	.	.	none		0.597	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
KCTD8	386617	hgsc.bcm.edu	37	4	44450163	44450163	+	Silent	SNP	C	C	T			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr4:44450163C>T	ENST00000360029.3	-	1	661	c.378G>A	c.(376-378)gaG>gaA	p.E126E	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	126					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GCCGCTCCTTCTCGGGGAAGT	0.617										HNSCC(17;0.042)																											p.E126E		Atlas-SNP	.											.	KCTD8	96	.	0			c.G378A						PASS	.						23.0	22.0	23.0					4																	44450163		2170	4255	6425	SO:0001819	synonymous_variant	386617	exon1			CTCCTTCTCGGGG	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.378G>A	4.37:g.44450163C>T		81.0	0.0	0		67.0	36.0	0.537313	NM_198353	A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1																																																																																			.	.	none		0.617	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
MUC15	143662	hgsc.bcm.edu	37	11	26582712	26582712	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr11:26582712T>C	ENST00000455601.2	-	4	1023	c.905A>G	c.(904-906)tAc>tGc	p.Y302C	ANO3_ENST00000531568.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.Y329C|ANO3_ENST00000529242.1_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.Y329C|MUC15_ENST00000527569.1_Missense_Mutation_p.Y279C|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000281268.8_Missense_Mutation_p.Y279C	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	302					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						AGTTGGATTGTAGTAGCTAGA	0.383																																					p.Y329C		Atlas-SNP	.											.	MUC15	88	.	0			c.A986G						PASS	.						151.0	138.0	142.0					11																	26582712		2203	4300	6503	SO:0001583	missense	143662	exon5			GGATTGTAGTAGC	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.905A>G	11.37:g.26582712T>C	ENSP00000397339:p.Tyr302Cys	295.0	0.0	0		283.0	22.0	0.0777385	NM_001135091	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	37	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389236	0.61956	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.48201	0.86;0.82;0.87;0.82;0.87	5.43	4.23	0.50019	.	0.000000	0.45361	D	0.000370	T	0.55386	0.1917	L	0.32530	0.975	0.33656	D	0.609055	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.66614	-0.5879	10	0.62326	D	0.03	-5.9356	11.3819	0.49763	0.1354:0.0:0.0:0.8646	.	279;302;329	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	C	302;329;279;329;279	ENSP00000397339:Y302C;ENSP00000416753:Y329C;ENSP00000281268:Y279C;ENSP00000431983:Y329C;ENSP00000431945:Y279C	ENSP00000281268:Y279C	Y	-	2	0	MUC15	26539288	1.000000	0.71417	0.986000	0.45419	0.780000	0.44128	2.385000	0.44371	2.187000	0.69744	0.482000	0.46254	TAC	.	.	none		0.383	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
EPPK1	83481	hgsc.bcm.edu	37	8	144940706	144940706	+	Missense_Mutation	SNP	C	C	T	rs112377501	byFrequency	TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr8:144940706C>T	ENST00000525985.1	-	2	6787	c.6716G>A	c.(6715-6717)cGc>cAc	p.R2239H				P58107	EPIPL_HUMAN	epiplakin 1	2239						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R2239H(2)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCTCCTGGCGGCCGGGCTG	0.701																																					p.R2239H		Atlas-SNP	.											EPPK1,NS,carcinoma,0,9	EPPK1	199	9	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.G6716A						scavenged	.						61.0	61.0	61.0					8																	144940706		2173	4243	6416	SO:0001583	missense	83481	exon1			TCCTGGCGGCCGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6716G>A	8.37:g.144940706C>T	ENSP00000436337:p.Arg2239His	62.0	2.0	0.0322581		80.0	4.0	0.05	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	16.79	3.221029	0.58560	.	.	ENSG00000227184	ENST00000525985	T	0.73047	-0.71	4.67	3.7	0.42460	.	.	.	.	.	T	0.50854	0.1640	L	0.38175	1.15	0.25587	N	0.986731	P	0.43938	0.822	B	0.30179	0.112	T	0.49093	-0.8975	9	0.45353	T	0.12	.	5.4805	0.16721	0.0:0.7826:0.0:0.2174	.	2239	E9PPU0	.	H	2239	ENSP00000436337:R2239H	ENSP00000436337:R2239H	R	-	2	0	EPPK1	145012694	.	.	0.959000	0.39883	0.982000	0.71751	.	.	2.420000	0.82092	0.591000	0.81541	CGC	C|0.993;T|0.007	0.007	strong		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
KRT17	3872	hgsc.bcm.edu	37	17	39775873	39775873	+	Silent	SNP	G	G	A	rs575174355		TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr17:39775873G>A	ENST00000311208.8	-	8	1339	c.1272C>T	c.(1270-1272)cgC>cgT	p.R424R	JUP_ENST00000540235.1_Silent_p.R583R	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	424	Tail.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				GGACCTGCTCGCGGGAGGAGA	0.652													g|||	1	0.000199681	0.0	0.0	5008	,	,		17112	0.0		0.0	False		,,,				2504	0.001				p.R424R	Pancreas(92;1242 2086 39193 50508)	Atlas-SNP	.											.	KRT17	57	.	0			c.C1272T						PASS	.						93.0	92.0	92.0					17																	39775873		2203	4300	6503	SO:0001819	synonymous_variant	3872	exon8			CTGCTCGCGGGAG	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.1272C>T	17.37:g.39775873G>A		354.0	0.0	0		358.0	157.0	0.438547	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Silent	SNP	ENST00000311208.8	37	CCDS11402.1																																																																																			.	.	none		0.652	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
CSNK1A1	1452	hgsc.bcm.edu	37	5	148930448	148930448	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr5:148930448G>C	ENST00000377843.2	-	1	559	c.80C>G	c.(79-81)tCc>tGc	p.S27C	CSNK1A1_ENST00000515748.2_Missense_Mutation_p.S27C|CSNK1A1_ENST00000515768.1_Missense_Mutation_p.S27C|CSNK1A1_ENST00000515435.1_5'Flank|CSNK1A1_ENST00000504676.1_5'Flank|CSNK1A1_ENST00000261798.5_Missense_Mutation_p.S27C	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	27	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GTCCCCGAAGGAGCCAGACCC	0.537																																					p.S27C	Colon(5;64 69 1309 10383)	Atlas-SNP	.											.	CSNK1A1	63	.	0			c.C80G						PASS	.						101.0	112.0	109.0					5																	148930448		2152	4284	6436	SO:0001583	missense	1452	exon1			CCGAAGGAGCCAG	AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.80C>G	5.37:g.148930448G>C	ENSP00000367074:p.Ser27Cys	106.0	0.0	0		95.0	90.0	0.947368	NM_001025105	D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Missense_Mutation	SNP	ENST00000377843.2	37	CCDS47303.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668650	0.88348	.	.	ENSG00000113712	ENST00000261798;ENST00000377843;ENST00000322237;ENST00000515768;ENST00000515748	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.68531	0.3011	H	0.99312	4.51	0.80722	D	1	D;D;D	0.62365	0.989;0.974;0.991	P;P;P	0.61397	0.888;0.749;0.877	D	0.83643	0.0151	10	0.87932	D	0	.	18.6698	0.91507	0.0:0.0:1.0:0.0	.	27;27;27	Q71TU5;P48729;P48729-2	.;KC1A_HUMAN;.	C	27	ENSP00000261798:S27C;ENSP00000367074:S27C;ENSP00000421689:S27C;ENSP00000421268:S27C	ENSP00000261798:S27C	S	-	2	0	CSNK1A1	148910641	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.596000	0.82721	2.634000	0.89283	0.561000	0.74099	TCC	.	.	none		0.537	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001892	
AWAT2	158835	hgsc.bcm.edu	37	X	69261726	69261726	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chrX:69261726G>A	ENST00000276101.3	-	7	939	c.934C>T	c.(934-936)Cgt>Tgt	p.R312C		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	312					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						AACAGTTTACGTAGGGCATCA	0.502																																					p.R312C	NSCLC(80;1334 1436 9350 24214 26427)	Atlas-SNP	.											.	AWAT2	36	.	0			c.C934T						PASS	.						165.0	127.0	140.0					X																	69261726		2203	4300	6503	SO:0001583	missense	158835	exon7			GTTTACGTAGGGC	BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.934C>T	X.37:g.69261726G>A	ENSP00000421172:p.Arg312Cys	123.0	0.0	0		108.0	89.0	0.824074	NM_001002254	Q6IEE3|Q6P437	Missense_Mutation	SNP	ENST00000276101.3	37	CCDS35320.1	.	.	.	.	.	.	.	.	.	.	G	3.291	-0.144980	0.06627	.	.	ENSG00000147160	ENST00000276101	D	0.93366	-3.21	4.94	-0.467	0.12150	.	0.674304	0.14683	N	0.304642	D	0.84660	0.5521	N	0.21240	0.645	0.09310	N	1	B	0.25486	0.127	B	0.23419	0.046	T	0.73285	-0.4031	10	0.49607	T	0.09	.	4.6613	0.12643	0.3968:0.0:0.4605:0.1427	.	312	Q6E213	AWAT2_HUMAN	C	312	ENSP00000421172:R312C	ENSP00000421172:R312C	R	-	1	0	AWAT2	69178451	0.002000	0.14202	0.000000	0.03702	0.087000	0.18053	1.168000	0.31859	-0.386000	0.07821	-0.190000	0.12839	CGT	.	.	none		0.502	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358738.1	NM_001002254	
DNAJC10	54431	hgsc.bcm.edu	37	2	183627529	183627529	+	Splice_Site	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr2:183627529G>A	ENST00000264065.7	+	22	2680		c.e22+1			NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10						cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAGAGCAAAGGTATGTCCAGA	0.413																																					.	Pancreas(56;860 1183 25669 35822 48585)	Atlas-SNP	.											.	DNAJC10	76	.	0			c.2265+1G>A						PASS	.						116.0	113.0	114.0					2																	183627529		2203	4300	6503	SO:0001630	splice_region_variant	54431	exon22			GCAAAGGTATGTC		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.2265+1G>A	2.37:g.183627529G>A		272.0	0.0	0		266.0	136.0	0.511278	NM_018981	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Splice_Site	SNP	ENST00000264065.7	37	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980875	0.34942	.	.	ENSG00000077232	ENST00000264065;ENST00000392392	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5399	0.91024	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJC10	183335774	1.000000	0.71417	0.999000	0.59377	0.097000	0.18754	7.235000	0.78143	2.816000	0.96949	0.563000	0.77884	.	.	.	none		0.413	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981	Intron
CNNM1	26507	hgsc.bcm.edu	37	10	101090081	101090081	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-A7CX-01A-12D-A382-10	TCGA-FF-A7CX-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4d394512-e495-472b-89e0-bb402f714949	3a9f03ca-8618-47eb-80a8-120d835ab714	g.chr10:101090081G>A	ENST00000356713.4	+	1	1226	c.937G>A	c.(937-939)Ggg>Agg	p.G313R	CNNM1_ENST00000370528.3_Missense_Mutation_p.G242R|CNNM1_ENST00000446890.1_Missense_Mutation_p.G242R|CNNM1_ENST00000370534.4_5'UTR	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	313	DUF21.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CGGGGGCACCGGGGAAGACTA	0.687																																					p.G313R		Atlas-SNP	.											CNNM1_ENST00000356713,NS,carcinoma,-1,1	CNNM1	101	1	0			c.G937A						PASS	.						7.0	11.0	10.0					10																	101090081		1994	4112	6106	SO:0001583	missense	26507	exon1			GGCACCGGGGAAG	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.937G>A	10.37:g.101090081G>A	ENSP00000349147:p.Gly313Arg	102.0	0.0	0		104.0	8.0	0.0769231	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610067	0.28712	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528	D;D;D	0.88741	-2.42;-2.42;-2.42	4.33	3.4	0.38934	Domain of unknown function DUF21 (1);	.	.	.	.	D	0.89234	0.6657	L	0.29908	0.895	0.80722	D	1	P;D	0.76494	0.941;0.999	B;D	0.76071	0.232;0.987	D	0.85675	0.1297	9	0.22706	T	0.39	-21.3627	12.086	0.53698	0.0:0.0:0.8264:0.1736	.	313;313	Q9NRU3-2;Q9NRU3	.;CNNM1_HUMAN	R	313;242;242	ENSP00000349147:G313R;ENSP00000406492:G242R;ENSP00000359559:G242R	ENSP00000349147:G313R	G	+	1	0	CNNM1	101080071	0.799000	0.28903	0.429000	0.26710	0.155000	0.21991	0.917000	0.28665	1.001000	0.39076	0.462000	0.41574	GGG	.	.	none		0.687	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
