#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRG4	10216	hgsc.bcm.edu	37	1	186277976	186277979	+	Frame_Shift_Del	DEL	GAGT	GAGT	-			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	GAGT	GAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:186277976_186277979delGAGT	ENST00000445192.2	+	7	3170_3173	c.3125_3128delGAGT	c.(3124-3129)agagtgfs	p.RV1042fs	PRG4_ENST00000367484.3_Frame_Shift_Del_p.RV571fs|RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367483.4_Frame_Shift_Del_p.RV1001fs|PRG4_ENST00000367486.3_Frame_Shift_Del_p.RV999fs|PRG4_ENST00000367485.4_Frame_Shift_Del_p.RV949fs	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1042					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						ACAATGCCTAGAGTGAGAAAACCA	0.446																																					p.1042_1043del		Pindel,Atlas-Indel	.											PRG4,NS,adenoma,-1,1	PRG4	259	1	0			c.3124_3127del	GRCh37	CD061459	PRG4	D		PASS	.																																			SO:0001589	frameshift_variant	10216	exon7			.	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3125_3128delGAGT	1.37:g.186277976_186277979delGAGT	ENSP00000399679:p.Arg1042fs	118.0	0.0	.		105.0	18.0	0.171	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Frame_Shift_Del	DEL	ENST00000445192.2	37	CCDS1369.1																																																																																			.	.	none		0.446	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PCDH15	65217	hgsc.bcm.edu	37	10	55782809	55782811	+	In_Frame_Del	DEL	ACA	ACA	-	rs483352837		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	ACA	ACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:55782809_55782811delACA	ENST00000320301.6	-	19	2761_2763	c.2367_2369delTGT	c.(2365-2370)gttgtg>gtg	p.789_790VV>V	PCDH15_ENST00000395445.1_In_Frame_Del_p.796_797VV>V|PCDH15_ENST00000395438.1_In_Frame_Del_p.789_790VV>V|PCDH15_ENST00000373965.2_In_Frame_Del_p.796_797VV>V|PCDH15_ENST00000437009.1_In_Frame_Del_p.718_719VV>V|PCDH15_ENST00000373955.1_In_Frame_Del_p.789_790VV>V|PCDH15_ENST00000395430.1_In_Frame_Del_p.789_790VV>V|PCDH15_ENST00000395432.2_In_Frame_Del_p.752_753VV>V|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000409834.1_In_Frame_Del_p.400_401VV>V|PCDH15_ENST00000395433.1_In_Frame_Del_p.767_768VV>V|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000361849.3_In_Frame_Del_p.789_790VV>V|PCDH15_ENST00000414778.1_In_Frame_Del_p.794_795VV>V|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	789	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.V790L(2)|p.V795L(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATCTGTTGCCACAACAACAAGTT	0.414										HNSCC(58;0.16)																											p.795_795del		Pindel,Atlas-Indel	.											PCDH15_ENST00000417177,NS,carcinoma,-2,4	PCDH15	1715	4	4	Substitution - Missense(4)	lung(4)	c.2383_2385del						PASS	.		,,,,,,,,,,,	6,4258		3,0,2129					,,,,,,,,,,,	4.9	1.0			181	21,8233		10,1,4116	no	coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding,coding	PCDH15	NM_033056.3,NM_001142773.1,NM_001142772.1,NM_001142771.1,NM_001142770.1,NM_001142769.1,NM_001142768.1,NM_001142767.1,NM_001142766.1,NM_001142765.1,NM_001142764.1,NM_001142763.1	,,,,,,,,,,,	13,1,6245	A1A1,A1R,RR		0.2544,0.1407,0.2157	,,,,,,,,,,,	,,,,,,,,,,,		27,12491				SO:0001651	inframe_deletion	65217	exon20			.	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2367_2369delTGT	10.37:g.55782815_55782817delACA	ENSP00000322604:p.Val790del	171.0	0.0	.		134.0	37.0	0.276	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	In_Frame_Del	DEL	ENST00000320301.6	37	CCDS7248.1																																																																																			.	.	none		0.414	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
MBNL2	10150	hgsc.bcm.edu	37	13	97928659	97928660	+	Frame_Shift_Ins	INS	-	-	AA	rs139620750		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr13:97928659_97928660insAA	ENST00000376673.3	+	2	951_952	c.170_171insAA	c.(169-174)ctaaagfs	p.LK57fs	MBNL2_ENST00000397601.1_Frame_Shift_Ins_p.LK57fs|MBNL2_ENST00000445661.2_Frame_Shift_Ins_p.LK57fs|MBNL2_ENST00000345429.6_Frame_Shift_Ins_p.LK57fs|MBNL2_ENST00000343600.4_Frame_Shift_Ins_p.LK57fs			Q5VZF2	MBNL2_HUMAN	muscleblind-like splicing regulator 2	57					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			TTTGATTCCCTAAAGGTAAGAG	0.371																																					p.L57fs		Pindel,Atlas-Indel	.											.	MBNL2	84	.	0			c.170_171insAA						PASS	.																																			SO:0001589	frameshift_variant	10150	exon2			.	AF061261	CCDS9483.1, CCDS9484.1	13q31.1	2013-01-18	2012-02-23		ENSG00000139793	ENSG00000139793		"""Zinc fingers, CCCH-type domain containing"""	16746	protein-coding gene	gene with protein product		607327	"""muscleblind-like 2 (Drosophila)"""			11929853	Standard	NM_207304		Approved	MBLL, MBLL39	uc001vmz.4	Q5VZF2	OTTHUMG00000017239	ENST00000376673.3:c.171_172dupAA	13.37:g.97928660_97928661dupAA	ENSP00000365861:p.Leu57fs	147.0	0.0	.		106.0	37.0	0.349	NM_207304	Q3SXY5|Q58F19|Q8NEV3|Q8TD82	Frame_Shift_Ins	INS	ENST00000376673.3	37																																																																																				.	.	none		0.371	MBNL2-202	KNOWN	basic	protein_coding	protein_coding		NM_144778	
SCN7A	6332	hgsc.bcm.edu	37	2	167313460	167313461	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:167313460_167313461delCT	ENST00000409855.1	-	10	1335_1336	c.1209_1210delAG	c.(1207-1212)agagttfs	p.RV403fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	403					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ATTTCACCAACTCTCTGCTTTT	0.332																																					p.404_404del		Pindel,Atlas-Indel	.											.	SCN7A	410	.	0			c.1210_1211del						PASS	.																																			SO:0001589	frameshift_variant	6332	exon10			.	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1209_1210delAG	2.37:g.167313464_167313465delCT	ENSP00000386796:p.Arg403fs	159.0	0.0	.		151.0	39.0	0.258	NM_002976		Frame_Shift_Del	DEL	ENST00000409855.1	37	CCDS46442.1																																																																																			.	.	none		0.332	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49433749	49433750	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:49433749_49433750delCT	ENST00000301067.7	-	31	7802_7803	c.7803_7804delAG	c.(7801-7806)acagggfs	p.G2602fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2602	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TAGCTCTCCCCTGTGGACCCGC	0.663																																					p.2602_2602del		Pindel,Atlas-Indel	.											.	MLL2	1173	.	0			c.7804_7805del						PASS	.																																			SO:0001589	frameshift_variant	8085	exon31			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7803_7804delAG	12.37:g.49433749_49433750delCT	ENSP00000301067:p.Gly2602fs	85.0	0.0	.		54.0	18.0	0.333	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.663	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
SPCS1	28972	hgsc.bcm.edu	37	3	52741760	52741760	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:52741760delC	ENST00000602728.1	+	4	410	c.241delC	c.(241-243)caafs	p.Q81fs	GLT8D1_ENST00000407584.3_5'Flank|GLT8D1_ENST00000266014.5_5'Flank|GLT8D1_ENST00000478968.2_5'Flank|SPCS1_ENST00000233025.7_Frame_Shift_Del_p.Q148fs|SPCS1_ENST00000423431.1_Frame_Shift_Del_p.Q59fs|GLT8D1_ENST00000491606.1_5'Flank			Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog (S. cerevisiae)	81					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		GTTACCTGTTCAAGAATCAAG	0.413																																					p.V147fs		Pindel,Atlas-Indel	.											.	SPCS1	20	.	0			c.441delT						PASS	.						123.0	126.0	125.0					3																	52741760		2203	4300	6503	SO:0001589	frameshift_variant	28972	exon4			.	AF092138	CCDS33769.2	3p21.31	2005-01-05			ENSG00000114902	ENSG00000114902			23401	protein-coding gene	gene with protein product		610358				8632014	Standard	NM_014041		Approved	SPC12, HSPC033, YJR010C-A, SPC1	uc011bei.2	Q9Y6A9	OTTHUMG00000154930	ENST00000602728.1:c.241delC	3.37:g.52741760delC	ENSP00000473265:p.Gln81fs	331.0	0.0	.		202.0	43.0	0.213	NM_014041	B3KNF8|Q9BVW1	Frame_Shift_Del	DEL	ENST00000602728.1	37																																																																																				.	.	none		0.413	SPCS1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467759.1	NM_014041	
TBC1D10B	26000	hgsc.bcm.edu	37	16	30369466	30369486	+	In_Frame_Del	DEL	CCGCTCCTTCTCCTGTTTCTG	CCGCTCCTTCTCCTGTTTCTG	-	rs144176745|rs549120802		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	CCGCTCCTTCTCCTGTTTCTG	CCGCTCCTTCTCCTGTTTCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:30369466_30369486delCCGCTCCTTCTCCTGTTTCTG	ENST00000409939.3	-	9	2286_2306	c.2206_2226delCAGAAACAGGAGAAGGAGCGG	c.(2206-2226)cagaaacaggagaaggagcggdel	p.QKQEKER736del	CD2BP2_ENST00000305596.3_5'Flank|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	736					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			gctccttctcccgctccttctcctgtttctgccgctccttc	0.584																																					p.736_743del		Pindel,Atlas-Indel	.											.	TBC1D10B	32	.	0			c.2207_2227del						PASS	.																																			SO:0001651	inframe_deletion	26000	exon9			.	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.2206_2226delCAGAAACAGGAGAAGGAGCGG	16.37:g.30369466_30369486delCCGCTCCTTCTCCTGTTTCTG	ENSP00000386538:p.Gln736_Arg742del	284.0	0.0	.		131.0	21.0	0.160	NM_015527	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	In_Frame_Del	DEL	ENST00000409939.3	37	CCDS10676.2																																																																																			.	.	none		0.584	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	
ITPRIPL2	162073	hgsc.bcm.edu	37	16	19126354	19126354	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:19126354C>T	ENST00000381440.3	+	1	1101	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	191						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCTGGAGCCACGGAGCCTGGG	0.716											OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R191W		Atlas-SNP	.											.	ITPRIPL2	40	.	0			c.C571T						PASS	.						9.0	13.0	11.0					16																	19126354		2072	4098	6170	SO:0001583	missense	162073	exon1			GAGCCACGGAGCC		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.571C>T	16.37:g.19126354C>T	ENSP00000370849:p.Arg191Trp	5.0	0.0	0	730	4.0	4.0	1	NM_001034841		Missense_Mutation	SNP	ENST00000381440.3	37	CCDS32395.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.301907	0.60195	.	.	ENSG00000205730	ENST00000381440	T	0.15603	2.41	4.67	3.67	0.42095	.	0.000000	0.29508	U	0.011950	T	0.25044	0.0608	N	0.24115	0.695	0.37413	D	0.913301	D	0.89917	1.0	D	0.66979	0.948	T	0.14783	-1.0460	10	0.59425	D	0.04	-13.6348	12.7941	0.57551	0.1644:0.8356:0.0:0.0	.	191	Q3MIP1	IPIL2_HUMAN	W	191	ENSP00000370849:R191W	ENSP00000370849:R191W	R	+	1	2	ITPRIPL2	19033855	0.145000	0.22656	0.938000	0.37757	0.804000	0.45430	1.856000	0.39389	2.137000	0.66172	0.655000	0.94253	CGG	.	.	none		0.716	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	NM_001034841	
R3HDM2	22864	hgsc.bcm.edu	37	12	57690294	57690294	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:57690294G>A	ENST00000347140.3	-	9	991	c.601C>T	c.(601-603)Cgg>Tgg	p.R201W	RP11-123K3.4_ENST00000548184.1_5'Flank|R3HDM2_ENST00000358907.2_Missense_Mutation_p.R201W|R3HDM2_ENST00000403821.2_Missense_Mutation_p.R201W|R3HDM2_ENST00000413953.2_5'Flank|R3HDM2_ENST00000402412.1_Missense_Mutation_p.R201W			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	201	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AATAGCATCCGGTGATATGAG	0.408																																					p.R201W		Atlas-SNP	.											.	R3HDM2	125	.	0			c.C601T						PASS	.						118.0	92.0	100.0					12																	57690294		692	1591	2283	SO:0001583	missense	22864	exon7			GCATCCGGTGATA	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.601C>T	12.37:g.57690294G>A	ENSP00000317903:p.Arg201Trp	134.0	0.0	0		69.0	17.0	0.246377	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185177	0.78677	.	.	ENSG00000179912	ENST00000347140;ENST00000402412;ENST00000358907;ENST00000403821;ENST00000547262	D;D;D;D;D	0.99098	-5.42;-5.42;-5.42;-5.42;-5.42	4.79	4.79	0.61399	Single-stranded nucleic acid binding R3H (3);	0.000000	0.85682	D	0.000000	D	0.99239	0.9735	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98758	1.0723	9	.	.	.	-20.0351	10.7182	0.46026	0.0:0.0:0.7054:0.2946	.	201;201	B5MCU0;Q9Y2K5	.;R3HD2_HUMAN	W	201;201;201;201;89	ENSP00000317903:R201W;ENSP00000385839:R201W;ENSP00000351784:R201W;ENSP00000385169:R201W;ENSP00000450411:R89W	.	R	-	1	2	R3HDM2	55976561	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.007000	0.49536	2.653000	0.90120	0.655000	0.94253	CGG	.	.	none		0.408	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
PCYT1B	9468	hgsc.bcm.edu	37	X	24608245	24608245	+	Missense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:24608245C>A	ENST00000379144.2	-	4	511	c.381G>T	c.(379-381)atG>atT	p.M127I	PCYT1B_ENST00000379145.1_Missense_Mutation_p.M109I|PCYT1B_ENST00000356768.4_Missense_Mutation_p.M127I	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	127					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	CGGCTTCATTCATCACGGTGA	0.473																																					p.M127I		Atlas-SNP	.											.	PCYT1B	88	.	0			c.G381T						PASS	.						142.0	109.0	121.0					X																	24608245		2203	4300	6503	SO:0001583	missense	9468	exon4			TTCATTCATCACG	AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.381G>T	X.37:g.24608245C>A	ENSP00000368439:p.Met127Ile	130.0	0.0	0		114.0	43.0	0.377193	NM_004845	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	ENST00000379144.2	37	CCDS14213.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743164	0.89663	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96041	-3.89;-3.89;-3.89	5.44	5.44	0.79542	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.96830	0.8965	M	0.62016	1.91	0.80722	D	1	D;P;P	0.56968	0.978;0.877;0.746	P;P;P	0.60236	0.871;0.823;0.686	D	0.97087	0.9788	10	0.62326	D	0.03	-23.8847	18.3331	0.90277	0.0:1.0:0.0:0.0	.	127;109;127	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	I	109;127;127	ENSP00000368440:M109I;ENSP00000368439:M127I;ENSP00000349211:M127I	ENSP00000349211:M127I	M	-	3	0	PCYT1B	24518166	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.320000	0.79064	2.524000	0.85096	0.600000	0.82982	ATG	.	.	none		0.473	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056103.1	NM_004845	
GSTA3	2940	hgsc.bcm.edu	37	6	52764808	52764808	+	Missense_Mutation	SNP	C	C	A	rs45602042	byFrequency	TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:52764808C>A	ENST00000211122.3	-	5	403	c.338G>T	c.(337-339)cGa>cTa	p.R113L	GSTA3_ENST00000370968.1_Missense_Mutation_p.R63L	NM_000847.4	NP_000838.3	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	113	GST C-terminal.		R -> Q (in dbSNP:rs45602042). {ECO:0000269|Ref.3}.	RP -> PA (in Ref. 1; AAA74634). {ECO:0000305}.	glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)	10	Lung NSC(77;0.0912)				Glutathione(DB00143)	TTCCTCAGGTCGACATAAGGG	0.388																																					p.R113L		Atlas-SNP	.											GSTA3,caecum,carcinoma,-1,1	GSTA3	21	1	0			c.G338T						PASS	.						194.0	177.0	183.0					6																	52764808		2203	4300	6503	SO:0001583	missense	2940	exon5			TCAGGTCGACATA	AF020919	CCDS4947.1	6p12.2	2012-06-21	2008-11-26		ENSG00000174156	ENSG00000174156	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4628	protein-coding gene	gene with protein product		605449	"""glutathione S-transferase A3"""			8307579, 9480897	Standard	NM_000847		Approved		uc003pbb.3	Q16772	OTTHUMG00000014865	ENST00000211122.3:c.338G>T	6.37:g.52764808C>A	ENSP00000211122:p.Arg113Leu	175.0	0.0	0		147.0	55.0	0.37415	NM_000847	O43468|Q068V6|Q8WWA8|Q9H415	Missense_Mutation	SNP	ENST00000211122.3	37	CCDS4947.1	.	.	.	.	.	.	.	.	.	.	C	8.320	0.824098	0.16678	.	.	ENSG00000174156	ENST00000370968;ENST00000211122;ENST00000431899	T;T;T	0.06849	4.49;4.49;3.25	3.91	1.91	0.25777	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.290327	0.31461	N	0.007611	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47262	-0.9131	10	0.48119	T	0.1	.	8.2476	0.31698	0.0:0.1509:0.579:0.2701	.	113	Q16772	GSTA3_HUMAN	L	63;113;63	ENSP00000360007:R63L;ENSP00000211122:R113L;ENSP00000399142:R63L	ENSP00000211122:R113L	R	-	2	0	GSTA3	52872767	0.352000	0.24895	0.008000	0.14137	0.007000	0.05969	2.182000	0.42556	0.971000	0.38288	-0.340000	0.08031	CGA	C|0.989;T|0.011	.	alt		0.388	GSTA3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040933.1		
ADAM23	8745	hgsc.bcm.edu	37	2	207437855	207437855	+	Missense_Mutation	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:207437855A>G	ENST00000264377.3	+	18	2001	c.1673A>G	c.(1672-1674)tAt>tGt	p.Y558C	ADAM23_ENST00000374416.1_Missense_Mutation_p.Y558C|ADAM23_ENST00000374415.3_Missense_Mutation_p.Y558C	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	558	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CCACGAGGGTATGAATGCCGG	0.373																																					p.Y558C	Melanoma(194;1127 2130 19620 24042 27855)	Atlas-SNP	.											.	ADAM23	239	.	0			c.A1673G						PASS	.						232.0	210.0	218.0					2																	207437855		2203	4300	6503	SO:0001583	missense	8745	exon18			GAGGGTATGAATG	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1673A>G	2.37:g.207437855A>G	ENSP00000264377:p.Tyr558Cys	119.0	0.0	0		100.0	4.0	0.04	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.247881	0.59103	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.11385	2.78;2.78;2.78	5.99	5.99	0.97316	Blood coagulation inhibitor, Disintegrin (5);	0.107594	0.41712	D	0.000829	T	0.29158	0.0725	M	0.76838	2.35	0.58432	D	0.999999	D	0.57571	0.98	P	0.59115	0.852	T	0.01858	-1.1259	10	0.62326	D	0.03	.	11.9424	0.52909	0.855:0.145:0.0:0.0	.	558	O75077	ADA23_HUMAN	C	558;558;452;558	ENSP00000264377:Y558C;ENSP00000363537:Y558C;ENSP00000363536:Y558C	ENSP00000264377:Y558C	Y	+	2	0	ADAM23	207146100	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	4.789000	0.62446	2.304000	0.77564	0.529000	0.55759	TAT	.	.	none		0.373	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
FAM118B	79607	hgsc.bcm.edu	37	11	126110774	126110774	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:126110774A>G	ENST00000533050.1	+	4	667	c.174A>G	c.(172-174)caA>caG	p.Q58Q	FAM118B_ENST00000360194.4_Silent_p.Q58Q|FAM118B_ENST00000525728.1_3'UTR|FAM118B_ENST00000529731.1_Silent_p.Q58Q	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	58								p.Q58H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		TTGCGCCCCAAGTTCCAGCCC	0.438																																					p.Q58Q		Atlas-SNP	.											FAM118B,caecum,carcinoma,0,1	FAM118B	29	1	1	Substitution - Missense(1)	large_intestine(1)	c.A174G						scavenged	.						192.0	206.0	201.0					11																	126110774		2201	4299	6500	SO:0001819	synonymous_variant	79607	exon4			GCCCCAAGTTCCA	BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.174A>G	11.37:g.126110774A>G		146.0	1.0	0.00684932		71.0	33.0	0.464789	NM_024556	Q9H7B0	Silent	SNP	ENST00000533050.1	37	CCDS8470.1																																																																																			.	.	none		0.438	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386346.1	NM_024556	
ERCC5	2073	hgsc.bcm.edu	37	13	103515306	103515306	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr13:103515306G>A	ENST00000355739.4	+	8	3230	c.1807G>A	c.(1807-1809)Gtg>Atg	p.V603M	ERCC5_ENST00000375954.1_5'Flank|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.C1028Y	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	603					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TGTGGAAAATGTGGTGTCATT	0.408			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.V1057M		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.G3169A						PASS	.						79.0	76.0	77.0					13																	103515306		2203	4300	6503	SO:0001583	missense	0	exon16	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GAAAATGTGGTGT	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.1807G>A	13.37:g.103515306G>A	ENSP00000347978:p.Val603Met	124.0	0.0	0		95.0	30.0	0.315789	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058536	0.55325	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955	T	0.05081	3.5	5.72	4.01	0.46588	.	1.630770	0.03085	N	0.158987	T	0.10723	0.0262	L	0.43152	1.355	0.09310	N	0.999999	P;P;P	0.46395	0.868;0.744;0.877	P;B;B	0.45506	0.483;0.31;0.365	T	0.26155	-1.0111	10	0.40728	T	0.16	-0.086	7.6996	0.28615	0.2635:0.0:0.7365:0.0	.	603;603;1028	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	M	1028;603;435	ENSP00000347978:V603M	ENSP00000347978:V603M	V	+	1	0	ERCC5	102313307	0.000000	0.05858	0.002000	0.10522	0.455000	0.32408	0.187000	0.16998	0.791000	0.33826	-0.186000	0.12905	GTG	.	.	none		0.408	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
ZNF319	57567	hgsc.bcm.edu	37	16	58032032	58032032	+	Silent	SNP	G	G	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:58032032G>T	ENST00000299237.2	-	2	760	c.138C>A	c.(136-138)ggC>ggA	p.G46G	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	46	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						AGACGGCACAGCCCAGGGGGT	0.706																																					p.G46G		Atlas-SNP	.											.	ZNF319	42	.	0			c.C138A						PASS	.						42.0	43.0	43.0					16																	58032032		2197	4299	6496	SO:0001819	synonymous_variant	57567	exon2			GGCACAGCCCAGG	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.138C>A	16.37:g.58032032G>T		40.0	0.0	0		32.0	9.0	0.28125	NM_020807	Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																			.	.	none		0.706	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
CSMD1	64478	hgsc.bcm.edu	37	8	4494939	4494939	+	Missense_Mutation	SNP	G	G	T	rs562417147		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:4494939G>T	ENST00000520002.1	-	2	782	c.227C>A	c.(226-228)aCc>aAc	p.T76N	CSMD1_ENST00000539096.1_Missense_Mutation_p.T76N|CSMD1_ENST00000537824.1_Missense_Mutation_p.T76N|CSMD1_ENST00000602723.1_Missense_Mutation_p.T76N|CSMD1_ENST00000542608.1_Missense_Mutation_p.T76N|CSMD1_ENST00000400186.3_Missense_Mutation_p.T76N|CSMD1_ENST00000602557.1_Missense_Mutation_p.T76N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	76	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGAGCAAAGGTATGGAAGGA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		14473	0.001		0.0	False		,,,				2504	0.0				p.T76N		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C227A						PASS	.						132.0	131.0	131.0					8																	4494939		1923	4156	6079	SO:0001583	missense	64478	exon2			GCAAAGGTATGGA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.227C>A	8.37:g.4494939G>T	ENSP00000430733:p.Thr76Asn	144.0	0.0	0		78.0	39.0	0.5	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	14.03	2.413876	0.42817	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	5.12	5.12	0.69794	.	.	.	.	.	T	0.13286	0.0322	N	0.12569	0.235	0.29907	N	0.823931	P	0.34587	0.458	B	0.43052	0.406	T	0.14309	-1.0477	9	0.26408	T	0.33	.	9.6543	0.39917	0.0954:0.0:0.9046:0.0	.	76	E5RIG2	.	N	76	ENSP00000383047:T76N;ENSP00000430733:T76N;ENSP00000441462:T76N;ENSP00000446243:T76N;ENSP00000441675:T76N	ENSP00000383047:T76N	T	-	2	0	CSMD1	4482347	1.000000	0.71417	0.951000	0.38953	0.965000	0.64279	5.671000	0.68095	2.401000	0.81631	0.585000	0.79938	ACC	.	.	none		0.423	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ZSCAN20	7579	hgsc.bcm.edu	37	1	33959918	33959918	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:33959918C>T	ENST00000361328.3	+	8	2127	c.1974C>T	c.(1972-1974)tgC>tgT	p.C658C		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	658					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AAGCTGTTTGCCAACCTCTTG	0.448																																					p.C658C		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C1974T						PASS	.						71.0	70.0	70.0					1																	33959918		1865	4109	5974	SO:0001819	synonymous_variant	7579	exon8			TGTTTGCCAACCT	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1974C>T	1.37:g.33959918C>T		240.0	0.0	0		169.0	73.0	0.431953	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	CCDS41300.1																																																																																			.	.	none		0.448	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
PATE1	160065	hgsc.bcm.edu	37	11	125616559	125616559	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:125616559T>C	ENST00000305738.5	+	2	68	c.56T>C	c.(55-57)tTa>tCa	p.L19S	PATE1_ENST00000437148.2_Missense_Mutation_p.L19S	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	19						extracellular region (GO:0005576)				large_intestine(1)|lung(5)	6						CCAACAGCATTATCTGGATCA	0.418																																					p.L19S		Atlas-SNP	.											.	PATE1	21	.	0			c.T56C						PASS	.						132.0	132.0	132.0					11																	125616559		2201	4299	6500	SO:0001583	missense	160065	exon2			CAGCATTATCTGG	AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.56T>C	11.37:g.125616559T>C	ENSP00000307164:p.Leu19Ser	174.0	0.0	0		128.0	44.0	0.34375	NM_138294	Q3KNX2	Missense_Mutation	SNP	ENST00000305738.5	37	CCDS8464.1	.	.	.	.	.	.	.	.	.	.	T	3.058	-0.193988	0.06259	.	.	ENSG00000171053	ENST00000305738;ENST00000437148	T;T	0.31247	1.5;1.5	3.7	0.0174	0.14112	.	1.465370	0.05162	N	0.498016	T	0.19327	0.0464	N	0.12182	0.205	0.09310	N	1	P;P	0.47762	0.739;0.9	B;P	0.44477	0.305;0.451	T	0.12167	-1.0558	10	0.72032	D	0.01	-10.9707	3.1939	0.06626	0.0:0.2353:0.2167:0.548	.	19;19	Q8WXA2-2;Q8WXA2	.;PATE1_HUMAN	S	19	ENSP00000307164:L19S;ENSP00000396056:L19S	ENSP00000307164:L19S	L	+	2	0	PATE1	125121769	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.289000	0.18957	-0.012000	0.14223	0.459000	0.35465	TTA	.	.	none		0.418	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386726.2	NM_138294	
CSMD1	64478	hgsc.bcm.edu	37	8	4494914	4494914	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:4494914A>G	ENST00000520002.1	-	2	807	c.252T>C	c.(250-252)gaT>gaC	p.D84D	CSMD1_ENST00000539096.1_Silent_p.D84D|CSMD1_ENST00000537824.1_Silent_p.D84D|CSMD1_ENST00000602723.1_Silent_p.D84D|CSMD1_ENST00000542608.1_Silent_p.D84D|CSMD1_ENST00000400186.3_Silent_p.D84D|CSMD1_ENST00000602557.1_Silent_p.D84D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	84	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTGATAAAATATCAAAATCTT	0.398																																					p.D84D		Atlas-SNP	.											.	CSMD1	1469	.	0			c.T252C						PASS	.						121.0	121.0	121.0					8																	4494914		1894	4130	6024	SO:0001819	synonymous_variant	64478	exon2			TAAAATATCAAAA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.252T>C	8.37:g.4494914A>G		109.0	0.0	0		64.0	34.0	0.53125	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37																																																																																				.	.	none		0.398	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
C2CD4C	126567	hgsc.bcm.edu	37	19	407323	407323	+	Missense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:407323C>A	ENST00000332235.6	-	2	1212	c.1039G>T	c.(1039-1041)Ggc>Tgc	p.G347C		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	347	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.									large_intestine(1)|pancreas(1)	2						AGGCACAGGCCCACGCAGCAG	0.687																																					p.G347C		Atlas-SNP	.											.	C2CD4C	13	.	0			c.G1039T						PASS	.						19.0	20.0	20.0					19																	407323		691	1588	2279	SO:0001583	missense	126567	exon2			ACAGGCCCACGCA	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.1039G>T	19.37:g.407323C>A	ENSP00000328677:p.Gly347Cys	16.0	0.0	0		22.0	17.0	0.772727	NM_001136263	Q8N3H7	Missense_Mutation	SNP	ENST00000332235.6	37	CCDS45890.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821949	0.50633	.	.	ENSG00000183186	ENST00000332235	T	0.68903	-0.36	3.74	2.69	0.31865	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.309004	0.29028	U	0.013376	T	0.66376	0.2783	L	0.36672	1.1	0.27566	N	0.950037	P	0.51351	0.944	P	0.59115	0.852	T	0.58233	-0.7672	10	0.72032	D	0.01	.	6.5483	0.22418	0.1899:0.7066:0.0:0.1035	.	347	Q8TF44	C2C4C_HUMAN	C	347	ENSP00000328677:G347C	ENSP00000328677:G347C	G	-	1	0	C2CD4C	358323	0.466000	0.25823	0.993000	0.49108	0.989000	0.77384	0.930000	0.28858	0.676000	0.31285	0.561000	0.74099	GGC	.	.	none		0.687	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
B2M	567	hgsc.bcm.edu	37	15	45007710	45007710	+	Missense_Mutation	SNP	T	T	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr15:45007710T>A	ENST00000558401.1	+	2	227	c.157T>A	c.(157-159)Tcc>Acc	p.S53T	B2M_ENST00000559916.1_Missense_Mutation_p.S53T|B2M_ENST00000544417.1_Missense_Mutation_p.S53T|B2M_ENST00000559220.1_Intron	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	53	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GTTTCATCCATCCGACATTGA	0.403																																					p.S53T		Atlas-SNP	.											B2M,colon,carcinoma,-2,1	B2M	99	1	0			c.T157A						PASS	.						187.0	191.0	189.0					15																	45007710		2198	4298	6496	SO:0001583	missense	567	exon2			CATCCATCCGACA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.157T>A	15.37:g.45007710T>A	ENSP00000452780:p.Ser53Thr	123.0	0.0	0		103.0	87.0	0.84466	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.065633	0.36470	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.09073	3.02	6.03	4.15	0.48705	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.101727	0.64402	D	0.000001	T	0.13798	0.0334	L	0.52573	1.65	0.26086	N	0.981025	P;P;B	0.38992	0.653;0.594;0.302	B;P;B	0.47645	0.418;0.553;0.173	T	0.04360	-1.0957	10	0.87932	D	0	.	8.9614	0.35849	0.0:0.8383:0.0:0.1617	.	53;53;53	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	T	53	ENSP00000437604:S53T	ENSP00000340858:S53T	S	+	1	0	B2M	42795002	0.901000	0.30685	0.893000	0.35052	0.090000	0.18270	2.330000	0.43885	0.866000	0.35629	-0.912000	0.02778	TCC	.	.	none		0.403	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
KRTAP21-1	337977	hgsc.bcm.edu	37	21	32127679	32127679	+	Silent	SNP	G	G	A	rs147444076		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr21:32127679G>A	ENST00000335093.3	-	1	67	c.18C>T	c.(16-18)taC>taT	p.Y6Y		NM_181619.1	NP_853650.1	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	6						intermediate filament (GO:0005882)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7						agGAGTTGCCGTAGTAGTTGC	0.517													g|||	1	0.000199681	0.0	0.0	5008	,	,		18266	0.0		0.001	False		,,,				2504	0.0				p.Y6Y		Atlas-SNP	.											KRTAP21-1,NS,carcinoma,0,1	KRTAP21-1	23	1	0			c.C18T						PASS	.	G		0,4406		0,0,2203	125.0	118.0	121.0		18	-2.4	0.1	21	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRTAP21-1	NM_181619.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		6/80	32127679	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	337977	exon1			GTTGCCGTAGTAG	AP001709	CCDS13606.1	21q22.1	2006-03-13			ENSG00000187005	ENSG00000187005		"""Keratin associated proteins"""	18945	protein-coding gene	gene with protein product						12359730	Standard	NM_181619		Approved	KAP21.1	uc011adi.2	Q3LI58	OTTHUMG00000057777	ENST00000335093.3:c.18C>T	21.37:g.32127679G>A		41.0	0.0	0		34.0	19.0	0.558824	NM_181619		Silent	SNP	ENST00000335093.3	37	CCDS13606.1																																																																																			G|1.000;A|0.000	0.000	strong		0.517	KRTAP21-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128229.2		
ZNF438	220929	hgsc.bcm.edu	37	10	31138094	31138094	+	Silent	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:31138094T>G	ENST00000361310.3	-	6	1569	c.1240A>C	c.(1240-1242)Aga>Cga	p.R414R	ZNF438_ENST00000375311.1_5'UTR|ZNF438_ENST00000331737.6_Silent_p.R404R|ZNF438_ENST00000442986.1_Silent_p.R414R|ZNF438_ENST00000436087.2_Silent_p.R414R|ZNF438_ENST00000413025.1_Silent_p.R414R|ZNF438_ENST00000444692.2_Silent_p.R404R|ZNF438_ENST00000538351.2_Silent_p.R365R|ZNF438_ENST00000452305.1_Silent_p.R404R			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	414					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TTTTTTACTCTTTCTTTACCA	0.373																																					p.R414R		Atlas-SNP	.											.	ZNF438	90	.	0			c.A1240C						PASS	.						66.0	73.0	70.0					10																	31138094		2203	4298	6501	SO:0001819	synonymous_variant	220929	exon7			TTACTCTTTCTTT	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1240A>C	10.37:g.31138094T>G		57.0	0.0	0		64.0	29.0	0.453125	NM_182755	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Silent	SNP	ENST00000361310.3	37	CCDS7168.1																																																																																			.	.	none		0.373	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755	
FAIM	55179	hgsc.bcm.edu	37	3	138341028	138341028	+	Splice_Site	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:138341028A>G	ENST00000393035.2	+	3	220		c.e3-1		FAIM_ENST00000338446.4_Splice_Site|FAIM_ENST00000360570.3_Splice_Site|FAIM_ENST00000393034.2_Splice_Site|FAIM_ENST00000464668.1_Splice_Site	NM_001033032.1	NP_001028204.1	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)	cytoplasm (GO:0005737)				kidney(1)|upper_aerodigestive_tract(1)	2						TTTATTATGTAGGAAGAGATA	0.303																																					.		Atlas-SNP	.											.	FAIM	27	.	0			c.112-2A>G						PASS	.						40.0	42.0	41.0					3																	138341028		2202	4299	6501	SO:0001630	splice_region_variant	55179	exon3			TTATGTAGGAAGA	AK001444	CCDS3103.1, CCDS33864.1, CCDS33865.1	3q23	2008-07-18			ENSG00000158234	ENSG00000158234			18703	protein-coding gene	gene with protein product						10075978	Standard	NM_018147		Approved	FLJ10582, FAIM1	uc003esq.3	Q9NVQ4	OTTHUMG00000159885	ENST00000393035.2:c.112-1A>G	3.37:g.138341028A>G		26.0	0.0	0		24.0	6.0	0.25	NM_001033032	Q6IAN2	Splice_Site	SNP	ENST00000393035.2	37	CCDS3103.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089156	0.55968	.	.	ENSG00000158234	ENST00000338446;ENST00000360570;ENST00000393035;ENST00000393034;ENST00000464668;ENST00000479848	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2885	0.66260	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAIM	139823718	1.000000	0.71417	0.968000	0.41197	0.640000	0.38277	9.295000	0.96095	2.252000	0.74401	0.528000	0.53228	.	.	.	none		0.303	FAIM-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357979.1	NM_001033032	Intron
PFN1	5216	hgsc.bcm.edu	37	17	4849259	4849259	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:4849259T>G	ENST00000225655.5	-	3	978	c.359A>C	c.(358-360)cAc>cCc	p.H120P	PFN1_ENST00000574872.1_Missense_Mutation_p.H84P	NM_005022.3	NP_005013.1	P07737	PROF1_HUMAN	profilin 1	120					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cell death (GO:0008219)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of ruffle assembly (GO:1900029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|proline-rich region binding (GO:0070064)			NS(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5						CAAACCACCGTGGACACCTTC	0.557																																					p.H120P		Atlas-SNP	.											.	PFN1	6	.	0			c.A359C						PASS	.						107.0	81.0	90.0					17																	4849259		2203	4300	6503	SO:0001583	missense	5216	exon3			CCACCGTGGACAC	BC057828	CCDS11061.1	17p13.2	2010-07-09			ENSG00000108518	ENSG00000108518			8881	protein-coding gene	gene with protein product		176610				3356709, 1968707	Standard	NM_005022		Approved		uc002gaa.4	P07737	OTTHUMG00000099396	ENST00000225655.5:c.359A>C	17.37:g.4849259T>G	ENSP00000225655:p.His120Pro	331.0	0.0	0		195.0	71.0	0.364103	NM_005022	Q53Y44	Missense_Mutation	SNP	ENST00000225655.5	37	CCDS11061.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045910	0.36085	.	.	ENSG00000108518	ENST00000225655	D	0.85955	-2.05	4.01	4.01	0.46588	.	0.000000	0.64402	D	0.000001	D	0.90184	0.6932	M	0.69823	2.125	0.53688	D	0.999975	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88931	0.3373	10	0.35671	T	0.21	.	11.2225	0.48864	0.0:0.0:0.0:1.0	.	120;120	P07737;Q53Y44	PROF1_HUMAN;.	P	120	ENSP00000225655:H120P	ENSP00000225655:H120P	H	-	2	0	PFN1	4790004	1.000000	0.71417	0.998000	0.56505	0.619000	0.37552	6.169000	0.71913	1.815000	0.52974	0.247000	0.18012	CAC	.	.	alt		0.557	PFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216853.1	NM_005022	
HTR3A	3359	hgsc.bcm.edu	37	11	113848285	113848285	+	Intron	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:113848285G>A	ENST00000504030.2	+	2	512				HTR3A_ENST00000299961.5_Silent_p.R3R|HTR3A_ENST00000535865.1_Intron|HTR3A_ENST00000375498.2_Intron|HTR3A_ENST00000506841.2_Intron|HTR3A_ENST00000355556.2_Intron			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	GAATGCATAGGTCCTTTCTAC	0.423																																					p.R3R		Atlas-SNP	.											.	HTR3A	93	.	0			c.G9A						PASS	.						167.0	137.0	146.0					11																	113848285		692	1591	2283	SO:0001627	intron_variant	3359	exon1			GCATAGGTCCTTT	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.68-208G>A	11.37:g.113848285G>A		73.0	0.0	0		63.0	24.0	0.380952	NM_001161772	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	ENST00000504030.2	37																																																																																				.	.	none		0.423	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000360822.2	NM_000869	
CHEK2	11200	hgsc.bcm.edu	37	22	29107902	29107902	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr22:29107902C>T	ENST00000405598.1	-	7	978	c.787G>A	c.(787-789)Gag>Aag	p.E263K	CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382566.1_Missense_Mutation_p.E263K|CHEK2_ENST00000382580.2_Missense_Mutation_p.E306K|CHEK2_ENST00000464581.1_5'UTR|CHEK2_ENST00000348295.3_Missense_Mutation_p.E263K|CHEK2_ENST00000544772.1_Missense_Mutation_p.E42K|CHEK2_ENST00000402731.1_Missense_Mutation_p.E263K|CHEK2_ENST00000382578.1_Missense_Mutation_p.E172K|CHEK2_ENST00000404276.1_Missense_Mutation_p.E263K|CHEK2_ENST00000403642.1_Missense_Mutation_p.E172K|CHEK2_ENST00000328354.6_Missense_Mutation_p.E263K			O96017	CHK2_HUMAN	checkpoint kinase 2	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CTTACTGCCTCTCTTGCTGAA	0.368			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.E306K		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2	438	.	0			c.G916A						PASS	.						166.0	135.0	145.0					22																	29107902		2203	4300	6503	SO:0001583	missense	11200	exon7			CTGCCTCTCTTGC	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.787G>A	22.37:g.29107902C>T	ENSP00000386087:p.Glu263Lys	102.0	0.0	0		65.0	4.0	0.0615385	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392506	0.42410	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000544772;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000425190;ENST00000439200	D;T;T;T;T;T;T;T;T;D;T;T;D	0.93712	-1.65;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-1.65;-0.14;-0.14;-3.27	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.185810	0.47455	D	0.000221	D	0.85566	0.5726	N	0.13198	0.31	0.42139	D	0.991506	B;B;B;B;B;B;B	0.28933	0.002;0.228;0.008;0.101;0.082;0.039;0.137	B;B;B;B;B;B;B	0.27796	0.009;0.083;0.012;0.061;0.036;0.079;0.076	T	0.82928	-0.0214	10	0.10902	T	0.67	-1.9415	15.167	0.72837	0.0:1.0:0.0:0.0	.	263;172;42;263;263;263;306	O96017-7;O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;.;CHK2_HUMAN;.	K	263;172;42;263;263;263;263;306;172;263;196;42;294	ENSP00000329012:E263K;ENSP00000372021:E172K;ENSP00000442458:E42K;ENSP00000372007:E263K;ENSP00000329178:E263K;ENSP00000385747:E263K;ENSP00000386087:E263K;ENSP00000372023:E306K;ENSP00000384919:E172K;ENSP00000384835:E263K;ENSP00000397478:E196K;ENSP00000390244:E42K;ENSP00000408065:E294K	ENSP00000329178:E263K	E	-	1	0	CHEK2	27437902	0.978000	0.34361	0.162000	0.22713	0.680000	0.39746	2.867000	0.48428	2.339000	0.79563	0.591000	0.81541	GAG	.	.	none		0.368	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
PRAMEF4	400735	hgsc.bcm.edu	37	1	12942173	12942173	+	Missense_Mutation	SNP	C	C	G	rs201789683		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:12942173C>G	ENST00000235349.5	-	3	447	c.377G>C	c.(376-378)tGc>tCc	p.C126S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	126					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGAGGAAGCACCCATGGGC	0.493																																					p.C126S		Atlas-SNP	.											PRAMEF4,NS,carcinoma,0,1	PRAMEF4	62	1	0			c.G377C						scavenged	.						44.0	56.0	52.0					1																	12942173		1381	2629	4010	SO:0001583	missense	400735	exon3			AGGAAGCACCCAT		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.377G>C	1.37:g.12942173C>G	ENSP00000235349:p.Cys126Ser	61.0	0.0	0		33.0	4.0	0.121212	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	8.575	0.881031	0.17467	.	.	ENSG00000243073	ENST00000235349	T	0.18016	2.24	1.35	0.315	0.15852	.	1.371720	0.04624	N	0.402516	T	0.19406	0.0466	L	0.53671	1.685	0.09310	N	1	P	0.50272	0.933	P	0.44811	0.461	T	0.23190	-1.0195	10	0.33940	T	0.23	.	5.2546	0.15540	0.0:0.6297:0.3703:0.0	.	126	O60810	PRAM4_HUMAN	S	126	ENSP00000235349:C126S	ENSP00000235349:C126S	C	-	2	0	PRAMEF4	12864760	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	0.188000	0.17018	0.112000	0.17975	0.194000	0.17425	TGC	C|0.500;G|0.500	0.500	weak		0.493	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
SHH	6469	hgsc.bcm.edu	37	7	155599176	155599176	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:155599176C>T	ENST00000297261.2	-	2	526	c.376G>A	c.(376-378)Gag>Aag	p.E126K	SHH_ENST00000472308.1_5'Flank	NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	126					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCCAGCCCTCGGTCACCCGC	0.612																																					p.E126K		Atlas-SNP	.											.	SHH	34	.	0			c.G376A						PASS	.						105.0	77.0	87.0					7																	155599176		2203	4300	6503	SO:0001583	missense	6469	exon2			AGCCCTCGGTCAC		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.376G>A	7.37:g.155599176C>T	ENSP00000297261:p.Glu126Lys	151.0	0.0	0		94.0	4.0	0.0425532	NM_000193	A4D247|Q75MC9	Missense_Mutation	SNP	ENST00000297261.2	37	CCDS5942.1	.	.	.	.	.	.	.	.	.	.	C	32	5.149394	0.94645	.	.	ENSG00000164690	ENST00000297261;ENST00000430104	D;D	0.99578	-6.21;-6.21	3.55	3.55	0.40652	Hedgehog/DD-peptidase (2);Hedgehog, N-terminal signaling domain (1);	0.000000	0.85682	D	0.000000	D	0.99641	0.9868	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.998	D	0.97386	0.9986	10	0.87932	D	0	.	15.6723	0.77289	0.0:1.0:0.0:0.0	.	126;129;39	Q15465;D9ZGF9;C9JC48	SHH_HUMAN;.;.	K	126;39	ENSP00000297261:E126K;ENSP00000396621:E39K	ENSP00000297261:E126K	E	-	1	0	SHH	155291937	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	7.409000	0.80053	1.967000	0.57214	0.561000	0.74099	GAG	.	.	none		0.612	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
B2M	567	hgsc.bcm.edu	37	15	45007681	45007681	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr15:45007681T>G	ENST00000558401.1	+	2	198	c.128T>G	c.(127-129)cTg>cGg	p.L43R	B2M_ENST00000559916.1_Missense_Mutation_p.L43R|B2M_ENST00000544417.1_Missense_Mutation_p.L43R|B2M_ENST00000559220.1_Intron	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	43	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L43P(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCAAATTTCCTGAATTGCTAT	0.408																																					p.L43R		Atlas-SNP	.											B2M,colon,carcinoma,0,2	B2M	99	2	1	Substitution - Missense(1)	breast(1)	c.T128G						PASS	.						176.0	180.0	178.0					15																	45007681		2198	4298	6496	SO:0001583	missense	567	exon2			ATTTCCTGAATTG	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.128T>G	15.37:g.45007681T>G	ENSP00000452780:p.Leu43Arg	109.0	0.0	0		81.0	67.0	0.82716	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001047	0.74818	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.22539	1.95	6.03	6.03	0.97812	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.595751	0.18761	N	0.131892	T	0.63954	0.2555	H	0.98594	4.275	0.58432	D	0.99999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76777	-0.2834	10	0.87932	D	0	.	12.95	0.58394	0.0:0.0:0.0:1.0	.	43;43;43	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	R	43	ENSP00000437604:L43R	ENSP00000340858:L43R	L	+	2	0	B2M	42794973	0.971000	0.33674	0.101000	0.21167	0.672000	0.39443	4.264000	0.58859	2.308000	0.77769	0.533000	0.62120	CTG	.	.	none		0.408	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
CEP290	80184	hgsc.bcm.edu	37	12	88483187	88483187	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:88483187A>G	ENST00000552810.1	-	31	3994	c.3651T>C	c.(3649-3651)gcT>gcC	p.A1217A	CEP290_ENST00000397838.3_Silent_p.A277A|CEP290_ENST00000547691.2_Silent_p.A277A|CEP290_ENST00000309041.7_Silent_p.A1219A	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1217					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ACTTACCAAGAGCAGTAGCCT	0.393																																					p.A1217A		Atlas-SNP	.											.	CEP290	195	.	0			c.T3651C						PASS	.						54.0	52.0	52.0					12																	88483187		1885	4119	6004	SO:0001819	synonymous_variant	80184	exon31			ACCAAGAGCAGTA	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3651T>C	12.37:g.88483187A>G		132.0	0.0	0		100.0	4.0	0.04	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Silent	SNP	ENST00000552810.1	37	CCDS55858.1																																																																																			.	.	none		0.393	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
BCL6	604	hgsc.bcm.edu	37	3	187442783	187442783	+	Missense_Mutation	SNP	G	G	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:187442783G>T	ENST00000406870.2	-	9	2289	c.1923C>A	c.(1921-1923)caC>caA	p.H641Q	BCL6_ENST00000450123.2_Missense_Mutation_p.H585Q|RP11-211G3.3_ENST00000437407.1_Intron|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.H641Q	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	641					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GAGTCTGAAGGTGCCGGAAAC	0.562			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.H641Q		Atlas-SNP	.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	107	.	0			c.C1923A						PASS	.						112.0	109.0	110.0					3																	187442783		2203	4300	6503	SO:0001583	missense	604	exon9			CTGAAGGTGCCGG		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1923C>A	3.37:g.187442783G>T	ENSP00000384371:p.His641Gln	143.0	0.0	0		88.0	32.0	0.363636	NM_001706	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213582	0.79352	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.18338	2.22;2.22;2.22	5.78	4.9	0.64082	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	N	0.16602	0.42	0.51233	D	0.999912	D;D	0.69078	0.975;0.997	P;D	0.81914	0.857;0.995	T	0.07424	-1.0773	10	0.19590	T	0.45	.	13.9219	0.63937	0.0728:0.0:0.9272:0.0	.	585;641	B8PSA7;P41182	.;BCL6_HUMAN	Q	641;641;585	ENSP00000384371:H641Q;ENSP00000232014:H641Q;ENSP00000413122:H585Q	ENSP00000232014:H641Q	H	-	3	2	BCL6	188925477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.762000	0.68809	1.441000	0.47550	0.655000	0.94253	CAC	.	.	none		0.562	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
MXRA5	25878	hgsc.bcm.edu	37	X	3242042	3242042	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:3242042C>A	ENST00000217939.6	-	5	1838	c.1684G>T	c.(1684-1686)Gaa>Taa	p.E562*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	562	Ig-like C2-type 1.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGGTCCATTTCATCCCTCACT	0.527																																					p.E562X		Atlas-SNP	.											.	MXRA5	815	.	0			c.G1684T						PASS	.						53.0	39.0	44.0					X																	3242042		2203	4300	6503	SO:0001587	stop_gained	25878	exon5			CCATTTCATCCCT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1684G>T	X.37:g.3242042C>A	ENSP00000217939:p.Glu562*	387.0	1.0	0.00258398		282.0	101.0	0.358156	NM_015419	Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	36	5.738582	0.96865	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.76	3.76	0.43208	.	0.000000	0.41194	U	0.000936	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	10.7443	0.46170	0.1902:0.8098:0.0:0.0	.	.	.	.	X	562	.	ENSP00000217939:E562X	E	-	1	0	MXRA5	3252042	1.000000	0.71417	0.055000	0.19348	0.387000	0.30353	6.358000	0.73055	1.507000	0.48752	0.525000	0.51046	GAA	.	.	none		0.527	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
PFN1	5216	hgsc.bcm.edu	37	17	4849260	4849260	+	Missense_Mutation	SNP	G	G	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:4849260G>C	ENST00000225655.5	-	3	977	c.358C>G	c.(358-360)Cac>Gac	p.H120D	PFN1_ENST00000574872.1_Missense_Mutation_p.H84D	NM_005022.3	NP_005013.1	P07737	PROF1_HUMAN	profilin 1	120					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cell death (GO:0008219)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of ruffle assembly (GO:1900029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|proline-rich region binding (GO:0070064)			NS(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5						AAACCACCGTGGACACCTTCT	0.552																																					p.H120D		Atlas-SNP	.											.	PFN1	6	.	0			c.C358G						PASS	.						107.0	81.0	90.0					17																	4849260		2203	4300	6503	SO:0001583	missense	5216	exon3			CACCGTGGACACC	BC057828	CCDS11061.1	17p13.2	2010-07-09			ENSG00000108518	ENSG00000108518			8881	protein-coding gene	gene with protein product		176610				3356709, 1968707	Standard	NM_005022		Approved		uc002gaa.4	P07737	OTTHUMG00000099396	ENST00000225655.5:c.358C>G	17.37:g.4849260G>C	ENSP00000225655:p.His120Asp	330.0	0.0	0		196.0	72.0	0.367347	NM_005022	Q53Y44	Missense_Mutation	SNP	ENST00000225655.5	37	CCDS11061.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805916	0.70682	.	.	ENSG00000108518	ENST00000225655	D	0.85702	-2.02	4.14	4.14	0.48551	.	0.000000	0.64402	D	0.000001	D	0.91878	0.7429	M	0.83953	2.67	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91227	0.5011	10	0.35671	T	0.21	.	14.3076	0.66395	0.0:0.0:1.0:0.0	.	120;120	P07737;Q53Y44	PROF1_HUMAN;.	D	120	ENSP00000225655:H120D	ENSP00000225655:H120D	H	-	1	0	PFN1	4790005	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	7.593000	0.82686	2.300000	0.77407	0.448000	0.29417	CAC	.	.	none		0.552	PFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216853.1	NM_005022	
UNKL	64718	hgsc.bcm.edu	37	16	1417803	1417803	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:1417803T>C	ENST00000389221.4	-	13	1632	c.1633A>G	c.(1633-1635)Agc>Ggc	p.S545G	UNKL_ENST00000402641.2_Missense_Mutation_p.S47G|UNKL_ENST00000391893.2_Missense_Mutation_p.S44G|UNKL_ENST00000508903.2_Missense_Mutation_p.S548G|UNKL_ENST00000248104.7_Missense_Mutation_p.S44G|UNKL_ENST00000403703.1_Missense_Mutation_p.S47G|UNKL_ENST00000397464.1_Missense_Mutation_p.S47G	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	545	Ser-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGGGAGGGGCTGGGGGAGAAG	0.652																																					p.S548G		Atlas-SNP	.											.	UNKL	46	.	0			c.A1642G						PASS	.						9.0	9.0	9.0					16																	1417803		2180	4274	6454	SO:0001583	missense	64718	exon13			AGGGGCTGGGGGA	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1633A>G	16.37:g.1417803T>C	ENSP00000373873:p.Ser545Gly	146.0	0.0	0		127.0	73.0	0.574803	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	ENST00000389221.4	37	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	t	16.06	3.015598	0.54468	.	.	ENSG00000059145	ENST00000248104;ENST00000389221;ENST00000403703;ENST00000391893;ENST00000397464;ENST00000402641;ENST00000508903;ENST00000513783	T;T	0.68331	-0.22;-0.32	4.67	4.67	0.58626	.	.	.	.	.	T	0.74566	0.3733	L	0.49455	1.56	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.982	P;D;D	0.85130	0.836;0.997;0.952	T	0.71130	-0.4682	9	0.23891	T	0.37	.	12.1563	0.54079	0.0:0.0:0.0:1.0	.	545;44;548	Q9H9P5;Q9H9P5-3;E9PDK2	UNKL_HUMAN;.;.	G	44;545;47;44;47;47;548;47	ENSP00000373873:S545G;ENSP00000380606:S47G	ENSP00000248104:S44G	S	-	1	0	UNKL	1357804	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	5.503000	0.66962	1.760000	0.52011	0.445000	0.29226	AGC	.	.	none		0.652	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
MLLT1	4298	hgsc.bcm.edu	37	19	6230658	6230658	+	Missense_Mutation	SNP	T	T	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:6230658T>A	ENST00000252674.7	-	4	506	c.343A>T	c.(343-345)Aac>Tac	p.N115Y		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	115					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						CGCAGGTGGTTCACGGGCGGG	0.612			T	MLL	AL																																p.N115Y		Atlas-SNP	.		Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	MLLT1,NS,carcinoma,+2,1	MLLT1	47	1	0			c.A343T						PASS	.						168.0	167.0	167.0					19																	6230658		2203	4300	6503	SO:0001583	missense	4298	exon4			GGTGGTTCACGGG		CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.343A>T	19.37:g.6230658T>A	ENSP00000252674:p.Asn115Tyr	78.0	0.0	0		39.0	26.0	0.666667	NM_005934	Q14768	Missense_Mutation	SNP	ENST00000252674.7	37	CCDS12160.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.187892	0.78789	.	.	ENSG00000130382	ENST00000252674	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.77287	0.4108	M	0.83692	2.655	0.80722	D	1	D	0.60575	0.988	P	0.61132	0.884	T	0.81398	-0.0951	9	0.72032	D	0.01	-55.4765	13.1576	0.59527	0.0:0.0:0.0:1.0	.	115	Q03111	ENL_HUMAN	Y	115	.	ENSP00000252674:N115Y	N	-	1	0	MLLT1	6181658	1.000000	0.71417	0.948000	0.38648	0.719000	0.41307	7.727000	0.84838	1.966000	0.57179	0.533000	0.62120	AAC	.	.	none		0.612	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
ERC2	26059	hgsc.bcm.edu	37	3	56052950	56052950	+	Missense_Mutation	SNP	G	G	A	rs201400364		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:56052950G>A	ENST00000288221.6	-	8	2006	c.1751C>T	c.(1750-1752)gCg>gTg	p.A584V		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	584						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CTCTAGCGTCGCCAGTGCAGT	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		17318	0.0		0.001	False		,,,				2504	0.0				p.A584V		Atlas-SNP	.											.	ERC2	221	.	0			c.C1751T						PASS	.						143.0	125.0	131.0					3																	56052950		1958	4155	6113	SO:0001583	missense	26059	exon8			AGCGTCGCCAGTG	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1751C>T	3.37:g.56052950G>A	ENSP00000288221:p.Ala584Val	212.0	0.0	0		148.0	57.0	0.385135	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	13.84|13.84	2.357442|2.357442	0.41801|0.41801	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	T|.	0.45276|.	0.9|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.68320|.	0.2988|.	L|L	0.44542|0.44542	1.39|1.39	0.53688|0.53688	D|D	0.999973|0.999973	P|.	0.35923|.	0.528|.	B|.	0.30029|.	0.11|.	T|.	0.63734|.	-0.6570|.	10|.	0.49607|.	T|.	0.09|.	-10.6087|-10.6087	19.2601|19.2601	0.93964|0.93964	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	584|.	O15083|.	ERC2_HUMAN|.	V|X	584|223	ENSP00000288221:A584V|.	ENSP00000288221:A584V|.	A|R	-|-	2|1	0|2	ERC2|ERC2	56027990|56027990	1.000000|1.000000	0.71417|0.71417	0.616000|0.616000	0.29078|0.29078	0.002000|0.002000	0.02628|0.02628	9.715000|9.715000	0.98748|0.98748	2.641000|2.641000	0.89580|0.89580	0.650000|0.650000	0.86243|0.86243	GCG|CGA	G|1.000;A|0.000	0.000	strong		0.468	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
UBE2QL1	134111	hgsc.bcm.edu	37	5	6491453	6491453	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:6491453C>T	ENST00000399816.3	+	2	748	c.477C>T	c.(475-477)tcC>tcT	p.S159S		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	159					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						CGCCCGTGTCCGACGGCTGAT	0.532																																					p.S159S		Atlas-SNP	.											.	UBE2QL1	10	.	0			c.C477T						PASS	.						70.0	68.0	69.0					5																	6491453		692	1591	2283	SO:0001819	synonymous_variant	134111	exon2			CGTGTCCGACGGC	AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.477C>T	5.37:g.6491453C>T		88.0	0.0	0		68.0	30.0	0.441176	NM_001145161		Silent	SNP	ENST00000399816.3	37	CCDS47189.1																																																																																			.	.	none		0.532	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365717.1	NM_001145161	
KSR2	283455	hgsc.bcm.edu	37	12	117962801	117962801	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:117962801C>T	ENST00000339824.5	-	14	2802	c.2075G>A	c.(2074-2076)cGg>cAg	p.R692Q	KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.R663Q|KSR2_ENST00000302438.5_Missense_Mutation_p.R389Q			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	692	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTCAATCAGCCGGATGGCCAC	0.597																																					p.R663Q		Atlas-SNP	.											.	KSR2	208	.	0			c.G1988A						PASS	.						54.0	58.0	56.0					12																	117962801		2111	4213	6324	SO:0001583	missense	283455	exon14			ATCAGCCGGATGG	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2075G>A	12.37:g.117962801C>T	ENSP00000339952:p.Arg692Gln	139.0	0.0	0		84.0	38.0	0.452381	NM_173598	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37		.	.	.	.	.	.	.	.	.	.	C	28.4	4.917300	0.92249	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	D;D;D	0.89681	-2.55;-2.55;-2.55	4.98	4.09	0.47781	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91898	0.7435	L	0.48362	1.52	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	D	0.92456	0.5974	10	0.72032	D	0.01	.	13.6616	0.62370	0.0:0.9254:0.0:0.0746	.	692	Q6VAB6	KSR2_HUMAN	Q	663;692;389;364	ENSP00000389715:R663Q;ENSP00000339952:R692Q;ENSP00000305466:R389Q	ENSP00000305466:R389Q	R	-	2	0	KSR2	116447184	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.933000	0.70130	1.328000	0.45358	-0.143000	0.13931	CGG	.	.	none		0.597	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
C14orf28	122525	hgsc.bcm.edu	37	14	45370114	45370114	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:45370114G>A	ENST00000325192.3	+	2	751	c.476G>A	c.(475-477)cGa>cAa	p.R159Q	C14orf28_ENST00000557112.1_Missense_Mutation_p.R159Q|C14orf28_ENST00000553841.1_3'UTR|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	159								p.R159L(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						TCCAACTGGCGATGCCCAACT	0.343																																					p.R159Q		Atlas-SNP	.											C14orf28,NS,carcinoma,0,1	C14orf28	32	1	1	Substitution - Missense(1)	lung(1)	c.G476A						PASS	.						70.0	72.0	72.0					14																	45370114		2203	4300	6503	SO:0001583	missense	122525	exon2			ACTGGCGATGCCC	AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.476G>A	14.37:g.45370114G>A	ENSP00000326846:p.Arg159Gln	88.0	0.0	0		85.0	31.0	0.364706	NM_001017923		Missense_Mutation	SNP	ENST00000325192.3	37	CCDS32069.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173338	0.38413	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.30714	1.52;1.52	5.86	4.96	0.65561	.	0.227351	0.44285	D	0.000467	T	0.12433	0.0302	N	0.08118	0	0.27714	N	0.945356	P	0.37176	0.586	B	0.21360	0.034	T	0.09907	-1.0653	10	0.40728	T	0.16	.	9.7082	0.40229	0.1595:0.0:0.8405:0.0	.	159	Q4W4Y0	CN028_HUMAN	Q	159	ENSP00000326846:R159Q;ENSP00000451791:R159Q	ENSP00000326846:R159Q	R	+	2	0	C14orf28	44439864	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.525000	0.53502	1.592000	0.50018	0.650000	0.86243	CGA	.	.	none		0.343	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923	
RBMX2	51634	hgsc.bcm.edu	37	X	129545348	129545348	+	Silent	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:129545348T>C	ENST00000305536.6	+	5	394	c.330T>C	c.(328-330)gaT>gaC	p.D110D	RBMX2_ENST00000469953.1_3'UTR	NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	110	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						TCCGAGTGGATCATGTGTCTA	0.478																																					p.D110D		Atlas-SNP	.											.	RBMX2	46	.	0			c.T330C						PASS	.						152.0	138.0	143.0					X																	129545348		1914	4108	6022	SO:0001819	synonymous_variant	51634	exon5			AGTGGATCATGTG	AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.330T>C	X.37:g.129545348T>C		107.0	0.0	0		99.0	48.0	0.484848	NM_016024	A8K9Z0|Q5JY82|Q9Y3I8	Silent	SNP	ENST00000305536.6	37	CCDS43993.1																																																																																			.	.	none		0.478	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058265.1	NM_016024	
DLGAP2	9228	hgsc.bcm.edu	37	8	1497731	1497731	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:1497731G>A	ENST00000421627.2	+	2	1006	c.872G>A	c.(871-873)tGg>tAg	p.W291*		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	370					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGCAGCTCCTGGTCTACGCTG	0.647																																					p.W291X		Atlas-SNP	.											.	DLGAP2	292	.	0			c.G872A						PASS	.						18.0	21.0	20.0					8																	1497731		2180	4277	6457	SO:0001587	stop_gained	9228	exon2			GCTCCTGGTCTAC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.872G>A	8.37:g.1497731G>A	ENSP00000400258:p.Trp291*	86.0	0.0	0		65.0	13.0	0.2	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Nonsense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.817673|7.817673	0.98507|0.98507	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|.	.|.	.|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.46852|.	0.1414|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39418|.	-0.9615|.	3|.	.|0.02654	.|T	.|1	-10.1825|-10.1825	18.9482|18.9482	0.92630|0.92630	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	S|X	308|336;291	.|.	.|ENSP00000348366:W336X	G|W	+|+	1|2	0|0	DLGAP2|DLGAP2	1485138|1485138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	8.917000|8.917000	0.92751|0.92751	2.463000|2.463000	0.83235|0.83235	0.655000|0.655000	0.94253|0.94253	GGT|TGG	.	.	none		0.647	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
ZNF676	163223	hgsc.bcm.edu	37	19	22363817	22363817	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:22363817A>G	ENST00000397121.2	-	3	1019	c.702T>C	c.(700-702)ttT>ttC	p.F234F		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AGGATCGATTAAAAGCTTTGC	0.368																																					p.F234F		Atlas-SNP	.											ZNF676,NS,carcinoma,-1,2	ZNF676	146	2	0			c.T702C						scavenged	.						75.0	83.0	80.0					19																	22363817		2176	4287	6463	SO:0001819	synonymous_variant	163223	exon3			TCGATTAAAAGCT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.702T>C	19.37:g.22363817A>G		26.0	1.0	0.0384615		24.0	3.0	0.125	NM_001001411	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																			.	.	none		0.368	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
SLC6A3	6531	hgsc.bcm.edu	37	5	1406387	1406387	+	Silent	SNP	G	G	A	rs114563841		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:1406387G>A	ENST00000270349.9	-	12	1642	c.1515C>T	c.(1513-1515)agC>agT	p.S505S	SLC6A3_ENST00000453492.2_Silent_p.S505S	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	505					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GGATGTCGTCGCTGAACTGCC	0.642													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17793	0.0		0.0	False		,,,				2504	0.0				p.S505S		Atlas-SNP	.											.	SLC6A3	102	.	0			c.C1515T						PASS	.						76.0	71.0	72.0					5																	1406387		2203	4300	6503	SO:0001819	synonymous_variant	6531	exon12			GTCGTCGCTGAAC		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1515C>T	5.37:g.1406387G>A		160.0	0.0	0		84.0	26.0	0.309524	NM_001044	A2RUN4|Q14996	Silent	SNP	ENST00000270349.9	37	CCDS3863.1																																																																																			G|0.995;A|0.005	0.005	strong		0.642	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
ARID1A	8289	hgsc.bcm.edu	37	1	27056217	27056217	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:27056217C>T	ENST00000324856.7	+	2	1584	c.1213C>T	c.(1213-1215)Cag>Tag	p.Q405*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q405*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q22*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	405					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q405*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTCGCAGCAACAGGGACCTCC	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q405X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0,1	ARID1A	842	1	1	Substitution - Nonsense(1)	endometrium(1)	c.C1213T						PASS	.						90.0	93.0	92.0					1																	27056217		2203	4300	6503	SO:0001587	stop_gained	8289	exon2			CAGCAACAGGGAC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1213C>T	1.37:g.27056217C>T	ENSP00000320485:p.Gln405*	376.0	1.0	0.00265957		269.0	99.0	0.36803	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	37	6.467169	0.97590	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000524572;ENST00000374152	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-7.4344	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	405;405;22;22	.	ENSP00000320485:Q405X	Q	+	1	0	ARID1A	26928804	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.752000	0.68728	2.937000	0.99478	0.650000	0.86243	CAG	.	.	none		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
RELN	5649	hgsc.bcm.edu	37	7	103236931	103236931	+	Missense_Mutation	SNP	T	T	G	rs374443790		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:103236931T>G	ENST00000428762.1	-	25	3670	c.3511A>C	c.(3511-3513)Atg>Ctg	p.M1171L	RELN_ENST00000343529.5_Missense_Mutation_p.M1171L|RELN_ENST00000424685.2_Missense_Mutation_p.M1171L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1171					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GAAAAGTACATCTCTGCTAGC	0.493																																					p.M1171L	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.A3511C						PASS	.						183.0	167.0	172.0					7																	103236931		2203	4300	6503	SO:0001583	missense	5649	exon25			AGTACATCTCTGC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3511A>C	7.37:g.103236931T>G	ENSP00000392423:p.Met1171Leu	188.0	0.0	0		187.0	46.0	0.245989	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419022	0.62622	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.37752	2.09;1.18;2.09	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.25531	0.0621	N	0.19112	0.55	0.44771	D	0.997776	P;B	0.35468	0.503;0.272	B;B	0.35931	0.214;0.032	T	0.06698	-1.0812	10	0.13470	T	0.59	.	16.1652	0.81750	0.0:0.0:0.0:1.0	.	1171;1171	P78509-2;P78509	.;RELN_HUMAN	L	1171	ENSP00000392423:M1171L;ENSP00000345694:M1171L;ENSP00000388446:M1171L	ENSP00000345694:M1171L	M	-	1	0	RELN	103024167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.653000	0.67967	2.230000	0.72887	0.528000	0.53228	ATG	.	.	alt		0.493	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
KPRP	448834	hgsc.bcm.edu	37	1	152732767	152732767	+	Nonsense_Mutation	SNP	C	C	T	rs569937176		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:152732767C>T	ENST00000606109.1	+	1	731	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	KPRP_ENST00000368773.1_Nonsense_Mutation_p.Q235*			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	235						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCCCAGTGCCAGACCCAGGG	0.602													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17686	0.0		0.0	False		,,,				2504	0.0				p.Q235X		Atlas-SNP	.											.	KPRP	152	.	0			c.C703T						PASS	.						76.0	81.0	80.0					1																	152732767		2203	4300	6503	SO:0001587	stop_gained	448834	exon2			CAGTGCCAGACCC	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.703C>T	1.37:g.152732767C>T	ENSP00000475216:p.Gln235*	142.0	0.0	0		129.0	30.0	0.232558	NM_001025231		Nonsense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336488	0.60963	.	.	ENSG00000203786	ENST00000368773	.	.	.	5.78	2.71	0.32032	.	0.165834	0.29152	N	0.012987	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.1297	4.9823	0.14172	0.1513:0.6187:0.1469:0.083	.	.	.	.	X	235	.	ENSP00000357762:Q235X	Q	+	1	0	KPRP	150999391	0.001000	0.12720	0.141000	0.22245	0.397000	0.30659	0.391000	0.20784	0.885000	0.36088	0.655000	0.94253	CAG	.	.	none		0.602	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
ATOH1	474	hgsc.bcm.edu	37	4	94750977	94750977	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr4:94750977C>T	ENST00000306011.3	+	1	936	c.900C>T	c.(898-900)agC>agT	p.S300S		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	300					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		TCGAGGACAGCGCCCTGACAG	0.607																																					p.S300S		Atlas-SNP	.											.	ATOH1	40	.	0			c.C900T						PASS	.						66.0	71.0	69.0					4																	94750977		2203	4300	6503	SO:0001819	synonymous_variant	474	exon1			GGACAGCGCCCTG	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.900C>T	4.37:g.94750977C>T		44.0	0.0	0		37.0	13.0	0.351351	NM_005172	Q14CT9	Silent	SNP	ENST00000306011.3	37	CCDS3638.1																																																																																			.	.	none		0.607	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
PCDHA13	56136	hgsc.bcm.edu	37	5	140263476	140263476	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:140263476C>T	ENST00000289272.2	+	1	1623	c.1623C>T	c.(1621-1623)ggC>ggT	p.G541G	PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000409494.1_Silent_p.G541G|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	541	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGACTCTGGCGTGCCGCCTC	0.692																																					p.G541G	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.C1623T						PASS	.						73.0	79.0	77.0					5																	140263476		2203	4299	6502	SO:0001819	synonymous_variant	56136	exon1			CTCTGGCGTGCCG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1623C>T	5.37:g.140263476C>T		55.0	0.0	0		24.0	14.0	0.583333	NM_031865	O75277	Silent	SNP	ENST00000289272.2	37	CCDS4240.1																																																																																			.	.	none		0.692	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
HCRTR2	3062	hgsc.bcm.edu	37	6	55113583	55113583	+	Missense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:55113583C>A	ENST00000370862.3	+	2	706	c.370C>A	c.(370-372)Cag>Aag	p.Q124K		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	124					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GTTTTTTGGACAGTCCCTTTG	0.433																																					p.Q124K		Atlas-SNP	.											.	HCRTR2	112	.	0			c.C370A						PASS	.						255.0	237.0	243.0					6																	55113583		2203	4299	6502	SO:0001583	missense	3062	exon2			TTTGGACAGTCCC	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.370C>A	6.37:g.55113583C>A	ENSP00000359899:p.Gln124Lys	211.0	0.0	0		142.0	59.0	0.415493	NM_001526	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	8.432	0.848733	0.17034	.	.	ENSG00000137252	ENST00000370862	T	0.71579	-0.58	4.65	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.238432	0.43747	D	0.000534	T	0.31544	0.0800	N	0.25825	0.765	0.36022	D	0.838786	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.008	T	0.10245	-1.0638	10	0.05959	T	0.93	.	9.4903	0.38955	0.1417:0.6016:0.2567:0.0	.	124;124	Q548Y0;O43614	.;OX2R_HUMAN	K	124	ENSP00000359899:Q124K	ENSP00000359899:Q124K	Q	+	1	0	HCRTR2	55221542	0.690000	0.27699	1.000000	0.80357	0.994000	0.84299	0.404000	0.20999	2.282000	0.76494	0.555000	0.69702	CAG	.	.	none		0.433	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
CACNA1F	778	hgsc.bcm.edu	37	X	49088337	49088337	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:49088337C>T	ENST00000376265.2	-	2	139	c.78G>A	c.(76-78)tgG>tgA	p.W26*	CACNA1F_ENST00000376251.1_Intron|CACNA1F_ENST00000323022.5_Nonsense_Mutation_p.W26*	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	26					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCACAGCCCCCATTCGGGAC	0.612																																					p.W26X		Atlas-SNP	.											.	CACNA1F	218	.	0			c.G78A						PASS	.						22.0	19.0	20.0					X																	49088337		2173	4252	6425	SO:0001587	stop_gained	778	exon2			CAGCCCCCATTCG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.78G>A	X.37:g.49088337C>T	ENSP00000365441:p.Trp26*	102.0	0.0	0		70.0	19.0	0.271429	NM_001256789	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Nonsense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891730	0.91889	.	.	ENSG00000102001	ENST00000323022;ENST00000376265	.	.	.	4.85	4.85	0.62838	.	0.890957	0.09424	N	0.804021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9927	0.41881	0.0:0.9014:0.0:0.0986	.	.	.	.	X	26	.	.	W	-	3	0	CACNA1F	48975281	0.139000	0.22563	1.000000	0.80357	0.747000	0.42532	0.576000	0.23744	2.155000	0.67459	0.436000	0.28706	TGG	.	.	none		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
MUC12	10071	hgsc.bcm.edu	37	7	100634964	100634964	+	Missense_Mutation	SNP	C	C	A	rs4370452	byFrequency	TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:100634964C>A	ENST00000379442.3	+	5	1549	c.1549C>A	c.(1549-1551)Cct>Act	p.P517T	MUC12_ENST00000536621.1_Missense_Mutation_p.P374T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	517	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.P374T(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AATGCACTTCCCTGAAAGCTC	0.537													c|||	2356	0.470447	0.3449	0.3703	5008	,	,		27699	0.6111		0.5139	False		,,,				2504	0.5215				p.P374T		Atlas-SNP	.											MUC12,NS,carcinoma,0,1	MUC12	140	1	1	Substitution - Missense(1)	stomach(1)	c.C1120A						scavenged	.						257.0	271.0	267.0					7																	100634964		692	1591	2283	SO:0001583	missense	10071	exon2			CACTTCCCTGAAA	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.1549C>A	7.37:g.100634964C>A	ENSP00000368755:p.Pro517Thr	0.0	0.0	.		3.0	3.0	1	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	ENST00000379442.3	37		1071	0.49038461538461536	193	0.39227642276422764	148	0.4088397790055249	332	0.5804195804195804	398	0.525065963060686	C	1.470	-0.559990	0.03967	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14893	2.48;2.47	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.38735	-0.9647	5	0.21014	T	0.42	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	rs4370452	.	.	.	T	517;374	ENSP00000368755:P517T;ENSP00000441929:P374T	ENSP00000368755:P517T	P	+	1	0	MUC12	100421684	0.000000	0.05858	0.005000	0.12908	0.102000	0.19082	-1.429000	0.02437	-0.833000	0.04245	0.064000	0.15345	CCT	C|0.492;A|0.508	0.508	strong		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
RNF145	153830	hgsc.bcm.edu	37	5	158630639	158630639	+	5'UTR	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:158630639T>C	ENST00000424310.2	-	0	346				RNF145_ENST00000518802.1_Missense_Mutation_p.K26R|RNF145_ENST00000521606.2_Missense_Mutation_p.K13R|RNF145_ENST00000520638.1_Missense_Mutation_p.K10R|RNF145_ENST00000519865.1_5'UTR|RNF145_ENST00000274542.2_Missense_Mutation_p.K24R	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			Gtttttttttttctttttttt	0.373																																					p.K26R		Atlas-SNP	.											RNF145,caecum,carcinoma,0,4	RNF145	110	4	0			c.A77G						scavenged	.						34.0	37.0	36.0					5																	158630639		2203	4300	6503	SO:0001623	5_prime_UTR_variant	153830	exon2			TTTTTTTTCTTTT	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-14A>G	5.37:g.158630639T>C		23.0	1.0	0.0434783		31.0	2.0	0.0645161	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	T	2.788	-0.251997	0.05829	.	.	ENSG00000145860	ENST00000274542;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000520638	T;T;T;T;T	0.77489	-1.09;-1.08;-1.07;-1.1;-1.07	1.51	1.51	0.23008	.	4.233800	0.00610	N	0.000418	T	0.51432	0.1674	N	0.08118	0	0.19300	N	0.99997	P;P;P;P;P	0.42584	0.784;0.544;0.544;0.544;0.673	B;B;B;B;B	0.28916	0.092;0.044;0.044;0.044;0.096	T	0.55471	-0.8136	10	0.12103	T	0.63	18.6048	5.0002	0.14261	0.0:0.0:0.0:1.0	.	12;13;10;26;24	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1-2	.;.;.;.;.	R	24;12;13;26;10	ENSP00000274542:K24R;ENSP00000430753:K12R;ENSP00000445115:K13R;ENSP00000430955:K26R;ENSP00000429071:K10R	ENSP00000274542:K24R	K	-	2	0	RNF145	158563217	0.054000	0.20591	0.003000	0.11579	0.003000	0.03518	2.210000	0.42816	0.663000	0.31027	0.164000	0.16699	AAA	.	.	none		0.373	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
CYP7A1	1581	hgsc.bcm.edu	37	8	59409213	59409213	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:59409213C>T	ENST00000301645.3	-	3	995	c.858G>A	c.(856-858)tcG>tcA	p.S286S		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	286					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TGTTTGCTTGCGATGCCCAGA	0.423									Neonatal Giant Cell Hepatitis																												p.S286S		Atlas-SNP	.											CYP7A1,NS,carcinoma,-1,2	CYP7A1	76	2	0			c.G858A						PASS	.						124.0	120.0	121.0					8																	59409213		2203	4300	6503	SO:0001819	synonymous_variant	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	TGCTTGCGATGCC	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.858G>A	8.37:g.59409213C>T		80.0	0.0	0		64.0	4.0	0.0625	NM_000780	P78454|Q3MIL8|Q7KZ19	Silent	SNP	ENST00000301645.3	37	CCDS6171.1																																																																																			.	.	none		0.423	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
XPO1	7514	hgsc.bcm.edu	37	2	61726851	61726851	+	Missense_Mutation	SNP	T	T	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:61726851T>A	ENST00000401558.2	-	7	1314	c.587A>T	c.(586-588)gAc>gTc	p.D196V	XPO1_ENST00000406957.1_Missense_Mutation_p.D196V|XPO1_ENST00000404992.2_Missense_Mutation_p.D196V	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	196	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TACTTGCCTGTCTTTTAAATG	0.289			Mis		CLL																																p.D196V		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.A587T						PASS	.						50.0	52.0	51.0					2																	61726851		2202	4299	6501	SO:0001583	missense	7514	exon7			TGCCTGTCTTTTA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.587A>T	2.37:g.61726851T>A	ENSP00000384863:p.Asp196Val	104.0	0.0	0		201.0	144.0	0.716418	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.562341	0.86335	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.52057	0.68;0.68;0.68	5.95	5.95	0.96441	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69762	0.3147	M	0.83118	2.625	0.80722	D	1	D	0.61080	0.989	D	0.65323	0.934	T	0.71310	-0.4631	10	0.40728	T	0.16	.	16.4025	0.83647	0.0:0.0:0.0:1.0	.	196	O14980	XPO1_HUMAN	V	196	ENSP00000384863:D196V;ENSP00000385942:D196V;ENSP00000385559:D196V	ENSP00000384863:D196V	D	-	2	0	XPO1	61580355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.027000	0.88791	2.268000	0.75426	0.533000	0.62120	GAC	.	.	none		0.289	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
PIGC	5279	hgsc.bcm.edu	37	1	172411314	172411314	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:172411314T>C	ENST00000367728.1	-	1	1912	c.449A>G	c.(448-450)tAt>tGt	p.Y150C	PIGC_ENST00000484368.1_Intron|PIGC_ENST00000344529.4_Missense_Mutation_p.Y150C|PIGC_ENST00000258324.1_Missense_Mutation_p.Y150C|C1orf105_ENST00000367727.4_Intron			Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C	150					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						TGACATGGCATAGATGGTGTC	0.468																																					p.Y150C		Atlas-SNP	.											.	PIGC	24	.	0			c.A449G						PASS	.						71.0	61.0	64.0					1																	172411314		2203	4300	6503	SO:0001583	missense	5279	exon2			ATGGCATAGATGG	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000367728.1:c.449A>G	1.37:g.172411314T>C	ENSP00000356702:p.Tyr150Cys	123.0	0.0	0		114.0	61.0	0.535088	NM_153747	O14491	Missense_Mutation	SNP	ENST00000367728.1	37	CCDS1302.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741330	0.69304	.	.	ENSG00000135845	ENST00000344529;ENST00000367728;ENST00000258324	T;T;T	0.45668	0.89;0.89;0.89	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.59542	0.2201	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67448	-0.5668	10	0.72032	D	0.01	-6.9131	13.6827	0.62496	0.0:0.0:0.0:1.0	.	150	Q92535	PIGC_HUMAN	C	150	ENSP00000356701:Y150C;ENSP00000356702:Y150C;ENSP00000258324:Y150C	ENSP00000258324:Y150C	Y	-	2	0	PIGC	170677937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.528000	0.81941	1.917000	0.55516	0.528000	0.53228	TAT	.	.	none		0.468	PIGC-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084068.1	NM_153747	
MDN1	23195	hgsc.bcm.edu	37	6	90437660	90437660	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:90437660C>T	ENST00000369393.3	-	37	5479	c.5364G>A	c.(5362-5364)ctG>ctA	p.L1788L	MDN1_ENST00000428876.1_Silent_p.L1788L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1788					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTGCTCCAAACAGGTCTGTGA	0.448																																					p.L1788L		Atlas-SNP	.											.	MDN1	478	.	0			c.G5364A						PASS	.						128.0	111.0	116.0					6																	90437660		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon37			TCCAAACAGGTCT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5364G>A	6.37:g.90437660C>T		79.0	0.0	0		61.0	28.0	0.459016	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	CCDS5024.1																																																																																			.	.	none		0.448	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MEF2B	100271849	hgsc.bcm.edu	37	19	19260045	19260045	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:19260045T>G	ENST00000602424.2	-	5	974	c.248A>C	c.(247-249)gAc>gCc	p.D83A	MEF2BNB-MEF2B_ENST00000514819.3_Missense_Mutation_p.D100A|MEF2B_ENST00000424583.2_Missense_Mutation_p.D83A|MEF2B_ENST00000410050.1_Missense_Mutation_p.D83A|MEF2B_ENST00000409224.1_Missense_Mutation_p.D83A|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR|MEF2B_ENST00000409447.2_Missense_Mutation_p.D83A|MEF2B_ENST00000162023.5_Missense_Mutation_p.D83A|MEF2BNB-MEF2B_ENST00000444486.3_Missense_Mutation_p.D83A	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	83					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D83V(11)|p.D83A(2)		breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			CTCGAGGATGTCAGTGTTGGT	0.607																																					p.D83A		Atlas-SNP	.											MEF2BNB-MEF2B,NS,lymphoid_neoplasm,0,15	MEF2BNB-MEF2B	29	15	13	Substitution - Missense(13)	haematopoietic_and_lymphoid_tissue(13)	c.A248C						scavenged	.						126.0	63.0	84.0					19																	19260045		2203	4300	6503	SO:0001583	missense	4207	exon5			AGGATGTCAGTGT	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.248A>C	19.37:g.19260045T>G	ENSP00000473308:p.Asp83Ala	172.0	2.0	0.0116279		97.0	70.0	0.721649	NM_005919	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Missense_Mutation	SNP	ENST00000602424.2	37	CCDS12394.1	.	.	.	.	.	.	.	.	.	.	T	19.93	3.917436	0.73098	.	.	ENSG00000213999	ENST00000409224;ENST00000424583;ENST00000410050;ENST00000444486;ENST00000409447;ENST00000162023	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.33	5.33	0.75918	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.90092	0.6905	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.987;0.978;0.996;0.999;0.997	D	0.90697	0.4617	10	0.56958	D	0.05	-31.0539	13.2359	0.59969	0.0:0.0:0.0:1.0	.	83;130;83;83;83	Q02080;B8ZZJ5;C9J4J4;G5E9M1;B3KQ23	MEF2B_HUMAN;.;.;.;.	A	83;83;83;83;130;83	ENSP00000386480:D83A;ENSP00000402154:D83A;ENSP00000386374:D83A;ENSP00000390762:D83A;ENSP00000162023:D83A	ENSP00000162023:D83A	D	-	2	0	MEF2B	19121045	1.000000	0.71417	0.999000	0.59377	0.518000	0.34316	7.923000	0.87546	2.024000	0.59613	0.459000	0.35465	GAC	.	.	none		0.607	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_005919	
HAUS6	54801	hgsc.bcm.edu	37	9	19058365	19058365	+	Silent	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:19058365T>C	ENST00000380502.3	-	16	2867	c.2400A>G	c.(2398-2400)aaA>aaG	p.K800K	HAUS6_ENST00000380496.1_Silent_p.K664K	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	800					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTGGCTCCAGTTTAAAATTGG	0.398																																					p.K800K		Atlas-SNP	.											.	HAUS6	66	.	0			c.A2400G						PASS	.						68.0	72.0	71.0					9																	19058365		2203	4299	6502	SO:0001819	synonymous_variant	54801	exon16			CTCCAGTTTAAAA	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2400A>G	9.37:g.19058365T>C		196.0	0.0	0		132.0	49.0	0.371212	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Silent	SNP	ENST00000380502.3	37	CCDS6489.1																																																																																			.	.	none		0.398	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
MUC2	4583	hgsc.bcm.edu	37	11	1092950	1092950	+	Missense_Mutation	SNP	C	C	T	rs199605832		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:1092950C>T	ENST00000441003.2	+	30	4796	c.4769C>T	c.(4768-4770)aCt>aTt	p.T1590I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1591I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1591I(1)|p.T1590I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.632																																					p.T1590I		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	2	2	Substitution - Missense(2)	endometrium(2)	c.C4769T						scavenged	.	C	ILE/THR	6,3646		0,6,1820	56.0	90.0	78.0		4766	-3.5	0.0	11		78	4,6702		0,4,3349	no	missense	MUC2	NM_002457.2	89	0,10,5169	TT,TC,CC		0.0596,0.1643,0.0965	possibly-damaging	1589/2813	1092950	10,10348	1826	3353	5179	SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4769C>T	11.37:g.1092950C>T	ENSP00000415183:p.Thr1590Ile	149.0	1.0	0.00671141		55.0	3.0	0.0545455	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	4.282	0.051491	0.08291	0.001643	5.96E-4	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15372	2.43;2.75	1.75	-3.51	0.04696	.	79.651400	0.00166	U	0.000017	T	0.09113	0.0225	.	.	.	0.09310	N	1	P	0.49090	0.919	B	0.31686	0.134	T	0.33954	-0.9848	9	0.51188	T	0.08	.	5.4287	0.16440	0.2102:0.3762:0.4136:0.0	.	1590	E7EUV1	.	I	1590;1591	ENSP00000415183:T1590I;ENSP00000351956:T1591I	ENSP00000351956:T1591I	T	+	2	0	MUC2	1082950	0.003000	0.15002	0.000000	0.03702	0.181000	0.23173	1.844000	0.39269	-1.047000	0.03242	0.121000	0.15741	ACT	.	.	weak		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
ANK3	288	hgsc.bcm.edu	37	10	61946498	61946498	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:61946498T>C	ENST00000280772.2	-	17	2251	c.2060A>G	c.(2059-2061)aAt>aGt	p.N687S	ANK3_ENST00000373827.2_Missense_Mutation_p.N681S|ANK3_ENST00000503366.1_Missense_Mutation_p.N670S	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	687					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CACATTCGCATTTCTACCGAG	0.517																																					p.N687S		Atlas-SNP	.											.	ANK3	703	.	0			c.A2060G						PASS	.						201.0	148.0	166.0					10																	61946498		2203	4300	6503	SO:0001583	missense	288	exon17			TTCGCATTTCTAC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2060A>G	10.37:g.61946498T>C	ENSP00000280772:p.Asn687Ser	136.0	0.0	0		100.0	55.0	0.55	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659040	0.47467	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000395293;ENST00000395304;ENST00000536348	T;T;T	0.15256	2.44;2.44;2.44	6.17	6.17	0.99709	Ankyrin repeat-containing domain (4);	0.000000	0.44902	D	0.000401	T	0.15176	0.0366	L	0.37630	1.12	0.80722	D	1	B;B;B;B;B	0.21071	0.002;0.001;0.005;0.025;0.051	B;B;B;B;B	0.19946	0.005;0.009;0.023;0.021;0.027	T	0.03773	-1.1005	10	0.46703	T	0.11	.	11.0511	0.47889	0.0:0.0685:0.0:0.9315	.	670;348;231;681;687	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	S	687;681;670;649;348;348;231	ENSP00000280772:N687S;ENSP00000362933:N681S;ENSP00000425236:N670S	ENSP00000280772:N687S	N	-	2	0	ANK3	61616504	1.000000	0.71417	0.998000	0.56505	0.626000	0.37791	4.282000	0.58971	2.371000	0.80710	0.533000	0.62120	AAT	.	.	none		0.517	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
MINK1	50488	hgsc.bcm.edu	37	17	4797860	4797860	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:4797860C>T	ENST00000355280.6	+	24	3045	c.2849C>T	c.(2848-2850)tCg>tTg	p.S950L	MINK1_ENST00000347992.7_Missense_Mutation_p.S921L|MINK1_ENST00000453408.3_Missense_Mutation_p.S930L	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						GGCAAGAGCTCGTTCACGATG	0.602																																					p.S950L		Atlas-SNP	.											.	MINK1	110	.	0			c.C2849T						PASS	.						57.0	62.0	60.0					17																	4797860		2116	4245	6361	SO:0001583	missense	50488	exon24			AGAGCTCGTTCAC	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2849C>T	17.37:g.4797860C>T	ENSP00000347427:p.Ser950Leu	108.0	0.0	0		75.0	4.0	0.0533333	NM_153827		Missense_Mutation	SNP	ENST00000355280.6	37	CCDS45588.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952243	0.92660	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	D;D;D	0.83591	-1.74;-1.74;-1.71	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.73598	2.24	0.58432	D	0.999999	D;D;D;D	0.69078	0.996;0.997;0.994;0.997	P;D;P;D	0.66847	0.658;0.947;0.885;0.947	D	0.91106	0.4918	10	0.87932	D	0	.	15.884	0.79226	0.0:1.0:0.0:0.0	.	913;930;950;921	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	L	950;930;921	ENSP00000347427:S950L;ENSP00000406487:S930L;ENSP00000269296:S921L	ENSP00000269296:S921L	S	+	2	0	MINK1	4738636	1.000000	0.71417	0.928000	0.36995	0.990000	0.78478	6.788000	0.75105	2.620000	0.88729	0.655000	0.94253	TCG	.	.	none		0.602	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716	
MYO7B	4648	hgsc.bcm.edu	37	2	128350377	128350377	+	Missense_Mutation	SNP	C	C	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:128350377C>G	ENST00000409816.2	+	16	2033	c.2001C>G	c.(1999-2001)gaC>gaG	p.D667E	MYO7B_ENST00000389524.4_Missense_Mutation_p.D667E|MYO7B_ENST00000428314.1_Missense_Mutation_p.D667E			Q6PIF6	MYO7B_HUMAN	myosin VIIB	667	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGCTGTTCGACCGGGAGCTGT	0.682																																					p.D667E		Atlas-SNP	.											.	MYO7B	359	.	0			c.C2001G						PASS	.						16.0	23.0	21.0					2																	128350377		2021	4165	6186	SO:0001583	missense	4648	exon17			GTTCGACCGGGAG		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2001C>G	2.37:g.128350377C>G	ENSP00000386461:p.Asp667Glu	116.0	0.0	0		63.0	22.0	0.349206	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163986	0.78339	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.89196	-2.48;-2.48;-2.48	4.93	2.71	0.32032	Myosin head, motor domain (2);	0.058193	0.64402	D	0.000003	D	0.88265	0.6390	L	0.48877	1.53	0.47441	D	0.999428	D	0.55800	0.973	P	0.59889	0.865	D	0.83912	0.0296	10	0.22109	T	0.4	.	6.5587	0.22474	0.0:0.5804:0.0:0.4196	.	667	Q6PIF6	MYO7B_HUMAN	E	667	ENSP00000374175:D667E;ENSP00000415090:D667E;ENSP00000386461:D667E	ENSP00000374175:D667E	D	+	3	2	MYO7B	128066847	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	1.575000	0.36493	1.215000	0.43411	-0.136000	0.14681	GAC	.	.	none		0.682	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
FUT5	2527	hgsc.bcm.edu	37	19	5867725	5867725	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:5867725C>T	ENST00000586349.1	-	4	406	c.407G>A	c.(406-408)tGg>tAg	p.W136*	FUT5_ENST00000252675.5_Silent_p.L4L|FUT5_ENST00000588525.1_Silent_p.L4L																							TGGCTGGGCCCAGGGGATCCA	0.602																																					p.L4L		Atlas-SNP	.											.	FUT5	29	.	0			c.G12A						PASS	.						22.0	25.0	24.0					19																	5867725		2200	4289	6489	SO:0001587	stop_gained	2527	exon2			TGGGCCCAGGGGA																												ENST00000586349.1:c.407G>A	19.37:g.5867725C>T	ENSP00000466639:p.Trp136*	223.0	0.0	0		107.0	32.0	0.299065	NM_002034		Silent	SNP	ENST00000586349.1	37																																																																																				.	.	none		0.602	AC024592.12-002	PUTATIVE	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_candidate_longest|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000452249.1		
NLRC5	84166	hgsc.bcm.edu	37	16	57060777	57060777	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:57060777T>G	ENST00000262510.6	+	6	2147	c.1922T>G	c.(1921-1923)tTc>tGc	p.F641C	NLRC5_ENST00000308149.7_Missense_Mutation_p.F641C|NLRC5_ENST00000436936.1_Missense_Mutation_p.F641C|NLRC5_ENST00000539144.1_Missense_Mutation_p.F641C	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	641					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CAACTGCCCTTCCACAATTTC	0.582																																					p.F641C		Atlas-SNP	.											.	NLRC5	186	.	0			c.T1922G						PASS	.						135.0	104.0	114.0					16																	57060777		2198	4300	6498	SO:0001583	missense	84166	exon5			TGCCCTTCCACAA	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1922T>G	16.37:g.57060777T>G	ENSP00000262510:p.Phe641Cys	145.0	0.0	0		161.0	103.0	0.639752	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.035554	0.54896	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.52	5.52	0.82312	.	0.000000	0.36200	N	0.002731	T	0.71660	0.3366	M	0.78049	2.395	0.30726	N	0.747709	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.85130	0.997;0.997;0.996;0.971	T	0.73849	-0.3853	10	0.42905	T	0.14	.	13.3563	0.60629	0.0:0.0:0.0:1.0	.	641;641;641;641	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.;.;.;NLRC5_HUMAN	C	641;641;641;115;641;148	ENSP00000262510:F641C;ENSP00000308886:F641C;ENSP00000389739:F641C;ENSP00000441727:F641C;ENSP00000441597:F148C	ENSP00000262510:F641C	F	+	2	0	NLRC5	55618278	1.000000	0.71417	0.996000	0.52242	0.574000	0.36063	4.416000	0.59815	2.096000	0.63516	0.459000	0.35465	TTC	.	.	none		0.582	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
KIAA0408	9729	hgsc.bcm.edu	37	6	127768258	127768258	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:127768258A>G	ENST00000483725.3	-	5	1542	c.1206T>C	c.(1204-1206)caT>caC	p.H402H	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	402										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		GAAGATCAGGATGAGATTTAG	0.438																																					p.H402H		Atlas-SNP	.											.	KIAA0408	61	.	0			c.T1206C						PASS	.						80.0	80.0	80.0					6																	127768258		2203	4300	6503	SO:0001819	synonymous_variant	9729	exon5			ATCAGGATGAGAT	AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1206T>C	6.37:g.127768258A>G		77.0	0.0	0		80.0	31.0	0.3875	NM_014702	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Silent	SNP	ENST00000483725.3	37	CCDS34531.1																																																																																			.	.	none		0.438	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702	
EZH2	2146	hgsc.bcm.edu	37	7	148508727	148508727	+	Missense_Mutation	SNP	T	T	A	rs267601394		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:148508727T>A	ENST00000460911.1	-	16	2010	c.1922A>T	c.(1921-1923)tAc>tTc	p.Y641F	EZH2_ENST00000350995.2_Missense_Mutation_p.Y602F|EZH2_ENST00000478654.1_Missense_Mutation_p.Y590F|EZH2_ENST00000476773.1_Missense_Mutation_p.Y590F|EZH2_ENST00000483967.1_Missense_Mutation_p.Y632F|EZH2_ENST00000320356.2_Missense_Mutation_p.Y646F|EZH2_ENST00000541220.1_Missense_Mutation_p.Y590F			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	641	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.		Y -> C (in a patient with diffuse large B-cell lymphoma; somatic mutation). {ECO:0000269|PubMed:20081860}.|Y -> F (found in patients with follicular lymphoma; also in diffuse large B-cell lymphoma; somatic mutation). {ECO:0000269|PubMed:20081860}.|Y -> H (found in patients with follicular lymphoma; also in diffuse large B-cell lymphoma; somatic mutation). {ECO:0000269|PubMed:20081860}.|Y -> N (found in patients with follicular lymphoma; also in diffuse large B-cell lymphoma; somatic mutation). {ECO:0000269|PubMed:20081860}.|Y -> S (found in patients with follicular lymphoma; also in diffuse large B-cell lymphoma; somatic mutation). {ECO:0000269|PubMed:20081860}.		cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.Y646F(59)|p.Y646S(22)|p.Y602F(8)|p.Y646C(6)|p.Y602S(4)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTCTCCACAGTATTCTGAGAT	0.378			Mis		DLBCL																																p.Y646F		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	EZH2_ENST00000350995,face,carcinoma,-1,214	EZH2	823	214	99	Substitution - Missense(99)	haematopoietic_and_lymphoid_tissue(99)	c.A1937T						PASS	.						96.0	89.0	91.0					7																	148508727		2203	4300	6503	SO:0001583	missense	2146	exon16			CCACAGTATTCTG		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1922A>T	7.37:g.148508727T>A	ENSP00000419711:p.Tyr641Phe	31.0	0.0	0		36.0	14.0	0.388889	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	t	28.3	4.907221	0.92107	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	D;D;D;D;D;D;D	0.92965	-3.14;-1.9;-1.9;-1.9;-3.14;-3.14;-1.9	5.63	5.63	0.86233	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.96990	0.9017	M	0.93328	3.405	0.80722	D	1	D;D;D;D;P	0.76494	0.999;0.997;0.964;0.999;0.817	D;D;D;D;B	0.71656	0.974;0.956;0.912;0.974;0.367	D	0.98006	1.0363	10	0.87932	D	0	.	15.87	0.79108	0.0:0.0:0.0:1.0	.	632;590;641;602;646	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	F	590;646;641;602;590;590;632	ENSP00000417062:Y590F;ENSP00000320147:Y646F;ENSP00000419711:Y641F;ENSP00000223193:Y602F;ENSP00000443219:Y590F;ENSP00000419050:Y590F;ENSP00000419856:Y632F	ENSP00000320147:Y646F	Y	-	2	0	EZH2	148139660	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.789000	0.85783	2.145000	0.66743	0.533000	0.62120	TAC	.	.	none		0.378	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
NCKAP5	344148	hgsc.bcm.edu	37	2	133542832	133542832	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:133542832T>C	ENST00000409261.1	-	14	1925	c.1552A>G	c.(1552-1554)Aga>Gga	p.R518G	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R518G|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	518										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AAGTGTTTTCTGTTTGTCTCC	0.493																																					p.R518G		Atlas-SNP	.											.	NCKAP5	322	.	0			c.A1552G						PASS	.						124.0	124.0	124.0					2																	133542832		1962	4173	6135	SO:0001583	missense	344148	exon14			GTTTTCTGTTTGT	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1552A>G	2.37:g.133542832T>C	ENSP00000387128:p.Arg518Gly	157.0	0.0	0		129.0	46.0	0.356589	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	t	0.068	-1.208267	0.01568	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10099	2.91;2.91	5.38	0.0287	0.14159	.	0.509237	0.13975	N	0.349882	T	0.05181	0.0138	N	0.12746	0.255	0.25358	N	0.988806	B	0.02656	0.0	B	0.06405	0.002	T	0.45425	-0.9262	10	0.12766	T	0.61	.	9.6561	0.39928	0.0:0.3315:0.0:0.6685	.	518	O14513	NCKP5_HUMAN	G	518	ENSP00000387128:R518G;ENSP00000380603:R518G	ENSP00000380603:R518G	R	-	1	2	NCKAP5	133259302	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.118000	0.10692	-0.187000	0.10516	-0.424000	0.05967	AGA	.	.	none		0.493	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
LOXL4	84171	hgsc.bcm.edu	37	10	100017842	100017842	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:100017842G>A	ENST00000260702.3	-	7	1151	c.1001C>T	c.(1000-1002)aCg>aTg	p.T334M	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	334	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GTCACAGACCGTGCCCCACTG	0.682																																					p.T334M		Atlas-SNP	.											.	LOXL4	60	.	0			c.C1001T						PASS	.						70.0	64.0	66.0					10																	100017842		2203	4300	6503	SO:0001583	missense	84171	exon7			CAGACCGTGCCCC	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1001C>T	10.37:g.100017842G>A	ENSP00000260702:p.Thr334Met	118.0	0.0	0		72.0	25.0	0.347222	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	37	CCDS7473.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952441	0.92660	.	.	ENSG00000138131	ENST00000260702	T	0.39229	1.09	4.94	4.94	0.65067	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	T	0.77136	0.4086	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85790	0.1367	10	0.66056	D	0.02	.	18.1558	0.89690	0.0:0.0:1.0:0.0	.	334	Q96JB6	LOXL4_HUMAN	M	334	ENSP00000260702:T334M	ENSP00000260702:T334M	T	-	2	0	LOXL4	100007832	1.000000	0.71417	0.929000	0.37066	0.949000	0.60115	9.869000	0.99810	2.283000	0.76528	0.549000	0.68633	ACG	.	.	none		0.682	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
SMOC1	64093	hgsc.bcm.edu	37	14	70459149	70459149	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:70459149C>T	ENST00000381280.4	+	6	795	c.542C>T	c.(541-543)cCg>cTg	p.P181L	SMOC1_ENST00000361956.3_Missense_Mutation_p.P181L	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	181					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GGGTCTAAGCCGACACCCACG	0.438																																					p.P181L		Atlas-SNP	.											.	SMOC1	61	.	0			c.C542T						PASS	.						146.0	147.0	146.0					14																	70459149		2203	4300	6503	SO:0001583	missense	64093	exon6			CTAAGCCGACACC	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.542C>T	14.37:g.70459149C>T	ENSP00000370680:p.Pro181Leu	110.0	0.0	0		79.0	4.0	0.0506329	NM_001034852	A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912646	0.72983	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.57273	0.41;0.41	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.60534	0.2276	L	0.29908	0.895	0.80722	D	1	P;D	0.89917	0.519;1.0	B;D	0.85130	0.175;0.997	T	0.52305	-0.8593	10	0.11485	T	0.65	-15.2578	18.9026	0.92449	0.0:1.0:0.0:0.0	.	181;181	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	L	181	ENSP00000355110:P181L;ENSP00000370680:P181L	ENSP00000355110:P181L	P	+	2	0	SMOC1	69528902	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.703000	0.84585	2.478000	0.83669	0.555000	0.69702	CCG	.	.	none		0.438	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1		
SLFN12	55106	hgsc.bcm.edu	37	17	33738875	33738875	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:33738875T>G	ENST00000394562.1	-	6	1742	c.1219A>C	c.(1219-1221)Aag>Cag	p.K407Q	SLFN12_ENST00000304905.5_Missense_Mutation_p.K407Q|RP11-686D22.8_ENST00000587012.1_RNA|SLFN12_ENST00000452764.3_Missense_Mutation_p.K407Q|SLFN12_ENST00000460530.1_5'UTR			Q8IYM2	SLN12_HUMAN	schlafen family member 12	407							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATTAATTGCTTAAGTCCTTCA	0.383																																					p.K407Q		Atlas-SNP	.											SLFN12,colon,carcinoma,+2,1	SLFN12	56	1	0			c.A1219C						PASS	.						103.0	107.0	106.0					17																	33738875		2203	4300	6503	SO:0001583	missense	55106	exon4			ATTGCTTAAGTCC	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1219A>C	17.37:g.33738875T>G	ENSP00000378063:p.Lys407Gln	74.0	0.0	0		47.0	18.0	0.382979	NM_018042	A8K711|Q9NP47	Missense_Mutation	SNP	ENST00000394562.1	37	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	T	4.983	0.182542	0.09495	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764	T;T;T	0.03920	3.76;3.76;3.76	3.05	-0.252	0.12999	.	.	.	.	.	T	0.02610	0.0079	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43877	-0.9364	9	0.51188	T	0.08	.	3.4293	0.07422	0.0:0.5168:0.2174:0.2659	.	407	Q8IYM2	SLN12_HUMAN	Q	407	ENSP00000378063:K407Q;ENSP00000302077:K407Q;ENSP00000394903:K407Q	ENSP00000302077:K407Q	K	-	1	0	SLFN12	30762988	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.299000	0.01139	-0.137000	0.11455	-2.169000	0.00324	AAG	.	.	none		0.383	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
SPRED3	399473	hgsc.bcm.edu	37	19	38882747	38882747	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:38882747G>A	ENST00000338502.4	+	2	442	c.339G>A	c.(337-339)ctG>ctA	p.L113L	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000586301.1_Silent_p.L113L|SPRED3_ENST00000587013.1_Silent_p.L157L	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	113	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGCCGCACTGGGTCGAGGTG	0.627																																					p.L113L		Atlas-SNP	.											.	SPRED3	47	.	0			c.G339A						PASS	.						81.0	88.0	86.0					19																	38882747		2051	4190	6241	SO:0001819	synonymous_variant	399473	exon2			CGCACTGGGTCGA		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.339G>A	19.37:g.38882747G>A		110.0	0.0	0		79.0	35.0	0.443038	NM_001042522	Q2MJR1	Silent	SNP	ENST00000338502.4	37	CCDS42560.1																																																																																			.	.	none		0.627	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459216.1	XM_351191	
ANKRD35	148741	hgsc.bcm.edu	37	1	145561654	145561654	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:145561654G>A	ENST00000355594.4	+	10	1429	c.1342G>A	c.(1342-1344)Ggg>Agg	p.G448R		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	448										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GACTACCAATGGGGCACAGAC	0.572																																					p.G448R	Melanoma(9;127 754 22988 51047)	Atlas-SNP	.											.	ANKRD35	96	.	0			c.G1342A						PASS	.						61.0	70.0	67.0					1																	145561654		2203	4300	6503	SO:0001583	missense	148741	exon10			ACCAATGGGGCAC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1342G>A	1.37:g.145561654G>A	ENSP00000347802:p.Gly448Arg	124.0	0.0	0		148.0	44.0	0.297297	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	G	2.695	-0.272176	0.05716	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	D	0.81821	-1.54	5.08	1.06	0.20224	.	0.359955	0.20369	N	0.093688	T	0.51601	0.1684	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.41752	-0.9491	10	0.22706	T	0.39	-7.101	4.7491	0.13052	0.2659:0.1576:0.5765:0.0	.	448	Q8N283	ANR35_HUMAN	R	357;448	ENSP00000347802:G448R	ENSP00000347802:G448R	G	+	1	0	ANKRD35	144273011	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.130000	0.15850	0.012000	0.14892	0.655000	0.94253	GGG	.	.	none		0.572	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
DAAM2	23500	hgsc.bcm.edu	37	6	39832772	39832772	+	Missense_Mutation	SNP	C	C	T	rs574596379	byFrequency	TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:39832772C>T	ENST00000398904.2	+	5	532	c.350C>T	c.(349-351)gCg>gTg	p.A117V	DAAM2_ENST00000538976.1_Missense_Mutation_p.A117V|DAAM2_ENST00000274867.4_Missense_Mutation_p.A117V|DAAM2_ENST00000494405.1_3'UTR			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	117	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					AGTCTGTACGCGTTTGATGAG	0.572											OREG0017416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2	0.000399361	0.0	0.0029	5008	,	,		17783	0.0		0.0	False		,,,				2504	0.0				p.A117V		Atlas-SNP	.											.	DAAM2	101	.	0			c.C350T						PASS	.						83.0	97.0	92.0					6																	39832772		2092	4212	6304	SO:0001583	missense	23500	exon5			TGTACGCGTTTGA	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.350C>T	6.37:g.39832772C>T	ENSP00000381876:p.Ala117Val	189.0	0.0	0	888	105.0	37.0	0.352381	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638456	0.47153	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.77620	-1.11;-1.11;-1.11	5.69	1.47	0.22746	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.460055	0.23541	N	0.047078	T	0.52451	0.1735	L	0.48362	1.52	0.80722	D	1	B;B	0.13594	0.007;0.008	B;B	0.08055	0.002;0.003	T	0.52102	-0.8620	10	0.36615	T	0.2	.	9.0456	0.36345	0.3782:0.5537:0.0:0.0681	.	117;117	G5EA45;Q86T65	.;DAAM2_HUMAN	V	117	ENSP00000274867:A117V;ENSP00000381876:A117V;ENSP00000437808:A117V	ENSP00000274867:A117V	A	+	2	0	DAAM2	39940750	0.840000	0.29493	0.012000	0.15200	0.795000	0.44927	1.720000	0.38022	0.695000	0.31675	0.655000	0.94253	GCG	.	.	none		0.572	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
EGFR	1956	hgsc.bcm.edu	37	7	55214404	55214404	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:55214404C>T	ENST00000275493.2	+	4	707	c.530C>T	c.(529-531)tCg>tTg	p.S177L	EGFR_ENST00000442591.1_Missense_Mutation_p.S177L|EGFR_ENST00000455089.1_Intron|EGFR_ENST00000342916.3_Missense_Mutation_p.S177L|EGFR_ENST00000344576.2_Missense_Mutation_p.S177L|EGFR_ENST00000454757.2_Missense_Mutation_p.S124L|EGFR_ENST00000420316.2_Missense_Mutation_p.S177L	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	177			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AGCAACATGTCGATGGACTTC	0.582		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.S177L		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	20426	.	0			c.C530T						PASS	.						128.0	101.0	110.0					7																	55214404		2203	4300	6503	SO:0001583	missense	1956	exon4	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	ACATGTCGATGGA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.530C>T	7.37:g.55214404C>T	ENSP00000275493:p.Ser177Leu	97.0	0.0	0		69.0	16.0	0.231884	NM_201283	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191545	0.38707	.	.	ENSG00000146648	ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000450046;ENST00000454757	D;D;D;D;D;T;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.06;-1.53	5.6	5.6	0.85130	.	0.578375	0.18102	N	0.151642	T	0.78110	0.4232	L	0.51422	1.61	0.37607	D	0.920783	B;B;B;B	0.17038	0.003;0.02;0.012;0.007	B;B;B;B	0.14023	0.006;0.01;0.007;0.002	T	0.75637	-0.3249	10	0.51188	T	0.08	.	17.1089	0.86670	0.0:1.0:0.0:0.0	.	177;177;177;177	P00533;P00533-3;P00533-4;P00533-2	EGFR_HUMAN;.;.;.	L	177;47;177;177;177;177;124;124	ENSP00000342376:S177L;ENSP00000345973:S177L;ENSP00000413843:S177L;ENSP00000275493:S177L;ENSP00000410031:S177L;ENSP00000413354:S124L;ENSP00000395243:S124L	ENSP00000275493:S177L	S	+	2	0	EGFR	55181898	0.008000	0.16893	0.978000	0.43139	0.094000	0.18550	1.093000	0.30939	2.630000	0.89119	0.655000	0.94253	TCG	.	.	none		0.582	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
OR2L8	391190	hgsc.bcm.edu	37	1	248112914	248112914	+	Missense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:248112914C>A	ENST00000357191.3	+	1	755	c.755C>A	c.(754-756)gCa>gAa	p.A252E	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCTACTATGCACCTTTTGTC	0.478																																					p.A252E		Atlas-SNP	.											OR2L8,right_upper_lobe,carcinoma,0,1	OR2L8	92	1	0			c.C755A						PASS	.						143.0	103.0	116.0					1																	248112914		2203	4298	6501	SO:0001583	missense	391190	exon1			ACTATGCACCTTT	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.755C>A	1.37:g.248112914C>A	ENSP00000349719:p.Ala252Glu	234.0	0.0	0		208.0	45.0	0.216346	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	6.378	0.437845	0.12104	.	.	ENSG00000196936	ENST00000357191	T	0.38887	1.11	1.8	-0.381	0.12485	GPCR, rhodopsin-like superfamily (1);	0.590255	0.12675	U	0.448469	T	0.44265	0.1285	L	0.60067	1.865	0.09310	N	1	P	0.45126	0.851	P	0.51550	0.673	T	0.36359	-0.9751	10	0.87932	D	0	.	3.7754	0.08657	0.0:0.3475:0.3505:0.302	.	252	Q8NGY9	OR2L8_HUMAN	E	252	ENSP00000349719:A252E	ENSP00000349719:A252E	A	+	2	0	OR2L8	246179537	0.000000	0.05858	0.211000	0.23655	0.010000	0.07245	-0.477000	0.06583	-0.281000	0.09141	-0.443000	0.05667	GCA	.	.	none		0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
RSPO3	84870	hgsc.bcm.edu	37	6	127476585	127476585	+	Splice_Site	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:127476585T>C	ENST00000356698.4	+	4	1223		c.e4+2		RSPO3_ENST00000368317.3_Splice_Site	NM_032784.3	NP_116173.2	Q9BXY4	RSPO3_HUMAN	R-spondin 3						branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)	extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		PTPRK/RSPO3(10)	breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17				GBM - Glioblastoma multiforme(226;0.0555)		GAGAACGAGGTACAATCATAA	0.368																																					.		Atlas-SNP	.											RSPO3,NS,carcinoma,+2,1	RSPO3	32	1	0			c.634+2T>C						PASS	.						63.0	53.0	56.0					6																	127476585		2203	4300	6503	SO:0001630	splice_region_variant	84870	exon4			ACGAGGTACAATC	BC022367	CCDS5135.1	6q22.33	2013-02-28	2011-06-29	2005-08-08	ENSG00000146374	ENSG00000146374		"""Endogenous ligands"""	20866	protein-coding gene	gene with protein product		610574	"""thrombospondin, type I, domain containing 2"", ""R-spondin 3 homolog (Xenopus laevis)"""	THSD2		10842357, 15469841	Standard	NM_032784		Approved	FLJ14440	uc003qar.3	Q9BXY4	OTTHUMG00000015521	ENST00000356698.4:c.634+2T>C	6.37:g.127476585T>C		59.0	0.0	0		50.0	24.0	0.48	NM_032784	B2RC27|Q5VTV4|Q96K87	Splice_Site	SNP	ENST00000356698.4	37	CCDS5135.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359375	0.61403	.	.	ENSG00000146374	ENST00000356698;ENST00000368317	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6555	0.51315	0.0:0.0:0.1481:0.8519	.	.	.	.	.	-1	.	.	.	+	.	.	RSPO3	127518278	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.139000	0.50577	2.124000	0.65301	0.455000	0.32223	.	.	.	none		0.368	RSPO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042111.1	NM_032784	Intron
FAM210B	116151	hgsc.bcm.edu	37	20	54945628	54945628	+	IGR	SNP	G	G	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr20:54945628G>C	ENST00000371384.3	+	0	3046				AURKA_ENST00000395909.4_Missense_Mutation_p.S314R|AURKA_ENST00000347343.2_Missense_Mutation_p.S314R|AURKA_ENST00000371356.2_Missense_Mutation_p.S314R|AURKA_ENST00000395915.3_Missense_Mutation_p.S314R|AURKA_ENST00000395913.3_Missense_Mutation_p.S314R|AURKA_ENST00000395911.1_Missense_Mutation_p.S314R|AURKA_ENST00000395914.1_Missense_Mutation_p.S314R|AURKA_ENST00000395907.1_Missense_Mutation_p.S314R|AURKA_ENST00000312783.6_Missense_Mutation_p.S314R	NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B							integral component of membrane (GO:0016021)											GAACTCCAAGGCTCCAGAGAT	0.483																																					p.S314R		Atlas-SNP	.											.	AURKA	42	.	0			c.C942G						PASS	.						86.0	85.0	85.0					20																	54945628		2203	4300	6503	SO:0001628	intergenic_variant	6790	exon8			TCCAAGGCTCCAG	AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793		20.37:g.54945628G>C		126.0	0.0	0		92.0	31.0	0.336957	NM_198437	B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	ENST00000371384.3	37	CCDS13450.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514015	0.64522	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907	T;T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.01	2.65	0.31530	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	H	0.97962	4.115	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.998;0.998;0.998	T	0.71344	-0.4621	10	0.72032	D	0.01	-11.5994	10.6203	0.45476	0.2568:0.0:0.7432:0.0	.	246;314;314;314	B4DX16;A3KFJ0;B2R6Z3;O14965	.;.;.;AURKA_HUMAN	R	314	ENSP00000379245:S314R;ENSP00000379250:S314R;ENSP00000216911:S314R;ENSP00000379251:S314R;ENSP00000321591:S314R;ENSP00000360407:S314R;ENSP00000379249:S314R;ENSP00000379247:S314R;ENSP00000379243:S314R	ENSP00000321591:S314R	S	-	3	2	AURKA	54379035	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.239000	0.32719	1.239000	0.43787	0.650000	0.86243	AGC	.	.	none		0.483	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079800.2	NM_080821	
GJA9	81025	hgsc.bcm.edu	37	1	39341674	39341674	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:39341674G>A	ENST00000360786.3	-	1	349	c.97C>T	c.(97-99)Cga>Tga	p.R33*	RP5-864K19.4_ENST00000456813.1_RNA|RP5-864K19.4_ENST00000433671.2_RNA|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000454994.2_Nonsense_Mutation_p.R33*|MYCBP_ENST00000397572.2_5'Flank|GJA9_ENST00000357771.3_Nonsense_Mutation_p.R33*|MYCBP_ENST00000489803.1_5'UTR			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	33					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			ACAAGCATTCGAAATATGAAC	0.463																																					p.R33X		Atlas-SNP	.											GJA9,NS,carcinoma,+1,2	GJA9	55	2	0			c.C97T						PASS	.						232.0	234.0	234.0					1																	39341674		2203	4300	6503	SO:0001587	stop_gained	81025	exon2			GCATTCGAAATAT	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.97C>T	1.37:g.39341674G>A	ENSP00000354020:p.Arg33*	105.0	0.0	0		88.0	32.0	0.363636	NM_030772	B2R722|B3KVQ2|Q5TA63|Q96KG0	Nonsense_Mutation	SNP	ENST00000360786.3	37	CCDS432.1	.	.	.	.	.	.	.	.	.	.	G	37	6.181663	0.97352	.	.	ENSG00000131233	ENST00000454994;ENST00000357771;ENST00000360786	.	.	.	4.56	1.49	0.22878	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2658	0.20925	0.1684:0.0:0.6824:0.1491	.	.	.	.	X	33	.	ENSP00000350415:R33X	R	-	1	2	GJA9	39114261	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	3.814000	0.55643	0.198000	0.20407	0.655000	0.94253	CGA	.	.	none		0.463	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001205.1	NM_030772	
PLD2	5338	hgsc.bcm.edu	37	17	4718855	4718855	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:4718855C>T	ENST00000263088.6	+	13	1389	c.1258C>T	c.(1258-1260)Ctg>Ttg	p.L420L	PLD2_ENST00000572940.1_Silent_p.L420L	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	420					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CAAGAGGGCGCTGATGCTGCT	0.582											OREG0024105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L420L		Atlas-SNP	.											PLD2_ENST00000263088,bladder,carcinoma,-2,2	PLD2	138	2	0			c.C1258T						PASS	.						250.0	220.0	230.0					17																	4718855		2203	4300	6503	SO:0001819	synonymous_variant	5338	exon13			AGGGCGCTGATGC	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1258C>T	17.37:g.4718855C>T		156.0	0.0	0	621	115.0	48.0	0.417391	NM_001243108	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	ENST00000263088.6	37	CCDS11057.1																																																																																			.	.	none		0.582	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
TSEN15	116461	hgsc.bcm.edu	37	1	184020964	184020964	+	Silent	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:184020964C>A	ENST00000361641.1	+	1	154	c.75C>A	c.(73-75)ggC>ggA	p.G25G	TSEN15_ENST00000533373.1_Silent_p.G25G|TSEN15_ENST00000423085.2_Silent_p.G25G	NM_052965.2	NP_443197.1	Q8WW01	SEN15_HUMAN	TSEN15 tRNA splicing endonuclease subunit	25					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)	tRNA-intron endonuclease activity (GO:0000213)			breast(1)|kidney(3)|large_intestine(2)|lung(2)	8						GCGGCTTTGGCGACGGCGGTG	0.746																																					p.G25G		Atlas-SNP	.											.	TSEN15	19	.	0			c.C75A						PASS	.						6.0	9.0	8.0					1																	184020964		2080	4114	6194	SO:0001819	synonymous_variant	116461	exon1			CTTTGGCGACGGC	AF288394	CCDS1361.1, CCDS44286.1, CCDS72993.1	1q25	2013-08-06	2013-08-06	2008-06-12	ENSG00000198860	ENSG00000198860		"""tRNA splicing endonuclease subunits"""	16791	protein-coding gene	gene with protein product		608756	"""chromosome 1 open reading frame 19"", ""tRNA splicing endonuclease 15 homolog (S. cerevisiae)"""	C1orf19		11318611, 17166513	Standard	XM_006711148		Approved		uc001gqt.4	Q8WW01	OTTHUMG00000035461	ENST00000361641.1:c.75C>A	1.37:g.184020964C>A		38.0	0.0	0		41.0	13.0	0.317073	NM_001127394	B4DKP0|Q9BZQ5	Silent	SNP	ENST00000361641.1	37	CCDS1361.1																																																																																			.	.	none		0.746	TSEN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086132.1		
SIPA1L1	26037	hgsc.bcm.edu	37	14	72190600	72190600	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:72190600G>A	ENST00000555818.1	+	16	4856	c.4508G>A	c.(4507-4509)aGa>aAa	p.R1503K	SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.R1482K|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.R957K|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.R1482K	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1503					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ATGGACACGAGAAAGTAAGAG	0.473																																					p.R1503K		Atlas-SNP	.											.	SIPA1L1	219	.	0			c.G4508A						PASS	.						62.0	69.0	67.0					14																	72190600		2203	4300	6503	SO:0001583	missense	26037	exon16			ACACGAGAAAGTA	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4508G>A	14.37:g.72190600G>A	ENSP00000450832:p.Arg1503Lys	61.0	0.0	0		37.0	12.0	0.324324	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041335	0.35989	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;D	0.83673	-0.92;-0.91;-0.92;-1.75	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.82614	0.5075	N	0.16368	0.405	0.80722	D	1	P;P;B;P;B	0.52842	0.885;0.956;0.063;0.942;0.127	P;P;B;P;B	0.62184	0.465;0.899;0.034;0.573;0.161	T	0.77635	-0.2514	10	0.12430	T	0.62	-26.2712	19.4992	0.95086	0.0:0.0:1.0:0.0	.	957;1503;957;1482;1503	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	K	1482;1503;1482;957	ENSP00000370630:R1482K;ENSP00000450832:R1503K;ENSP00000351352:R1482K;ENSP00000440682:R957K	ENSP00000351352:R1503K	R	+	2	0	SIPA1L1	71260353	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.184000	0.94893	2.689000	0.91719	0.655000	0.94253	AGA	.	.	none		0.473	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
MZF1	7593	hgsc.bcm.edu	37	19	59073591	59073591	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:59073591C>T	ENST00000215057.2	-	6	2613	c.2053G>A	c.(2053-2055)Gag>Aag	p.E685K	AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594234.1_3'UTR|MZF1_ENST00000599369.1_Missense_Mutation_p.E685K	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	685					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E685K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		TTGCCACACTCAGGGCATGCG	0.697																																					p.E685K		Atlas-SNP	.											MZF1,NS,carcinoma,0,1	MZF1	37	1	1	Substitution - Missense(1)	endometrium(1)	c.G2053A						PASS	.						57.0	44.0	48.0					19																	59073591		2202	4298	6500	SO:0001583	missense	7593	exon6			CACACTCAGGGCA	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.2053G>A	19.37:g.59073591C>T	ENSP00000215057:p.Glu685Lys	94.0	0.0	0		47.0	23.0	0.489362	NM_198055	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949631	0.73787	.	.	ENSG00000099326	ENST00000215057	T	0.16597	2.33	3.06	3.06	0.35304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12944	0.0314	N	0.21142	0.635	0.35830	D	0.825217	P	0.43542	0.81	B	0.40506	0.331	T	0.27468	-1.0073	9	0.72032	D	0.01	-17.6756	12.3439	0.55109	0.0:1.0:0.0:0.0	.	685	P28698	MZF1_HUMAN	K	685	ENSP00000215057:E685K	ENSP00000215057:E685K	E	-	1	0	MZF1	63765403	0.000000	0.05858	0.996000	0.52242	0.941000	0.58515	-0.144000	0.10280	2.014000	0.59158	0.462000	0.41574	GAG	.	.	none		0.697	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
EZH2	2146	hgsc.bcm.edu	37	7	148507460	148507460	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:148507460T>C	ENST00000460911.1	-	17	2067	c.1979A>G	c.(1978-1980)aAa>aGa	p.K660R	EZH2_ENST00000350995.2_Missense_Mutation_p.K621R|EZH2_ENST00000478654.1_Missense_Mutation_p.K609R|EZH2_ENST00000476773.1_Missense_Mutation_p.K609R|EZH2_ENST00000483967.1_Missense_Mutation_p.K651R|EZH2_ENST00000320356.2_Missense_Mutation_p.K665R|EZH2_ENST00000541220.1_Missense_Mutation_p.K609R			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	660	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.K665_Y666del(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			GCACATGTATTTATCATACAC	0.428			Mis		DLBCL																																p.K665R		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.A1994G						PASS	.						110.0	91.0	98.0					7																	148507460		2202	4300	6502	SO:0001583	missense	2146	exon17			ATGTATTTATCAT		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1979A>G	7.37:g.148507460T>C	ENSP00000419711:p.Lys660Arg	79.0	0.0	0		61.0	22.0	0.360656	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	t	29.6	5.021682	0.93462	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	T;T;T;T;T;T;T	0.81247	-1.47;-1.32;-1.32;-1.32;-1.47;-1.47;-1.32	5.45	5.45	0.79879	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.84611	0.5510	L	0.39566	1.225	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.994	T	0.81705	-0.0811	10	0.21014	T	0.42	.	15.542	0.76057	0.0:0.0:0.0:1.0	.	651;609;660;621;665	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	R	609;665;660;621;609;609;651	ENSP00000417062:K609R;ENSP00000320147:K665R;ENSP00000419711:K660R;ENSP00000223193:K621R;ENSP00000443219:K609R;ENSP00000419050:K609R;ENSP00000419856:K651R	ENSP00000320147:K665R	K	-	2	0	EZH2	148138393	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.789000	0.85783	2.064000	0.61679	0.533000	0.62120	AAA	.	.	none		0.428	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
PTBP2	58155	hgsc.bcm.edu	37	1	97243142	97243142	+	Splice_Site	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:97243142G>A	ENST00000426398.2	+	6	477	c.434G>A	c.(433-435)cGt>cAt	p.R145H	PTBP2_ENST00000541987.1_Splice_Site_p.R114H|PTBP2_ENST00000370198.1_Splice_Site_p.R145H|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370197.1_Splice_Site_p.R145H|PTBP2_ENST00000609116.1_Splice_Site_p.R145H|PTBP2_ENST00000394184.3_Splice_Site_p.R156H	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	145					mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		AATTTCCAGCGTGCTCAGGCA	0.438																																					p.R145H		Atlas-SNP	.											.	PTBP2	62	.	0			c.G434A						PASS	.						68.0	66.0	67.0					1																	97243142		2203	4300	6503	SO:0001630	splice_region_variant	58155	exon6			TCCAGCGTGCTCA	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.433-1G>A	1.37:g.97243142G>A		332.0	0.0	0		216.0	98.0	0.453704	NM_021190	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	CCDS754.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813104	0.90707	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	T;T;T;T;T;T	0.77750	0.89;0.86;0.86;0.89;0.87;-1.12	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	M	0.69463	2.115	0.80722	D	1	B;D;D;B;B;B	0.76494	0.069;0.999;0.999;0.276;0.227;0.397	B;D;D;B;B;B	0.76071	0.059;0.987;0.984;0.049;0.03;0.071	D	0.84408	0.0564	10	0.52906	T	0.07	-2.5786	20.5632	0.99335	0.0:0.0:1.0:0.0	.	153;156;145;145;145;145	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;PTBP2_HUMAN;.;.	H	145;145;145;145;156;114;135	ENSP00000236228:R145H;ENSP00000359217:R145H;ENSP00000359216:R145H;ENSP00000412788:R145H;ENSP00000377738:R156H;ENSP00000442475:R114H	ENSP00000236228:R145H	R	+	2	0	PTBP2	97015730	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.143000	0.94623	2.937000	0.99478	0.650000	0.86243	CGT	.	.	none		0.438	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		Missense_Mutation
VANGL1	81839	hgsc.bcm.edu	37	1	116206595	116206595	+	Missense_Mutation	SNP	G	G	A	rs148341022		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:116206595G>A	ENST00000355485.2	+	4	789	c.518G>A	c.(517-519)cGc>cAc	p.R173H	VANGL1_ENST00000310260.3_Missense_Mutation_p.R173H|VANGL1_ENST00000369509.1_Missense_Mutation_p.R173H|VANGL1_ENST00000369510.4_Missense_Mutation_p.R171H	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	173					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.F171fs*93(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CTTTTTTTCCGCAAGCGGAGA	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18866	0.0		0.0	False		,,,				2504	0.0				p.R173H		Atlas-SNP	.											.	VANGL1	65	.	1	Deletion - Frameshift(1)	kidney(1)	c.G518A						PASS	.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	157.0	164.0	162.0		512,518,518	4.4	1.0	1	dbSNP_134	162	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	VANGL1	NM_001172411.1,NM_001172412.1,NM_138959.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	171/523,173/525,173/525	116206595	1,13005	2203	4300	6503	SO:0001583	missense	81839	exon4			TTTTCCGCAAGCG	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.518G>A	1.37:g.116206595G>A	ENSP00000347672:p.Arg173His	344.0	1.0	0.00290698		214.0	82.0	0.383178	NM_138959	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	37	CCDS883.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.625876	0.66901	0.0	1.16E-4	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	5.34	4.43	0.53597	.	0.000000	0.85682	D	0.000000	D	0.92355	0.7574	M	0.84511	2.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.979;0.988	D	0.93638	0.6962	10	0.72032	D	0.01	-0.2344	14.2916	0.66281	0.0719:0.0:0.9281:0.0	.	171;173	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	H	173;171;173;173	ENSP00000347672:R173H;ENSP00000358523:R171H;ENSP00000310800:R173H;ENSP00000358522:R173H	ENSP00000310800:R173H	R	+	2	0	VANGL1	116008118	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	9.476000	0.97823	1.397000	0.46682	-0.142000	0.14014	CGC	G|1.000;A|0.000	0.000	weak		0.493	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
FAT4	79633	hgsc.bcm.edu	37	4	126412678	126412678	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr4:126412678G>A	ENST00000394329.3	+	17	14714	c.14701G>A	c.(14701-14703)Gga>Aga	p.G4901R	FAT4_ENST00000335110.5_Missense_Mutation_p.G3142R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4901					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGCCGAGGGAGGACCTGTGGG	0.537																																					p.G4901R		Atlas-SNP	.											.	FAT4	1752	.	0			c.G14701A						PASS	.						60.0	58.0	59.0					4																	126412678		2203	4300	6503	SO:0001583	missense	79633	exon17			GAGGGAGGACCTG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14701G>A	4.37:g.126412678G>A	ENSP00000377862:p.Gly4901Arg	148.0	0.0	0		141.0	60.0	0.425532	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518282	0.64634	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.89617	-2.38;-2.54	5.19	5.19	0.71726	.	0.000000	0.33875	U	0.004462	D	0.93818	0.8023	M	0.79123	2.44	0.52501	D	0.999958	D;D;D	0.69078	0.99;0.997;0.99	P;P;P	0.62382	0.901;0.881;0.901	D	0.94568	0.7768	10	0.87932	D	0	.	17.7328	0.88383	0.0:0.0:1.0:0.0	.	3142;4901;4900	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	4901;3142	ENSP00000377862:G4901R;ENSP00000335169:G3142R	ENSP00000335169:G3142R	G	+	1	0	FAT4	126632128	1.000000	0.71417	0.824000	0.32777	0.750000	0.42670	5.265000	0.65519	2.425000	0.82216	0.491000	0.48974	GGA	.	.	none		0.537	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
DNAH1	25981	hgsc.bcm.edu	37	3	52409342	52409342	+	Missense_Mutation	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:52409342A>G	ENST00000420323.2	+	45	7333	c.7072A>G	c.(7072-7074)Atg>Gtg	p.M2358V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2358	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCGCGGCTGATGCGTCACTT	0.572																																					p.M2358V		Atlas-SNP	.											.	DNAH1	534	.	0			c.A7072G						PASS	.						52.0	53.0	53.0					3																	52409342		2088	4207	6295	SO:0001583	missense	25981	exon45			CGGCTGATGCGTC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7072A>G	3.37:g.52409342A>G	ENSP00000401514:p.Met2358Val	78.0	0.0	0		36.0	17.0	0.472222	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	6.771	0.511200	0.12883	.	.	ENSG00000114841	ENST00000420323	T	0.34667	1.35	5.71	5.71	0.89125	.	0.396398	0.21139	N	0.079506	T	0.24661	0.0598	N	0.16602	0.42	0.23869	N	0.996616	B	0.06786	0.001	B	0.09377	0.004	T	0.10359	-1.0633	10	0.17832	T	0.49	.	15.9779	0.80083	1.0:0.0:0.0:0.0	.	2358	C9JXH6	.	V	2358	ENSP00000401514:M2358V	ENSP00000401514:M2358V	M	+	1	0	DNAH1	52384382	0.995000	0.38212	0.987000	0.45799	0.158000	0.22134	3.572000	0.53849	2.183000	0.69458	0.454000	0.30748	ATG	.	.	none		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DCC	1630	hgsc.bcm.edu	37	18	50832066	50832066	+	Missense_Mutation	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr18:50832066A>G	ENST00000442544.2	+	13	2646	c.2030A>G	c.(2029-2031)aAc>aGc	p.N677S	DCC_ENST00000581580.1_Missense_Mutation_p.N332S|DCC_ENST00000412726.1_Missense_Mutation_p.N525S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	677	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTGGAGCCAAACAACCTCTGG	0.428																																					p.N677S		Atlas-SNP	.											.	DCC	360	.	0			c.A2030G						PASS	.						99.0	104.0	102.0					18																	50832066		2203	4300	6503	SO:0001583	missense	1630	exon13			AGCCAAACAACCT	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2030A>G	18.37:g.50832066A>G	ENSP00000389140:p.Asn677Ser	121.0	0.0	0		88.0	35.0	0.397727	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631843	0.46944	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.56776	0.44;0.44	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.30603	0.0770	N	0.05383	-0.06	0.52099	D	0.999944	B;B;B	0.15141	0.007;0.003;0.012	B;B;B	0.20767	0.031;0.031;0.018	T	0.19712	-1.0297	10	0.05620	T	0.96	.	15.0365	0.71751	1.0:0.0:0.0:0.0	.	525;525;677	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	S	677;610;525	ENSP00000389140:N677S;ENSP00000397322:N525S	ENSP00000304146:N610S	N	+	2	0	DCC	49086064	1.000000	0.71417	0.985000	0.45067	0.977000	0.68977	8.773000	0.91762	2.239000	0.73571	0.533000	0.62120	AAC	.	.	none		0.428	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
ADRA1D	146	hgsc.bcm.edu	37	20	4229009	4229009	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr20:4229009C>T	ENST00000379453.4	-	1	712	c.596G>A	c.(595-597)cGc>cAc	p.R199H		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	199					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)	p.R199H(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	GAGTGAGTGGCGCACGCCCAC	0.682																																					p.R199H		Atlas-SNP	.											ADRA1D,NS,carcinoma,0,1	ADRA1D	36	1	1	Substitution - Missense(1)	lung(1)	c.G596A						PASS	.						33.0	36.0	35.0					20																	4229009		2196	4296	6492	SO:0001583	missense	146	exon1			GAGTGGCGCACGC	U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.596G>A	20.37:g.4229009C>T	ENSP00000368766:p.Arg199His	135.0	0.0	0		83.0	32.0	0.385542	NM_000678	Q9NPY0	Missense_Mutation	SNP	ENST00000379453.4	37	CCDS13079.1	.	.	.	.	.	.	.	.	.	.	c	18.46	3.627986	0.66901	.	.	ENSG00000171873	ENST00000379453	T	0.19806	2.12	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.055353	0.64402	D	0.000004	T	0.34513	0.0900	L	0.48260	1.515	0.31054	N	0.714891	D	0.76494	0.999	D	0.73380	0.98	T	0.24977	-1.0145	10	0.59425	D	0.04	.	8.376	0.32442	0.0:0.8943:0.0:0.1057	.	199	P25100	ADA1D_HUMAN	H	199	ENSP00000368766:R199H	ENSP00000368766:R199H	R	-	2	0	ADRA1D	4177009	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.625000	0.46452	2.339000	0.79563	0.552000	0.68991	CGC	.	.	none		0.682	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077812.2	NM_000678	
GNAI2	2771	hgsc.bcm.edu	37	3	50294169	50294169	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:50294169G>A	ENST00000313601.6	+	6	992	c.608G>A	c.(607-609)gGt>gAt	p.G203D	GNAI2_ENST00000440628.1_Missense_Mutation_p.G151D|GNAI2_ENST00000536647.1_Missense_Mutation_p.G122D|GNAI2_ENST00000422163.1_Missense_Mutation_p.G187D|GNAI2_ENST00000451956.1_Missense_Mutation_p.G166D|GNAI2_ENST00000266027.5_Missense_Mutation_p.G187D|GNAI2_ENST00000491100.1_3'UTR	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	203					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		TTTGATGTGGGTGGTCAGCGG	0.542																																					p.G203D		Atlas-SNP	.											.	GNAI2	42	.	0			c.G608A						PASS	.						166.0	156.0	159.0					3																	50294169		2203	4300	6503	SO:0001583	missense	2771	exon6			ATGTGGGTGGTCA	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.608G>A	3.37:g.50294169G>A	ENSP00000312999:p.Gly203Asp	283.0	0.0	0		191.0	76.0	0.397906	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	37	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738764	0.89573	.	.	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	4.97	4.1	0.47936	.	0.000000	0.85682	D	0.000000	D	0.98592	0.9529	H	0.98936	4.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98640	1.0675	10	0.87932	D	0	.	11.6416	0.51235	0.0865:0.0:0.9135:0.0	.	166;203;187;187	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	D	187;203;122;203;151;166;187	ENSP00000406871:G187D;ENSP00000312999:G203D;ENSP00000444360:G122D;ENSP00000395736:G151D;ENSP00000406369:G166D;ENSP00000266027:G187D	ENSP00000266027:G187D	G	+	2	0	GNAI2	50269173	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.596000	0.98267	1.479000	0.48272	0.655000	0.94253	GGT	.	.	none		0.542	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
ERICH6B	220081	hgsc.bcm.edu	37	13	46115752	46115752	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr13:46115752G>A	ENST00000298738.2	-	15	2100	c.1936C>T	c.(1936-1938)Cca>Tca	p.P646S	FAM194B_ENST00000504261.1_Intron	NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		646										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TGGGCTGTTGGGCCGGGTTCT	0.522																																					p.P646S		Atlas-SNP	.											.	FAM194B	42	.	0			c.C1936T						PASS	.						181.0	172.0	174.0					13																	46115752		692	1591	2283	SO:0001583	missense	220081	exon15			CTGTTGGGCCGGG																												ENST00000298738.2:c.1936C>T	13.37:g.46115752G>A	ENSP00000298738:p.Pro646Ser	219.0	0.0	0		153.0	48.0	0.313726	NM_182542	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	G	0.395	-0.921643	0.02396	.	.	ENSG00000165837	ENST00000298738	T	0.10477	2.87	4.89	-4.13	0.03904	.	.	.	.	.	T	0.02418	0.0074	N	0.00707	-1.245	0.09310	N	1	B	0.32573	0.376	B	0.27887	0.084	T	0.42766	-0.9432	9	0.87932	D	0	-0.0214	5.6283	0.17495	0.2256:0.0:0.505:0.2694	.	646	Q5W0A0	F194B_HUMAN	S	646	ENSP00000298738:P646S	ENSP00000298738:P646S	P	-	1	0	FAM194B	45013753	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.717000	0.04986	-0.484000	0.06763	0.603000	0.83216	CCA	.	.	none		0.522	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
TRIM42	287015	hgsc.bcm.edu	37	3	140406661	140406661	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:140406661C>T	ENST00000286349.3	+	3	1328	c.1137C>T	c.(1135-1137)ggC>ggT	p.G379G		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	379						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCAGAAATGGCTTTCTCAAGT	0.383																																					p.G379G		Atlas-SNP	.											.	TRIM42	143	.	0			c.C1137T						PASS	.						75.0	74.0	75.0					3																	140406661		2203	4300	6503	SO:0001819	synonymous_variant	287015	exon3			AAATGGCTTTCTC	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1137C>T	3.37:g.140406661C>T		174.0	0.0	0		126.0	57.0	0.452381	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																			.	.	none		0.383	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
KLHL6	89857	hgsc.bcm.edu	37	3	183273173	183273173	+	Missense_Mutation	SNP	A	A	G	rs140971016		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:183273173A>G	ENST00000341319.3	-	1	304	c.269T>C	c.(268-270)cTt>cCt	p.L90P		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	90	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GGCTGCGGCAAGCACCACGCG	0.507													A|||	1	0.000199681	0.0	0.0	5008	,	,		15531	0.0		0.0	False		,,,				2504	0.001				p.L90P		Atlas-SNP	.											.	KLHL6	100	.	0			c.T269C						PASS	.	A	PRO/LEU	0,4406		0,0,2203	98.0	88.0	92.0		269	5.6	1.0	3	dbSNP_134	92	1,8599		0,1,4299	no	missense	KLHL6	NM_130446.2	98	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	90/622	183273173	1,13005	2203	4300	6503	SO:0001583	missense	89857	exon1			GCGGCAAGCACCA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.269T>C	3.37:g.183273173A>G	ENSP00000341342:p.Leu90Pro	206.0	0.0	0		147.0	58.0	0.394558	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386970	0.82902	0.0	1.16E-4	ENSG00000172578	ENST00000341319	D	0.90004	-2.6	5.56	5.56	0.83823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.96972	0.9011	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98701	1.0700	10	0.87932	D	0	.	15.7124	0.77641	1.0:0.0:0.0:0.0	.	90	Q8WZ60	KLHL6_HUMAN	P	90	ENSP00000341342:L90P	ENSP00000341342:L90P	L	-	2	0	KLHL6	184755867	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.483000	0.81158	2.108000	0.64289	0.533000	0.62120	CTT	A|1.000;G|0.000	0.000	weak		0.507	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
ABCA13	154664	hgsc.bcm.edu	37	7	48314642	48314642	+	Silent	SNP	T	T	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:48314642T>A	ENST00000435803.1	+	17	5403	c.5379T>A	c.(5377-5379)atT>atA	p.I1793I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1793					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ACTTCGCAATTGTGATAAAAA	0.378																																					p.I1793I		Atlas-SNP	.											.	ABCA13	1192	.	0			c.T5379A						PASS	.						43.0	41.0	41.0					7																	48314642		1844	4104	5948	SO:0001819	synonymous_variant	154664	exon17			CGCAATTGTGATA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5379T>A	7.37:g.48314642T>A		123.0	0.0	0		157.0	44.0	0.280255	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.	.	none		0.378	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
SEC16A	9919	hgsc.bcm.edu	37	9	139371030	139371030	+	Silent	SNP	A	A	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:139371030A>C	ENST00000371706.3	-	1	537	c.504T>G	c.(502-504)cgT>cgG	p.R168R	SEC16A_ENST00000431893.2_Silent_p.R168R|SEC16A_ENST00000313050.7_Silent_p.R346R|SEC16A_ENST00000290037.6_Silent_p.R168R			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	168					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGTGGTGCGTACGGTTTTCTG	0.632																																					p.R346R		Atlas-SNP	.											.	SEC16A	249	.	0			c.T1038G						PASS	.						20.0	22.0	21.0					9																	139371030		1852	4093	5945	SO:0001819	synonymous_variant	9919	exon3			GTGCGTACGGTTT	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.504T>G	9.37:g.139371030A>C		96.0	0.0	0		87.0	40.0	0.45977	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	37																																																																																				.	.	none		0.632	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
AVL9	23080	hgsc.bcm.edu	37	7	32620454	32620454	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:32620454G>A	ENST00000318709.4	+	15	2004	c.1783G>A	c.(1783-1785)Gtc>Atc	p.V595I	AVL9_ENST00000404479.1_Intron|AVL9_ENST00000409301.1_Missense_Mutation_p.V577I	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	595					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AATTGGAAACGTCATGGTCAC	0.368																																					p.V595I		Atlas-SNP	.											.	AVL9	66	.	0			c.G1783A						PASS	.						92.0	86.0	88.0					7																	32620454		2203	4300	6503	SO:0001583	missense	23080	exon15			GGAAACGTCATGG	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.1783G>A	7.37:g.32620454G>A	ENSP00000315568:p.Val595Ile	159.0	0.0	0		178.0	33.0	0.185393	NM_015060	Q92573	Missense_Mutation	SNP	ENST00000318709.4	37	CCDS34613.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390565	0.82902	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714	T;T	0.45276	0.96;0.9	5.89	5.89	0.94794	.	0.126361	0.52532	D	0.000065	T	0.32496	0.0831	L	0.29908	0.895	0.80722	D	1	P	0.36733	0.567	B	0.21708	0.036	T	0.22312	-1.0220	10	0.87932	D	0	-15.1738	20.2617	0.98447	0.0:0.0:1.0:0.0	.	595	Q8NBF6	AVL9_HUMAN	I	595;577;537	ENSP00000315568:V595I;ENSP00000387011:V577I	ENSP00000315568:V595I	V	+	1	0	AVL9	32586979	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	9.202000	0.95026	2.793000	0.96121	0.655000	0.94253	GTC	.	.	none		0.368	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
HIST1H3D	8351	hgsc.bcm.edu	37	6	26197212	26197212	+	Silent	SNP	C	C	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:26197212C>G	ENST00000356476.2	-	1	266	c.267G>C	c.(265-267)gcG>gcC	p.A89A	HIST1H3D_ENST00000377831.5_Silent_p.A89A|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	89					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GCGCCATCACCGCCGAGCTCT	0.582																																					p.A89A	GBM(108;3816 4467)	Atlas-SNP	.											HIST1H3D,colon,carcinoma,0,1	HIST1H3D	31	1	0			c.G267C						PASS	.						76.0	73.0	74.0					6																	26197212		2203	4300	6503	SO:0001819	synonymous_variant	8351	exon2			CATCACCGCCGAG	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.267G>C	6.37:g.26197212C>G		186.0	0.0	0		109.0	36.0	0.330275	NM_003530	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000356476.2	37	CCDS4590.1																																																																																			.	.	none		0.582	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530	
KMT2C	58508	hgsc.bcm.edu	37	7	151970845	151970845	+	Missense_Mutation	SNP	A	A	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:151970845A>T	ENST00000262189.6	-	7	1175	c.957T>A	c.(955-957)gaT>gaA	p.D319E	KMT2C_ENST00000355193.2_Missense_Mutation_p.D319E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	319					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGTGACTGAAATCCTGAAAGG	0.413																																					p.D319E		Atlas-SNP	.											MLL3_ENST00000355193,NS,carcinoma,-1,2	MLL3	1564	2	0			c.T957A						PASS	.						260.0	243.0	249.0					7																	151970845		2203	4300	6503	SO:0001583	missense	58508	exon7			ACTGAAATCCTGA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.957T>A	7.37:g.151970845A>T	ENSP00000262189:p.Asp319Glu	704.0	0.0	0		404.0	21.0	0.0519802	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474094	0.63737	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.69175	-0.38;-0.38	4.87	-3.2	0.05156	Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.000000	0.44902	U	0.000409	T	0.68787	0.3039	L	0.43598	1.365	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.65384	-0.6181	10	0.23302	T	0.38	.	12.0041	0.53248	0.8755:0.0:0.1245:0.0	.	319	Q8NEZ4	MLL3_HUMAN	E	319	ENSP00000262189:D319E;ENSP00000347325:D319E	ENSP00000262189:D319E	D	-	3	2	MLL3	151601778	1.000000	0.71417	0.830000	0.32933	0.993000	0.82548	1.285000	0.33261	-0.549000	0.06191	0.528000	0.53228	GAT	.	.	none		0.413	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
GRIA2	2891	hgsc.bcm.edu	37	4	158257596	158257596	+	Missense_Mutation	SNP	A	A	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr4:158257596A>C	ENST00000264426.9	+	11	1820	c.1541A>C	c.(1540-1542)aAg>aCg	p.K514T	GRIA2_ENST00000507898.1_Missense_Mutation_p.K467T|GRIA2_ENST00000393815.2_Missense_Mutation_p.K467T|GRIA2_ENST00000449365.1_Missense_Mutation_p.K467T|GRIA2_ENST00000296526.7_Missense_Mutation_p.K514T	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	514					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GACTTCTCAAAGCCCTTCATG	0.408																																					p.K514T		Atlas-SNP	.											.	GRIA2	358	.	0			c.A1541C						PASS	.						172.0	171.0	171.0					4																	158257596		2203	4300	6503	SO:0001583	missense	2891	exon11			TCTCAAAGCCCTT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1541A>C	4.37:g.158257596A>C	ENSP00000264426:p.Lys514Thr	270.0	1.0	0.0037037		197.0	84.0	0.426396	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013329	0.75161	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19	5.46	5.46	0.80206	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.47985	0.1475	L	0.27975	0.815	0.80722	D	1	P;D;D	0.89917	0.94;1.0;0.993	B;D;D	0.91635	0.346;0.999;0.968	T	0.48151	-0.9060	10	0.51188	T	0.08	.	15.8204	0.78638	1.0:0.0:0.0:0.0	.	514;514;467	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	T	467;467;514;514;467	ENSP00000426845:K467T;ENSP00000377403:K467T;ENSP00000296526:K514T;ENSP00000264426:K514T;ENSP00000389837:K467T	ENSP00000264426:K514T	K	+	2	0	GRIA2	158477046	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.196000	0.70406	0.533000	0.62120	AAG	.	.	none		0.408	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
NLRP1	22861	hgsc.bcm.edu	37	17	5440172	5440172	+	Splice_Site	SNP	G	G	A	rs199748129		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:5440172G>A	ENST00000572272.1	-	8	2958	c.2959C>T	c.(2959-2961)Cgg>Tgg	p.R987W	NLRP1_ENST00000577119.1_Intron|NLRP1_ENST00000269280.4_Splice_Site_p.R987W|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000354411.3_Intron|NLRP1_ENST00000345221.3_Splice_Site_p.R987W|NLRP1_ENST00000262467.5_Splice_Site_p.R987W			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	987					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.R987W(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCCCCTTACCGTCTGCTGAAG	0.587																																					p.R987W		Atlas-SNP	.											NLRP1,colon,carcinoma,0,1	NLRP1	358	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2959T						PASS	.						74.0	61.0	65.0					17																	5440172		2203	4300	6503	SO:0001630	splice_region_variant	22861	exon8			CTTACCGTCTGCT	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2960+1C>T	17.37:g.5440172G>A		53.0	0.0	0		37.0	11.0	0.297297	NM_014922	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	G	5.855	0.342015	0.11069	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000345221;ENST00000537069	T;T;T;T	0.71222	-0.55;-0.55;-0.54;-0.54	2.69	-5.38	0.02673	.	0.838313	0.09764	N	0.758830	T	0.37892	0.1020	N	0.03294	-0.36	0.09310	N	1	B;B;B;B	0.10296	0.003;0.0;0.002;0.001	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	T	0.12502	-1.0545	10	0.49607	T	0.09	.	2.3958	0.04389	0.2437:0.1575:0.4437:0.1551	.	253;987;987;987	F5H042;Q9C000;Q9C000-2;E9PE50	.;NALP1_HUMAN;.;.	W	987;987;987;987;253	ENSP00000442029:R987W;ENSP00000262467:R987W;ENSP00000269280:R987W;ENSP00000324366:R987W	ENSP00000262467:R987W	R	-	1	2	NLRP1	5380896	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.179000	0.03090	-1.788000	0.01266	-2.377000	0.00234	CGG	.	.	weak		0.587	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	Missense_Mutation
SERPINB7	8710	hgsc.bcm.edu	37	18	61471521	61471521	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr18:61471521G>A	ENST00000398019.2	+	8	1120	c.795G>A	c.(793-795)agG>agA	p.R265R	SERPINB7_ENST00000540675.1_Silent_p.R248R|SERPINB7_ENST00000336429.2_Silent_p.R265R|SERPINB7_ENST00000546027.1_Silent_p.R265R	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	265					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				CCAATCCAAGGCGAATGACCT	0.333																																					p.R265R		Atlas-SNP	.											.	SERPINB7	66	.	0			c.G795A						PASS	.						45.0	44.0	44.0					18																	61471521		2203	4300	6503	SO:0001819	synonymous_variant	8710	exon8			TCCAAGGCGAATG	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.795G>A	18.37:g.61471521G>A		22.0	0.0	0		19.0	7.0	0.368421	NM_001261830	B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Silent	SNP	ENST00000398019.2	37	CCDS11988.1																																																																																			.	.	none		0.333	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434902	1434902	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:1434902C>G	ENST00000233078.4	+	12	1376	c.1215C>G	c.(1213-1215)taC>taG	p.Y405*	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	405					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCACCCCTACCGACGCTAGC	0.677																																					p.Y405X		Atlas-SNP	.											.	DAZAP1	52	.	0			c.C1215G						PASS	.						10.0	11.0	10.0					19																	1434902		2142	4191	6333	SO:0001587	stop_gained	26528	exon12			CCCCTACCGACGC		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1215C>G	19.37:g.1434902C>G	ENSP00000233078:p.Tyr405*	15.0	0.0	0		12.0	5.0	0.416667	NM_018959	Q96MJ3|Q9NRR9	Nonsense_Mutation	SNP	ENST00000233078.4	37	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	C	37	6.251811	0.97412	.	.	ENSG00000071626	ENST00000233078	.	.	.	5.26	2.98	0.34508	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0207	0.42041	0.0:0.7804:0.0:0.2196	.	.	.	.	X	405	.	ENSP00000233078:Y405X	Y	+	3	2	DAZAP1	1385902	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.278000	0.33179	1.215000	0.43411	0.561000	0.74099	TAC	.	.	none		0.677	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
USP29	57663	hgsc.bcm.edu	37	19	57640529	57640529	+	Silent	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:57640529A>G	ENST00000254181.4	+	4	940	c.486A>G	c.(484-486)ttA>ttG	p.L162L	USP29_ENST00000598197.1_Silent_p.L162L	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	162					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGGGGATATTAGAAAATCAAG	0.358																																					p.L162L		Atlas-SNP	.											.	USP29	186	.	0			c.A486G						PASS	.						87.0	86.0	87.0					19																	57640529		2203	4300	6503	SO:0001819	synonymous_variant	57663	exon4			GATATTAGAAAAT		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.486A>G	19.37:g.57640529A>G		101.0	0.0	0		106.0	81.0	0.764151	NM_020903		Silent	SNP	ENST00000254181.4	37	CCDS33124.1																																																																																			.	.	none		0.358	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
SLC10A4	201780	hgsc.bcm.edu	37	4	48490448	48490448	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr4:48490448C>T	ENST00000273861.4	+	3	1025	c.806C>T	c.(805-807)tCc>tTc	p.S269F	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						TACTAGGTTTCCCTGTGGTCT	0.453																																					p.S269F		Atlas-SNP	.											.	SLC10A4	23	.	0			c.C806T						PASS	.						152.0	157.0	155.0					4																	48490448		2203	4300	6503	SO:0001583	missense	201780	exon3			AGGTTTCCCTGTG	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.806C>T	4.37:g.48490448C>T	ENSP00000273861:p.Ser269Phe	61.0	0.0	0		44.0	14.0	0.318182	NM_152679	Q8WUZ2	Missense_Mutation	SNP	ENST00000273861.4	37	CCDS3482.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640924	0.87859	.	.	ENSG00000145248	ENST00000273861	T	0.15372	2.43	5.55	5.55	0.83447	.	0.096024	0.85682	D	0.000000	T	0.29458	0.0734	L	0.31120	0.905	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.02126	-1.1209	10	0.10111	T	0.7	0.371	19.8809	0.96899	0.0:1.0:0.0:0.0	.	269	Q96EP9	NTCP4_HUMAN	F	269	ENSP00000273861:S269F	ENSP00000273861:S269F	S	+	2	0	SLC10A4	48185205	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.445000	0.80570	2.771000	0.95319	0.561000	0.74099	TCC	.	.	none		0.453	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	
PRPF39	55015	hgsc.bcm.edu	37	14	45579854	45579854	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:45579854G>A	ENST00000355765.6	+	10	1576	c.1406G>A	c.(1405-1407)gGa>gAa	p.G469E	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	469					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						CGACGGCATGGAAATCTGGAA	0.368																																					p.G469E		Atlas-SNP	.											.	PRPF39	46	.	0			c.G1406A						PASS	.						46.0	39.0	41.0					14																	45579854		2202	4299	6501	SO:0001583	missense	55015	exon10			GGCATGGAAATCT	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1406G>A	14.37:g.45579854G>A	ENSP00000348010:p.Gly469Glu	194.0	0.0	0		135.0	62.0	0.459259	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	37	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510464	0.85389	.	.	ENSG00000185246	ENST00000355765	T	0.38722	1.12	5.53	5.53	0.82687	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.87578	0.998;0.844	T	0.59579	-0.7428	10	0.09843	T	0.71	-13.7778	19.0642	0.93103	0.0:0.0:1.0:0.0	.	73;469	Q86UA1-2;Q86UA1	.;PRP39_HUMAN	E	469	ENSP00000348010:G469E	ENSP00000348010:G469E	G	+	2	0	PRPF39	44649604	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.824000	0.99380	2.607000	0.88179	0.563000	0.77884	GGA	.	.	none		0.368	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
DSG2	1829	hgsc.bcm.edu	37	18	29098213	29098213	+	Silent	SNP	C	C	T	rs587780925		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr18:29098213C>T	ENST00000261590.8	+	2	266	c.57C>T	c.(55-57)aaC>aaT	p.N19N	DSG2_ENST00000585206.1_Silent_p.N19N	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	19					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TCTGCTTTAACGTTGGAAGTG	0.368																																					p.N19N		Atlas-SNP	.											.	DSG2	115	.	0			c.C57T						PASS	.						105.0	100.0	102.0					18																	29098213		1839	4087	5926	SO:0001819	synonymous_variant	1829	exon2			CTTTAACGTTGGA	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.57C>T	18.37:g.29098213C>T		83.0	0.0	0		69.0	32.0	0.463768	NM_001943	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																			.	.	none		0.368	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
LRP2	4036	hgsc.bcm.edu	37	2	170127524	170127524	+	Missense_Mutation	SNP	G	G	A	rs201860953		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:170127524G>A	ENST00000263816.3	-	16	2495	c.2210C>T	c.(2209-2211)tCg>tTg	p.S737L	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	737					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S737L(2)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGGATTCCCCGAAACTGGAAC	0.413																																					p.S737L		Atlas-SNP	.											LRP2,rectum,carcinoma,0,2	LRP2	751	2	2	Substitution - Missense(2)	large_intestine(2)	c.C2210T						PASS	.	G	LEU/SER	0,4406		0,0,2203	122.0	106.0	111.0		2210	4.9	0.2	2		111	6,8594	5.0+/-18.6	0,6,4294	yes	missense	LRP2	NM_004525.2	145	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	benign	737/4656	170127524	6,13000	2203	4300	6503	SO:0001583	missense	4036	exon16			TTCCCCGAAACTG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2210C>T	2.37:g.170127524G>A	ENSP00000263816:p.Ser737Leu	142.0	0.0	0		97.0	36.0	0.371134	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.397079	0.42512	0.0	6.98E-4	ENSG00000081479	ENST00000263816	D	0.90788	-2.73	5.77	4.9	0.64082	Six-bladed beta-propeller, TolB-like (1);	0.101407	0.64402	D	0.000003	T	0.80363	0.4609	N	0.20685	0.6	0.80722	D	1	B	0.33120	0.398	B	0.22152	0.038	T	0.78288	-0.2262	10	0.07813	T	0.8	.	15.2561	0.73585	0.0675:0.0:0.9325:0.0	.	737	P98164	LRP2_HUMAN	L	737	ENSP00000263816:S737L	ENSP00000263816:S737L	S	-	2	0	LRP2	169835770	1.000000	0.71417	0.229000	0.23960	0.126000	0.20510	7.917000	0.87498	1.581000	0.49865	0.655000	0.94253	TCG	G|0.999;A|0.001	0.001	weak		0.413	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
L1CAM	3897	hgsc.bcm.edu	37	X	153128162	153128162	+	Missense_Mutation	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:153128162A>G	ENST00000370060.1	-	29	3919	c.3730T>C	c.(3730-3732)Tca>Cca	p.S1244P	L1CAM_ENST00000370057.3_Missense_Mutation_p.S1244P|L1CAM_ENST00000361981.3_Missense_Mutation_p.S1235P|L1CAM_ENST00000361699.4_Missense_Mutation_p.S1240P|L1CAM_ENST00000370055.1_Missense_Mutation_p.S1235P|L1CAM_ENST00000538883.1_Missense_Mutation_p.S1242P|L1CAM_ENST00000543994.1_Missense_Mutation_p.S1246P	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1244					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGGCCCCTGAGCTGTCATTG	0.602																																					p.S1244P		Atlas-SNP	.											.	L1CAM	189	.	0			c.T3730C						PASS	.						82.0	68.0	73.0					X																	153128162		2203	4300	6503	SO:0001583	missense	3897	exon28			CCCCTGAGCTGTC	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3730T>C	X.37:g.153128162A>G	ENSP00000359077:p.Ser1244Pro	163.0	0.0	0		98.0	29.0	0.295918	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.916391	0.73098	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	T;T;T;T;T;T;D;T	0.85773	-0.16;-0.15;-0.16;-0.12;-0.1;-0.1;-2.03;-0.14	4.7	4.7	0.59300	.	0.000000	0.46758	D	0.000276	D	0.89058	0.6607	L	0.48362	1.52	0.46927	D	0.999252	D;P;P	0.89917	1.0;0.513;0.757	D;B;P	0.87578	0.998;0.395;0.45	D	0.89887	0.4034	10	0.87932	D	0	.	12.2435	0.54558	1.0:0.0:0.0:0.0	.	1235;1240;1244	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	P	1244;1246;1244;1242;1235;1235;140;1240	ENSP00000359077:S1244P;ENSP00000438430:S1246P;ENSP00000359074:S1244P;ENSP00000439645:S1242P;ENSP00000354712:S1235P;ENSP00000359072:S1235P;ENSP00000359075:S140P;ENSP00000355380:S1240P	ENSP00000355380:S1240P	S	-	1	0	L1CAM	152781356	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	5.828000	0.69307	1.732000	0.51606	0.430000	0.28490	TCA	.	.	none		0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
SATB2	23314	hgsc.bcm.edu	37	2	200193545	200193545	+	Missense_Mutation	SNP	A	A	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:200193545A>G	ENST00000417098.1	-	8	2078	c.1262T>C	c.(1261-1263)tTc>tCc	p.F421S	RP11-486F17.1_ENST00000489557.2_RNA|SATB2_ENST00000443023.1_Missense_Mutation_p.F362S|SATB2_ENST00000260926.5_Missense_Mutation_p.F421S|SATB2_ENST00000428695.1_Missense_Mutation_p.F303S|SATB2_ENST00000457245.1_Missense_Mutation_p.F421S	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	421					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CAGATTGAGGAAATTCTGCAT	0.517																																					p.F421S	Colon(30;262 767 11040 24421 36230)	Atlas-SNP	.											SATB2,NS,carcinoma,+1,1	SATB2	134	1	0			c.T1262C						PASS	.						111.0	99.0	103.0					2																	200193545		2203	4300	6503	SO:0001583	missense	23314	exon9			TTGAGGAAATTCT	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1262T>C	2.37:g.200193545A>G	ENSP00000401112:p.Phe421Ser	137.0	0.0	0		76.0	33.0	0.434211	NM_015265	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.643706	0.87859	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.61158	0.18;0.19;0.18;0.13;0.18	4.98	4.98	0.66077	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	T	0.79112	-0.1937	10	0.87932	D	0	-16.206	15.1355	0.72562	1.0:0.0:0.0:0.0	.	303;421	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	S	421;362;421;303;421	ENSP00000401112:F421S;ENSP00000388764:F362S;ENSP00000260926:F421S;ENSP00000388581:F303S;ENSP00000405420:F421S	ENSP00000260926:F421S	F	-	2	0	SATB2	199901790	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	2.218000	0.71995	0.528000	0.53228	TTC	.	.	none		0.517	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
IQCF2	389123	hgsc.bcm.edu	37	3	51897174	51897174	+	Missense_Mutation	SNP	G	G	A	rs369181892		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:51897174G>A	ENST00000333127.3	+	3	312	c.283G>A	c.(283-285)Gcc>Acc	p.A95T	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	95								p.A95T(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGCTCTGATCGCCTACGCAAC	0.582																																					p.A95T		Atlas-SNP	.											IQCF2,mouth,carcinoma,0,1	IQCF2	21	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G283A						scavenged	.	G	THR/ALA	0,4406		0,0,2203	115.0	111.0	113.0		283	-4.6	0.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	IQCF2	NM_203424.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	95/165	51897174	1,13005	2203	4300	6503	SO:0001583	missense	389123	exon3			CTGATCGCCTACG	AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.283G>A	3.37:g.51897174G>A	ENSP00000329904:p.Ala95Thr	134.0	1.0	0.00746269		60.0	3.0	0.05	NM_203424		Missense_Mutation	SNP	ENST00000333127.3	37	CCDS2835.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.488097	0.26686	0.0	1.16E-4	ENSG00000184345	ENST00000333127	T	0.29917	1.55	4.95	-4.59	0.03400	.	2.430730	0.01286	N	0.009898	T	0.07098	0.0180	N	0.00517	-1.405	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.13899	-1.0492	10	0.18710	T	0.47	0.3689	0.6435	0.00814	0.3204:0.1226:0.3097:0.2474	.	95	Q8IXL9	IQCF2_HUMAN	T	95	ENSP00000329904:A95T	ENSP00000329904:A95T	A	+	1	0	IQCF2	51872214	0.000000	0.05858	0.000000	0.03702	0.303000	0.27691	-0.149000	0.10204	-0.609000	0.05724	-0.367000	0.07326	GCC	.	.	weak		0.582	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346594.1	NM_203424	
HINT2	84681	hgsc.bcm.edu	37	9	35813717	35813717	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:35813717C>T	ENST00000259667.5	-	2	187	c.146G>A	c.(145-147)gGg>gAg	p.G49E	SPAG8_ENST00000479751.1_5'Flank|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000340291.2_5'Flank|SPAG8_ENST00000396638.2_5'Flank|SPAG8_ENST00000484764.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|HINT2_ENST00000474908.1_5'UTR	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	49					apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			GGCTGCTCCCCCAGGAGTTGC	0.582											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G49E	GBM(185;1694 2122 5473 25431 37228)	Atlas-SNP	.											.	HINT2	15	.	0			c.G146A						PASS	.						48.0	43.0	45.0					9																	35813717		2203	4300	6503	SO:0001583	missense	84681	exon2			GCTCCCCCAGGAG	AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.146G>A	9.37:g.35813717C>T	ENSP00000259667:p.Gly49Glu	120.0	0.0	0	858	76.0	30.0	0.394737	NM_032593	Q5TCW3	Missense_Mutation	SNP	ENST00000259667.5	37	CCDS6594.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926970	0.34002	.	.	ENSG00000137133	ENST00000259667	T	0.73897	-0.79	5.08	4.18	0.49190	.	0.267851	0.36234	N	0.002713	T	0.48943	0.1528	N	0.19112	0.55	0.31821	N	0.625982	P	0.46952	0.887	B	0.26202	0.067	T	0.60895	-0.7172	10	0.49607	T	0.09	-14.0947	7.7201	0.28727	0.0:0.7473:0.1635:0.0893	.	49	Q9BX68	HINT2_HUMAN	E	49	ENSP00000259667:G49E	ENSP00000259667:G49E	G	-	2	0	HINT2	35803717	0.001000	0.12720	0.998000	0.56505	0.981000	0.71138	1.243000	0.32767	1.261000	0.44149	0.561000	0.74099	GGG	.	.	none		0.582	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052390.1	NM_032593	
CSMD3	114788	hgsc.bcm.edu	37	8	114031393	114031393	+	Missense_Mutation	SNP	A	A	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:114031393A>T	ENST00000297405.5	-	6	1177	c.933T>A	c.(931-933)aaT>aaA	p.N311K	CSMD3_ENST00000352409.3_Missense_Mutation_p.N311K|CSMD3_ENST00000455883.2_Missense_Mutation_p.N311K|CSMD3_ENST00000343508.3_Missense_Mutation_p.N271K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	311	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTGGTGGTATATTCATTCCAG	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N311K		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T933A						PASS	.						182.0	167.0	172.0					8																	114031393		2203	4300	6503	SO:0001583	missense	114788	exon6			TGGTATATTCATT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.933T>A	8.37:g.114031393A>T	ENSP00000297405:p.Asn311Lys	220.0	0.0	0		146.0	54.0	0.369863	NM_052900	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	a	15.30	2.793743	0.50102	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.6	1.85	0.25348	CUB (5);	0.000000	0.64402	D	0.000001	D	0.90373	0.6987	N	0.25094	0.71	0.28935	N	0.891307	P;B;D;P	0.89917	0.952;0.002;1.0;0.5	B;B;D;B	0.87578	0.419;0.004;0.998;0.376	T	0.82222	-0.0564	10	0.05959	T	0.93	.	5.9155	0.19052	0.7421:0.0:0.135:0.1228	.	311;311;311;271	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	K	271;311;311;311	ENSP00000345799:N271K;ENSP00000297405:N311K;ENSP00000412263:N311K;ENSP00000343124:N311K	ENSP00000297405:N311K	N	-	3	2	CSMD3	114100569	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.922000	0.40045	0.076000	0.16826	-0.545000	0.04230	AAT	.	.	none		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ILF3	3609	hgsc.bcm.edu	37	19	10795539	10795539	+	Intron	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:10795539T>G	ENST00000590261.1	+	16	2059				ILF3_ENST00000449870.1_Intron|ILF3_ENST00000588657.1_Intron|ILF3_ENST00000407004.3_3'UTR|ILF3_ENST00000592763.1_3'UTR|ILF3_ENST00000318511.3_Intron|ILF3_ENST00000420083.1_Silent_p.G688G|ILF3_ENST00000250241.8_Silent_p.G688G			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa						defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TTACAGCAGGTTTTGTATGAA	0.358																																					p.G688G		Atlas-SNP	.											.	ILF3	99	.	0			c.T2064G						PASS	.						102.0	93.0	95.0					19																	10795539		1844	4079	5923	SO:0001627	intron_variant	3609	exon18			AGCAGGTTTTGTA	U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.2059+893T>G	19.37:g.10795539T>G		119.0	0.0	0		94.0	76.0	0.808511	NM_153464	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	ENST00000590261.1	37	CCDS12246.1																																																																																			.	.	none		0.358	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1		
PNLIPRP1	5407	hgsc.bcm.edu	37	10	118351352	118351352	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:118351352G>A	ENST00000528052.1	+	3	190	c.119G>A	c.(118-120)aGg>aAg	p.R40K	PNLIPRP1_ENST00000442761.1_Missense_Mutation_p.R40K|PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.R40K|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.R40K|PNLIPRP1_ENST00000480870.2_3'UTR			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	40					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		ACAGCAATCAGGCCCCTGAAA	0.512																																					p.R40K		Atlas-SNP	.											.	PNLIPRP1	82	.	0			c.G119A						PASS	.						111.0	118.0	116.0					10																	118351352		2203	4300	6503	SO:0001583	missense	5407	exon3			CAATCAGGCCCCT	BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.119G>A	10.37:g.118351352G>A	ENSP00000433933:p.Arg40Lys	89.0	0.0	0		61.0	20.0	0.327869	NM_006229	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	ENST00000528052.1	37	CCDS7595.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277781	0.59758	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000442761;ENST00000530319;ENST00000527980;ENST00000471549;ENST00000534537	D;D;D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	5.51	4.59	0.56863	Lipase, N-terminal (1);	0.128417	0.53938	D	0.000050	D	0.96636	0.8902	H	0.95328	3.655	0.45995	D	0.998805	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.97514	1.0068	10	0.72032	D	0.01	-8.5798	14.5305	0.67923	0.0:0.0:0.852:0.148	.	40;40	P54315;P54315-2	LIPR1_HUMAN;.	K	40	ENSP00000436123:R40K;ENSP00000351695:R40K;ENSP00000433933:R40K;ENSP00000400963:R40K;ENSP00000437263:R40K;ENSP00000433785:R40K;ENSP00000431207:R40K;ENSP00000434159:R40K	ENSP00000351695:R40K	R	+	2	0	PNLIPRP1	118341342	1.000000	0.71417	0.937000	0.37676	0.979000	0.70002	6.886000	0.75611	1.304000	0.44892	0.655000	0.94253	AGG	.	.	none		0.512	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384633.1	NM_006229	
HOXD4	3233	hgsc.bcm.edu	37	2	177016724	177016724	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:177016724G>A	ENST00000306324.3	+	1	775	c.363G>A	c.(361-363)ccG>ccA	p.P121P	MIR10B_ENST00000385011.1_RNA|HOXD3_ENST00000468418.3_5'UTR	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	121					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		CCAAGCAGCCGCCCTCCGGGA	0.682																																					p.P121P		Atlas-SNP	.											.	HOXD4	32	.	0			c.G363A						PASS	.						28.0	35.0	33.0					2																	177016724		2125	4262	6387	SO:0001819	synonymous_variant	3233	exon1			GCAGCCGCCCTCC		CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.363G>A	2.37:g.177016724G>A		29.0	0.0	0		18.0	11.0	0.611111	NM_014621	B2R9R3|Q96AU0	Silent	SNP	ENST00000306324.3	37	CCDS2269.1																																																																																			.	.	none		0.682	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2		
FAM102A	399665	hgsc.bcm.edu	37	9	130742408	130742408	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:130742408G>A	ENST00000373095.1	-	1	384	c.9C>T	c.(7-9)ttC>ttT	p.F3F		NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	3										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						TCTTCATCAAGAAAGCCATGA	0.527																																					p.F3F		Atlas-SNP	.											.	FAM102A	32	.	0			c.C9T						PASS	.						93.0	106.0	101.0					9																	130742408		2203	4300	6503	SO:0001819	synonymous_variant	399665	exon1			CATCAAGAAAGCC		CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.9C>T	9.37:g.130742408G>A		82.0	0.0	0		59.0	25.0	0.423729	NM_001035254	A2A329|Q8TEL4	Silent	SNP	ENST00000373095.1	37	CCDS35150.1																																																																																			.	.	none		0.527	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
ASIC3	9311	hgsc.bcm.edu	37	7	150746203	150746203	+	Missense_Mutation	SNP	T	T	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:150746203T>G	ENST00000349064.5	+	1	429	c.231T>G	c.(229-231)gaT>gaG	p.D77E	ASIC3_ENST00000297512.8_Missense_Mutation_p.D77E|ASIC3_ENST00000357922.4_Missense_Mutation_p.D77E	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	77					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										CTGCCCTGGATGAGCGAGAAA	0.642																																					p.D77E		Atlas-SNP	.											.	.	.	.	0			c.T231G						PASS	.						112.0	89.0	97.0					7																	150746203		2203	4300	6503	SO:0001583	missense	9311	exon1			CCTGGATGAGCGA	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.231T>G	7.37:g.150746203T>G	ENSP00000344838:p.Asp77Glu	62.0	0.0	0		36.0	15.0	0.416667	NM_020322	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	37	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985752	0.53934	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.64085	-0.08;-0.08;-0.08	5.11	-4.68	0.03309	.	0.214262	0.21995	N	0.066087	T	0.45756	0.1358	L	0.49513	1.565	0.22648	N	0.998896	B;B;B	0.22604	0.072;0.003;0.01	B;B;B	0.25291	0.059;0.003;0.047	T	0.35301	-0.9794	10	0.20519	T	0.43	-12.6316	7.4624	0.27302	0.0:0.2523:0.2205:0.5272	.	77;77;77	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	E	77	ENSP00000350600:D77E;ENSP00000344838:D77E;ENSP00000297512:D77E	ENSP00000297512:D77E	D	+	3	2	ACCN3	150377136	0.001000	0.12720	0.892000	0.35008	0.965000	0.64279	-1.636000	0.02016	-0.937000	0.03719	-0.441000	0.05720	GAT	.	.	none		0.642	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
COL6A5	256076	hgsc.bcm.edu	37	3	130159037	130159037	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:130159037G>A	ENST00000432398.2	+	35	6349	c.5855G>A	c.(5854-5856)cGa>cAa	p.R1952Q	COL6A5_ENST00000265379.6_Missense_Mutation_p.R1952Q	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1952	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GCTTGCATTCGAGAGGCTTTC	0.393																																					p.R1952Q		Atlas-SNP	.											.	COL6A5	205	.	0			c.G5855A						PASS	.						71.0	65.0	67.0					3																	130159037		1876	4103	5979	SO:0001583	missense	256076	exon35			GCATTCGAGAGGC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.5855G>A	3.37:g.130159037G>A	ENSP00000390895:p.Arg1952Gln	146.0	0.0	0		117.0	52.0	0.444444	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	G	5.461	0.270143	0.10349	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.88586	-2.32;-2.4	5.63	-2.94	0.05581	.	.	.	.	.	T	0.62732	0.2452	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57700	-0.7766	9	0.13470	T	0.59	.	6.1151	0.20122	0.5337:0.0:0.3505:0.1158	.	1952	A8TX70-2	.	Q	1952	ENSP00000390895:R1952Q;ENSP00000265379:R1952Q	ENSP00000265379:R1952Q	R	+	2	0	COL6A5	131641727	0.451000	0.25705	0.007000	0.13788	0.227000	0.25037	1.081000	0.30791	-0.396000	0.07703	-0.414000	0.06135	CGA	.	.	none		0.393	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
RFX3	5991	hgsc.bcm.edu	37	9	3225259	3225259	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:3225259C>T	ENST00000382004.3	-	18	2344	c.2033G>A	c.(2032-2034)aGt>aAt	p.S678N		NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	678					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		ATCCATTTCACTTTCTACTTC	0.418																																					p.S678N		Atlas-SNP	.											RFX3_ENST00000382004,NS,carcinoma,+1,1	RFX3	156	1	0			c.G2033A						PASS	.						95.0	91.0	93.0					9																	3225259		2203	4300	6503	SO:0001583	missense	5991	exon18			ATTTCACTTTCTA	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.2033G>A	9.37:g.3225259C>T	ENSP00000371434:p.Ser678Asn	94.0	0.0	0		61.0	24.0	0.393443	NM_134428	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288405	0.59976	.	.	ENSG00000080298	ENST00000382004	T	0.45276	0.9	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	L	0.57536	1.79	0.80722	D	1	P	0.44734	0.842	B	0.36922	0.236	T	0.33574	-0.9863	10	0.33940	T	0.23	-14.4178	19.8344	0.96650	0.0:1.0:0.0:0.0	.	678	P48380	RFX3_HUMAN	N	678	ENSP00000371434:S678N	ENSP00000371434:S678N	S	-	2	0	RFX3	3215259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.448000	0.73469	2.686000	0.91538	0.643000	0.83706	AGT	.	.	none		0.418	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
COL6A3	1293	hgsc.bcm.edu	37	2	238277339	238277339	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr2:238277339G>A	ENST00000295550.4	-	10	5219	c.4767C>T	c.(4765-4767)gaC>gaT	p.D1589D	COL6A3_ENST00000346358.4_Silent_p.D1389D|COL6A3_ENST00000347401.3_Silent_p.D1388D|COL6A3_ENST00000472056.1_Silent_p.D982D|COL6A3_ENST00000409809.1_Silent_p.D1383D|COL6A3_ENST00000353578.4_Silent_p.D1383D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1589	Nonhelical region.|VWFA 8. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCAGTCTGGGGTCATTGGTGA	0.542																																					p.D1589D		Atlas-SNP	.											.	COL6A3	608	.	0			c.C4767T						PASS	.						198.0	175.0	182.0					2																	238277339		2203	4300	6503	SO:0001819	synonymous_variant	1293	exon10			TCTGGGGTCATTG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4767C>T	2.37:g.238277339G>A		159.0	0.0	0		110.0	42.0	0.381818	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.	.	none		0.542	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
VPS13B	157680	hgsc.bcm.edu	37	8	100789120	100789120	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:100789120C>T	ENST00000358544.2	+	41	7551	c.7440C>T	c.(7438-7440)tgC>tgT	p.C2480C	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Silent_p.C2455C	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2480					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CATCCCTTTGCGTTTCTTTCC	0.458																																					p.C2480C	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.C7440T						PASS	.						285.0	226.0	246.0					8																	100789120		2203	4300	6503	SO:0001819	synonymous_variant	157680	exon41			CCTTTGCGTTTCT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7440C>T	8.37:g.100789120C>T		292.0	1.0	0.00342466		203.0	76.0	0.374384	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																			.	.	none		0.458	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
LTB	4050	hgsc.bcm.edu	37	6	31550123	31550123	+	Silent	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:31550123T>C	ENST00000429299.2	-	1	79	c.72A>G	c.(70-72)gcA>gcG	p.A24A	LTB_ENST00000446745.2_Silent_p.A24A|LTB_ENST00000483972.1_Intron	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	24					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						AAGTGGCTCCTGCCACAGCTA	0.647																																					p.A24A		Atlas-SNP	.											.	LTB	19	.	0			c.A72G						PASS	.						69.0	50.0	57.0					6																	31550123		1509	2708	4217	SO:0001819	synonymous_variant	4050	exon1			GGCTCCTGCCACA	L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.72A>G	6.37:g.31550123T>C		251.0	0.0	0		164.0	63.0	0.384146	NM_002341	P78370|Q52LU8|Q99761	Silent	SNP	ENST00000429299.2	37	CCDS4703.1																																																																																			.	.	none		0.647	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		
MAG	4099	hgsc.bcm.edu	37	19	35793379	35793379	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:35793379G>A	ENST00000392213.3	+	7	1158	c.999G>A	c.(997-999)ggG>ggA	p.G333G	MAG_ENST00000537831.2_Silent_p.G308G|MAG_ENST00000361922.4_Silent_p.G333G	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	333	Ig-like C2-type 3.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CAGTGAACGGGACAATGGTGG	0.572																																					p.G333G		Atlas-SNP	.											.	MAG	172	.	0			c.G999A						PASS	.						86.0	73.0	77.0					19																	35793379		2203	4300	6503	SO:0001819	synonymous_variant	4099	exon7			GAACGGGACAATG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.999G>A	19.37:g.35793379G>A		55.0	0.0	0		29.0	22.0	0.758621	NM_080600	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																			.	.	none		0.572	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
ADCY9	115	hgsc.bcm.edu	37	16	4016487	4016487	+	Silent	SNP	C	C	T	rs371159341		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:4016487C>T	ENST00000294016.3	-	11	3889	c.3351G>A	c.(3349-3351)gcG>gcA	p.A1117A		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1117	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCAGCCCTGACGCCGCCATGT	0.617																																					p.A1117A		Atlas-SNP	.											.	ADCY9	151	.	0			c.G3351A						PASS	.	C		0,4394		0,0,2197	87.0	75.0	79.0		3351	-10.2	0.1	16		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADCY9	NM_001116.3		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		1117/1354	4016487	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	115	exon11			CCCTGACGCCGCC	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3351G>A	16.37:g.4016487C>T		80.0	0.0	0		76.0	20.0	0.263158	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	37	CCDS32382.1																																																																																			.	.	weak		0.617	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
NUDT6	11162	hgsc.bcm.edu	37	4	123814096	123814096	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr4:123814096C>T	ENST00000304430.5	-	5	871	c.838G>A	c.(838-840)Gac>Aac	p.D280N	FGF2_ENST00000608478.1_3'UTR|NUDT6_ENST00000339154.2_Missense_Mutation_p.D111N|FGF2_ENST00000264498.3_3'UTR|NUDT6_ENST00000608639.1_5'Flank|NUDT6_ENST00000502270.1_Missense_Mutation_p.D111N	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	280						mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						TCAATTTTGTCAAACCCTTCT	0.423																																					p.D280N		Atlas-SNP	.											.	NUDT6	50	.	0			c.G838A						PASS	.						94.0	93.0	93.0					4																	123814096		2203	4300	6503	SO:0001583	missense	11162	exon5			TTTTGTCAAACCC	AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.838G>A	4.37:g.123814096C>T	ENSP00000306070:p.Asp280Asn	118.0	0.0	0		96.0	34.0	0.354167	NM_007083	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	ENST00000304430.5	37	CCDS43268.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936405	0.52972	.	.	ENSG00000170917	ENST00000304430;ENST00000339154;ENST00000502270	T;T;T	0.29655	1.56;1.56;1.56	5.11	5.11	0.69529	NUDIX hydrolase domain-like (1);	0.313784	0.34314	N	0.004066	T	0.34164	0.0888	M	0.71581	2.175	0.37755	D	0.926118	P	0.34462	0.454	B	0.31290	0.127	T	0.42899	-0.9424	10	0.59425	D	0.04	-23.1859	14.2122	0.65771	0.0:0.8508:0.1492:0.0	.	280	P53370	NUDT6_HUMAN	N	280;111;111	ENSP00000306070:D280N;ENSP00000344011:D111N;ENSP00000424117:D111N	ENSP00000306070:D280N	D	-	1	0	NUDT6	124033546	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.142000	0.50601	2.380000	0.81148	0.650000	0.86243	GAC	.	.	none		0.423	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095331.3	NM_007083	
OR4C16	219428	hgsc.bcm.edu	37	11	55340486	55340486	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:55340486G>A	ENST00000314634.3	+	1	883	c.883G>A	c.(883-885)Gcc>Acc	p.A295T		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				AGTGAAAAGTGCCATGAGGAA	0.368																																					p.A295T		Atlas-SNP	.											.	OR4C16	104	.	0			c.G883A						PASS	.						45.0	43.0	44.0					11																	55340486		2201	4296	6497	SO:0001583	missense	219428	exon1			AAAAGTGCCATGA	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.883G>A	11.37:g.55340486G>A	ENSP00000324913:p.Ala295Thr	62.0	0.0	0		65.0	24.0	0.369231	NM_001004701	Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795312	0.31777	.	.	ENSG00000181935	ENST00000314634	T	0.42131	0.98	4.68	3.77	0.43336	.	0.000000	0.64402	D	0.000016	T	0.38904	0.1058	L	0.47716	1.5	0.26601	N	0.973018	B	0.32338	0.365	B	0.37239	0.244	T	0.40059	-0.9583	10	0.66056	D	0.02	.	10.7693	0.46312	0.0931:0.0:0.9069:0.0	.	295	Q8NGL9	OR4CG_HUMAN	T	295	ENSP00000324913:A295T	ENSP00000324913:A295T	A	+	1	0	OR4C16	55097062	0.004000	0.15560	0.990000	0.47175	0.345000	0.29048	1.157000	0.31724	1.203000	0.43233	0.549000	0.68633	GCC	.	.	none		0.368	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701	
AATK	9625	hgsc.bcm.edu	37	17	79098649	79098649	+	Splice_Site	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr17:79098649C>T	ENST00000326724.4	-	9	865		c.e9-1		AATK_ENST00000417379.1_Splice_Site|MIR338_ENST00000390137.2_RNA|MIR657_ENST00000385003.1_RNA|AATK_ENST00000572339.1_5'Flank	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase						brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AGTAGTCCTCCTGTTGGCACA	0.667																																					.		Atlas-SNP	.											.	AATK	102	.	0			c.841-1G>A						PASS	.						33.0	38.0	36.0					17																	79098649		2147	4246	6393	SO:0001630	splice_region_variant	9625	exon10			GTCCTCCTGTTGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.841-1G>A	17.37:g.79098649C>T		186.0	0.0	0		99.0	46.0	0.464646	NM_001080395	O75136|Q6ZN31|Q86X28	Splice_Site	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262080	0.39995	.	.	ENSG00000181409	ENST00000326724;ENST00000417379;ENST00000374792	.	.	.	3.66	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6471	0.68769	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AATK	76713244	1.000000	0.71417	0.999000	0.59377	0.276000	0.26787	7.002000	0.76304	2.041000	0.60428	0.591000	0.81541	.	.	.	none		0.667	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	Intron
SLC6A11	6538	hgsc.bcm.edu	37	3	10976837	10976837	+	Silent	SNP	G	G	A	rs138273152		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:10976837G>A	ENST00000254488.2	+	13	1764	c.1698G>A	c.(1696-1698)ccG>ccA	p.P566P		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	566					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	TCTGCATCCCGCTCTGGATCT	0.607																																					p.P566P		Atlas-SNP	.											SLC6A11,NS,carcinoma,+1,2	SLC6A11	87	2	0			c.G1698A						PASS	.	G		4,4402	8.1+/-20.4	0,4,2199	162.0	145.0	150.0		1698	-8.4	0.4	3	dbSNP_134	150	0,8600		0,0,4300	no	coding-synonymous	SLC6A11	NM_014229.1		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		566/633	10976837	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	6538	exon13			CATCCCGCTCTGG	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1698G>A	3.37:g.10976837G>A		207.0	0.0	0		133.0	28.0	0.210526	NM_014229	B2R6U6|Q8IYC9	Silent	SNP	ENST00000254488.2	37	CCDS2602.1																																																																																			G|1.000;A|0.000	0.000	weak		0.607	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
ZNF675	171392	hgsc.bcm.edu	37	19	23869831	23869831	+	Splice_Site	SNP	A	A	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:23869831A>C	ENST00000359788.4	-	1	172		c.e1+1		ZNF675_ENST00000601935.1_Splice_Site|ZNF675_ENST00000601010.1_Splice_Site|ZNF675_ENST00000596211.1_Splice_Site|ZNF675_ENST00000600313.1_Splice_Site|ZNF675_ENST00000599168.1_Splice_Site	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675						bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CGTAACTCTCACCATTTCTAG	0.602																																					.		Atlas-SNP	.											.	ZNF675	88	.	0			c.3+2T>G						PASS	.						87.0	81.0	83.0					19																	23869831		2203	4300	6503	SO:0001630	splice_region_variant	171392	exon2			ACTCTCACCATTT		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.3+1T>G	19.37:g.23869831A>C		59.0	0.0	0		26.0	7.0	0.269231	NM_138330	Q8N211	Splice_Site	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	3.188	-0.166399	0.06461	.	.	ENSG00000197372	ENST00000359788	.	.	.	0.458	0.458	0.16670	.	.	.	.	.	.	.	.	.	.	.	0.24824	N	0.992563	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF675	23661671	0.065000	0.20965	0.013000	0.15412	0.013000	0.08279	0.320000	0.19540	0.407000	0.25591	0.397000	0.26171	.	.	.	none		0.602	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	Intron
EPHA7	2045	hgsc.bcm.edu	37	6	93982068	93982068	+	Missense_Mutation	SNP	G	G	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:93982068G>C	ENST00000369303.4	-	6	1581	c.1397C>G	c.(1396-1398)cCa>cGa	p.P466R		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	466	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		GGGATGCTCTGGTTCCTGCCA	0.448																																					p.P466R		Atlas-SNP	.											.	EPHA7	251	.	0			c.C1397G						PASS	.						275.0	254.0	261.0					6																	93982068		2203	4300	6503	SO:0001583	missense	2045	exon6			TGCTCTGGTTCCT	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1397C>G	6.37:g.93982068G>C	ENSP00000358309:p.Pro466Arg	278.0	1.0	0.00359712		208.0	75.0	0.360577	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949958	0.73787	.	.	ENSG00000135333	ENST00000369303	T	0.74737	-0.87	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93291	0.7862	H	0.99811	4.8	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;1.0;1.0	D	0.95956	0.8958	10	0.87932	D	0	.	19.9439	0.97175	0.0:0.0:1.0:0.0	.	466;466;466	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	R	466	ENSP00000358309:P466R	ENSP00000358309:P466R	P	-	2	0	EPHA7	94038789	1.000000	0.71417	0.923000	0.36655	0.990000	0.78478	9.420000	0.97426	2.797000	0.96272	0.561000	0.74099	CCA	.	.	none		0.448	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
REV3L	5980	hgsc.bcm.edu	37	6	111694135	111694135	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr6:111694135C>T	ENST00000358835.3	-	14	5877	c.5423G>A	c.(5422-5424)gGa>gAa	p.G1808E	REV3L_ENST00000435970.1_Missense_Mutation_p.G1730E|REV3L_ENST00000368805.1_Missense_Mutation_p.G1808E|REV3L_ENST00000368802.3_Missense_Mutation_p.G1808E			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1808					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AAGAGACTGTCCCATTTCTTT	0.428								DNA polymerases (catalytic subunits)																													p.G1808E		Atlas-SNP	.											.	REV3L	386	.	0			c.G5423A						PASS	.						148.0	135.0	139.0					6																	111694135		2203	4300	6503	SO:0001583	missense	5980	exon13			GACTGTCCCATTT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5423G>A	6.37:g.111694135C>T	ENSP00000351697:p.Gly1808Glu	100.0	0.0	0		70.0	32.0	0.457143	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.600138	0.00849	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01406	5.02;5.02;5.02;4.93	5.93	0.909	0.19332	Ribonuclease H-like (1);	1.297520	0.04829	N	0.438371	T	0.00271	0.0008	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36768	-0.9734	10	0.02654	T	1	-0.0059	2.2054	0.03934	0.1225:0.4906:0.1189:0.268	.	1808	O60673	DPOLZ_HUMAN	E	1808;1808;1808;1730	ENSP00000357792:G1808E;ENSP00000357795:G1808E;ENSP00000351697:G1808E;ENSP00000402003:G1730E	ENSP00000351697:G1808E	G	-	2	0	REV3L	111800828	0.032000	0.19561	0.030000	0.17652	0.264000	0.26372	-0.020000	0.12525	0.116000	0.18110	0.655000	0.94253	GGA	.	.	none		0.428	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
CCAR2	57805	hgsc.bcm.edu	37	8	22464810	22464810	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:22464810C>T	ENST00000308511.4	+	6	708	c.459C>T	c.(457-459)caC>caT	p.H153H	CCAR2_ENST00000520861.1_5'UTR|CCAR2_ENST00000389279.3_Silent_p.H153H			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	153					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TCCAGCCTCACCGGATTCCCC	0.547																																					p.H153H		Atlas-SNP	.											KIAA1967,NS,carcinoma,+2,1	KIAA1967	72	1	0			c.C459T						scavenged	.						82.0	68.0	73.0					8																	22464810		2203	4300	6503	SO:0001819	synonymous_variant	57805	exon6			GCCTCACCGGATT	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.459C>T	8.37:g.22464810C>T		30.0	0.0	0		15.0	2.0	0.133333	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Silent	SNP	ENST00000308511.4	37	CCDS34863.1	.	.	.	.	.	.	.	.	.	.	C	7.746	0.702375	0.15172	.	.	ENSG00000158941	ENST00000523801;ENST00000518989	.	.	.	5.96	0.261	0.15592	.	.	.	.	.	T	0.54464	0.1860	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45948	-0.9226	4	.	.	.	-25.3158	7.9306	0.29899	0.0:0.4073:0.0:0.5927	.	.	.	.	S	161;106	.	.	P	+	1	0	KIAA1967	22520755	0.998000	0.40836	0.998000	0.56505	0.997000	0.91878	0.425000	0.21346	0.097000	0.17492	-0.150000	0.13652	CCG	.	.	none		0.547	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
PRPF40B	25766	hgsc.bcm.edu	37	12	50026835	50026835	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:50026835C>T	ENST00000380281.1	+	6	385	c.321C>T	c.(319-321)cgC>cgT	p.R107R	PRPF40B_ENST00000261897.1_Silent_p.R101R|PRPF40B_ENST00000548825.2_Silent_p.R129R			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	107	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						CAGATGGGCGCATCTACTACT	0.612																																					p.R129R		Atlas-SNP	.											.	PRPF40B	83	.	0			c.C387T						PASS	.						35.0	31.0	32.0					12																	50026835		2203	4299	6502	SO:0001819	synonymous_variant	25766	exon7			TGGGCGCATCTAC	AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.321C>T	12.37:g.50026835C>T		86.0	0.0	0		61.0	17.0	0.278689	NM_001031698	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Silent	SNP	ENST00000380281.1	37																																																																																				.	.	none		0.612	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1	NM_012272	
PCDHGA1	56114	hgsc.bcm.edu	37	5	140711926	140711926	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:140711926G>A	ENST00000517417.1	+	1	1675	c.1675G>A	c.(1675-1677)Gcg>Acg	p.A559T	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.A559T	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCGCCCGAGAT	0.647																																					p.A559T		Atlas-SNP	.											PCDHGA1_ENST00000517417,NS,carcinoma,0,4	PCDHGA1	397	4	0			c.G1675A						scavenged	.						135.0	148.0	144.0					5																	140711926		2203	4300	6503	SO:0001583	missense	56114	exon1			GACAACGCGCCCG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1675G>A	5.37:g.140711926G>A	ENSP00000431083:p.Ala559Thr	132.0	0.0	0		65.0	3.0	0.0461538	NM_018912	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	C	3.266	-0.150071	0.06585	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.61742	0.08;0.08	3.92	-2.88	0.05682	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.462493	0.17896	N	0.158361	T	0.42268	0.1195	L	0.53617	1.68	0.09310	N	1	B;B	0.27559	0.026;0.181	B;B	0.15870	0.013;0.014	T	0.18304	-1.0341	10	0.28530	T	0.3	.	7.8166	0.29263	0.2962:0.1121:0.5917:0.0	.	559;559	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	T	559	ENSP00000431083:A559T;ENSP00000367345:A559T	ENSP00000367345:A559T	A	+	1	0	PCDHGA1	140692110	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.397000	0.00485	-0.867000	0.04063	-2.215000	0.00298	GCG	.	.	none		0.647	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
FRMD4B	23150	hgsc.bcm.edu	37	3	69230472	69230472	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr3:69230472G>A	ENST00000398540.3	-	21	2512	c.2429C>T	c.(2428-2430)aCa>aTa	p.T810I	FRMD4B_ENST00000542259.1_Missense_Mutation_p.T756I|FRMD4B_ENST00000478263.1_Missense_Mutation_p.T462I	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	810					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TGCATAGGGTGTGTACCCGGC	0.483																																					p.T810I		Atlas-SNP	.											.	FRMD4B	90	.	0			c.C2429T						PASS	.						60.0	61.0	61.0					3																	69230472		1950	4148	6098	SO:0001583	missense	23150	exon21			TAGGGTGTGTACC	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2429C>T	3.37:g.69230472G>A	ENSP00000381549:p.Thr810Ile	92.0	0.0	0		87.0	45.0	0.517241	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534382	0.45073	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.83250	-1.7;-1.7	5.83	4.94	0.65067	.	0.763911	0.12619	N	0.453162	T	0.71634	0.3363	N	0.08118	0	0.09310	N	1	B;B	0.18166	0.026;0.02	B;B	0.13407	0.009;0.009	T	0.64257	-0.6450	10	0.87932	D	0	0.0843	16.0743	0.80958	0.0:0.0:0.8649:0.1351	.	654;810	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	I	810;756;462	ENSP00000381549:T810I;ENSP00000437658:T756I	ENSP00000381549:T810I	T	-	2	0	FRMD4B	69313162	0.427000	0.25514	0.002000	0.10522	0.958000	0.62258	3.999000	0.57031	1.424000	0.47217	0.591000	0.81541	ACA	.	.	none		0.483	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
ZNF559	84527	hgsc.bcm.edu	37	19	9449245	9449245	+	Missense_Mutation	SNP	C	C	G	rs35591059		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr19:9449245C>G	ENST00000393883.2	+	3	668	c.20C>G	c.(19-21)aCa>aGa	p.T7R	ZNF177_ENST00000602738.1_5'UTR|ZNF559_ENST00000603380.1_Missense_Mutation_p.T7R|ZNF559_ENST00000586255.1_Missense_Mutation_p.T35R|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000317221.7_Missense_Mutation_p.T7R|ZNF559_ENST00000538743.1_Intron|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_5'UTR|ZNF559_ENST00000592504.1_Missense_Mutation_p.T7R|ZNF559_ENST00000585352.1_Missense_Mutation_p.T7R|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000592896.1_Missense_Mutation_p.T35R|ZNF559_ENST00000587557.1_Missense_Mutation_p.T71R	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	7					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						GGGTGGTTGACAAATTACTCT	0.393																																					p.T71R		Atlas-SNP	.											.	ZNF559	77	.	0			c.C212G						PASS	.						190.0	180.0	183.0					19																	9449245		2203	4300	6503	SO:0001583	missense	84527	exon3			GGTTGACAAATTA	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.20C>G	19.37:g.9449245C>G	ENSP00000377461:p.Thr7Arg	157.0	1.0	0.00636943		119.0	98.0	0.823529	NM_001202408	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	C	10.08	1.252616	0.22880	.	.	ENSG00000188321	ENST00000317221;ENST00000393883	T;T	0.06687	4.85;3.27	2.47	-1.11	0.09840	Krueppel-associated box (1);	.	.	.	.	T	0.02342	0.0072	N	0.03983	-0.305	0.09310	N	1	B	0.33964	0.434	B	0.30572	0.117	T	0.39921	-0.9590	9	0.09590	T	0.72	.	2.3148	0.04196	0.2411:0.4635:0.0:0.2955	.	7	Q9BR84	ZN559_HUMAN	R	7	ENSP00000325393:T7R;ENSP00000377461:T7R	ENSP00000325393:T7R	T	+	2	0	ZNF559	9310245	0.000000	0.05858	0.000000	0.03702	0.444000	0.32077	-0.799000	0.04560	-0.164000	0.10927	0.462000	0.41574	ACA	.	.	none		0.393	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
HAUS6	54801	hgsc.bcm.edu	37	9	19058226	19058226	+	Missense_Mutation	SNP	T	T	G	rs201053056		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr9:19058226T>G	ENST00000380502.3	-	16	3006	c.2539A>C	c.(2539-2541)Aaa>Caa	p.K847Q	HAUS6_ENST00000380496.1_Missense_Mutation_p.K711Q	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	847					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCTTCCCTTTTCTTGGAAAGA	0.428																																					p.K847Q		Atlas-SNP	.											.	HAUS6	66	.	0			c.A2539C						PASS	.						149.0	147.0	148.0					9																	19058226		2203	4300	6503	SO:0001583	missense	54801	exon16			CCCTTTTCTTGGA	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2539A>C	9.37:g.19058226T>G	ENSP00000369871:p.Lys847Gln	197.0	0.0	0		135.0	57.0	0.422222	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	T	0.794	-0.757692	0.03019	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.26660	1.73;1.72	5.27	0.291	0.15732	.	0.706131	0.13913	N	0.354089	T	0.12561	0.0305	N	0.17474	0.49	0.09310	N	1	B;B;B	0.20052	0.041;0.041;0.023	B;B;B	0.17433	0.018;0.012;0.012	T	0.26815	-1.0092	10	0.28530	T	0.3	-0.407	5.0616	0.14560	0.0:0.2258:0.3007:0.4735	.	812;711;847	Q7Z4H7-3;Q5VY60;Q7Z4H7	.;.;HAUS6_HUMAN	Q	847;711	ENSP00000369871:K847Q;ENSP00000369865:K711Q	ENSP00000369865:K711Q	K	-	1	0	HAUS6	19048226	0.001000	0.12720	0.069000	0.20011	0.046000	0.14306	0.201000	0.17276	-0.090000	0.12462	-0.456000	0.05471	AAA	T|1.000;C|0.000	.	alt		0.428	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
BCO2	83875	hgsc.bcm.edu	37	11	112071462	112071462	+	Missense_Mutation	SNP	C	C	T	rs141269805		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:112071462C>T	ENST00000357685.5	+	7	1127	c.992C>T	c.(991-993)aCg>aTg	p.T331M	BCO2_ENST00000526088.1_Missense_Mutation_p.T297M|BCO2_ENST00000361053.4_Missense_Mutation_p.T258M|BCO2_ENST00000438022.1_Missense_Mutation_p.T297M|BCO2_ENST00000532593.1_Missense_Mutation_p.T226M|BCO2_ENST00000393032.2_Missense_Mutation_p.T297M|BCO2_ENST00000531169.1_Missense_Mutation_p.T297M			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	331					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						CAGTGTAATACGCGGTTTCAT	0.398																																					p.T331M	GBM(177;1916 2099 21049 29541 39946)	Atlas-SNP	.											.	BCO2	44	.	0			c.C992T						PASS	.	C	MET/THR,MET/THR	1,4401	2.1+/-5.4	0,1,2200	121.0	124.0	123.0		890,992	5.4	0.9	11	dbSNP_134	123	0,8594		0,0,4297	no	missense,missense	BCO2	NM_001037290.1,NM_031938.4	81,81	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	297/546,331/580	112071462	1,12995	2201	4297	6498	SO:0001583	missense	83875	exon7			GTAATACGCGGTT	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.992C>T	11.37:g.112071462C>T	ENSP00000350314:p.Thr331Met	80.0	0.0	0		92.0	33.0	0.358696	NM_031938	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354480	0.61293	2.27E-4	0.0	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75;-3.75;-3.75;-3.75	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.98140	0.9386	M	0.89353	3.025	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.993	D	0.98900	1.0776	10	0.87932	D	0	-17.1853	19.2802	0.94050	0.0:1.0:0.0:0.0	.	308;258;331;158	C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.;.;BCDO2_HUMAN;.	M	331;297;258;297;297;226;297	ENSP00000350314:T331M;ENSP00000376752:T297M;ENSP00000354338:T258M;ENSP00000414843:T297M;ENSP00000436615:T297M;ENSP00000431802:T226M;ENSP00000437053:T297M	ENSP00000350314:T331M	T	+	2	0	BCO2	111576672	1.000000	0.71417	0.948000	0.38648	0.108000	0.19459	5.274000	0.65569	2.579000	0.87056	0.585000	0.79938	ACG	C|1.000;T|0.000	0.000	weak		0.398	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
LVRN	206338	hgsc.bcm.edu	37	5	115299001	115299001	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:115299001C>T	ENST00000357872.4	+	1	811	c.687C>T	c.(685-687)ggC>ggT	p.G229G	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		229						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CCGACCAGGGCGAGCGCAGGT	0.662																																					p.G229G		Atlas-SNP	.											.	.	.	.	0			c.C687T						PASS	.						13.0	15.0	14.0					5																	115299001		2141	4234	6375	SO:0001819	synonymous_variant	0	exon1			CCAGGGCGAGCGC																												ENST00000357872.4:c.687C>T	5.37:g.115299001C>T		59.0	0.0	0		38.0	16.0	0.421053	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																			.	.	none		0.662	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
PKD2L2	27039	hgsc.bcm.edu	37	5	137228235	137228235	+	Missense_Mutation	SNP	A	A	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:137228235A>T	ENST00000508883.1	+	3	226	c.200A>T	c.(199-201)gAc>gTc	p.D67V	PKD2L2_ENST00000502810.1_Missense_Mutation_p.D67V|PKD2L2_ENST00000290431.5_Missense_Mutation_p.D67V|PKD2L2_ENST00000508638.1_Missense_Mutation_p.D67V|PKD2L2_ENST00000350250.4_Missense_Mutation_p.D33V			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	67					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTATTTTTGGACACTTCTGTG	0.338																																					p.D67V		Atlas-SNP	.											.	PKD2L2	68	.	0			c.A200T						PASS	.						147.0	140.0	142.0					5																	137228235		1857	4103	5960	SO:0001583	missense	27039	exon3			TTTTGGACACTTC	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.200A>T	5.37:g.137228235A>T	ENSP00000424725:p.Asp67Val	122.0	0.0	0		86.0	34.0	0.395349	NM_001258448	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	ENST00000508883.1	37		.	.	.	.	.	.	.	.	.	.	A	18.53	3.644784	0.67358	.	.	ENSG00000078795	ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T;T	0.72835	-0.31;0.23;-0.69;-0.23;-0.24	5.84	5.84	0.93424	.	0.078484	0.53938	D	0.000050	T	0.67487	0.2898	L	0.52905	1.665	0.80722	D	1	B;P;B	0.40731	0.036;0.728;0.328	B;B;B	0.37601	0.09;0.254;0.155	T	0.72308	-0.4332	10	0.72032	D	0.01	-18.009	15.8841	0.79226	1.0:0.0:0.0:0.0	.	67;67;67	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	V	33;67;67;67;67	ENSP00000344177:D33V;ENSP00000423382:D67V;ENSP00000425513:D67V;ENSP00000424725:D67V;ENSP00000290431:D67V	ENSP00000290431:D67V	D	+	2	0	PKD2L2	137256134	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.333000	0.90026	2.233000	0.73108	0.496000	0.49642	GAC	.	.	none		0.338	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
ETS1	2113	hgsc.bcm.edu	37	11	128442997	128442997	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:128442997C>T	ENST00000392668.4	-	2	113	c.29G>A	c.(28-30)aGc>aAc	p.S10N	ETS1_ENST00000525404.1_5'UTR	NM_001143820.1	NP_001137292.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	0					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GACGGGGCTGCTCCCAGCAGA	0.577																																					p.S10N		Atlas-SNP	.											.	ETS1	123	.	0			c.G29A						PASS	.						46.0	53.0	51.0					11																	128442997		1565	3577	5142	SO:0001583	missense	2113	exon2			GGGCTGCTCCCAG		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000392668.4:c.29G>A	11.37:g.128442997C>T	ENSP00000376436:p.Ser10Asn	101.0	0.0	0		70.0	21.0	0.3	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000392668.4	37	CCDS44767.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693001	0.30052	.	.	ENSG00000134954	ENST00000392668	T	0.12569	2.67	5.25	3.4	0.38934	.	0.224065	0.36034	N	0.002835	T	0.08313	0.0207	.	.	.	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.32188	-0.9916	9	0.24483	T	0.36	.	7.9729	0.30138	0.0:0.8177:0.0:0.1823	.	10	Q6N087	.	N	10	ENSP00000376436:S10N	ENSP00000376436:S10N	S	-	2	0	ETS1	127948207	0.002000	0.14202	0.002000	0.10522	0.012000	0.07955	1.224000	0.32539	0.915000	0.36847	-0.136000	0.14681	AGC	.	.	none		0.577	ETS1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386267.2	NM_005238	
MACROD2	140733	hgsc.bcm.edu	37	20	15967421	15967421	+	Silent	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr20:15967421G>A	ENST00000310348.4	+	14	1035	c.1035G>A	c.(1033-1035)tcG>tcA	p.S345S	MACROD2_ENST00000378058.3_Silent_p.S110S|MACROD2_ENST00000402914.1_Silent_p.S110S|MACROD2_ENST00000407045.3_5'UTR|MACROD2_ENST00000217246.4_Silent_p.S345S			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	345	Glu-rich.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AAACAGAATCGCAGAGCTCAT	0.318																																					p.S345S		Atlas-SNP	.											MACROD2,colon,carcinoma,+2,2	MACROD2	34	2	0			c.G1035A						PASS	.						71.0	67.0	69.0					20																	15967421		2203	4300	6503	SO:0001819	synonymous_variant	140733	exon14			AGAATCGCAGAGC	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1035G>A	20.37:g.15967421G>A		178.0	0.0	0		121.0	50.0	0.413223	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																			.	.	none		0.318	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
MAP4K5	11183	hgsc.bcm.edu	37	14	50901153	50901153	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:50901153T>C	ENST00000013125.4	-	27	2441	c.2123A>G	c.(2122-2124)aAt>aGt	p.N708S		NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	708	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					AGAGTTCAAATTGATTGTCTC	0.348																																					p.N708S		Atlas-SNP	.											.	MAP4K5	48	.	0			c.A2123G						PASS	.						85.0	73.0	77.0					14																	50901153		1864	4096	5960	SO:0001583	missense	11183	exon27			TTCAAATTGATTG	U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.2123A>G	14.37:g.50901153T>C	ENSP00000013125:p.Asn708Ser	88.0	0.0	0		68.0	32.0	0.470588	NM_006575	Q8IYF6	Missense_Mutation	SNP	ENST00000013125.4	37		.	.	.	.	.	.	.	.	.	.	T	21.9	4.222735	0.79464	.	.	ENSG00000012983	ENST00000013125	T	0.05025	3.51	4.96	4.96	0.65561	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.27454	0.0674	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.79108	0.958;0.992	T	0.03662	-1.1015	10	0.62326	D	0.03	.	14.6592	0.68858	0.0:0.0:0.0:1.0	.	708;708	B2R928;Q9Y4K4	.;M4K5_HUMAN	S	708	ENSP00000013125:N708S	ENSP00000013125:N708S	N	-	2	0	MAP4K5	49970903	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.991000	0.88244	1.861000	0.53984	0.454000	0.30748	AAT	.	.	none		0.348	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410880.1	NM_006575	
TIRAP	114609	hgsc.bcm.edu	37	11	126162924	126162924	+	Missense_Mutation	SNP	G	G	A	rs199561634		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:126162924G>A	ENST00000392680.2	+	5	1025	c.620G>A	c.(619-621)cGt>cAt	p.R207H	TIRAP_ENST00000392678.3_Missense_Mutation_p.R207H|RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392679.1_Missense_Mutation_p.R207H|RP11-712L6.7_ENST00000533378.1_RNA	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	207	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		GGTGGCTTTCGTCAAGTCAAA	0.537																																					p.R207H		Atlas-SNP	.											.	TIRAP	37	.	0			c.G620A						PASS	.						57.0	62.0	60.0					11																	126162924		2193	4291	6484	SO:0001583	missense	114609	exon5			GCTTTCGTCAAGT	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.620G>A	11.37:g.126162924G>A	ENSP00000376447:p.Arg207His	90.0	0.0	0		77.0	36.0	0.467532	NM_148910	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Missense_Mutation	SNP	ENST00000392680.2	37	CCDS8472.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365402	0.24684	.	.	ENSG00000150455	ENST00000392679;ENST00000279992;ENST00000392678;ENST00000392680	T;T;T	0.02472	4.28;4.28;4.28	5.83	-9.57	0.00562	Toll/interleukin-1 receptor homology (TIR) domain (1);	1.158350	0.06092	N	0.663909	T	0.02267	0.0070	L	0.31294	0.92	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.01281	0.0;0.0	T	0.43327	-0.9398	9	.	.	.	-12.1802	13.0157	0.58754	0.2329:0.0818:0.6853:0.0	.	207;207	P58753;Q56UH9	TIRAP_HUMAN;.	H	207	ENSP00000376446:R207H;ENSP00000376445:R207H;ENSP00000376447:R207H	.	R	+	2	0	TIRAP	125668134	0.000000	0.05858	0.284000	0.24805	0.924000	0.55760	-0.924000	0.03996	-1.520000	0.01773	-0.290000	0.09829	CGT	G|0.999;A|0.001	0.001	weak		0.537	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000277092.1	NM_148910	
MCM4	4173	hgsc.bcm.edu	37	8	48875553	48875553	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr8:48875553A>T	ENST00000262105.2	+	6	855	c.646A>T	c.(646-648)Aaa>Taa	p.K216*	PRKDC_ENST00000338368.3_5'Flank|PRKDC_ENST00000314191.2_5'Flank|MCM4_ENST00000523944.1_Nonsense_Mutation_p.K216*|PRKDC_ENST00000523565.1_5'Flank	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	216					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TGAACACATCAAATCATTTGA	0.274																																					p.K216X		Atlas-SNP	.											.	MCM4	97	.	0			c.A646T						PASS	.						61.0	65.0	64.0					8																	48875553		2202	4299	6501	SO:0001587	stop_gained	4173	exon7			CACATCAAATCAT		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.646A>T	8.37:g.48875553A>T	ENSP00000262105:p.Lys216*	153.0	0.0	0		111.0	31.0	0.279279	NM_182746	Q8NEH1|Q99658	Nonsense_Mutation	SNP	ENST00000262105.2	37	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	A	33	5.216530	0.95104	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000519170	.	.	.	5.64	3.16	0.36331	.	0.515689	0.24332	N	0.039454	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6873	12.5614	0.56283	0.7376:0.2624:0.0:0.0	.	.	.	.	X	216;216;203;176;166	.	ENSP00000262105:K216X	K	+	1	0	MCM4	49038106	1.000000	0.71417	0.921000	0.36526	0.971000	0.66376	3.376000	0.52417	0.379000	0.24794	0.379000	0.24179	AAA	.	.	none		0.274	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
CCDC88C	440193	hgsc.bcm.edu	37	14	91770135	91770135	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr14:91770135G>T	ENST00000389857.6	-	20	3631	c.3545C>A	c.(3544-3546)tCg>tAg	p.S1182*		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1182					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GTACTCGGCCGATTGCCGCTC	0.637																																					p.S1182X		Atlas-SNP	.											CCDC88C_ENST00000389857,caecum,carcinoma,+1,2	CCDC88C	192	2	0			c.C3545A						PASS	.						52.0	56.0	55.0					14																	91770135		2129	4235	6364	SO:0001587	stop_gained	440193	exon20			TCGGCCGATTGCC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3545C>A	14.37:g.91770135G>T	ENSP00000374507:p.Ser1182*	84.0	0.0	0		71.0	29.0	0.408451	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Nonsense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	44	10.628605	0.99440	.	.	ENSG00000015133	ENST00000389857	.	.	.	5.37	4.47	0.54385	.	0.141481	0.32563	U	0.005935	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-16.2203	15.9444	0.79782	0.0:0.1467:0.8533:0.0	.	.	.	.	X	1182	.	ENSP00000374507:S1182X	S	-	2	0	CCDC88C	90839888	1.000000	0.71417	0.851000	0.33527	0.827000	0.46813	7.740000	0.84986	1.376000	0.46267	0.561000	0.74099	TCG	.	.	none		0.637	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
KREMEN2	79412	hgsc.bcm.edu	37	16	3014557	3014557	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr16:3014557C>T	ENST00000303746.5	+	1	613	c.36C>T	c.(34-36)ctC>ctT	p.L12L	KREMEN2_ENST00000572045.1_Silent_p.L12L|KREMEN2_ENST00000575885.1_Silent_p.L12L|KREMEN2_ENST00000575769.1_Silent_p.L12L|KREMEN2_ENST00000319500.6_Silent_p.L12L|KREMEN2_ENST00000571007.1_Silent_p.L12L			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	12					Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						TCCTCTTTCTCCTCTTCCTCC	0.687																																					p.L12L		Atlas-SNP	.											.	KREMEN2	13	.	0			c.C36T						PASS	.						58.0	63.0	61.0					16																	3014557		2198	4300	6498	SO:0001819	synonymous_variant	79412	exon1			CTTTCTCCTCTTC	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.36C>T	16.37:g.3014557C>T		144.0	0.0	0		136.0	35.0	0.257353	NM_001253725	B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Silent	SNP	ENST00000303746.5	37	CCDS10483.1																																																																																			.	.	none		0.687	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250964.2	NM_145347	
MTMR8	55613	hgsc.bcm.edu	37	X	63574801	63574801	+	Missense_Mutation	SNP	A	A	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chrX:63574801A>T	ENST00000374852.3	-	4	391	c.324T>A	c.(322-324)gaT>gaA	p.D108E	MTMR8_ENST00000453546.1_Missense_Mutation_p.D108E	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	108						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						AAGCATAAAGATCTTCAGGTA	0.363																																					p.D108E		Atlas-SNP	.											.	MTMR8	178	.	1	Whole gene deletion(1)	ovary(1)	c.T324A						PASS	.						61.0	48.0	52.0					X																	63574801		2203	4300	6503	SO:0001583	missense	55613	exon4			ATAAAGATCTTCA	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.324T>A	X.37:g.63574801A>T	ENSP00000363985:p.Asp108Glu	83.0	0.0	0		63.0	30.0	0.47619	NM_017677	Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.868|8.868	0.948526|0.948526	0.18356|0.18356	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000453546;ENST00000374852;ENST00000247400|ENST00000442913	T;T|.	0.81247|.	-1.47;-1.47|.	2.78|2.78	1.59|1.59	0.23543|0.23543	.|.	0.113616|.	0.32868|.	U|.	0.005558|.	T|T	0.08758|0.08758	0.0217|0.0217	N|N	0.01771|0.01771	-0.73|-0.73	0.27265|0.27265	N|N	0.958517|0.958517	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.08055|.	0.001;0.003|.	T|T	0.29397|0.29397	-1.0013|-1.0013	10|5	0.10902|.	T|.	0.67|.	.|.	2.1307|2.1307	0.03749|0.03749	0.4848:0.0:0.2795:0.2356|0.4848:0.0:0.2795:0.2356	.|.	108;108|.	B4DQL0;Q96EF0|.	.;MTMR8_HUMAN|.	E|T	108;108;107|25	ENSP00000394003:D108E;ENSP00000363985:D108E|.	ENSP00000247400:D107E|.	D|S	-|-	3|1	2|0	MTMR8|MTMR8	63491526|63491526	0.857000|0.857000	0.29778|0.29778	0.998000|0.998000	0.56505|0.56505	0.978000|0.978000	0.69477|0.69477	-0.122000|-0.122000	0.10627|0.10627	0.349000|0.349000	0.23975|0.23975	-0.453000|-0.453000	0.05500|0.05500	GAT|TCT	.	.	none		0.363	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677	
ADCY2	108	hgsc.bcm.edu	37	5	7826845	7826845	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:7826845C>T	ENST00000338316.4	+	25	3226	c.3137C>T	c.(3136-3138)aCg>aTg	p.T1046M	ADCY2_ENST00000537121.1_Missense_Mutation_p.T866M	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1046					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACCGAGGAGACGAGCCTCGTC	0.488																																					p.T1046M		Atlas-SNP	.											.	ADCY2	337	.	0			c.C3137T						PASS	.						103.0	92.0	96.0					5																	7826845		2203	4300	6503	SO:0001583	missense	108	exon25			AGGAGACGAGCCT	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3137C>T	5.37:g.7826845C>T	ENSP00000342952:p.Thr1046Met	104.0	0.0	0		60.0	22.0	0.366667	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957024	0.34565	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	D;D	0.84516	-1.86;-1.86	5.43	4.56	0.56223	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.053234	0.85682	D	0.000000	D	0.92557	0.7636	M	0.85299	2.745	0.50171	D	0.999853	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92270	0.5824	10	0.37606	T	0.19	.	15.5943	0.76566	0.1387:0.8613:0.0:0.0	.	866;1046	B7Z2C1;Q08462	.;ADCY2_HUMAN	M	1046;158;879;866	ENSP00000342952:T1046M;ENSP00000444803:T866M	ENSP00000342952:T1046M	T	+	2	0	ADCY2	7879845	1.000000	0.71417	0.683000	0.30040	0.075000	0.17131	5.871000	0.69628	1.275000	0.44379	0.591000	0.81541	ACG	.	.	none		0.488	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ZNF485	220992	hgsc.bcm.edu	37	10	44112510	44112510	+	Missense_Mutation	SNP	C	C	G			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:44112510C>G	ENST00000361807.3	+	5	1213	c.1019C>G	c.(1018-1020)tCc>tGc	p.S340C	ZNF485_ENST00000374435.3_Missense_Mutation_p.S340C|ZNF485_ENST00000374437.2_Missense_Mutation_p.S249C	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						TATAGCTCATCCTTTGCTGGT	0.428																																					p.S340C		Atlas-SNP	.											.	ZNF485	102	.	0			c.C1019G						PASS	.						122.0	117.0	119.0					10																	44112510		2203	4300	6503	SO:0001583	missense	220992	exon5			GCTCATCCTTTGC	AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.1019C>G	10.37:g.44112510C>G	ENSP00000354694:p.Ser340Cys	70.0	0.0	0		34.0	13.0	0.382353	NM_145312	B4DSE6|Q96CL0	Missense_Mutation	SNP	ENST00000361807.3	37	CCDS7205.2	.	.	.	.	.	.	.	.	.	.	C	9.435	1.086676	0.20390	.	.	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.08008	3.14;3.14;3.14	1.86	1.86	0.25419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17704	0.0425	L	0.56124	1.755	0.09310	N	1	P	0.52842	0.956	P	0.57776	0.827	T	0.04811	-1.0925	9	0.62326	D	0.03	.	9.7485	0.40462	0.0:1.0:0.0:0.0	.	340	Q8NCK3	ZN485_HUMAN	C	340;249;340	ENSP00000354694:S340C;ENSP00000363560:S249C;ENSP00000363558:S340C	ENSP00000354694:S340C	S	+	2	0	ZNF485	43432516	0.000000	0.05858	0.680000	0.29994	0.951000	0.60555	-1.275000	0.02817	1.337000	0.45525	0.313000	0.20887	TCC	.	.	none		0.428	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047719.2	NM_145312	
ZNF608	57507	hgsc.bcm.edu	37	5	123984038	123984038	+	Missense_Mutation	SNP	G	G	A	rs186374145		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:123984038G>A	ENST00000306315.5	-	4	2474	c.2039C>T	c.(2038-2040)aCg>aTg	p.T680M	ZNF608_ENST00000504926.1_Missense_Mutation_p.T253M	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	680							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TAACGCAGCCGTCATGTTGGA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		17651	0.0		0.001	False		,,,				2504	0.0				p.T680M		Atlas-SNP	.											.	ZNF608	117	.	0			c.C2039T						PASS	.						117.0	120.0	119.0					5																	123984038		2203	4300	6503	SO:0001583	missense	57507	exon4			GCAGCCGTCATGT	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2039C>T	5.37:g.123984038G>A	ENSP00000307746:p.Thr680Met	185.0	0.0	0		147.0	71.0	0.482993	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	13.84	2.356303	0.41700	.	.	ENSG00000168916	ENST00000504926;ENST00000306315;ENST00000509799;ENST00000513986	T;T	0.50277	0.75;0.75	5.88	5.88	0.94601	.	0.336013	0.35235	N	0.003341	T	0.41766	0.1173	N	0.14661	0.345	0.35596	D	0.807501	D	0.57899	0.981	P	0.47015	0.534	T	0.51919	-0.8644	10	0.51188	T	0.08	-7.3927	20.2315	0.98350	0.0:0.0:1.0:0.0	.	680	Q9ULD9	ZN608_HUMAN	M	253;680;680;680	ENSP00000427657:T253M;ENSP00000307746:T680M	ENSP00000307746:T680M	T	-	2	0	ZNF608	124011937	0.997000	0.39634	0.999000	0.59377	0.904000	0.53231	6.509000	0.73725	2.784000	0.95788	0.551000	0.68910	ACG	G|1.000;A|0.000	0.000	strong		0.458	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
TMPO	7112	hgsc.bcm.edu	37	12	98931352	98931352	+	Splice_Site	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr12:98931352T>C	ENST00000556029.1	+	4	1019		c.e4+2		TMPO_ENST00000343315.5_Splice_Site|TMPO_ENST00000393053.2_Splice_Site|TMPO_ENST00000261210.5_Missense_Mutation_p.V222A	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CACAATCAGGTATCTTTAGTT	0.413																																					.		Atlas-SNP	.											.	TMPO	111	.	0			c.663+2T>C						PASS	.						95.0	88.0	90.0					12																	98931352		2203	4300	6503	SO:0001630	splice_region_variant	7112	exon4			ATCAGGTATCTTT		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.663+2T>C	12.37:g.98931352T>C		71.0	0.0	0		68.0	27.0	0.397059	NM_001032284	A2T926|Q14861	Splice_Site	SNP	ENST00000556029.1	37	CCDS31879.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.038827|4.038827	0.75617|0.75617	.|.	.|.	ENSG00000120802|ENSG00000120802	ENST00000556029;ENST00000343315;ENST00000393053;ENST00000556678|ENST00000261210	.|T	.|0.75589	.|-0.95	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|.	.|.	.|.	.|.	.|D	.|0.85754	.|0.5770	.|.	.|.	.|.	0.30616|0.30616	N|N	0.759|0.759	.|D	.|0.69078	.|0.997	.|D	.|0.72625	.|0.978	.|D	.|0.84747	.|0.0754	.|7	.|.	.|.	.|.	.|.	16.0796|16.0796	0.80995|0.80995	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|222	.|A2T926	.|.	.|A	-1|222	.|ENSP00000261210:V222A	.|.	.|V	+|+	.|2	.|0	TMPO|TMPO	97455483|97455483	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.893000|0.893000	0.52053|0.52053	5.448000|5.448000	0.66612|0.66612	2.195000|2.195000	0.70347|0.70347	0.528000|0.528000	0.53228|0.53228	.|GTA	.	.	none		0.413	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	Intron
EZH2	2146	hgsc.bcm.edu	37	7	148507461	148507461	+	Missense_Mutation	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr7:148507461T>C	ENST00000460911.1	-	17	2066	c.1978A>G	c.(1978-1980)Aaa>Gaa	p.K660E	EZH2_ENST00000350995.2_Missense_Mutation_p.K621E|EZH2_ENST00000478654.1_Missense_Mutation_p.K609E|EZH2_ENST00000476773.1_Missense_Mutation_p.K609E|EZH2_ENST00000483967.1_Missense_Mutation_p.K651E|EZH2_ENST00000320356.2_Missense_Mutation_p.K665E|EZH2_ENST00000541220.1_Missense_Mutation_p.K609E			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	660	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.K665_Y666del(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CACATGTATTTATCATACACT	0.428			Mis		DLBCL																																p.K665E		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.A1993G						PASS	.						109.0	91.0	97.0					7																	148507461		2202	4300	6502	SO:0001583	missense	2146	exon17			TGTATTTATCATA		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1978A>G	7.37:g.148507461T>C	ENSP00000419711:p.Lys660Glu	78.0	0.0	0		63.0	23.0	0.365079	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	t	29.7	5.031157	0.93575	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	D;T;T;T;D;D;T	0.81659	-1.52;-1.32;-1.32;-1.32;-1.52;-1.52;-1.32	5.45	5.45	0.79879	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.86439	0.5933	L	0.46567	1.45	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.994	D	0.86978	0.2102	10	0.52906	T	0.07	.	15.542	0.76057	0.0:0.0:0.0:1.0	.	651;609;660;621;665	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	E	609;665;660;621;609;609;651	ENSP00000417062:K609E;ENSP00000320147:K665E;ENSP00000419711:K660E;ENSP00000223193:K621E;ENSP00000443219:K609E;ENSP00000419050:K609E;ENSP00000419856:K651E	ENSP00000320147:K665E	K	-	1	0	EZH2	148138394	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.789000	0.85783	2.064000	0.61679	0.533000	0.62120	AAA	.	.	none		0.428	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
BCL2	596	hgsc.bcm.edu	37	18	60985444	60985444	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr18:60985444C>T	ENST00000398117.1	-	1	1917	c.456G>A	c.(454-456)gaG>gaA	p.E152E	BCL2_ENST00000589955.1_Silent_p.E152E|BCL2_ENST00000444484.1_Silent_p.E152E|BCL2_ENST00000333681.4_Silent_p.E152E	NM_000633.2	NP_000624.2	P10415	BCL2_HUMAN	B-cell CLL/lymphoma 2	152					actin filament organization (GO:0007015)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|axonogenesis (GO:0007409)|B cell homeostasis (GO:0001782)|B cell lineage commitment (GO:0002326)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|behavioral fear response (GO:0001662)|branching involved in ureteric bud morphogenesis (GO:0001658)|CD8-positive, alpha-beta T cell lineage commitment (GO:0043375)|cell aging (GO:0007569)|cell growth (GO:0016049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to organic substance (GO:0071310)|cochlear nucleus development (GO:0021747)|defense response to virus (GO:0051607)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|ear development (GO:0043583)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|female pregnancy (GO:0007565)|focal adhesion assembly (GO:0048041)|gland morphogenesis (GO:0022612)|glomerulus development (GO:0032835)|hair follicle morphogenesis (GO:0031069)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|melanin metabolic process (GO:0006582)|melanocyte differentiation (GO:0030318)|mesenchymal cell development (GO:0014031)|metanephros development (GO:0001656)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of autophagy (GO:0010507)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cellular pH reduction (GO:0032848)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of retinal cell programmed cell death (GO:0046671)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oocyte development (GO:0048599)|organ growth (GO:0035265)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pigment granule organization (GO:0048753)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell growth (GO:0030307)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron maturation (GO:0014042)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smooth muscle cell migration (GO:0014911)|post-embryonic development (GO:0009791)|protein dephosphorylation (GO:0006470)|protein polyubiquitination (GO:0000209)|reactive oxygen species metabolic process (GO:0072593)|regulation of calcium ion transport (GO:0051924)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glycoprotein biosynthetic process (GO:0010559)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|regulation of protein stability (GO:0031647)|regulation of transmembrane transporter activity (GO:0022898)|regulation of viral genome replication (GO:0045069)|release of cytochrome c from mitochondria (GO:0001836)|renal system process (GO:0003014)|response to acid chemical (GO:0001101)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to iron ion (GO:0010039)|response to ischemia (GO:0002931)|response to nicotine (GO:0035094)|response to radiation (GO:0009314)|response to toxic substance (GO:0009636)|response to UV-B (GO:0010224)|single organismal cell-cell adhesion (GO:0016337)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|channel inhibitor activity (GO:0016248)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(106)|kidney(1)|large_intestine(1)|lung(3)	113		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Ibuprofen(DB01050)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CCCCACCGAACTCAAAGAAGG	0.627			T	IGH@	"""NHL, CLL"""																																p.E152E		Atlas-SNP	.		Dom	yes		18	18q21.3	596	B-cell CLL/lymphoma 2		L	.	BCL2	272	.	0			c.G456A						PASS	.						139.0	148.0	145.0					18																	60985444		2203	4300	6503	SO:0001819	synonymous_variant	596	exon2			ACCGAACTCAAAG	M14745	CCDS11981.1, CCDS45882.1	18q21.3	2014-03-07			ENSG00000171791	ENSG00000171791		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	990	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 50"""	151430					Standard	XM_006722523		Approved	Bcl-2, PPP1R50	uc002lit.1	P10415	OTTHUMG00000132791	ENST00000398117.1:c.456G>A	18.37:g.60985444C>T		190.0	0.0	0		128.0	50.0	0.390625	NM_000633	C9JHD5|P10416|Q13842|Q16197	Silent	SNP	ENST00000398117.1	37	CCDS11981.1																																																																																			.	.	none		0.627	BCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256199.1	NM_000633, NM_000657	
PCDHA6	56142	hgsc.bcm.edu	37	5	140209668	140209668	+	Silent	SNP	G	G	A	rs141570762	byFrequency	TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:140209668G>A	ENST00000529310.1	+	1	2106	c.1992G>A	c.(1990-1992)acG>acA	p.T664T	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACGGCCACGGTTCTGGTGT	0.692																																					p.T664T		Atlas-SNP	.											.	PCDHA6	442	.	0			c.G1992A						PASS	.						37.0	44.0	42.0					5																	140209668		2202	4297	6499	SO:0001819	synonymous_variant	56142	exon1			GGCCACGGTTCTG	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1992G>A	5.37:g.140209668G>A		94.0	0.0	0		56.0	29.0	0.517857	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																			G|0.998;C|0.002	.	alt		0.692	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
GPR158	57512	hgsc.bcm.edu	37	10	25701364	25701364	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:25701364G>A	ENST00000376351.3	+	4	1656	c.1297G>A	c.(1297-1299)Gtt>Att	p.V433I		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	433					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GCTCGACTTCGTTAGCATGCT	0.473																																					p.V433I		Atlas-SNP	.											.	GPR158	255	.	0			c.G1297A						PASS	.						195.0	167.0	177.0					10																	25701364		2203	4300	6503	SO:0001583	missense	57512	exon4			GACTTCGTTAGCA	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1297G>A	10.37:g.25701364G>A	ENSP00000365529:p.Val433Ile	159.0	0.0	0		88.0	35.0	0.397727	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	5.850	0.341062	0.11069	.	.	ENSG00000151025	ENST00000376351	D	0.87729	-2.29	6.16	-9.35	0.00633	GPCR, family 3, C-terminal (2);	0.949110	0.08702	N	0.906239	T	0.65688	0.2715	N	0.04355	-0.22	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.60944	-0.7162	10	0.02654	T	1	.	15.4514	0.75277	0.7301:0.0789:0.1909:0.0	.	433	Q5T848	GP158_HUMAN	I	433	ENSP00000365529:V433I	ENSP00000365529:V433I	V	+	1	0	GPR158	25741370	0.208000	0.23494	0.004000	0.12327	0.915000	0.54546	0.141000	0.16076	-2.012000	0.00950	-2.218000	0.00297	GTT	.	.	none		0.473	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
RUFY2	55680	hgsc.bcm.edu	37	10	70143622	70143622	+	Missense_Mutation	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr10:70143622C>T	ENST00000602465.1	-	10	972	c.872G>A	c.(871-873)cGt>cAt	p.R291H	RUFY2_ENST00000454950.2_Missense_Mutation_p.R233H|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000399200.2_Missense_Mutation_p.R257H|RUFY2_ENST00000388768.2_Missense_Mutation_p.R326H			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	340						nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TAGCCCCTGACGAGAATGCTT	0.353																																					p.R326H		Atlas-SNP	.											.	RUFY2	58	.	0			c.G977A						PASS	.						143.0	129.0	133.0					10																	70143622		1866	4102	5968	SO:0001583	missense	55680	exon10			CCCTGACGAGAAT	AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.872G>A	10.37:g.70143622C>T	ENSP00000473462:p.Arg291His	103.0	0.0	0		74.0	41.0	0.554054	NM_017987	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	ENST00000602465.1	37		.	.	.	.	.	.	.	.	.	.	C	32	5.126953	0.94429	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	T;T;T	0.54479	0.57;1.78;1.36	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.70622	0.3245	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.987;0.994;0.991;0.994	T	0.70970	-0.4727	10	0.49607	T	0.09	.	16.8596	0.86014	0.0:1.0:0.0:0.0	.	233;291;257;326	B4DFR0;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.	H	326;257;233	ENSP00000373420:R326H;ENSP00000382151:R257H;ENSP00000404986:R233H	ENSP00000373420:R326H	R	-	2	0	RUFY2	69813628	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.004000	0.76317	2.647000	0.89833	0.585000	0.79938	CGT	.	.	none		0.353	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467567.1	NM_017987	
PCDHGA1	56114	hgsc.bcm.edu	37	5	140711925	140711925	+	Silent	SNP	C	C	T			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr5:140711925C>T	ENST00000517417.1	+	1	1674	c.1674C>T	c.(1672-1674)aaC>aaT	p.N558N	PCDHGA1_ENST00000378105.3_Silent_p.N558N	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N558N(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCCGAGA	0.647																																					p.N558N		Atlas-SNP	.											PCDHGA1_ENST00000517417,NS,carcinoma,0,4	PCDHGA1	397	4	2	Substitution - coding silent(2)	lung(2)	c.C1674T						scavenged	.						140.0	153.0	149.0					5																	140711925		2203	4300	6503	SO:0001819	synonymous_variant	56114	exon1			CGACAACGCGCCC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1674C>T	5.37:g.140711925C>T		133.0	1.0	0.0075188		65.0	20.0	0.307692	NM_018912	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1																																																																																			.	.	none		0.647	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
HERC2	8924	hgsc.bcm.edu	37	15	28366537	28366537	+	Silent	SNP	T	T	C			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr15:28366537T>C	ENST00000261609.7	-	86	13335	c.13227A>G	c.(13225-13227)gtA>gtG	p.V4409V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GACGATCGCGTACCATAGTTG	0.468																																					p.V4409V		Atlas-SNP	.											.	HERC2	501	.	0			c.A13227G						PASS	.						135.0	124.0	128.0					15																	28366537		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon86			ATCGCGTACCATA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13227A>G	15.37:g.28366537T>C		115.0	0.0	0		75.0	4.0	0.0533333	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			.	.	none		0.468	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
USF1	7391	hgsc.bcm.edu	37	1	161012436	161012436	+	Missense_Mutation	SNP	G	G	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr1:161012436G>A	ENST00000368021.3	-	4	287	c.83C>T	c.(82-84)cCa>cTa	p.P28L	USF1_ENST00000368020.1_Missense_Mutation_p.P28L|USF1_ENST00000368019.1_Missense_Mutation_p.P28L|USF1_ENST00000435396.1_5'UTR	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	28					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CACACTGGTTGGGTCTTCCCC	0.522																																					p.P28L		Atlas-SNP	.											.	USF1	29	.	0			c.C83T						PASS	.						54.0	53.0	54.0					1																	161012436		2203	4300	6503	SO:0001583	missense	7391	exon4			CTGGTTGGGTCTT	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.83C>T	1.37:g.161012436G>A	ENSP00000357000:p.Pro28Leu	148.0	0.0	0		145.0	31.0	0.213793	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	37	CCDS1214.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.526071	0.64860	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000368019;ENST00000531842	D;D;D;D	0.93076	-3.14;-3.14;-3.16;-2.74	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.90051	0.6893	L	0.58101	1.795	0.80722	D	1	P	0.43938	0.822	B	0.42555	0.391	D	0.91114	0.4924	10	0.52906	T	0.07	-14.642	15.2652	0.73654	0.0:0.0:1.0:0.0	.	28	P22415	USF1_HUMAN	L	28	ENSP00000356999:P28L;ENSP00000357000:P28L;ENSP00000356998:P28L;ENSP00000435005:P28L	ENSP00000356998:P28L	P	-	2	0	USF1	159279060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.478000	0.60230	2.450000	0.82876	0.655000	0.94253	CCA	.	.	none		0.522	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
OR10A5	144124	hgsc.bcm.edu	37	11	6866966	6866966	+	Missense_Mutation	SNP	C	C	A			TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr11:6866966C>A	ENST00000299454.4	+	1	84	c.53C>A	c.(52-54)tCt>tAt	p.S18Y	OR10A5_ENST00000379831.2_Missense_Mutation_p.S22Y			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	18					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATGAGCTTCTCTTCCCTACCT	0.413																																					p.S18Y	Pancreas(44;21 1072 25662 28041 45559)	Atlas-SNP	.											.	OR10A5	48	.	0			c.C53A						PASS	.						185.0	192.0	190.0					11																	6866966		2201	4296	6497	SO:0001583	missense	144124	exon1			GCTTCTCTTCCCT	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.53C>A	11.37:g.6866966C>A	ENSP00000299454:p.Ser18Tyr	273.0	0.0	0		220.0	85.0	0.386364	NM_178168	O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	ENST00000299454.4	37	CCDS7773.1	.	.	.	.	.	.	.	.	.	.	.	14.86	2.662395	0.47572	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.01106	5.33;5.33	3.46	3.46	0.39613	.	0.000000	0.50627	D	0.000101	T	0.07234	0.0183	M	0.93550	3.43	0.32884	D	0.510957	P	0.44776	0.843	P	0.53954	0.738	T	0.01087	-1.1456	10	0.72032	D	0.01	.	13.2073	0.59805	0.0:1.0:0.0:0.0	.	18	Q9H207	O10A5_HUMAN	Y	18;22	ENSP00000299454:S18Y;ENSP00000369159:S22Y	ENSP00000299454:S18Y	S	+	2	0	OR10A5	6823542	0.749000	0.28305	0.976000	0.42696	0.745000	0.42441	3.177000	0.50871	2.225000	0.72522	0.591000	0.81541	TCT	.	.	none		0.413	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
ATP9A	10079	hgsc.bcm.edu	37	20	50313972	50313972	+	Silent	SNP	G	G	A	rs376498362		TCGA-FM-8000-01A-11D-2210-10	TCGA-FM-8000-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	68ab7686-eb0b-4bdd-8e60-132917be4063	b1ed3024-96f1-49e2-bde2-851174877525	g.chr20:50313972G>A	ENST00000338821.5	-	5	750	c.486C>T	c.(484-486)atC>atT	p.I162I	ATP9A_ENST00000311637.5_Intron|ATP9A_ENST00000402822.1_Intron	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	162					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCTTTTCAACGATGATAAGGT	0.413																																					p.I162I		Atlas-SNP	.											.	ATP9A	135	.	0			c.C486T						PASS	.						278.0	258.0	265.0					20																	50313972		2203	4300	6503	SO:0001819	synonymous_variant	10079	exon5			TTCAACGATGATA	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.486C>T	20.37:g.50313972G>A		143.0	0.0	0		94.0	34.0	0.361702	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	CCDS33489.1																																																																																			.	.	weak		0.413	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
