#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TPRX1	284355	hgsc.bcm.edu	37	19	48305613	48305624	+	In_Frame_Del	DEL	TTGGGCCTGAGA	TTGGGCCTGAGA	-	rs201007421		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	TTGGGCCTGAGA	TTGGGCCTGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:48305613_48305624delTTGGGCCTGAGA	ENST00000322175.3	-	2	799_810	c.644_655delTCTCAGGCCCAA	c.(643-657)atctcaggcccaaac>aac	p.ISGP215del	TPRX1_ENST00000535759.1_In_Frame_Del_p.ISGP312del|TPRX1_ENST00000543508.1_In_Frame_Del_p.ISGP205del	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	215	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gggcctgggtttgggcctgagattgggcctga	0.67																																					p.215_219del	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-Indel	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	1	0			c.645_656del						PASS	.																																			SO:0001651	inframe_deletion	284355	exon2			.		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.644_655delTCTCAGGCCCAA	19.37:g.48305613_48305624delTTGGGCCTGAGA	ENSP00000323455:p.Ile215_Pro218del	32.0	0.0	0		32.0	11.0	0.34375	NM_198479	A5D8Y3|B2RPL5	In_Frame_Del	DEL	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.	none		0.670	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
HIST1H2BG	8339	hgsc.bcm.edu	37	6	26216764	26216764	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26216764C>T	ENST00000244601.3	-	1	108	c.108G>A	c.(106-108)gaG>gaA	p.E36E	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	36					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				CGGAGTAGCTCTCCTTACGAC	0.517																																					p.E36E		Atlas-SNP	.											.	HIST1H2BG	25	.	0			c.G108A						PASS	.						250.0	219.0	229.0					6																	26216764		2203	4300	6503	SO:0001819	synonymous_variant	8339	exon1			GTAGCTCTCCTTA	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.108G>A	6.37:g.26216764C>T		105.0	0.0	0		88.0	19.0	0.215909	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	CCDS4594.1																																																																																			.	.	none		0.517	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234674	26234674	+	Missense_Mutation	SNP	G	G	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26234674G>C	ENST00000244534.5	-	1	542	c.488C>G	c.(487-489)gCa>gGa	p.A163G		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	163					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGCAGCGGTTGCTGGCTTCTT	0.537																																					p.A163G		Atlas-SNP	.											.	HIST1H1D	40	.	0			c.C488G						PASS	.						95.0	103.0	100.0					6																	26234674		2203	4300	6503	SO:0001583	missense	3007	exon1			GCGGTTGCTGGCT	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.488C>G	6.37:g.26234674G>C	ENSP00000244534:p.Ala163Gly	84.0	0.0	0		74.0	16.0	0.216216	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	9.047	0.991113	0.18966	.	.	ENSG00000124575	ENST00000244534	T	0.25414	1.8	5.22	4.35	0.52113	.	0.316723	0.32444	N	0.006082	T	0.06280	0.0162	N	0.08118	0	0.53005	D	0.999965	B	0.27853	0.191	B	0.28465	0.09	T	0.16453	-1.0402	10	0.33940	T	0.23	-1.7269	13.338	0.60528	0.0768:0.0:0.9232:0.0	.	163	P16402	H13_HUMAN	G	163	ENSP00000244534:A163G	ENSP00000244534:A163G	A	-	2	0	HIST1H1D	26342653	0.437000	0.25593	0.009000	0.14445	0.105000	0.19272	2.513000	0.45494	1.351000	0.45789	0.650000	0.86243	GCA	.	.	none		0.537	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
PLXDC2	84898	hgsc.bcm.edu	37	10	20436808	20436808	+	Nonsense_Mutation	SNP	C	C	T	rs372842489		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr10:20436808C>T	ENST00000377252.4	+	6	1601	c.760C>T	c.(760-762)Cga>Tga	p.R254*	PLXDC2_ENST00000377242.3_Nonsense_Mutation_p.R205*|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	254					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CATGGATGGACGAATCATCTT	0.453																																					p.R254X		Atlas-SNP	.											.	PLXDC2	108	.	0			c.C760T						PASS	.						102.0	82.0	88.0					10																	20436808		2203	4300	6503	SO:0001587	stop_gained	84898	exon6			GATGGACGAATCA	AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.760C>T	10.37:g.20436808C>T	ENSP00000366460:p.Arg254*	105.0	0.0	0		102.0	14.0	0.137255	NM_032812	Q96E59|Q96PD9|Q96SU9	Nonsense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	C	44	11.271397	0.99539	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	.	.	.	4.83	3.85	0.44370	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1168	0.65159	0.1509:0.8491:0.0:0.0	.	.	.	.	X	254;205;117;240	.	ENSP00000366446:R117X	R	+	1	2	PLXDC2	20476814	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.792000	0.55476	2.392000	0.81423	0.557000	0.71058	CGA	.	.	none		0.453	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
CNN2	1265	hgsc.bcm.edu	37	19	1037764	1037764	+	Silent	SNP	C	C	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:1037764C>G	ENST00000263097.4	+	7	1158	c.795C>G	c.(793-795)ggC>ggG	p.G265G	AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000565096.2_Silent_p.G254G|CNN2_ENST00000348419.3_Silent_p.G226G|CNN2_ENST00000562958.2_Silent_p.G286G|ABCA7_ENST00000263094.6_5'Flank|CNN2_ENST00000606983.1_3'UTR	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	265					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGCCTGGGCCGGCAGATAT	0.652																																					p.G265G		Atlas-SNP	.											.	CNN2	26	.	0			c.C795G						PASS	.						70.0	81.0	77.0					19																	1037764		2200	4288	6488	SO:0001819	synonymous_variant	1265	exon7			CCTGGGCCGGCAG	D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.795C>G	19.37:g.1037764C>G		137.0	0.0	0		108.0	26.0	0.240741	NM_004368	A5D8U8|A6NFI4|D6W5X9|Q92578	Silent	SNP	ENST00000263097.4	37	CCDS12053.1																																																																																			.	.	none		0.652	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3	NM_004368	
ROBO1	6091	hgsc.bcm.edu	37	3	78795978	78795978	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:78795978C>A	ENST00000464233.1	-	5	685	c.572G>T	c.(571-573)tGc>tTc	p.C191F	ROBO1_ENST00000495273.1_Missense_Mutation_p.C152F|ROBO1_ENST00000467549.1_Missense_Mutation_p.C152F|ROBO1_ENST00000436010.2_Missense_Mutation_p.C152F	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	191	Ig-like C2-type 2.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGGAGGTTGGCATTCCATTAC	0.433																																					p.C191F		Atlas-SNP	.											.	ROBO1	833	.	0			c.G572T						PASS	.						124.0	123.0	123.0					3																	78795978		1923	4132	6055	SO:0001583	missense	6091	exon5			GGTTGGCATTCCA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.572G>T	3.37:g.78795978C>A	ENSP00000420321:p.Cys191Phe	97.0	0.0	0		108.0	14.0	0.12963	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664509	0.67700	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	D	0.90038	0.6889	H	0.96175	3.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92395	0.5924	9	.	.	.	.	20.1133	0.97917	0.0:1.0:0.0:0.0	.	191;152;152;152	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	F	152;152;191;152;152;191	ENSP00000406043:C152F;ENSP00000420321:C191F;ENSP00000420637:C152F;ENSP00000417992:C152F	.	C	-	2	0	ROBO1	78878668	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	7.818000	0.86416	2.762000	0.94881	0.591000	0.81541	TGC	.	.	none		0.433	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
PPP2R5A	5525	hgsc.bcm.edu	37	1	212532087	212532087	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:212532087T>G	ENST00000261461.2	+	12	1860	c.1286T>G	c.(1285-1287)cTt>cGt	p.L429R	RP11-384C4.2_ENST00000447949.1_RNA|PPP2R5A_ENST00000537030.3_Missense_Mutation_p.L372R	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	429					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		AATGGCAAGCTTTTCGATGAC	0.343																																					p.L429R		Atlas-SNP	.											.	PPP2R5A	48	.	0			c.T1286G						PASS	.						94.0	89.0	91.0					1																	212532087		2203	4300	6503	SO:0001583	missense	5525	exon12			GCAAGCTTTTCGA	BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.1286T>G	1.37:g.212532087T>G	ENSP00000261461:p.Leu429Arg	269.0	0.0	0		318.0	47.0	0.147799	NM_006243	B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Missense_Mutation	SNP	ENST00000261461.2	37	CCDS1503.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736868	0.89482	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87653	0.6231	H	0.97103	3.94	0.80722	D	1	D;D	0.57257	0.979;0.979	D;D	0.66084	0.941;0.941	D	0.91502	0.5220	9	0.72032	D	0.01	-16.7161	16.6154	0.84909	0.0:0.0:0.0:1.0	.	372;429	B7Z7L2;Q15172	.;2A5A_HUMAN	R	429;429;372	.	ENSP00000261461:L429R	L	+	2	0	PPP2R5A	210598710	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.678000	0.84035	2.315000	0.78130	0.533000	0.62120	CTT	.	.	none		0.343	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089302.1	NM_006243	
CNOT1	23019	hgsc.bcm.edu	37	16	58577327	58577327	+	Intron	SNP	A	A	C	rs556592424		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:58577327A>C	ENST00000317147.5	-	31	4767				CNOT1_ENST00000441024.2_Missense_Mutation_p.F1540V|CNOT1_ENST00000569240.1_Intron|CNOT1_ENST00000245138.4_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		aaaaaaaaaaaacacacagac	0.299													A|||	1	0.000199681	0.0	0.0	5008	,	,		18548	0.0		0.001	False		,,,				2504	0.0				p.F1540V		Atlas-SNP	.											CNOT1_ENST00000441024,caecum,carcinoma,0,1	CNOT1	359	1	0			c.T4618G						scavenged	.						20.0	20.0	20.0					16																	58577327		1013	2122	3135	SO:0001627	intron_variant	23019	exon31			AAAAAAAACACAC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+183T>G	16.37:g.58577327A>C		215.0	2.0	0.00930233		188.0	8.0	0.0425532	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	A	4.645	0.119968	0.08881	.	.	ENSG00000125107	ENST00000441024	T	0.44482	0.92	1.6	-3.2	0.05156	.	.	.	.	.	T	0.28499	0.0705	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12400	-1.0549	8	0.87932	D	0	.	5.872	0.18809	0.2548:0.5872:0.158:0.0	.	1540	A5YKK6-4	.	V	1540	ENSP00000413113:F1540V	ENSP00000413113:F1540V	F	-	1	0	CNOT1	57134828	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.507000	0.22675	-2.105000	0.00842	-1.344000	0.01245	TTT	.	.	none		0.299	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
NHSL1	57224	hgsc.bcm.edu	37	6	138751531	138751531	+	Splice_Site	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:138751531T>C	ENST00000427025.2	-	5	4591	c.3963A>G	c.(3961-3963)gcA>gcG	p.A1321A	NHSL1_ENST00000343505.5_Splice_Site_p.A1317A	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1321										breast(2)|endometrium(4)|kidney(1)	7						CAGACTCACCTGCTCCGTCCT	0.587																																					p.A1321A		Atlas-SNP	.											.	NHSL1	99	.	0			c.A3963G						PASS	.						12.0	14.0	13.0					6																	138751531		692	1591	2283	SO:0001630	splice_region_variant	57224	exon5			CTCACCTGCTCCG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.3964+1A>G	6.37:g.138751531T>C		72.0	0.0	0		89.0	27.0	0.303371	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	ENST00000427025.2	37	CCDS55063.1																																																																																			.	.	none		0.587	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	Silent
INSR	3643	hgsc.bcm.edu	37	19	7174667	7174667	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:7174667C>T	ENST00000302850.5	-	4	1192	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S	INSR_ENST00000341500.5_Silent_p.S350S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	350			S -> L (in RMS and LEPRCH). {ECO:0000269|PubMed:12970295, ECO:0000269|PubMed:8314008}.		activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CAGACGTCACCGAGTCGATGG	0.602																																					p.S350S		Atlas-SNP	.											.	INSR	265	.	0			c.G1050A						PASS	.						109.0	80.0	90.0					19																	7174667		2203	4300	6503	SO:0001819	synonymous_variant	3643	exon4			CGTCACCGAGTCG	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1050G>A	19.37:g.7174667C>T		67.0	0.0	0		75.0	13.0	0.173333	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Silent	SNP	ENST00000302850.5	37	CCDS12176.1																																																																																			.	.	none		0.602	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
CASR	846	hgsc.bcm.edu	37	3	122002948	122002948	+	Missense_Mutation	SNP	G	G	A	rs201670662		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:122002948G>A	ENST00000490131.1	+	7	2519	c.2147G>A	c.(2146-2148)cGc>cAc	p.R716H	CASR_ENST00000296154.5_Missense_Mutation_p.R716H|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.R726H	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	716					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AGCTTCCACCGCAAGTGGTGG	0.567																																					p.R726H		Atlas-SNP	.											.	CASR	190	.	0			c.G2177A						PASS	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	55.0	51.0	52.0		2147,2177	6.0	1.0	3		52	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CASR	NM_000388.3,NM_001178065.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	716/1079,726/1089	122002948	1,13005	2203	4300	6503	SO:0001583	missense	846	exon7			TCCACCGCAAGTG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2147G>A	3.37:g.122002948G>A	ENSP00000418685:p.Arg716His	53.0	0.0	0		29.0	7.0	0.241379	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668983	0.67814	0.0	1.16E-4	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87729	-2.29;-2.29;-2.29	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.93304	0.7866	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.98	D	0.92406	0.5933	10	0.51188	T	0.08	.	19.5674	0.95401	0.0:0.0:1.0:0.0	.	726;716	E7ENE0;P41180	.;CASR_HUMAN	H	716;726;716	ENSP00000418685:R716H;ENSP00000420194:R726H;ENSP00000296154:R716H	ENSP00000296154:R716H	R	+	2	0	CASR	123485638	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.928000	0.87587	2.873000	0.98535	0.561000	0.74099	CGC	.	.	weak		0.567	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
TMEM44	93109	hgsc.bcm.edu	37	3	194338424	194338424	+	Missense_Mutation	SNP	G	G	C	rs58679389|rs386669926	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:194338424G>C	ENST00000392432.2	-	6	899	c.694C>G	c.(694-696)Cgt>Ggt	p.R232G	TMEM44_ENST00000347147.4_Intron|TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	232			R -> H (in dbSNP:rs12695036). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		ctgggagaacgTGAGGGAGAC	0.627													G|||	932	0.186102	0.1399	0.2003	5008	,	,		16153	0.3036		0.0666	False		,,,				2504	0.2403				p.R232G		Atlas-SNP	.											.	TMEM44	42	.	0			c.C694G						PASS	.						62.0	71.0	68.0					3																	194338424		692	1591	2283	SO:0001583	missense	93109	exon6			GAGAACGTGAGGG	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.694C>G	3.37:g.194338424G>C	ENSP00000376227:p.Arg232Gly	0.0	0.0	.		4.0	4.0	1	NM_001166305	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	304	0.1391941391941392	64	0.13008130081300814	59	0.16298342541436464	148	0.25874125874125875	33	0.04353562005277045	G	3.222	-0.159324	0.06544	.	.	ENSG00000145014	ENST00000392432	T	0.23552	1.9	2.03	-2.52	0.06346	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.45101	-0.9284	6	0.30078	T	0.28	.	6.5849	0.22614	0.6181:0.0:0.3819:0.0	rs58679389	.	.	.	G	232	ENSP00000376227:R232G	ENSP00000376227:R232G	R	-	1	0	TMEM44	195819713	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.396000	0.01052	-0.762000	0.04664	-0.464000	0.05259	CGT	C|0.130;G|0.870	0.130	strong		0.627	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
TRPM2	7226	hgsc.bcm.edu	37	21	45825049	45825049	+	Missense_Mutation	SNP	G	G	A	rs144022462		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr21:45825049G>A	ENST00000397928.1	+	17	3008	c.2563G>A	c.(2563-2565)Ggg>Agg	p.G855R	TRPM2_ENST00000300482.5_Missense_Mutation_p.G855R|TRPM2_ENST00000397932.2_Missense_Mutation_p.G855R|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Missense_Mutation_p.G835R	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	855					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TGACGAGTGCGGGCTGATGAA	0.537																																					p.G855R		Atlas-SNP	.											.	TRPM2	196	.	0			c.G2563A						PASS	.						200.0	156.0	171.0					21																	45825049		2202	4299	6501	SO:0001583	missense	7226	exon17			GAGTGCGGGCTGA	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2563G>A	21.37:g.45825049G>A	ENSP00000381023:p.Gly855Arg	62.0	0.0	0		55.0	12.0	0.218182	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	g	13.30	2.195886	0.38806	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	4.55	1.57	0.23409	Ion transport (1);	0.225132	0.36740	N	0.002438	T	0.52901	0.1763	M	0.70903	2.155	0.34092	D	0.660838	P;P;P	0.47106	0.731;0.89;0.604	B;B;B	0.39562	0.235;0.303;0.235	T	0.59182	-0.7502	10	0.33141	T	0.24	-18.79	6.0001	0.19515	0.0754:0.1359:0.6479:0.1408	.	855;641;855	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	R	855;855;835;855	ENSP00000300482:G855R;ENSP00000381023:G855R;ENSP00000300481:G835R;ENSP00000381026:G855R	ENSP00000300481:G835R	G	+	1	0	TRPM2	44649477	1.000000	0.71417	0.005000	0.12908	0.850000	0.48378	4.013000	0.57138	0.096000	0.17463	0.465000	0.42564	GGG	G|1.000;T|0.000	.	alt		0.537	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
BPTF	2186	hgsc.bcm.edu	37	17	65955758	65955758	+	Silent	SNP	T	T	C	rs139709271|rs202116659		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:65955758T>C	ENST00000321892.4	+	26	8467	c.8406T>C	c.(8404-8406)gcT>gcC	p.A2802A	BPTF_ENST00000424123.3_Silent_p.A2520A|BPTF_ENST00000306378.6_Silent_p.A2676A|BPTF_ENST00000335221.5_Silent_p.A2659A			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2802	Pro-rich.			AP -> VL (in Ref. 1; BAA89208). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A2676A(1)|p.A2659A(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGACAccagctcctccagccc	0.582																																					p.A2676A		Atlas-SNP	.											BPTF_ENST00000335221,rectum,carcinoma,0,2	BPTF	415	2	2	Substitution - coding silent(2)	large_intestine(2)	c.T8028C						scavenged	.						40.0	33.0	36.0					17																	65955758		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon24			ACCAGCTCCTCCA	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8406T>C	17.37:g.65955758T>C		92.0	2.0	0.0217391		108.0	18.0	0.166667	NM_182641	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.	.	weak		0.582	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
LRFN5	145581	hgsc.bcm.edu	37	14	42356300	42356300	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr14:42356300A>C	ENST00000298119.4	+	3	1661	c.472A>C	c.(472-474)Aat>Cat	p.N158H	LRFN5_ENST00000554120.1_Missense_Mutation_p.N158H|LRFN5_ENST00000554171.1_Missense_Mutation_p.N158H	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	158						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GTCCTATAATAATCTAGAAAC	0.398										HNSCC(30;0.082)																											p.N158H		Atlas-SNP	.											LRFN5,NS,carcinoma,0,1	LRFN5	269	1	0			c.A472C						scavenged	.						83.0	72.0	76.0					14																	42356300		2203	4300	6503	SO:0001583	missense	145581	exon3			TATAATAATCTAG	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.472A>C	14.37:g.42356300A>C	ENSP00000298119:p.Asn158His	67.0	1.0	0.0149254		55.0	15.0	0.272727	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288566	0.59976	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.92249	-3.0;-3.0;-3.0	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000010	D	0.92251	0.7542	N	0.17800	0.525	0.58432	D	0.999995	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.993	D	0.92871	0.6314	10	0.51188	T	0.08	.	13.6661	0.62396	1.0:0.0:0.0:0.0	.	158;158	G3V364;Q96NI6	.;LRFN5_HUMAN	H	158	ENSP00000298119:N158H;ENSP00000451897:N158H;ENSP00000451067:N158H	ENSP00000298119:N158H	N	+	1	0	LRFN5	41426050	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.098000	0.63641	0.528000	0.53228	AAT	.	.	none		0.398	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
TTN	7273	hgsc.bcm.edu	37	2	179605902	179605902	+	Missense_Mutation	SNP	A	A	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:179605902A>T	ENST00000591111.1	-	46	11331	c.11107T>A	c.(11107-11109)Tcc>Acc	p.S3703T	TTN_ENST00000342175.6_Missense_Mutation_p.S3849T|TTN_ENST00000589042.1_Missense_Mutation_p.S4020T|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S3782T|TTN_ENST00000460472.2_Missense_Mutation_p.S3657T|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin	14005	Ig-like 22.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACAGGTGGACTCACCCAAC	0.488																																					p.S4020T		Atlas-SNP	.											.	TTN	18412	.	0			c.T12058A						PASS	.						79.0	80.0	80.0					2																	179605902		1920	4138	6058	SO:0001583	missense	7273	exon48			AGGTGGACTCACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11107T>A	2.37:g.179605902A>T	ENSP00000465570:p.Ser3703Thr	25.0	0.0	0		29.0	11.0	0.37931	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	9.788	1.177085	0.21787	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.67345	-0.26;-0.26;-0.26	5.87	2.01	0.26516	.	.	.	.	.	T	0.51635	0.1686	N	0.21373	0.66	0.20638	N	0.99987	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.002;0.003	T	0.46247	-0.9205	9	0.87932	D	0	.	10.1952	0.43049	0.3712:0.524:0.0:0.1048	.	3657;3782;3849	D3DPF9;E7EQE6;E7ET18	.;.;.	T	3657;3849;3782;3657	ENSP00000434586:S3657T;ENSP00000340554:S3849T;ENSP00000352154:S3782T	ENSP00000340554:S3849T	S	-	1	0	TTN	179314147	1.000000	0.71417	0.717000	0.30585	0.415000	0.31203	1.705000	0.37867	0.157000	0.19338	-0.313000	0.08912	TCC	.	.	none		0.488	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	hgsc.bcm.edu	37	2	216257886	216257886	+	Intron	SNP	G	G	T	rs61732520	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:216257886G>T	ENST00000359671.1	-	25	4062				FN1_ENST00000356005.4_Intron|FN1_ENST00000346544.3_Intron|FN1_ENST00000443816.1_Intron|FN1_ENST00000354785.4_Silent_p.T1279T|FN1_ENST00000357009.2_Intron|FN1_ENST00000432072.2_Silent_p.T1279T|FN1_ENST00000323926.6_Silent_p.T1279T|FN1_ENST00000421182.1_Intron|FN1_ENST00000446046.1_Intron|FN1_ENST00000336916.4_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000357867.4_Intron			P02751	FINC_HUMAN	fibronectin 1						acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TGCTTGAATCGGTTATATCAA	0.473																																					p.T1279T		Atlas-SNP	.											.	FN1	521	.	0			c.C3837A						PASS	.						79.0	78.0	78.0					2																	216257886		1867	4095	5962	SO:0001627	intron_variant	2335	exon25			TGAATCGGTTATA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3797-1349C>A	2.37:g.216257886G>T		88.0	0.0	0		100.0	4.0	0.04	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																				G|0.994;A|0.006	.	alt		0.473	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
OR2L3	391192	hgsc.bcm.edu	37	1	248224739	248224739	+	Silent	SNP	A	A	G	rs113420317	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:248224739A>G	ENST00000359959.3	+	1	756	c.756A>G	c.(754-756)gcA>gcG	p.A252A	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TCTACTATGCACCTTTTGTCT	0.498													a|||	40	0.00798722	0.0287	0.0029	5008	,	,		20949	0.0		0.0	False		,,,				2504	0.0				p.A252A		Atlas-SNP	.											OR2L3,NS,carcinoma,0,2	OR2L3	97	2	0			c.A756G						scavenged	.	A	,	90,4316	73.1+/-111.1	2,86,2115	131.0	124.0	126.0		756,	-4.0	0.0	1	dbSNP_132	126	20,8576	3.0+/-9.4	0,20,4278	no	coding-synonymous,intron	OR2L13,OR2L3	NM_001004687.1,NM_175911.2	,	2,106,6393	GG,GA,AA		0.2327,2.0427,0.846	,	252/313,	248224739	110,12892	2203	4298	6501	SO:0001819	synonymous_variant	391192	exon1			CTATGCACCTTTT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.756A>G	1.37:g.248224739A>G		115.0	1.0	0.00869565		60.0	4.0	0.0666667	NM_001004687	B9EH44	Silent	SNP	ENST00000359959.3	37	CCDS31104.1																																																																																			.	.	weak		0.498	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
LRCOL1	100507055	hgsc.bcm.edu	37	12	133181399	133181399	+	lincRNA	SNP	T	T	C	rs11146963	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:133181399T>C	ENST00000545517.1	-	0	323							A6NCL2	LRCL1_HUMAN	leucine rich colipase-like 1						digestion (GO:0007586)|lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	enzyme activator activity (GO:0008047)										TCGTGTCTCCTGCATGGCTCC	0.622													C|||	3614	0.721645	0.885	0.7594	5008	,	,		19537	0.7808		0.5497	False		,,,				2504	0.59				p.R42G		Atlas-SNP	.											.	.	.	.	0			c.A124G						PASS	.																																					100507055	exon3			GTCTCCTGCATGG		CCDS73547.1	12q24.33	2012-07-02			ENSG00000204583	ENSG00000204583			44160	protein-coding gene	gene with protein product							Standard	NM_001195520		Approved		uc021rgr.1	A6NCL2	OTTHUMG00000168043		12.37:g.133181399T>C		0.0	0.0	.		4.0	4.0	1	NM_001195520	H9BFB1	Missense_Mutation	SNP	ENST00000545517.1	37																																																																																				T|0.274;C|0.726	0.726	strong		0.622	LRCOL1-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000397683.1	NM_001195520	
PLD1	5337	hgsc.bcm.edu	37	3	171455820	171455820	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:171455820G>A	ENST00000351298.4	-	2	148	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	PLD1_ENST00000356327.5_Missense_Mutation_p.R8W|PLD1_ENST00000342215.6_Missense_Mutation_p.R8W|PLD1_ENST00000340989.4_Missense_Mutation_p.R8W	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	8					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.R8W(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GTATTTACCCGTGGCTCGTTT	0.418																																					p.R8W	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											PLD1,NS,carcinoma,0,2	PLD1	134	2	1	Substitution - Missense(1)	endometrium(1)	c.C22T						scavenged	.						80.0	75.0	77.0					3																	171455820		2203	4300	6503	SO:0001583	missense	5337	exon2			TTACCCGTGGCTC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.22C>T	3.37:g.171455820G>A	ENSP00000342793:p.Arg8Trp	130.0	1.0	0.00769231		172.0	27.0	0.156977	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772291	0.31411	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989;ENST00000418087	T;T;T;T;T	0.46063	3.34;3.35;1.44;3.21;0.88	5.51	-5.02	0.02982	.	0.379407	0.22897	N	0.054316	T	0.29126	0.0724	L	0.29908	0.895	0.09310	N	1	D;D	0.69078	0.997;0.994	B;B	0.43783	0.409;0.431	T	0.48234	-0.9053	10	0.72032	D	0.01	-6.2871	14.8852	0.70564	0.0768:0.0:0.6076:0.3156	.	31;8	Q59EA4;Q13393	.;PLD1_HUMAN	W	8	ENSP00000348681:R8W;ENSP00000342793:R8W;ENSP00000339936:R8W;ENSP00000340326:R8W;ENSP00000400639:R8W	ENSP00000340326:R8W	R	-	1	2	PLD1	172938514	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.421000	0.07053	-0.550000	0.06183	-0.262000	0.10625	CGG	.	.	none		0.418	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
MAGEF1	64110	hgsc.bcm.edu	37	3	184429559	184429559	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:184429559C>T	ENST00000317897.3	-	1	277	c.51G>A	c.(49-51)ggG>ggA	p.G17G		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	17						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			CATCCTTCTCCCCCTCGGCCT	0.721																																					p.G17G		Atlas-SNP	.											.	MAGEF1	27	.	0			c.G51A						PASS	.						8.0	10.0	9.0					3																	184429559		2097	4121	6218	SO:0001819	synonymous_variant	64110	exon1			CTTCTCCCCCTCG	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.51G>A	3.37:g.184429559C>T		103.0	0.0	0		111.0	17.0	0.153153	NM_022149	Q9H215	Silent	SNP	ENST00000317897.3	37	CCDS3269.1																																																																																			.	.	none		0.721	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
CRYGN	155051	hgsc.bcm.edu	37	7	151135158	151135158	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr7:151135158T>G	ENST00000337323.2	-	2	320	c.194A>C	c.(193-195)gAg>gCg	p.E65A	CRYGN_ENST00000491928.1_Missense_Mutation_p.E65A|RP4-555L14.4_ENST00000465549.1_RNA|CRYGN_ENST00000476631.1_5'UTR	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N	65	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.									central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTCGCCGTGCTCCAAGATGAA	0.617																																					p.E65A		Atlas-SNP	.											.	CRYGN	15	.	0			c.A194C						PASS	.						62.0	61.0	61.0					7																	151135158		2203	4300	6503	SO:0001583	missense	155051	exon2			CCGTGCTCCAAGA	AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.194A>C	7.37:g.151135158T>G	ENSP00000338613:p.Glu65Ala	45.0	0.0	0		58.0	11.0	0.189655	NM_144727	Q496G6	Missense_Mutation	SNP	ENST00000337323.2	37	CCDS5926.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.655167	0.88056	.	.	ENSG00000127377	ENST00000337323	T	0.78364	-1.17	5.05	5.05	0.67936	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.90810	0.7114	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.92787	0.6245	10	0.56958	D	0.05	.	13.9762	0.64275	0.0:0.0:0.0:1.0	.	65;65	Q8WXF5-2;Q8WXF5	.;CRGN_HUMAN	A	65	ENSP00000338613:E65A	ENSP00000338613:E65A	E	-	2	0	CRYGN	150766091	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.602000	0.82796	1.894000	0.54839	0.379000	0.24179	GAG	.	.	none		0.617	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348553.1		
MT-ND6	4541	hgsc.bcm.edu	37	M	14364	14364	+	Silent	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chrM:14364G>A	ENST00000361681.2	-	1	309	c.310C>T	c.(310-312)Ctg>Ttg	p.L104L	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	104					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TTTCACCCACAGCACCAATCC	0.493																																					p.L104L		Atlas-SNP	.											.	.	.	.	0			c.C310T						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CCCACAGCACCAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.310C>T	M.37:g.14364G>A		0.0	0.0	.		7.0	7.0	1	ENST00000361681	Q34774|Q8HG30	Silent	SNP	ENST00000361681.2	37																																																																																				.	.	none		0.493	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
KLHL6	89857	hgsc.bcm.edu	37	3	183212058	183212058	+	Missense_Mutation	SNP	T	T	C	rs372112529		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:183212058T>C	ENST00000341319.3	-	5	1194	c.1159A>G	c.(1159-1161)Aca>Gca	p.T387A		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	387					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TCATGCTGTGTTTCTTTGCCA	0.408																																					p.T387A		Atlas-SNP	.											.	KLHL6	100	.	0			c.A1159G						PASS	.						106.0	106.0	106.0					3																	183212058		2203	4300	6503	SO:0001583	missense	89857	exon5			GCTGTGTTTCTTT	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1159A>G	3.37:g.183212058T>C	ENSP00000341342:p.Thr387Ala	69.0	0.0	0		78.0	19.0	0.24359	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	T	18.48	3.633258	0.67015	.	.	ENSG00000172578	ENST00000341319	T	0.65549	-0.16	5.96	5.96	0.96718	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.65186	0.2667	M	0.64997	1.995	0.58432	D	0.999997	P	0.51449	0.945	P	0.44732	0.459	T	0.69558	-0.5113	10	0.59425	D	0.04	.	16.4338	0.83864	0.0:0.0:0.0:1.0	.	387	Q8WZ60	KLHL6_HUMAN	A	387	ENSP00000341342:T387A	ENSP00000341342:T387A	T	-	1	0	KLHL6	184694752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.270000	0.75569	0.533000	0.62120	ACA	.	.	alt		0.408	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
COL24A1	255631	hgsc.bcm.edu	37	1	86249233	86249233	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:86249233T>G	ENST00000370571.2	-	51	4596	c.4230A>C	c.(4228-4230)gaA>gaC	p.E1410D	COL24A1_ENST00000436319.1_Missense_Mutation_p.E1410D	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1410	Collagen-like 16.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.E1410D(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CAGCATCCCCTTCAGGACCCT	0.353																																					p.E1410D		Atlas-SNP	.											COL24A1,colon,carcinoma,0,1	COL24A1	202	1	1	Substitution - Missense(1)	large_intestine(1)	c.A4230C						PASS	.						122.0	115.0	117.0					1																	86249233		1840	4085	5925	SO:0001583	missense	255631	exon51			ATCCCCTTCAGGA	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.4230A>C	1.37:g.86249233T>G	ENSP00000359603:p.Glu1410Asp	123.0	0.0	0		156.0	35.0	0.224359	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872250	0.33069	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.93307	-3.2;-3.1	5.48	-3.93	0.04143	.	0.000000	0.39083	N	0.001464	T	0.65943	0.2740	N	0.11201	0.11	0.26770	N	0.969815	P;P	0.34977	0.478;0.458	B;B	0.38880	0.148;0.284	T	0.73672	-0.3909	10	0.13853	T	0.58	.	3.6705	0.08272	0.5974:0.1259:0.0997:0.177	.	1410;1410	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	D	1410	ENSP00000359603:E1410D;ENSP00000392531:E1410D	ENSP00000359603:E1410D	E	-	3	2	COL24A1	86021821	0.021000	0.18746	0.961000	0.40146	0.883000	0.51084	-1.096000	0.03353	-0.281000	0.09141	-0.242000	0.12053	GAA	.	.	none		0.353	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
FCRL3	115352	hgsc.bcm.edu	37	1	157670256	157670256	+	Silent	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:157670256C>T	ENST00000368184.3	-	2	315	c.24G>A	c.(22-24)ctG>ctA	p.L8L	FCRL3_ENST00000473231.1_5'Flank|FCRL3_ENST00000368186.5_Silent_p.L8L	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CACTCAGGATCAGCAGCAGCA	0.547																																					p.L8L		Atlas-SNP	.											.	FCRL3	163	.	0			c.G24A						PASS	.						47.0	49.0	49.0					1																	157670256		2203	4300	6503	SO:0001819	synonymous_variant	115352	exon2			CAGGATCAGCAGC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.24G>A	1.37:g.157670256C>T		127.0	0.0	0		160.0	39.0	0.24375	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																			.	.	none		0.547	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
CNTRL	11064	hgsc.bcm.edu	37	9	123937296	123937296	+	Splice_Site	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr9:123937296G>A	ENST00000373855.1	+	43	7008	c.6748G>A	c.(6748-6750)Gcc>Acc	p.A2250T	CNTRL_ENST00000238341.5_Splice_Site_p.A2250T|CNTRL_ENST00000373850.1_Splice_Site_p.A1698T|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	2250	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CACTTTTCAGGCCCAACTCCG	0.438																																					p.A2250T		Atlas-SNP	.											.	CNTRL	161	.	0			c.G6748A						PASS	.						115.0	122.0	120.0					9																	123937296		2203	4300	6503	SO:0001630	splice_region_variant	11064	exon41			TTTCAGGCCCAAC	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6748-1G>A	9.37:g.123937296G>A		77.0	0.0	0		81.0	21.0	0.259259	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	33	5.277169	0.95459	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.35421	1.48;1.48;1.31	5.59	5.59	0.84812	.	.	.	.	.	T	0.59169	0.2174	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.55108	-0.8192	8	.	.	.	.	18.5881	0.91197	0.0:0.0:1.0:0.0	.	2250	Q7Z7A1	CNTRL_HUMAN	T	2250;2250;2250;407;1698;932	ENSP00000362962:A2250T;ENSP00000238341:A2250T;ENSP00000362956:A1698T	.	A	+	1	0	CNTRL	122977117	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.810000	0.86072	2.629000	0.89072	0.555000	0.69702	GCC	.	.	none		0.438	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	Missense_Mutation
ATXN1	6310	hgsc.bcm.edu	37	6	16327891	16327891	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:16327891C>A	ENST00000244769.4	-	8	1587	c.651G>T	c.(649-651)caG>caT	p.Q217H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q217H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	217	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q217H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgctgct	0.657																																					p.Q217H		Atlas-SNP	.											ATXN1,NS,carcinoma,0,1	ATXN1	117	1	1	Substitution - Missense(1)	lung(1)	c.G651T						PASS	.																																			SO:0001583	missense	6310	exon7			CTGCTGCTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.651G>T	6.37:g.16327891C>A	ENSP00000244769:p.Gln217His	27.0	0.0	0		40.0	9.0	0.225	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	-	6.133	0.392825	0.11638	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.63913	-0.07;-0.07	0.753	-0.262	0.12958	.	.	.	.	.	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.28713	0.22	B	0.17979	0.02	T	0.12344	-1.0551	9	0.54805	T	0.06	.	3.1001	0.06323	0.0:0.6446:0.0:0.3554	.	217	P54253	ATX1_HUMAN	H	217	ENSP00000244769:Q217H;ENSP00000416360:Q217H	ENSP00000244769:Q217H	Q	-	3	2	ATXN1	16435870	0.069000	0.21087	0.004000	0.12327	0.137000	0.21094	0.232000	0.17891	-0.113000	0.11958	0.121000	0.15741	CAG	.	.	none		0.657	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E		Atlas-SNP	.											PRKCSH,caecum,carcinoma,0,1	PRKCSH	55	1	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A						PASS	.						27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A		60.0	0.0	0		71.0	5.0	0.0704225	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.	.	weak		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
JUNB	3726	hgsc.bcm.edu	37	19	12902785	12902785	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr19:12902785G>A	ENST00000302754.4	+	1	476	c.200G>A	c.(199-201)aGc>aAc	p.S67N		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	67					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						GGTGGCGGCAGCTACTTTTCT	0.672																																					p.S67N		Atlas-SNP	.											.	JUNB	14	.	0			c.G200A						PASS	.						12.0	13.0	13.0					19																	12902785		2200	4293	6493	SO:0001583	missense	3726	exon1			GCGGCAGCTACTT	M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.200G>A	19.37:g.12902785G>A	ENSP00000303315:p.Ser67Asn	88.0	0.0	0		69.0	20.0	0.289855	NM_002229	Q96GH3	Missense_Mutation	SNP	ENST00000302754.4	37	CCDS12280.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050854	0.36181	.	.	ENSG00000171223	ENST00000302754	T	0.29655	1.56	4.25	3.1	0.35709	Jun-like transcription factor (1);	.	.	.	.	T	0.20373	0.0490	N	0.25485	0.75	0.33704	D	0.614893	B	0.28820	0.224	B	0.26094	0.066	T	0.17107	-1.0380	9	0.17369	T	0.5	-16.9799	13.1068	0.59252	0.0:0.1633:0.8367:0.0	.	67	P17275	JUNB_HUMAN	N	67	ENSP00000303315:S67N	ENSP00000303315:S67N	S	+	2	0	JUNB	12763785	0.995000	0.38212	1.000000	0.80357	0.967000	0.64934	2.201000	0.42734	2.300000	0.77407	0.549000	0.68633	AGC	.	.	none		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451015.1	NM_002229	
VWF	7450	hgsc.bcm.edu	37	12	6085324	6085324	+	Missense_Mutation	SNP	G	G	A	rs61751286		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:6085324G>A	ENST00000261405.5	-	43	7644	c.7390C>T	c.(7390-7392)Cgc>Tgc	p.R2464C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2464	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGGGCCACGCGGAGGCCCATC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17555	0.0		0.001	False		,,,				2504	0.0				p.R2464C		Atlas-SNP	.											VWF,NS,lymphoid_neoplasm,+1,1	VWF	338	1	0			c.C7390T	GRCh37	CM070317	VWF	M	rs61751286	scavenged	.						70.0	63.0	65.0					12																	6085324		2203	4300	6503	SO:0001583	missense	7450	exon43			CCACGCGGAGGCC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7390C>T	12.37:g.6085324G>A	ENSP00000261405:p.Arg2464Cys	99.0	1.0	0.010101		68.0	16.0	0.235294	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.3	4.268417	0.80469	.	.	ENSG00000110799	ENST00000261405	T	0.65916	-0.18	5.19	5.19	0.71726	von Willebrand factor, type C (4);	0.185059	0.26631	N	0.023302	T	0.71779	0.3380	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	P	0.60609	0.877	T	0.73563	-0.3943	10	0.56958	D	0.05	.	15.8551	0.78972	0.0:0.0:1.0:0.0	rs61751286	2464	P04275	VWF_HUMAN	C	2464	ENSP00000261405:R2464C	ENSP00000261405:R2464C	R	-	1	0	VWF	5955585	1.000000	0.71417	0.987000	0.45799	0.734000	0.41952	5.369000	0.66138	2.412000	0.81896	0.591000	0.81541	CGC	G|1.000;A|0.000	0.000	strong		0.642	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
EP300	2033	hgsc.bcm.edu	37	22	41572795	41572795	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr22:41572795A>G	ENST00000263253.7	+	31	6299	c.5080A>G	c.(5080-5082)Acc>Gcc	p.T1694A	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1694	Binding region for E1A adenovirus.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTTGTGTATCACCTGCTATAA	0.423			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.T1694A		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.A5080G						PASS	.						131.0	125.0	127.0					22																	41572795		2203	4300	6503	SO:0001583	missense	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	TGTATCACCTGCT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.5080A>G	22.37:g.41572795A>G	ENSP00000263253:p.Thr1694Ala	69.0	0.0	0		93.0	25.0	0.268817	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319613	0.41096	.	.	ENSG00000100393	ENST00000263253	D	0.91124	-2.79	5.45	5.45	0.79879	Zinc finger, ZZ-type (4);	0.000000	0.49916	D	0.000129	T	0.80727	0.4678	N	0.04655	-0.195	0.43032	D	0.994605	P	0.36616	0.561	B	0.40285	0.325	T	0.80016	-0.1559	10	0.08381	T	0.77	-9.5504	15.8114	0.78568	1.0:0.0:0.0:0.0	.	1694	Q09472	EP300_HUMAN	A	1694	ENSP00000263253:T1694A	ENSP00000263253:T1694A	T	+	1	0	EP300	39902741	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.576000	0.82467	2.191000	0.70037	0.528000	0.53228	ACC	.	.	none		0.423	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
TMEM44	93109	hgsc.bcm.edu	37	3	194338423	194338423	+	Missense_Mutation	SNP	C	C	T	rs12695036|rs386669926	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:194338423C>T	ENST00000392432.2	-	6	900	c.695G>A	c.(694-696)cGt>cAt	p.R232H	TMEM44_ENST00000347147.4_Intron|TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44	232			R -> H (in dbSNP:rs12695036). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		gctgggagaacgTGAGGGAGA	0.622													C|||	2410	0.48123	0.3517	0.5331	5008	,	,		16125	0.75		0.2942	False		,,,				2504	0.5348				p.R232H		Atlas-SNP	.											.	TMEM44	42	.	0			c.G695A						PASS	.	C	,HIS/ARG,,	361,1023		75,211,406	60.0	69.0	66.0		,695,,	-2.8	0.0	3	dbSNP_121	66	912,2270		173,566,852	yes	intron,missense,intron,intron	TMEM44	NM_001011655.2,NM_001166305.1,NM_001166306.1,NM_138399.4	,29,,	248,777,1258	TT,TC,CC		28.6612,26.0838,27.88	,,,	,232/476,,	194338423	1273,3293	692	1591	2283	SO:0001583	missense	93109	exon6			GGAGAACGTGAGG	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.695G>A	3.37:g.194338423C>T	ENSP00000376227:p.Arg232His	0.0	0.0	.		4.0	4.0	1	NM_001166305	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	ENST00000392432.2	37	CCDS54699.1	1016	0.4652014652014652	176	0.35772357723577236	195	0.5386740331491713	431	0.7534965034965035	214	0.28232189973614774	C	6.123	0.390972	0.11581	0.260838	0.286612	ENSG00000145014	ENST00000392432	T	0.23950	1.88	2.03	-2.85	0.05734	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.32428	-0.9907	6	0.23302	T	0.38	.	0.4159	0.00448	0.1788:0.2613:0.2601:0.2998	rs12695036;rs59789853;rs12695036	.	.	.	H	232	ENSP00000376227:R232H	ENSP00000376227:R232H	R	-	2	0	TMEM44	195819712	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.678000	0.01942	-0.836000	0.04229	-1.270000	0.01421	CGT	C|0.567;T|0.433	0.433	strong		0.622	TMEM44-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342750.1	NM_138399	
PAPPA2	60676	hgsc.bcm.edu	37	1	176671860	176671860	+	Silent	SNP	G	G	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:176671860G>C	ENST00000367662.3	+	9	4518	c.3354G>C	c.(3352-3354)ggG>ggC	p.G1118G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1118					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTGGAGATGGGAAGGTGTCAG	0.502																																					p.G1118G		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G3354C						PASS	.						85.0	81.0	82.0					1																	176671860		1978	4164	6142	SO:0001819	synonymous_variant	60676	exon9			AGATGGGAAGGTG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3354G>C	1.37:g.176671860G>C		33.0	0.0	0		30.0	4.0	0.133333	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																			.	.	none		0.502	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
NFKBIE	4794	hgsc.bcm.edu	37	6	44227895	44227895	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:44227895A>G	ENST00000275015.5	-	5	1321	c.1322T>C	c.(1321-1323)cTg>cCg	p.L441P	SLC35B2_ENST00000495706.1_5'Flank|SLC35B2_ENST00000393812.3_5'Flank|SLC35B2_ENST00000537814.1_5'Flank|SLC35B2_ENST00000538577.1_5'Flank|SLC35B2_ENST00000393810.1_5'Flank	NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	441					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGCCAGGTGCAGGGGTGTGCA	0.647																																					p.L441P		Atlas-SNP	.											.	NFKBIE	31	.	0			c.T1322C						PASS	.						49.0	51.0	50.0					6																	44227895		2203	4300	6503	SO:0001583	missense	4794	exon5			AGGTGCAGGGGTG	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.1322T>C	6.37:g.44227895A>G	ENSP00000275015:p.Leu441Pro	42.0	0.0	0		45.0	17.0	0.377778	NM_004556	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421610	0.83559	.	.	ENSG00000146232	ENST00000275015;ENST00000443607	D	0.82255	-1.59	5.05	5.05	0.67936	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000007	D	0.94238	0.8150	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96517	0.9383	10	0.87932	D	0	-42.6353	14.814	0.70017	1.0:0.0:0.0:0.0	.	441	O00221	IKBE_HUMAN	P	441;42	ENSP00000275015:L441P	ENSP00000275015:L441P	L	-	2	0	NFKBIE	44335873	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.297000	0.96120	1.895000	0.54865	0.533000	0.62120	CTG	.	.	none		0.647	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
PTPRK	5796	hgsc.bcm.edu	37	6	128505735	128505735	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:128505735C>T	ENST00000368215.3	-	7	1003	c.1004G>A	c.(1003-1005)gGa>gAa	p.G335E	PTPRK_ENST00000368207.3_Missense_Mutation_p.G335E|PTPRK_ENST00000368210.3_Missense_Mutation_p.G335E|PTPRK_ENST00000368226.4_Missense_Mutation_p.G335E|PTPRK_ENST00000368227.3_Missense_Mutation_p.G335E|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000532331.1_Missense_Mutation_p.G335E|PTPRK_ENST00000368213.5_Missense_Mutation_p.G335E			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	335	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TGTCCAGGATCCTGATGTCAT	0.433																																					p.G335E		Atlas-SNP	.											PTPRK_ENST00000368213,mucosal,malignant_melanoma,-1,2	PTPRK	330	2	0			c.G1004A						PASS	.						219.0	202.0	208.0					6																	128505735		2203	4300	6503	SO:0001583	missense	5796	exon7			CAGGATCCTGATG	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1004G>A	6.37:g.128505735C>T	ENSP00000357198:p.Gly335Glu	137.0	0.0	0		127.0	10.0	0.0787402	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.174795|5.174795	0.94807|0.94807	.|.	.|.	ENSG00000152894|ENSG00000152894	ENST00000490332|ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	.|T;T;T;T;T;T;T	.|0.80480	.|-1.38;-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85031|0.85031	0.5604|0.5604	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.995;0.993;0.988;1.0;1.0	.|D;D;P;P;D;D	.|0.91635	.|0.999;0.932;0.888;0.838;0.999;0.998	T|T	0.82764|0.82764	-0.0296|-0.0296	5|10	.|0.36615	.|T	.|0.2	.|.	19.3758|19.3758	0.94508|0.94508	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|335;335;335;192;335;335	.|B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.|.;.;.;.;PTPRK_HUMAN;.	N|E	152|335;335;335;335;335;335;335;192	.|ENSP00000357209:G335E;ENSP00000357210:G335E;ENSP00000432973:G335E;ENSP00000357196:G335E;ENSP00000357193:G335E;ENSP00000357198:G335E;ENSP00000357190:G335E	.|ENSP00000357190:G335E	D|G	-|-	1|2	0|0	PTPRK|PTPRK	128547428|128547428	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.944000|0.944000	0.59088|0.59088	7.818000|7.818000	0.86416|0.86416	2.577000|2.577000	0.86979|0.86979	0.655000|0.655000	0.94253|0.94253	GAT|GGA	.	.	none		0.433	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
ANKRD11	29123	hgsc.bcm.edu	37	16	89347228	89347228	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:89347228G>A	ENST00000301030.4	-	9	6182	c.5722C>T	c.(5722-5724)Ccc>Tcc	p.P1908S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.P1908S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1908	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGGTCCGGGGGAAGGGCCCCT	0.662																																					p.P1908S		Atlas-SNP	.											.	ANKRD11	195	.	0			c.C5722T						PASS	.						30.0	36.0	34.0					16																	89347228		2196	4296	6492	SO:0001583	missense	29123	exon9			CCGGGGGAAGGGC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5722C>T	16.37:g.89347228G>A	ENSP00000301030:p.Pro1908Ser	62.0	0.0	0		82.0	24.0	0.292683	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	g	16.17	3.048706	0.55110	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.43688	0.94;0.94	4.78	2.7	0.31948	.	0.169886	0.38111	N	0.001806	T	0.32224	0.0822	L	0.36672	1.1	0.80722	D	1	P	0.50066	0.931	B	0.41374	0.355	T	0.02743	-1.1116	10	0.24483	T	0.36	.	14.1122	0.65129	0.0:0.288:0.7119:0.0	.	1908	Q6UB99	ANR11_HUMAN	S	1908	ENSP00000301030:P1908S;ENSP00000367581:P1908S	ENSP00000301030:P1908S	P	-	1	0	ANKRD11	87874729	1.000000	0.71417	0.926000	0.36857	0.821000	0.46438	5.071000	0.64382	0.377000	0.24735	0.450000	0.29827	CCC	.	.	none		0.662	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
HIST1H2BG	8339	hgsc.bcm.edu	37	6	26216827	26216827	+	Silent	SNP	G	G	A	rs143774290		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr6:26216827G>A	ENST00000244601.3	-	1	45	c.45C>T	c.(43-45)tcC>tcT	p.S15S	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	15					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				CAGCCTTCTTGGAACCCTTCT	0.493																																					p.S15S		Atlas-SNP	.											.	HIST1H2BG	25	.	0			c.C45T						PASS	.	G		0,4406		0,0,2203	138.0	125.0	129.0		45	2.2	1.0	6	dbSNP_134	129	2,8598		0,2,4298	no	coding-synonymous	HIST1H2BG	NM_003518.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		15/127	26216827	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8339	exon1			CTTCTTGGAACCC	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.45C>T	6.37:g.26216827G>A		96.0	0.0	0		74.0	16.0	0.216216	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000244601.3	37	CCDS4594.1																																																																																			G|1.000;A|0.000	0.000	weak		0.493	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
BIRC7	79444	hgsc.bcm.edu	37	20	61870941	61870941	+	Missense_Mutation	SNP	G	G	A	rs142521563		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr20:61870941G>A	ENST00000217169.3	+	6	1095	c.881G>A	c.(880-882)cGc>cAc	p.R294H	NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000342412.6_Missense_Mutation_p.R276H|BIRC7_ENST00000395306.1_Missense_Mutation_p.R189H|MIR3196_ENST00000579556.1_RNA	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	294					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					AGCCGCGTGCGCACCTTCCTG	0.721																																					p.R294H		Atlas-SNP	.											BIRC7,colon,carcinoma,0,1	BIRC7	25	1	0			c.G881A						PASS	.	G	HIS/ARG,HIS/ARG	1,4385		0,1,2192	29.0	26.0	27.0		827,881	3.9	1.0	20	dbSNP_134	27	0,8582		0,0,4291	no	missense,missense	BIRC7	NM_022161.2,NM_139317.1	29,29	0,1,6483	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging,probably-damaging	276/281,294/299	61870941	1,12967	2193	4291	6484	SO:0001583	missense	79444	exon6			GCGTGCGCACCTT	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.881G>A	20.37:g.61870941G>A	ENSP00000217169:p.Arg294His	30.0	0.0	0		32.0	11.0	0.34375	NM_139317	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	37	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923510	0.52653	2.28E-4	0.0	ENSG00000101197	ENST00000342412;ENST00000217169;ENST00000395306	T;T;T	0.56776	0.64;0.44;1.65	4.89	3.94	0.45596	.	0.000000	0.40728	N	0.001031	T	0.51669	0.1688	M	0.70275	2.135	0.58432	D	0.999999	P;P	0.52842	0.943;0.956	B;B	0.42386	0.209;0.386	T	0.58188	-0.7680	10	0.87932	D	0	.	10.498	0.44789	0.162:0.0:0.838:0.0	.	294;276	Q96CA5;Q96CA5-2	BIRC7_HUMAN;.	H	276;294;189	ENSP00000345213:R276H;ENSP00000217169:R294H;ENSP00000378717:R189H	ENSP00000217169:R294H	R	+	2	0	BIRC7	61341386	1.000000	0.71417	0.998000	0.56505	0.136000	0.21042	4.069000	0.57541	1.038000	0.40049	0.467000	0.42956	CGC	G|1.000;A|0.000	0.000	weak		0.721	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317	
ZKSCAN1	7586	hgsc.bcm.edu	37	7	99631550	99631550	+	Silent	SNP	G	G	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr7:99631550G>T	ENST00000324306.6	+	6	1656	c.1422G>T	c.(1420-1422)tcG>tcT	p.S474S	ZKSCAN1_ENST00000426572.1_Silent_p.S438S|ZKSCAN1_ENST00000535170.1_Silent_p.S261S	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GCCAGAGCTCGGACCTCACCA	0.483																																					p.S474S		Atlas-SNP	.											.	ZKSCAN1	59	.	0			c.G1422T						PASS	.						99.0	106.0	104.0					7																	99631550		2203	4300	6503	SO:0001819	synonymous_variant	7586	exon6			GAGCTCGGACCTC	X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1422G>T	7.37:g.99631550G>T		70.0	0.0	0		91.0	4.0	0.043956	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Silent	SNP	ENST00000324306.6	37	CCDS34698.1																																																																																			.	.	none		0.483	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
KDM2B	84678	hgsc.bcm.edu	37	12	121891060	121891060	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr12:121891060G>A	ENST00000377071.4	-	13	1894	c.1822C>T	c.(1822-1824)Cgg>Tgg	p.R608W	KDM2B_ENST00000536437.1_Missense_Mutation_p.R491W|KDM2B_ENST00000542973.1_5'UTR|KDM2B_ENST00000377069.4_Missense_Mutation_p.R577W	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	608					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GTCCGGCGCCGCCGAGCTCCT	0.706																																					p.R608W		Atlas-SNP	.											.	KDM2B	218	.	0			c.C1822T						PASS	.						10.0	13.0	12.0					12																	121891060		1945	4112	6057	SO:0001583	missense	84678	exon13			GGCGCCGCCGAGC	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1822C>T	12.37:g.121891060G>A	ENSP00000366271:p.Arg608Trp	66.0	0.0	0		44.0	11.0	0.25	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900662	0.72754	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000540043;ENST00000261824	T;T;T	0.54675	1.97;1.38;0.56	5.18	0.934	0.19477	Zinc finger, CXXC-type (2);	0.000000	0.47852	D	0.000201	T	0.71134	0.3304	M	0.87547	2.89	0.47245	D	0.999366	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.971;0.999;0.971;0.999	T	0.72001	-0.4422	10	0.87932	D	0	-18.2694	9.0059	0.36111	0.0676:0.0:0.5518:0.3806	.	48;491;608;577;48	B7ZB05;Q1RLM7;Q8NHM5;A8MRS1;B4DSN4	.;.;KDM2B_HUMAN;.;.	W	608;577;608;491;608;48;608	ENSP00000366269:R577W;ENSP00000366271:R608W;ENSP00000445196:R491W	ENSP00000261824:R608W	R	-	1	2	KDM2B	120375443	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.788000	0.38714	0.298000	0.22638	-0.266000	0.10368	CGG	.	.	none		0.706	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
RARB	5915	hgsc.bcm.edu	37	3	25611289	25611289	+	Silent	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr3:25611289G>A	ENST00000404969.1	+	4	510	c.510G>A	c.(508-510)tcG>tcA	p.S170S	RARB_ENST00000458646.1_Silent_p.S51S|RARB_ENST00000330688.4_Silent_p.S163S|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000437042.2_Silent_p.S51S			P10826	RARB_HUMAN	retinoic acid receptor, beta	170	Hinge.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	AGGAGACTTCGAAGCAAGAAT	0.507																																					p.S163S		Atlas-SNP	.											RARB_ENST00000404969,rectum,carcinoma,+1,2	RARB	123	2	0			c.G489A						scavenged	.						118.0	114.0	115.0					3																	25611289		2203	4300	6503	SO:0001819	synonymous_variant	5915	exon4			GACTTCGAAGCAA	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.510G>A	3.37:g.25611289G>A		102.0	1.0	0.00980392		82.0	20.0	0.243902	NM_000965	P12891|Q00989|Q15298|Q9UN48	Silent	SNP	ENST00000404969.1	37																																																																																				.	.	none		0.507	RARB-201	KNOWN	basic	protein_coding	protein_coding		NM_000965, NM_016152	
OR4D6	219983	hgsc.bcm.edu	37	11	59225155	59225155	+	Missense_Mutation	SNP	C	C	T	rs376910045	byFrequency	TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr11:59225155C>T	ENST00000300127.2	+	1	745	c.722C>T	c.(721-723)aCg>aTg	p.T241M		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						TCCACGTGCACGTCCCACATG	0.562													C|||	2	0.000399361	0.0	0.0	5008	,	,		20259	0.0		0.0	False		,,,				2504	0.002				p.T241M		Atlas-SNP	.											OR4D6,colon,carcinoma,-1,1	OR4D6	65	1	0			c.C722T						PASS	.	C	MET/THR	0,4402		0,0,2201	120.0	107.0	112.0		722	5.1	1.0	11		112	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR4D6	NM_001004708.1	81	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	241/315	59225155	1,12991	2201	4295	6496	SO:0001583	missense	219983	exon1			CGTGCACGTCCCA	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.722C>T	11.37:g.59225155C>T	ENSP00000300127:p.Thr241Met	64.0	0.0	0		55.0	9.0	0.163636	NM_001004708	B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	ENST00000300127.2	37	CCDS31562.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281877	0.40394	0.0	1.16E-4	ENSG00000166884	ENST00000300127	T	0.40756	1.02	6.01	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000039	T	0.65575	0.2704	M	0.77486	2.375	0.23831	N	0.996728	D	0.89917	1.0	D	0.77004	0.989	T	0.62581	-0.6824	10	0.62326	D	0.03	-21.1448	15.3738	0.74587	0.1406:0.8594:0.0:0.0	.	241	Q8NGJ1	OR4D6_HUMAN	M	241	ENSP00000300127:T241M	ENSP00000300127:T241M	T	+	2	0	OR4D6	58981731	0.000000	0.05858	0.983000	0.44433	0.227000	0.25037	0.628000	0.24522	1.516000	0.48900	0.655000	0.94253	ACG	.	.	weak		0.562	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708	
C16orf93	90835	hgsc.bcm.edu	37	16	30770512	30770512	+	Silent	SNP	T	T	C			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr16:30770512T>C	ENST00000543610.1	-	7	1675	c.714A>G	c.(712-714)ccA>ccG	p.P238P	PHKG2_ENST00000563588.1_3'UTR|RNF40_ENST00000324685.6_5'Flank|PHKG2_ENST00000424889.3_Intron|C16orf93_ENST00000541260.1_Silent_p.P303P	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	238										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						TCTCACTCTCTGGCCACAGTT	0.597																																					p.P238P		Atlas-SNP	.											.	C16orf93	33	.	0			c.A714G						PASS	.						68.0	70.0	70.0					16																	30770512		2197	4300	6497	SO:0001819	synonymous_variant	90835	exon7			ACTCTCTGGCCAC	BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.714A>G	16.37:g.30770512T>C		38.0	0.0	0		51.0	12.0	0.235294	NM_001014979	A1A4V8|F5GX13|Q569G2	Silent	SNP	ENST00000543610.1	37	CCDS32434.2	.	.	.	.	.	.	.	.	.	.	T	5.075	0.199509	0.09652	.	.	ENSG00000196118	ENST00000535476	.	.	.	5.12	2.78	0.32641	.	.	.	.	.	T	0.51686	0.1689	.	.	.	0.51482	D	0.999921	.	.	.	.	.	.	T	0.39563	-0.9608	4	.	.	.	-0.303	4.4208	0.11479	0.1727:0.094:0.0:0.7333	.	.	.	.	R	135	.	.	Q	-	2	0	C16orf93	30678013	0.438000	0.25602	0.578000	0.28575	0.575000	0.36095	0.133000	0.15912	0.327000	0.23409	0.533000	0.62120	CAG	.	.	none		0.597	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397089.1	NM_001014979	
MYO18B	84700	hgsc.bcm.edu	37	22	26242205	26242205	+	Silent	SNP	C	C	T	rs375428629		TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr22:26242205C>T	ENST00000407587.2	+	19	3679	c.3510C>T	c.(3508-3510)gcC>gcT	p.A1170A	MYO18B_ENST00000335473.7_Silent_p.A1169A|MYO18B_ENST00000536101.1_Silent_p.A1169A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1169	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCAGCCTTGCCGCGGTGAGGA	0.652																																					p.A1169A		Atlas-SNP	.											.	MYO18B	322	.	0			c.C3507T						PASS	.	C		1,4315		0,1,2157	71.0	84.0	80.0		3507	-8.6	0.0	22		80	0,8484		0,0,4242	no	coding-synonymous	MYO18B	NM_032608.5		0,1,6399	TT,TC,CC		0.0,0.0232,0.0078		1169/2568	26242205	1,12799	2158	4242	6400	SO:0001819	synonymous_variant	84700	exon19			CCTTGCCGCGGTG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3510C>T	22.37:g.26242205C>T		48.0	0.0	0		48.0	11.0	0.229167	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37																																																																																				.	.	weak		0.652	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PODN	127435	hgsc.bcm.edu	37	1	53544260	53544260	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr1:53544260C>T	ENST00000312553.5	+	8	1229	c.1222C>T	c.(1222-1224)Cgg>Tgg	p.R408W	PODN_ENST00000371500.3_Missense_Mutation_p.R389W|RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000395871.2_Missense_Mutation_p.R266W	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	360					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGGCCTCAAGCGGTTGCACAC	0.652																																					p.R408W		Atlas-SNP	.											.	PODN	86	.	0			c.C1222T						PASS	.						57.0	54.0	55.0					1																	53544260		2203	4300	6503	SO:0001583	missense	127435	exon8			CTCAAGCGGTTGC	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1222C>T	1.37:g.53544260C>T	ENSP00000308315:p.Arg408Trp	81.0	0.0	0		84.0	24.0	0.285714	NM_153703	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	CCDS573.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536732	0.65085	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.58940	0.3;0.3;0.3	4.81	1.05	0.20165	.	0.456979	0.21202	N	0.078445	T	0.72630	0.3484	M	0.74467	2.265	0.32794	N	0.500809	D;D;D	0.76494	0.999;0.999;0.994	D;D;P	0.67103	0.949;0.946;0.877	T	0.80204	-0.1479	10	0.72032	D	0.01	.	14.7344	0.69406	0.8156:0.1844:0.0:0.0	.	266;389;408	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	W	389;266;408	ENSP00000360555:R389W;ENSP00000379212:R266W;ENSP00000308315:R408W	ENSP00000308315:R408W	R	+	1	2	PODN	53316848	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	1.866000	0.39489	0.051000	0.15978	0.555000	0.69702	CGG	.	.	none		0.652	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703	
SYNRG	11276	hgsc.bcm.edu	37	17	35913676	35913676	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr17:35913676C>T	ENST00000339208.6	-	14	2289	c.2149G>A	c.(2149-2151)Gag>Aag	p.E717K	SYNRG_ENST00000591288.1_Missense_Mutation_p.E556K|SYNRG_ENST00000502449.2_Missense_Mutation_p.E639K|SYNRG_ENST00000585472.1_Missense_Mutation_p.E638K|SYNRG_ENST00000346661.4_Missense_Mutation_p.E717K|SYNRG_ENST00000345615.4_Missense_Mutation_p.E639K|SYNRG_ENST00000588194.1_5'UTR|SYNRG_ENST00000394378.2_Missense_Mutation_p.E639K	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	717	Interaction with A1P1G1 and A1P1G2.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CTGGCTTCCTCTTTAAGGGCA	0.473																																					p.E717K		Atlas-SNP	.											.	SYNRG	101	.	0			c.G2149A						PASS	.						54.0	55.0	54.0					17																	35913676		2203	4300	6503	SO:0001583	missense	11276	exon14			CTTCCTCTTTAAG	AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.2149G>A	17.37:g.35913676C>T	ENSP00000343610:p.Glu717Lys	88.0	0.0	0		73.0	7.0	0.0958904	NM_007247	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	ENST00000339208.6	37	CCDS11321.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603368	0.66445	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T;T;T;T	0.50548	1.48;1.15;0.74;0.9;0.9	6.17	6.17	0.99709	.	0.196730	0.53938	D	0.000058	T	0.38585	0.1046	L	0.54323	1.7	0.39716	D	0.971399	P;B;B;B;P;P	0.47762	0.57;0.317;0.317;0.317;0.9;0.9	B;B;B;B;B;B	0.39258	0.255;0.228;0.228;0.228;0.295;0.295	T	0.22591	-1.0212	10	0.16420	T	0.52	-12.6231	10.2468	0.43345	0.0:0.7921:0.1368:0.071	.	556;639;639;639;717;717	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	K	717;556;717;639;639	ENSP00000005279:E717K;ENSP00000343610:E556K;ENSP00000315722:E717K;ENSP00000424893:E639K;ENSP00000377903:E639K	ENSP00000343610:E556K	E	-	1	0	SYNRG	32987789	0.729000	0.28090	0.990000	0.47175	0.951000	0.60555	1.279000	0.33191	2.941000	0.99782	0.655000	0.94253	GAG	.	.	none		0.473	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256811.2	NM_007247	
CERS6	253782	hgsc.bcm.edu	37	2	169417787	169417787	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D6-01A-11D-A31X-10	TCGA-GR-A4D6-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5a58bec0-67a8-4529-80d8-1042dfd8164a	5efebdb0-cfc1-42ae-be1d-e124289877a5	g.chr2:169417787G>A	ENST00000305747.6	+	3	949	c.362G>A	c.(361-363)cGc>cAc	p.R121H	CERS6_ENST00000392687.4_Missense_Mutation_p.R121H	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	121					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CGACAAAGACGCAATCAGGAG	0.458																																					p.R121H		Atlas-SNP	.											LASS6,colon,carcinoma,+1,1	.	.	1	0			c.G362A						PASS	.						151.0	143.0	145.0					2																	169417787		2203	4300	6503	SO:0001583	missense	253782	exon3			AAAGACGCAATCA	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.362G>A	2.37:g.169417787G>A	ENSP00000306579:p.Arg121His	96.0	0.0	0		73.0	20.0	0.273973	NM_001256126	Q32M63|Q8N617	Missense_Mutation	SNP	ENST00000305747.6	37	CCDS2228.1	.	.	.	.	.	.	.	.	.	.	G	34	5.405789	0.96051	.	.	ENSG00000172292	ENST00000305747;ENST00000392687	D;D	0.99158	-5.5;-5.5	5.31	5.31	0.75309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.045720	0.85682	D	0.000000	D	0.99518	0.9828	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.995;0.998	D	0.98417	1.0575	10	0.52906	T	0.07	-28.4318	19.3447	0.94358	0.0:0.0:1.0:0.0	.	121;121	Q32M63;Q6ZMG9	.;CERS6_HUMAN	H	121	ENSP00000306579:R121H;ENSP00000376453:R121H	ENSP00000306579:R121H	R	+	2	0	CERS6	169126033	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.813000	0.99286	2.641000	0.89580	0.650000	0.86243	CGC	.	.	none		0.458	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463	
