#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SFPQ	6421	hgsc.bcm.edu	37	1	35658418	35658432	+	In_Frame_Del	DEL	GGTGGCTGCTGCGGT	GGTGGCTGCTGCGGT	-			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	GGTGGCTGCTGCGGT	GGTGGCTGCTGCGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:35658418_35658432delGGTGGCTGCTGCGGT	ENST00000357214.5	-	1	317_331	c.219_233delACCGCAGCAGCCACC	c.(217-234)ccaccgcagcagccaccg>ccg	p.73_78PPQQPP>P		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	73	Gln/Glu/Pro-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				ctgctgcggcggtggctgctgcggtggtggcTGTT	0.707			T	TFE3	papillary renal cell																																p.74_78del		Atlas-Indel	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.220_234del						PASS	.			136,3204		29,78,1563						1.2	0.0			4	216,6642		53,110,3266	no	coding	SFPQ	NM_005066.2		82,188,4829	A1A1,A1R,RR		3.1496,4.0719,3.4517				352,9846				SO:0001651	inframe_deletion	6421	exon1			.	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.219_233delACCGCAGCAGCCACC	1.37:g.35658418_35658432delGGTGGCTGCTGCGGT	ENSP00000349748:p.Pro78_Pro82del	27.0	0.0	0		29.0	13.0	0.448276	NM_005066	P30808|Q5SZ71	In_Frame_Del	DEL	ENST00000357214.5	37	CCDS388.1																																																																																			.	.	none		0.707	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
B2M	567	hgsc.bcm.edu	37	15	45007689	45007690	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr15:45007689_45007690delTA	ENST00000558401.1	+	2	206_207	c.136_137delTA	c.(136-138)tatfs	p.Y46fs	B2M_ENST00000559916.1_Frame_Shift_Del_p.Y46fs|B2M_ENST00000559220.1_Intron|B2M_ENST00000544417.1_Frame_Shift_Del_p.Y46fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	46	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CCTGAATTGCTATGTGTCTGGG	0.401																																					p.45_46del		Pindel,Atlas-Indel	.											B2M,NS,lymphoid_neoplasm,+2,1	B2M	99	1	0			c.135_136del						PASS	.																																			SO:0001589	frameshift_variant	567	exon2			.	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.136_137delTA	15.37:g.45007689_45007690delTA	ENSP00000452780:p.Tyr46fs	94.0	0.0	.		76.0	35.0	0.461	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	CCDS10113.1																																																																																			.	.	none		0.401	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
CIITA	4261	hgsc.bcm.edu	37	16	11001270	11001271	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:11001270_11001271delTA	ENST00000324288.8	+	11	2054_2055	c.1921_1922delTA	c.(1921-1923)tatfs	p.Y641fs	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	641	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CACGGGACTCTATGTCGGCCTG	0.688			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.640_641del		Atlas-Indel	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.1920_1921del						PASS	.																																			SO:0001589	frameshift_variant	4261	exon11			.	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.1921_1922delTA	16.37:g.11001270_11001271delTA	ENSP00000316328:p.Tyr641fs	71.0	0.0	0		97.0	19.0	0.195876	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Frame_Shift_Del	DEL	ENST00000324288.8	37	CCDS10544.1																																																																																			.	.	none		0.688	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ICE1	23379	hgsc.bcm.edu	37	5	5461621	5461621	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr5:5461621delA	ENST00000296564.7	+	13	2396	c.2174delA	c.(2173-2175)tatfs	p.Y725fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		725					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GGGATAGAATATACAAAAGTA	0.383																																					p.Y725fs		Pindel,Atlas-Indel	.											KIAA0947_ENST00000296564,NS,carcinoma,-1,2	KIAA0947	301	2	0			c.2173delT						PASS	.						54.0	52.0	52.0					5																	5461621		1850	4094	5944	SO:0001589	frameshift_variant	23379	exon13			.																												ENST00000296564.7:c.2174delA	5.37:g.5461621delA	ENSP00000296564:p.Tyr725fs	173.0	0.0	.		158.0	30.0	0.190	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Del	DEL	ENST00000296564.7	37	CCDS47187.1																																																																																			.	.	none		0.383	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
PRDM1	639	hgsc.bcm.edu	37	6	106552891	106552892	+	Frame_Shift_Ins	INS	-	-	GT	rs17066588	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr6:106552891_106552892insGT	ENST00000369096.4	+	5	1090_1091	c.856_857insGT	c.(856-858)cgtfs	p.R286fs	PRDM1_ENST00000369091.2_Frame_Shift_Ins_p.R250fs|PRDM1_ENST00000369089.3_Frame_Shift_Ins_p.R152fs	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	286					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CTTTAGAAGACGTGGGAGCCCC	0.525			"""D, N, Mis, F, S"""		DLBCL																																p.R286fs		Pindel,Atlas-Indel	.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	PRDM1,colon,carcinoma,0,1	PRDM1	195	1	0			c.856_857insGT						PASS	.																																			SO:0001589	frameshift_variant	639	exon5			.		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.857_858dupGT	6.37:g.106552892_106552893dupGT	ENSP00000358092:p.Arg286fs	152.0	0.0	.		78.0	19.0	0.244	NM_001198	B2REA6|E1P5E0|Q86WM7	Frame_Shift_Ins	INS	ENST00000369096.4	37	CCDS5054.2																																																																																			.	.	none		0.525	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
DAAM1	23002	hgsc.bcm.edu	37	14	59797397	59797397	+	Silent	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr14:59797397G>A	ENST00000395125.1	+	12	1574	c.1551G>A	c.(1549-1551)gaG>gaA	p.E517E	DAAM1_ENST00000351081.1_Silent_p.E517E|DAAM1_ENST00000360909.3_Silent_p.E517E	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	517					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AGCTCCATGAGCTCAGCAGGG	0.527																																					p.E517E		Atlas-SNP	.											.	DAAM1	95	.	0			c.G1551A						PASS	.						56.0	57.0	57.0					14																	59797397		2203	4300	6503	SO:0001819	synonymous_variant	23002	exon13			CCATGAGCTCAGC	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1551G>A	14.37:g.59797397G>A		194.0	0.0	0		166.0	53.0	0.319277	NM_001270520	Q86U34|Q8N1Z8|Q8TB39	Silent	SNP	ENST00000395125.1	37	CCDS9737.1																																																																																			.	.	none		0.527	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
KCTD10	83892	hgsc.bcm.edu	37	12	109889615	109889615	+	Missense_Mutation	SNP	C	C	G			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr12:109889615C>G	ENST00000228495.6	-	7	1008	c.727G>C	c.(727-729)Gag>Cag	p.E243Q	KCTD10_ENST00000540411.1_Missense_Mutation_p.E217Q|KCTD10_ENST00000424763.2_Missense_Mutation_p.E62Q|KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000540089.1_Missense_Mutation_p.E62Q	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	243					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						TCGGGAAACTCCACCTGTGTT	0.582																																					p.E243Q		Atlas-SNP	.											KCTD10,NS,carcinoma,0,1	KCTD10	24	1	0			c.G727C						PASS	.						25.0	28.0	27.0					12																	109889615		2203	4300	6503	SO:0001583	missense	83892	exon7			GAAACTCCACCTG	BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.727G>C	12.37:g.109889615C>G	ENSP00000228495:p.Glu243Gln	47.0	0.0	0		71.0	24.0	0.338028	NM_031954	Q53HN2|Q59FV1|Q6PL47|Q96SU0	Missense_Mutation	SNP	ENST00000228495.6	37	CCDS9128.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.138586|4.138586	0.77775|0.77775	.|.	.|.	ENSG00000110906|ENSG00000110906	ENST00000228495;ENST00000540089;ENST00000545759;ENST00000424763;ENST00000540411;ENST00000542954;ENST00000535546;ENST00000540402;ENST00000540355|ENST00000538161	T;T|.	0.58060|.	0.51;0.36|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.051633|.	0.85682|.	D|.	0.000000|.	T|T	0.79275|0.79275	0.4418|0.4418	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;0.998|.	D;D;D|.	0.83275|.	0.988;0.996;0.974|.	T|T	0.80683|0.80683	-0.1273|-0.1273	10|5	0.87932|.	D|.	0|.	-31.0378|-31.0378	17.765|17.765	0.88475|0.88475	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	217;220;243|.	F5GWA4;Q9H3F6-2;Q9H3F6|.	.;.;BACD3_HUMAN|.	Q|C	243;62;85;62;217;62;62;62;62|208	ENSP00000228495:E243Q;ENSP00000441672:E217Q|.	ENSP00000228495:E243Q|.	E|W	-|-	1|3	0|0	KCTD10|KCTD10	108373998|108373998	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.476000|0.476000	0.33039|0.33039	7.622000|7.622000	0.83099|0.83099	2.757000|2.757000	0.94681|0.94681	0.655000|0.655000	0.94253|0.94253	GAG|TGG	.	.	none		0.582	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403099.1	NM_031954	
MARCH10	162333	hgsc.bcm.edu	37	17	60821880	60821880	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:60821880G>T	ENST00000311269.5	-	5	666	c.392C>A	c.(391-393)gCa>gAa	p.A131E	MARCH10_ENST00000544856.2_Missense_Mutation_p.A130E|MARCH10_ENST00000456609.2_Missense_Mutation_p.A131E|MARCH10_ENST00000583600.1_Missense_Mutation_p.A169E	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	131					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						AACCATTGGTGCTTGGTCTGC	0.428																																					p.A131E		Atlas-SNP	.											.	MARCH10	102	.	0			c.C392A						PASS	.						93.0	86.0	89.0					17																	60821880		2203	4300	6503	SO:0001583	missense	162333	exon5			ATTGGTGCTTGGT	AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.392C>A	17.37:g.60821880G>T	ENSP00000311496:p.Ala131Glu	65.0	0.0	0		52.0	14.0	0.269231	NM_001100875	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	ENST00000311269.5	37	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	G	1.039	-0.679492	0.03353	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	T;T;T	0.13089	2.66;2.66;2.62	4.02	-0.384	0.12474	.	1.015540	0.07895	N	0.971731	T	0.08980	0.0222	L	0.35723	1.085	0.09310	N	0.999999	B;B;B	0.18461	0.006;0.01;0.028	B;B;B	0.13407	0.004;0.009;0.009	T	0.42832	-0.9428	10	0.18710	T	0.47	-0.0502	3.2196	0.06711	0.205:0.0:0.4324:0.3626	.	130;130;131	B3KVK0;G3V1Q5;Q8NA82	.;.;MARHA_HUMAN	E	131;131;130	ENSP00000416177:A131E;ENSP00000311496:A131E;ENSP00000443746:A130E	ENSP00000311496:A131E	A	-	2	0	MARCH10	58175612	0.082000	0.21442	0.050000	0.19076	0.111000	0.19643	0.226000	0.17776	-0.006000	0.14370	0.561000	0.74099	GCA	.	.	none		0.428	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1	NM_152598	
FBLN1	2192	hgsc.bcm.edu	37	22	45937241	45937241	+	Missense_Mutation	SNP	C	C	T	rs540607391		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr22:45937241C>T	ENST00000327858.6	+	9	1150	c.1055C>T	c.(1054-1056)aCg>aTg	p.T352M	FBLN1_ENST00000442170.2_Missense_Mutation_p.T352M|FBLN1_ENST00000348697.2_Missense_Mutation_p.T352M|FBLN1_ENST00000340923.5_Missense_Mutation_p.T352M|FBLN1_ENST00000402984.3_Missense_Mutation_p.T390M|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000262722.7_Missense_Mutation_p.T352M	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	352	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GAGGAGGGAACGCGCTGTGTT	0.522													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20118	0.0		0.0	False		,,,				2504	0.0				p.T352M		Atlas-SNP	.											.	FBLN1	143	.	0			c.C1055T						PASS	.						101.0	84.0	89.0					22																	45937241		2203	4300	6503	SO:0001583	missense	2192	exon9			AGGGAACGCGCTG		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1055C>T	22.37:g.45937241C>T	ENSP00000331544:p.Thr352Met	76.0	0.0	0		83.0	28.0	0.337349	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.097040	0.56075	.	.	ENSG00000077942	ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923	D;D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-2.28;-3.12;-3.12	5.41	3.26	0.37387	EGF-like calcium-binding (2);	0.150392	0.64402	D	0.000014	D	0.93458	0.7913	L	0.45285	1.41	0.09310	N	0.99999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.995;0.991;0.995	D	0.87244	0.2268	10	0.66056	D	0.02	.	11.9956	0.53201	0.1373:0.7308:0.1319:0.0	.	390;352;352;352	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	M	352;390;352;352;352;352	ENSP00000262723:T352M;ENSP00000385521:T390M;ENSP00000262722:T352M;ENSP00000331544:T352M;ENSP00000393812:T352M;ENSP00000342212:T352M	ENSP00000262722:T352M	T	+	2	0	FBLN1	44315905	0.909000	0.30893	0.017000	0.16124	0.824000	0.46624	1.899000	0.39818	0.627000	0.30340	0.655000	0.94253	ACG	.	.	none		0.522	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
ARID1A	8289	hgsc.bcm.edu	37	1	27102083	27102083	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:27102083G>A	ENST00000324856.7	+	19	5380	c.5009G>A	c.(5008-5010)tGg>tAg	p.W1670*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.W1287*|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.W1453*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1670					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.W1670*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCGGAGGCATGGCGGGTAATG	0.542			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.W1670X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,bladder,carcinoma,0,1	ARID1A	842	1	1	Substitution - Nonsense(1)	urinary_tract(1)	c.G5009A						PASS	.						80.0	67.0	71.0					1																	27102083		2203	4300	6503	SO:0001587	stop_gained	8289	exon19			AGGCATGGCGGGT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5009G>A	1.37:g.27102083G>A	ENSP00000320485:p.Trp1670*	44.0	0.0	0		43.0	17.0	0.395349	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	10.783098|10.783098	0.99467|0.99467	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152	.|.	.|.	.|.	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.46560|.	0.1399|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34825|.	-0.9813|.	4|.	.|0.02654	.|T	.|1	-4.3496|-4.3496	18.5907|18.5907	0.91210|0.91210	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	I|X	566|1670;1453;1287	.|.	.|ENSP00000320485:W1670X	M|W	+|+	3|2	0|0	ARID1A|ARID1A	26974670|26974670	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.657000|9.657000	0.98554|0.98554	2.634000|2.634000	0.89283|0.89283	0.655000|0.655000	0.94253|0.94253	ATG|TGG	.	.	none		0.542	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
MARCH1	55016	hgsc.bcm.edu	37	4	165118819	165118819	+	Intron	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr4:165118819C>T	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A15A(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CATCAGAGGGCGCCCTGTTCC	0.502																																					p.A15A		Atlas-SNP	.											ANP32C,NS,carcinoma,0,1	ANP32C	59	1	1	Substitution - coding silent(1)	endometrium(1)	c.G45A						PASS	.						121.0	123.0	123.0					4																	165118819		2203	4300	6503	SO:0001627	intron_variant	23520	exon1			AGAGGGCGCCCTG	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-86005G>A	4.37:g.165118819C>T		95.0	0.0	0		102.0	34.0	0.333333	NM_012403	D3DP29|Q9NWR0	Silent	SNP	ENST00000503008.1	37	CCDS54814.1																																																																																			.	.	none		0.502	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
NLRP9	338321	hgsc.bcm.edu	37	19	56249530	56249530	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:56249530C>A	ENST00000332836.2	-	1	238	c.211G>T	c.(211-213)Gta>Tta	p.V71L	RN7SKP109_ENST00000410592.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	71	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TTCAGTGTTACCTCCCATGCC	0.493																																					p.V71L		Atlas-SNP	.											.	NLRP9	163	.	0			c.G211T						PASS	.						444.0	438.0	440.0					19																	56249530		2203	4300	6503	SO:0001583	missense	338321	exon1			GTGTTACCTCCCA	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.211G>T	19.37:g.56249530C>A	ENSP00000331857:p.Val71Leu	130.0	0.0	0		166.0	46.0	0.277108	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436550	0.43224	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.57595	0.39	3.63	-3.39	0.04868	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.47581	0.1453	L	0.39020	1.185	0.09310	N	1	P	0.46395	0.877	P	0.51016	0.656	T	0.48647	-0.9017	9	0.33141	T	0.24	.	9.9981	0.41911	0.1498:0.2618:0.5884:0.0	.	71	Q7RTR0	NALP9_HUMAN	L	71	ENSP00000331857:V71L	ENSP00000331857:V71L	V	-	1	0	NLRP9	60941342	0.080000	0.21391	0.000000	0.03702	0.011000	0.07611	-0.007000	0.12810	-0.423000	0.07394	-0.175000	0.13238	GTA	.	.	none		0.493	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
SATB2	23314	hgsc.bcm.edu	37	2	200173610	200173610	+	Missense_Mutation	SNP	A	A	G			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr2:200173610A>G	ENST00000417098.1	-	10	2429	c.1613T>C	c.(1612-1614)cTc>cCc	p.L538P	SATB2_ENST00000260926.5_Missense_Mutation_p.L538P|SATB2_ENST00000443023.1_Missense_Mutation_p.L479P|SATB2_ENST00000428695.1_Missense_Mutation_p.L420P|SATB2_ENST00000457245.1_Missense_Mutation_p.L538P	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	538					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GATGGTACAGAGGTTTTCCCA	0.557																																					p.L538P	Colon(30;262 767 11040 24421 36230)	Atlas-SNP	.											.	SATB2	134	.	0			c.T1613C						PASS	.						132.0	106.0	115.0					2																	200173610		2203	4300	6503	SO:0001583	missense	23314	exon11			GTACAGAGGTTTT	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1613T>C	2.37:g.200173610A>G	ENSP00000401112:p.Leu538Pro	140.0	0.0	0		119.0	47.0	0.394958	NM_015265	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.838366	0.91117	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.61980	0.18;0.19;0.18;0.06;0.18	5.21	5.21	0.72293	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.78188	0.4244	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	T	0.80879	-0.1185	10	0.87932	D	0	-15.8414	15.5441	0.76081	1.0:0.0:0.0:0.0	.	420;538	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	P	538;479;538;420;538	ENSP00000401112:L538P;ENSP00000388764:L479P;ENSP00000260926:L538P;ENSP00000388581:L420P;ENSP00000405420:L538P	ENSP00000260926:L538P	L	-	2	0	SATB2	199881855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	2.317000	0.78254	0.459000	0.35465	CTC	.	.	none		0.557	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
CBX3	11335	hgsc.bcm.edu	37	7	26245986	26245986	+	Splice_Site	SNP	A	A	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr7:26245986A>T	ENST00000337620.4	+	3	452		c.e3-1		CBX3_ENST00000409747.1_Splice_Site|CBX3_ENST00000396386.2_Splice_Site|CBX3_ENST00000497498.1_Splice_Site	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						GTTTTATTTTAGCAAAAAATG	0.308																																					.		Atlas-SNP	.											CBX3,colon,adenoma,0,1	CBX3	25	1	0			c.25-2A>T						scavenged	.						32.0	33.0	32.0					7																	26245986		2200	4300	6500	SO:0001630	splice_region_variant	11335	exon3			TATTTTAGCAAAA	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.25-1A>T	7.37:g.26245986A>T		76.0	1.0	0.0131579		89.0	6.0	0.0674157	NM_007276	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Splice_Site	SNP	ENST00000337620.4	37	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999549	0.54147	.	.	ENSG00000122565	ENST00000337620;ENST00000396386;ENST00000456948;ENST00000409747	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2344	0.54508	0.8582:0.1418:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBX3	26212511	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.092000	0.50207	2.323000	0.78572	0.533000	0.62120	.	.	.	none		0.308	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	Intron
MSH3	4437	hgsc.bcm.edu	37	5	79950708	79950708	+	Silent	SNP	T	T	C	rs201874762|rs2405875	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr5:79950708T>C	ENST00000265081.6	+	1	242	c.162T>C	c.(160-162)gcT>gcC	p.A54A	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	54	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CTgcagcggctgcagcggccg	0.687								Mismatch excision repair (MMR)					-|||	259	0.0517173	0.0499	0.0447	5008	,	,		6179	0.0754		0.0437	False		,,,				2504	0.0429				p.A54A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											.	MSH3	129	.	0			c.T162C						PASS	.						9.0	9.0	9.0					5																	79950708		2150	4207	6357	SO:0001819	synonymous_variant	4437	exon1			AGCGGCTGCAGCG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.162T>C	5.37:g.79950708T>C		11.0	0.0	0		29.0	22.0	0.758621	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	CCDS34195.1																																																																																			T|0.781;C|0.219	0.219	strong		0.687	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
TNRC6C	57690	hgsc.bcm.edu	37	17	76063864	76063864	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:76063864G>A	ENST00000588061.1	+	7	3365	c.2638G>A	c.(2638-2640)Ggc>Agc	p.G880S	RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000335749.4_Missense_Mutation_p.G877S|TNRC6C_ENST00000541771.1_Missense_Mutation_p.G880S|TNRC6C_ENST00000544502.1_Missense_Mutation_p.G877S|TNRC6C_ENST00000588847.1_Missense_Mutation_p.G877S|TNRC6C_ENST00000301624.4_Missense_Mutation_p.G880S			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	880	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGAAGGCTGGGGCAGTGGTGG	0.463																																					p.G880S		Atlas-SNP	.											.	TNRC6C	173	.	0			c.G2638A						PASS	.						127.0	129.0	128.0					17																	76063864		1937	4151	6088	SO:0001583	missense	57690	exon6			GGCTGGGGCAGTG	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2638G>A	17.37:g.76063864G>A	ENSP00000468647:p.Gly880Ser	91.0	0.0	0		81.0	4.0	0.0493827	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	35	5.459818	0.96240	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.17054	2.3;2.33;2.33;2.3	5.84	5.84	0.93424	Argonaute hook domain (1);	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.07654	-1.0761	10	0.32370	T	0.25	-20.2912	20.1187	0.97949	0.0:0.0:1.0:0.0	.	877;880;880	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	S	880;877;877;880;880;877	ENSP00000336783:G877S;ENSP00000301624:G880S;ENSP00000440310:G880S;ENSP00000442421:G877S	ENSP00000301624:G880S	G	+	1	0	TNRC6C	73575459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.767000	0.95098	0.591000	0.81541	GGC	.	.	none		0.463	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
RAB3IL1	5866	hgsc.bcm.edu	37	11	61675610	61675610	+	Silent	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr11:61675610G>A	ENST00000394836.2	-	2	337	c.180C>T	c.(178-180)gaC>gaT	p.D60D	RAB3IL1_ENST00000301773.5_Silent_p.D107D	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	60					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						GGCGCAACACGTCCAGCTGGG	0.672																																					p.D107D		Atlas-SNP	.											.	RAB3IL1	39	.	0			c.C321T						PASS	.						13.0	14.0	14.0					11																	61675610		2200	4293	6493	SO:0001819	synonymous_variant	5866	exon2			CAACACGTCCAGC	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.180C>T	11.37:g.61675610G>A		42.0	0.0	0		46.0	11.0	0.23913	NM_001271686	Q86V32|Q9P1Q8	Silent	SNP	ENST00000394836.2	37	CCDS8014.1																																																																																			.	.	none		0.672	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394917.1	NM_013401	
ZNF100	163227	hgsc.bcm.edu	37	19	21948514	21948514	+	Silent	SNP	C	C	A	rs530281593		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:21948514C>A	ENST00000358296.6	-	2	276	c.78G>T	c.(76-78)gtG>gtT	p.V26V	ZNF100_ENST00000596452.1_5'UTR	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						AATAAGACTGCACCAGAAGAC	0.478													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15991	0.0		0.0	False		,,,				2504	0.0				p.V26V		Atlas-SNP	.											.	ZNF100	62	.	0			c.G78T						PASS	.						91.0	100.0	97.0					19																	21948514		2190	4297	6487	SO:0001819	synonymous_variant	163227	exon2			AGACTGCACCAGA	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.78G>T	19.37:g.21948514C>A		78.0	0.0	0		73.0	15.0	0.205479	NM_173531	Q7M4M0	Silent	SNP	ENST00000358296.6	37	CCDS42538.1																																																																																			.	.	none		0.478	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
CADPS	8618	hgsc.bcm.edu	37	3	62647994	62647994	+	Missense_Mutation	SNP	C	C	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr3:62647994C>A	ENST00000383710.4	-	4	1313	c.964G>T	c.(964-966)Gcc>Tcc	p.A322S	CADPS_ENST00000283269.9_Missense_Mutation_p.A322S|CADPS_ENST00000357948.3_Missense_Mutation_p.A322S|CADPS_ENST00000490353.2_Missense_Mutation_p.A322S	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	322					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CTTACCCTGGCTATTTGGTCT	0.488																																					p.A322S		Atlas-SNP	.											.	CADPS	387	.	0			c.G964T						PASS	.						174.0	149.0	158.0					3																	62647994		2203	4300	6503	SO:0001583	missense	8618	exon4			CCCTGGCTATTTG	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.964G>T	3.37:g.62647994C>A	ENSP00000373215:p.Ala322Ser	31.0	0.0	0		36.0	18.0	0.5	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.965064	0.53507	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	5.54	5.54	0.83059	.	0.111048	0.64402	D	0.000006	D	0.86389	0.5921	N	0.20845	0.615	0.58432	D	0.999993	B;D;P	0.61697	0.073;0.99;0.657	B;D;B	0.73380	0.074;0.98;0.138	D	0.83718	0.0191	10	0.21014	T	0.42	.	18.2515	0.90005	0.0:1.0:0.0:0.0	.	322;322;322	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	S	322	ENSP00000373215:A322S;ENSP00000350632:A322S;ENSP00000283269:A322S;ENSP00000418736:A322S	ENSP00000283269:A322S	A	-	1	0	CADPS	62623034	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.387000	0.66243	2.606000	0.88127	0.655000	0.94253	GCC	.	.	none		0.488	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
KLHL6	89857	hgsc.bcm.edu	37	3	183209942	183209942	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr3:183209942C>T	ENST00000341319.3	-	7	1674	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	547					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CTGGCCCGCTCGTGGCTGAGC	0.657																																					p.E547K		Atlas-SNP	.											.	KLHL6	100	.	0			c.G1639A						PASS	.						39.0	39.0	39.0					3																	183209942		2202	4299	6501	SO:0001583	missense	89857	exon7			CCCGCTCGTGGCT	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1639G>A	3.37:g.183209942C>T	ENSP00000341342:p.Glu547Lys	140.0	0.0	0		151.0	52.0	0.344371	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888221	0.33348	.	.	ENSG00000172578	ENST00000341319	T	0.65732	-0.17	5.8	5.8	0.92144	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	N	0.21194	0.64	0.53688	D	0.999972	P	0.37663	0.604	B	0.37508	0.252	T	0.48364	-0.9042	10	0.02654	T	1	.	20.029	0.97531	0.0:1.0:0.0:0.0	.	547	Q8WZ60	KLHL6_HUMAN	K	547	ENSP00000341342:E547K	ENSP00000341342:E547K	E	-	1	0	KLHL6	184692636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.907000	0.69908	2.742000	0.94016	0.591000	0.81541	GAG	.	.	none		0.657	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
DLGAP1	9229	hgsc.bcm.edu	37	18	3814275	3814275	+	Splice_Site	SNP	T	T	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr18:3814275T>A	ENST00000315677.3	-	5	1553		c.e5-2		DLGAP1_ENST00000584874.1_Splice_Site|DLGAP1_ENST00000400147.2_Splice_Site|DLGAP1_ENST00000581699.1_Splice_Site|DLGAP1_ENST00000515196.2_Splice_Site|DLGAP1_ENST00000400150.3_Splice_Site|DLGAP1_ENST00000478161.1_Splice_Site|snoU13_ENST00000459060.1_RNA|DLGAP1_ENST00000539435.1_Splice_Site|DLGAP1_ENST00000400149.3_Splice_Site|DLGAP1_ENST00000400155.1_Splice_Site|DLGAP1_ENST00000400145.2_Splice_Site|DLGAP1_ENST00000534970.1_Splice_Site|DLGAP1_ENST00000581527.1_Splice_Site	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1						synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTGTGGAACCTATTCAGATAG	0.338																																					.		Atlas-SNP	.											.	DLGAP1	201	.	0			c.958-2A>T						PASS	.						87.0	84.0	85.0					18																	3814275		2203	4300	6503	SO:0001630	splice_region_variant	9229	exon6			GGAACCTATTCAG	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.958-2A>T	18.37:g.3814275T>A		90.0	0.0	0		95.0	23.0	0.242105	NM_004746	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Splice_Site	SNP	ENST00000315677.3	37	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297901	0.60086	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2416	0.82411	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DLGAP1	3804275	1.000000	0.71417	0.959000	0.39883	0.990000	0.78478	7.942000	0.87708	2.229000	0.72834	0.533000	0.62120	.	.	.	none		0.338	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		Intron
EXOC7	23265	hgsc.bcm.edu	37	17	74080183	74080183	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:74080183T>C	ENST00000335146.7	-	19	2062	c.2009A>G	c.(2008-2010)cAg>cGg	p.Q670R	EXOC7_ENST00000405575.4_Missense_Mutation_p.Q628R|EXOC7_ENST00000607838.1_Missense_Mutation_p.Q642R|EXOC7_ENST00000589210.1_Missense_Mutation_p.Q619R|EXOC7_ENST00000411744.2_Missense_Mutation_p.Q611R|EXOC7_ENST00000467929.2_Missense_Mutation_p.Q591R|EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000332065.5_Missense_Mutation_p.Q588R			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	670					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			CCAGGCCTTCTGGATTTTGCA	0.522																																					p.Q670R		Atlas-SNP	.											.	EXOC7	47	.	0			c.A2009G						PASS	.						54.0	50.0	51.0					17																	74080183		2203	4300	6503	SO:0001583	missense	23265	exon19			GCCTTCTGGATTT	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.2009A>G	17.37:g.74080183T>C	ENSP00000334100:p.Gln670Arg	70.0	0.0	0		73.0	25.0	0.342466	NM_001145297	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	t	25.0	4.593561	0.86953	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	5.28	5.28	0.74379	Cullin repeat-like-containing domain (1);	0.136469	0.51477	D	0.000088	T	0.80019	0.4547	M	0.80422	2.495	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.987;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;0.932;1.0;1.0;0.983;1.0	T	0.83105	-0.0126	9	0.72032	D	0.01	-24.4938	15.2203	0.73306	0.0:0.0:0.0:1.0	.	611;642;591;556;670;588;619	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	R	588;508;642;670;619;556;611	.	ENSP00000333806:Q588R	Q	-	2	0	EXOC7	71591778	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.843000	0.86859	2.000000	0.58554	0.449000	0.29647	CAG	.	.	none		0.522	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
ANKS1A	23294	hgsc.bcm.edu	37	6	34857324	34857324	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr6:34857324G>A	ENST00000360359.3	+	1	283	c.145G>A	c.(145-147)Ggc>Agc	p.G49S	ANKS1A_ENST00000535627.1_Missense_Mutation_p.G49S|TAF11_ENST00000420584.2_5'Flank|TAF11_ENST00000361288.4_5'Flank	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	49	Gly-rich.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						cggcagcggcggcggcggcgg	0.771																																					p.G49S		Atlas-SNP	.											ANKS1A,NS,carcinoma,0,1	ANKS1A	123	1	0			c.G145A						PASS	.						2.0	2.0	2.0					6																	34857324		382	1194	1576	SO:0001583	missense	23294	exon1			AGCGGCGGCGGCG	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.145G>A	6.37:g.34857324G>A	ENSP00000353518:p.Gly49Ser	4.0	0.0	0		8.0	4.0	0.5	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008376	0.54361	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;D	0.98649	1.19;-5.05	4.58	1.53	0.23141	Ankyrin repeat-containing domain (1);	1.264600	0.06451	N	0.727796	D	0.90783	0.7106	N	0.19112	0.55	0.25322	N	0.989108	P;B	0.49090	0.919;0.003	B;B	0.38655	0.278;0.002	D	0.88474	0.3064	10	0.17832	T	0.49	-4.009	8.7007	0.34323	0.0795:0.0:0.6816:0.2389	.	49;49	B4DQW8;Q92625	.;ANS1A_HUMAN	S	49	ENSP00000353518:G49S;ENSP00000438752:G49S	ENSP00000353518:G49S	G	+	1	0	ANKS1A	34965302	1.000000	0.71417	0.794000	0.32065	0.327000	0.28475	2.586000	0.46119	0.389000	0.25086	0.471000	0.43371	GGC	.	.	none		0.771	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
ZNF423	23090	hgsc.bcm.edu	37	16	49672444	49672444	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:49672444C>T	ENST00000561648.1	-	4	672	c.619G>A	c.(619-621)Gac>Aac	p.D207N	ZNF423_ENST00000262383.2_Missense_Mutation_p.D207N|ZNF423_ENST00000562520.1_Missense_Mutation_p.D147N|ZNF423_ENST00000562871.1_Missense_Mutation_p.D147N|ZNF423_ENST00000563137.2_Missense_Mutation_p.D147N|ZNF423_ENST00000567169.1_Missense_Mutation_p.D90N|ZNF423_ENST00000535559.1_Missense_Mutation_p.D90N	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	207					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D207Y(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGAGGTGGTCGCTGCGGGAG	0.602																																					p.D207N		Atlas-SNP	.											ZNF423_ENST00000262383,NS,carcinoma,0,1	ZNF423	463	1	1	Substitution - Missense(1)	ovary(1)	c.G619A						PASS	.						67.0	48.0	55.0					16																	49672444		2198	4300	6498	SO:0001583	missense	23090	exon4			GGTGGTCGCTGCG	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.619G>A	16.37:g.49672444C>T	ENSP00000455426:p.Asp207Asn	53.0	0.0	0		64.0	21.0	0.328125	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044496	0.75732	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.07567	3.18;3.18	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.21881	0.0527	L	0.41079	1.255	0.49483	D	0.999796	D	0.89917	1.0	D	0.91635	0.999	T	0.01099	-1.1452	9	.	.	.	.	18.3069	0.90185	0.0:1.0:0.0:0.0	.	207	Q2M1K9	ZN423_HUMAN	N	207;90	ENSP00000262383:D207N;ENSP00000442321:D90N	.	D	-	1	0	ZNF423	48229945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.709000	0.84645	2.331000	0.79229	0.561000	0.74099	GAC	.	.	none		0.602	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
PPP1R7	5510	hgsc.bcm.edu	37	2	242097275	242097275	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr2:242097275G>A	ENST00000234038.6	+	3	709	c.235G>A	c.(235-237)Gag>Aag	p.E79K	PPP1R7_ENST00000401987.1_Missense_Mutation_p.E36K|PPP1R7_ENST00000406106.3_Missense_Mutation_p.E79K|PPP1R7_ENST00000272983.8_Missense_Mutation_p.E36K|PPP1R7_ENST00000407025.1_Missense_Mutation_p.E79K|PPP1R7_ENST00000402734.1_Missense_Mutation_p.E20K|PPP1R7_ENST00000404405.3_Missense_Mutation_p.E79K|PPP1R7_ENST00000485630.1_3'UTR	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	79					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		CAGAGATGCAGAGGTAATGCC	0.468																																					p.E79K	NSCLC(62;446 1299 5417 11238 27640)	Atlas-SNP	.											.	PPP1R7	35	.	0			c.G235A						PASS	.						83.0	73.0	76.0					2																	242097275		2203	4300	6503	SO:0001583	missense	5510	exon3			GATGCAGAGGTAA	AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.235G>A	2.37:g.242097275G>A	ENSP00000234038:p.Glu79Lys	102.0	0.0	0		98.0	36.0	0.367347	NM_002712	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Missense_Mutation	SNP	ENST00000234038.6	37	CCDS2546.1	.	.	.	.	.	.	.	.	.	.	G	32	5.164816	0.94727	.	.	ENSG00000115685	ENST00000438799;ENST00000402734;ENST00000423280;ENST00000407025;ENST00000272983;ENST00000234038;ENST00000404405;ENST00000439916;ENST00000406106;ENST00000401987;ENST00000427172	T;T;T;T;T;T;T;T;T;T;T	0.47177	1.85;1.85;1.85;1.85;1.85;1.85;0.85;1.15;1.85;1.85;1.82	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	M	0.66506	2.035	0.80722	D	1	D;P;P;P;D;P	0.71674	0.996;0.947;0.902;0.893;0.998;0.956	P;P;B;P;D;P	0.80764	0.824;0.577;0.415;0.554;0.994;0.549	T	0.61917	-0.6964	10	0.27082	T	0.32	-26.0255	17.1348	0.86736	0.0:0.0:1.0:0.0	.	63;20;36;79;79;79	C9JD73;C9J177;Q15435-2;Q15435;Q15435-3;B5MBZ8	.;.;.;PP1R7_HUMAN;.;.	K	63;20;20;79;36;79;79;79;79;36;88	ENSP00000396376:E63K;ENSP00000385012:E20K;ENSP00000412092:E20K;ENSP00000385657:E79K;ENSP00000272983:E36K;ENSP00000234038:E79K;ENSP00000385498:E79K;ENSP00000409719:E79K;ENSP00000385022:E79K;ENSP00000385466:E36K;ENSP00000397985:E88K	ENSP00000234038:E79K	E	+	1	0	PPP1R7	241745948	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.281000	0.89905	2.490000	0.84030	0.655000	0.94253	GAG	.	.	none		0.468	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257244.4	NM_002712	
MSH3	4437	hgsc.bcm.edu	37	5	79950715	79950715	+	Missense_Mutation	SNP	G	G	C	rs144776112|rs201874762		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr5:79950715G>C	ENST00000265081.6	+	1	249	c.169G>C	c.(169-171)Gcc>Ccc	p.A57P	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggctgcagcggccgcagcggc	0.692								Mismatch excision repair (MMR)																													p.A57P	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3_ENST00000265081,NS,carcinoma,0,1	MSH3	129	1	0			c.G169C						PASS	.						7.0	7.0	7.0					5																	79950715		2089	4077	6166	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.169G>C	5.37:g.79950715G>C	ENSP00000265081:p.Ala57Pro	9.0	0.0	0		27.0	15.0	0.555556	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	362	0.16575091575091574	115	0.23373983739837398	67	0.1850828729281768	32	0.055944055944055944	148	0.19525065963060687	-	0.222	-1.028222	0.02045	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00039	0.0001	N	0.03608	-0.345	0.80722	P	0.0	.	.	.	.	.	.	T	0.02983	-1.1086	3	.	.	.	.	.	.	.	.	57	P20585	MSH3_HUMAN	P	57	ENSP00000265081:A57P	.	A	+	1	0	MSH3	79986471	0.041000	0.20044	0.049000	0.19019	0.152000	0.21847	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GCC	G|0.835;C|0.165	0.165	strong		0.692	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
SGTA	6449	hgsc.bcm.edu	37	19	2767594	2767594	+	Missense_Mutation	SNP	G	G	T	rs367983019		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:2767594G>T	ENST00000221566.2	-	3	352	c.191C>A	c.(190-192)gCg>gAg	p.A64E		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	64					viral process (GO:0016032)	cytoplasm (GO:0005737)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGGCAGCCGCTTCAAATAT	0.622																																					p.A64E		Atlas-SNP	.											.	SGTA	19	.	0			c.C191A						PASS	.						42.0	37.0	39.0					19																	2767594		2203	4300	6503	SO:0001583	missense	6449	exon3			GCAGCCGCTTCAA	AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.191C>A	19.37:g.2767594G>T	ENSP00000221566:p.Ala64Glu	99.0	0.0	0		82.0	4.0	0.0487805	NM_003021	D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	G	1.436	-0.568915	0.03910	.	.	ENSG00000104969	ENST00000221566	T	0.35973	1.28	3.92	3.92	0.45320	.	3.510430	0.04959	U	0.461626	T	0.33469	0.0864	L	0.39245	1.2	0.35474	D	0.797628	B	0.11235	0.004	B	0.13407	0.009	T	0.15780	-1.0425	10	0.11485	T	0.65	-5.3653	13.7696	0.63018	0.0:0.0:1.0:0.0	.	64	O43765	SGTA_HUMAN	E	64	ENSP00000221566:A64E	ENSP00000221566:A64E	A	-	2	0	SGTA	2718594	0.999000	0.42202	0.930000	0.37139	0.102000	0.19082	2.917000	0.48821	1.893000	0.54813	0.491000	0.48974	GCG	.	.	alt		0.622	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2	NM_003021	
CD3D	915	hgsc.bcm.edu	37	11	118211113	118211113	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr11:118211113G>A	ENST00000300692.4	-	2	387	c.251C>T	c.(250-252)tCt>tTt	p.S84F	CD3D_ENST00000392884.2_Missense_Mutation_p.S84F|CD3D_ENST00000529594.1_Intron	NM_000732.4	NP_000723.1	P04234	CD3D_HUMAN	CD3d molecule, delta (CD3-TCR complex)	84					cell surface receptor signaling pathway (GO:0007166)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive thymic T cell selection (GO:0045059)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	9	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	TTGCACGGTAGATTCTTTGTC	0.458																																					p.S84F		Atlas-SNP	.											.	CD3D	21	.	0			c.C251T						PASS	.						224.0	173.0	191.0					11																	118211113		2200	4296	6496	SO:0001583	missense	915	exon2			ACGGTAGATTCTT	X01451	CCDS8394.1, CCDS41724.1	11q23	2014-09-17	2006-03-28		ENSG00000167286	ENSG00000167286		"""CD molecules"""	1673	protein-coding gene	gene with protein product		186790	"""CD3d antigen, delta polypeptide (TiT3 complex)"""	T3D			Standard	NM_000732		Approved		uc001pss.1	P04234	OTTHUMG00000166970	ENST00000300692.4:c.251C>T	11.37:g.118211113G>A	ENSP00000300692:p.Ser84Phe	108.0	0.0	0		102.0	25.0	0.245098	NM_000732	A8MVP6	Missense_Mutation	SNP	ENST00000300692.4	37	CCDS8394.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566084	0.27915	.	.	ENSG00000167286	ENST00000300692;ENST00000392884	T;T	0.49720	2.09;0.77	5.15	-0.336	0.12658	Immunoglobulin-like fold (1);	1.180960	0.05785	N	0.609330	T	0.38054	0.1026	L	0.59436	1.845	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.08055	0.003;0.003	T	0.19745	-1.0296	10	0.10111	T	0.7	3.1627	4.787	0.13230	0.171:0.0:0.3239:0.5051	.	84;84	A8MVP6;P04234	.;CD3D_HUMAN	F	84	ENSP00000300692:S84F;ENSP00000376622:S84F	ENSP00000300692:S84F	S	-	2	0	CD3D	117716323	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	-0.767000	0.04720	-0.223000	0.09943	0.655000	0.94253	TCT	.	.	none		0.458	CD3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392128.1	NM_000732	
OR6M1	390261	hgsc.bcm.edu	37	11	123676690	123676690	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr11:123676690G>T	ENST00000309154.2	-	1	405	c.368C>A	c.(367-369)gCt>gAt	p.A123D		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTCGCAGATAGCCATGTAGCG	0.507																																					p.A123D		Atlas-SNP	.											.	OR6M1	60	.	0			c.C368A						PASS	.						51.0	52.0	52.0					11																	123676690		2202	4299	6501	SO:0001583	missense	390261	exon1			CAGATAGCCATGT	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.368C>A	11.37:g.123676690G>T	ENSP00000311038:p.Ala123Asp	71.0	0.0	0		97.0	36.0	0.371134	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035627	0.54896	.	.	ENSG00000196099	ENST00000309154	T	0.01234	5.13	3.68	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33127	U	0.005259	T	0.13114	0.0318	H	0.98133	4.155	0.35910	D	0.831017	D	0.89917	1.0	D	0.80764	0.994	T	0.14392	-1.0474	10	0.87932	D	0	.	9.2511	0.37555	0.1145:0.0:0.8855:0.0	.	123	Q8NGM8	OR6M1_HUMAN	D	123	ENSP00000311038:A123D	ENSP00000311038:A123D	A	-	2	0	OR6M1	123181900	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	6.085000	0.71343	1.862000	0.54008	0.655000	0.94253	GCT	.	.	none		0.507	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
C3orf35	339883	hgsc.bcm.edu	37	3	37476379	37476379	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr3:37476379C>T	ENST00000328376.5	+	6	1250	c.271C>T	c.(271-273)Cca>Tca	p.P91S	C3orf35_ENST00000481400.1_3'UTR	NM_178339.2	NP_848029.2	Q8IVJ8	APRG1_HUMAN	chromosome 3 open reading frame 35	91						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	11						tgactcaatcccagctgctgg	0.458																																					p.P91S		Atlas-SNP	.											.	C3orf35	21	.	0			c.C271T						PASS	.						34.0	33.0	34.0					3																	37476379		1889	4110	5999	SO:0001583	missense	339883	exon6			TCAATCCCAGCTG	AJ493599	CCDS43065.1, CCDS46792.1	3p22.3	2014-05-22			ENSG00000198590	ENSG00000198590			24082	protein-coding gene	gene with protein product	"""AP20 region protein"", ""APRG1 tumor suppressor candidate"""	611429				12543795	Standard	NM_178342		Approved	APRG1	uc003cha.4	Q8IVJ8	OTTHUMG00000155923	ENST00000328376.5:c.271C>T	3.37:g.37476379C>T	ENSP00000331625:p.Pro91Ser	265.0	0.0	0		248.0	88.0	0.354839	NM_178339	B7ZMA0|Q8IVJ5|Q8IVJ9	Missense_Mutation	SNP	ENST00000328376.5	37	CCDS43065.1	.	.	.	.	.	.	.	.	.	.	c	4.256	0.046572	0.08243	.	.	ENSG00000198590	ENST00000328376	T	0.56611	0.45	0.565	-1.13	0.09775	.	.	.	.	.	T	0.26412	0.0645	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.06405	0.002	T	0.12967	-1.0527	8	0.87932	D	0	.	.	.	.	.	91	Q8IVJ8	APRG1_HUMAN	S	91	ENSP00000331625:P91S	ENSP00000331625:P91S	P	+	1	0	C3orf35	37451383	0.027000	0.19231	0.004000	0.12327	0.004000	0.04260	-0.642000	0.05427	-0.979000	0.03529	-0.970000	0.02610	CCA	.	.	none		0.458	C3orf35-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342344.2	NM_178338	
TTN	7273	hgsc.bcm.edu	37	2	179604859	179604859	+	Missense_Mutation	SNP	C	C	A	rs367656813		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr2:179604859C>A	ENST00000591111.1	-	46	12374	c.12150G>T	c.(12148-12150)aaG>aaT	p.K4050N	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K4367N|TTN_ENST00000342175.6_Missense_Mutation_p.K4196N|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Missense_Mutation_p.K4129N|TTN_ENST00000460472.2_Missense_Mutation_p.K4004N			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGCACTTTCTTTATTGCCA	0.443																																					p.K4367N		Atlas-SNP	.											.	TTN	18412	.	0			c.G13101T						PASS	.	C	ASN/LYS,,ASN/LYS,ASN/LYS	1,3693		0,1,1846	67.0	66.0	66.0		12012,,12387,12588	-3.0	0.0	2		66	0,8188		0,0,4094	no	missense,intron,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	94,,94,94	0,1,5940	AA,AC,CC		0.0,0.0271,0.0084	,,,	4004/26927,,4129/27052,4196/27119	179604859	1,11881	1847	4094	5941	SO:0001583	missense	7273	exon48			CACTTTCTTTATT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12150G>T	2.37:g.179604859C>A	ENSP00000465570:p.Lys4050Asn	107.0	0.0	0		109.0	29.0	0.266055	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	1.754	-0.488428	0.04352	2.71E-4	0.0	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.61859	0.14;0.08;0.07	5.92	-3.05	0.05396	.	.	.	.	.	T	0.29190	0.0726	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.12116	-1.0560	9	0.87932	D	0	.	1.5845	0.02641	0.2937:0.3519:0.1844:0.17	.	4004;4129;4196	D3DPF9;E7EQE6;E7ET18	.;.;.	N	4004;4196;4129;4004	ENSP00000434586:K4004N;ENSP00000340554:K4196N;ENSP00000352154:K4129N	ENSP00000340554:K4196N	K	-	3	2	TTN	179313104	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.294000	0.19047	-1.056000	0.03205	-0.182000	0.12963	AAG	.	.	weak		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PRAMEF11	440560	hgsc.bcm.edu	37	1	12887686	12887686	+	Silent	SNP	T	T	C	rs59802947	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:12887686T>C	ENST00000535591.1	-	3	366	c.171A>G	c.(169-171)agA>agG	p.R57R		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	57					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R57R(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GAAGTTTCCATCTCCTGTGGG	0.468													.|||	5	0.000998403	0.0008	0.0	5008	,	,		21622	0.001		0.0	False		,,,				2504	0.0031				p.R57R		Atlas-SNP	.											PRAMEF11,NS,carcinoma,0,1	PRAMEF11	72	1	1	Substitution - coding silent(1)	endometrium(1)	c.A171G						scavenged	.																																			SO:0001819	synonymous_variant	440560	exon3			TTTCCATCTCCTG	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.171A>G	1.37:g.12887686T>C		9.0	0.0	0		16.0	4.0	0.25	NM_001146344		Silent	SNP	ENST00000535591.1	37	CCDS53268.1																																																																																			T|0.986;C|0.014	0.014	strong		0.468	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
RIMS2	9699	hgsc.bcm.edu	37	8	104831794	104831794	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr8:104831794T>G	ENST00000507740.1	+	1	295	c.59T>G	c.(58-60)gTt>gGt	p.V20G	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000262231.10_Missense_Mutation_p.V20G	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S22fs*10(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTTCATGGGGTTTTTTCATCC	0.343										HNSCC(12;0.0054)																											p.V20G		Atlas-SNP	.											RIMS2_ENST00000507740,colon,carcinoma,+1,1	RIMS2	1357	1	1	Insertion - Frameshift(1)	large_intestine(1)	c.T59G						scavenged	.						103.0	102.0	102.0					8																	104831794		1813	4086	5899	SO:0001583	missense	9699	exon1			ATGGGGTTTTTTC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.59T>G	8.37:g.104831794T>G	ENSP00000423559:p.Val20Gly	114.0	1.0	0.00877193		84.0	22.0	0.261905	NM_014677	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000507740.1	37	CCDS43761.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.865849	0.51588	.	.	ENSG00000176406	ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894	T;T;T;T	0.21932	1.98;2.04;2.05;1.99	5.71	5.71	0.89125	.	.	.	.	.	T	0.11879	0.0289	N	0.08118	0	0.80722	D	1	B;B	0.22683	0.073;0.073	B;B	0.24701	0.055;0.055	T	0.14587	-1.0467	9	0.39692	T	0.17	.	10.3403	0.43873	0.0:0.0731:0.0:0.9269	.	20;20	Q9UQ26-1;Q9UQ26-3	.;.	G	20	ENSP00000425205:V20G;ENSP00000262231:V20G;ENSP00000423559:V20G;ENSP00000386228:V20G	ENSP00000262231:V20G	V	+	2	0	RIMS2	104900970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.646000	0.61411	2.168000	0.68352	0.477000	0.44152	GTT	.	.	none		0.343	RIMS2-005	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367215.1	NM_001100117	
KIAA0196	9897	hgsc.bcm.edu	37	8	126069044	126069044	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr8:126069044G>A	ENST00000318410.7	-	16	2240	c.1891C>T	c.(1891-1893)Cca>Tca	p.P631S	KIAA0196_ENST00000517845.1_Missense_Mutation_p.P483S	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	631					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATGCTTTCTGGGATGATCTGC	0.408																																					p.P631S		Atlas-SNP	.											KIAA0196,NS,malignant_melanoma,0,1	KIAA0196	90	1	0			c.C1891T						PASS	.						156.0	146.0	149.0					8																	126069044		2203	4300	6503	SO:0001583	missense	9897	exon16			TTTCTGGGATGAT		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1891C>T	8.37:g.126069044G>A	ENSP00000318016:p.Pro631Ser	70.0	0.0	0		73.0	23.0	0.315068	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944848	0.92593	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.96300	-3.97;-3.97	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.98457	0.9486	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.995	D	0.99289	1.0898	10	0.87932	D	0	-11.8017	19.4322	0.94775	0.0:0.0:1.0:0.0	.	483;631	E7EQI7;Q12768	.;STRUM_HUMAN	S	631;483	ENSP00000318016:P631S;ENSP00000429676:P483S	ENSP00000318016:P631S	P	-	1	0	KIAA0196	126138226	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.809000	0.99208	2.649000	0.89929	0.655000	0.94253	CCA	.	.	none		0.408	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
PRKG2	5593	hgsc.bcm.edu	37	4	82031675	82031675	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr4:82031675G>T	ENST00000395578.1	-	15	1983	c.1867C>A	c.(1867-1869)Ctc>Atc	p.L623I	PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.L203I|PRKG2_ENST00000264399.1_Missense_Mutation_p.L623I|PRKG2_ENST00000418486.2_Missense_Mutation_p.L594I			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	623	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						CCCTTGTTGAGAATGACTTCA	0.438																																					p.L623I		Atlas-SNP	.											.	PRKG2	195	.	0			c.C1867A						PASS	.						124.0	121.0	122.0					4																	82031675		2203	4300	6503	SO:0001583	missense	5593	exon14			TGTTGAGAATGAC	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1867C>A	4.37:g.82031675G>T	ENSP00000378945:p.Leu623Ile	119.0	0.0	0		98.0	4.0	0.0408163	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.417180	0.62511	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.23	4.39	0.52855	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.060084	0.64402	D	0.000002	T	0.77731	0.4174	M	0.66297	2.02	0.58432	D	0.999998	D;D	0.76494	0.999;0.993	D;D	0.77004	0.984;0.989	T	0.78730	-0.2090	10	0.72032	D	0.01	-12.3911	9.7878	0.40686	0.1593:0.0:0.8407:0.0	.	594;623	E7EPE6;Q13237	.;KGP2_HUMAN	I	623;623;594;203	ENSP00000378945:L623I;ENSP00000264399:L623I;ENSP00000389038:L594I;ENSP00000439967:L203I	ENSP00000264399:L623I	L	-	1	0	PRKG2	82250699	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.122000	0.41987	1.211000	0.43351	0.557000	0.71058	CTC	.	.	none		0.438	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
PTGFRN	5738	hgsc.bcm.edu	37	1	117491909	117491909	+	Missense_Mutation	SNP	C	C	T	rs560392261	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:117491909C>T	ENST00000393203.2	+	4	1075	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	310	Ig-like C2-type 3.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CGATGACGTCCGGCCCGAGGT	0.597													C|||	2	0.000399361	0.0	0.0029	5008	,	,		18404	0.0		0.0	False		,,,				2504	0.0				p.R310W		Atlas-SNP	.											.	PTGFRN	91	.	0			c.C928T						PASS	.						115.0	99.0	105.0					1																	117491909		2203	4300	6503	SO:0001583	missense	5738	exon4			GACGTCCGGCCCG	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.928C>T	1.37:g.117491909C>T	ENSP00000376899:p.Arg310Trp	66.0	0.0	0		58.0	18.0	0.310345	NM_020440	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741688	0.30865	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.65916	-0.18	5.77	2.78	0.32641	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.547984	0.19786	N	0.106117	T	0.43478	0.1249	L	0.27053	0.805	0.09310	N	1	D	0.89917	1.0	P	0.59703	0.862	T	0.28004	-1.0057	10	0.66056	D	0.02	-17.914	4.9405	0.13963	0.1512:0.6227:0.146:0.0801	.	310	Q9P2B2	FPRP_HUMAN	W	310;169	ENSP00000376899:R310W	ENSP00000376899:R310W	R	+	1	2	PTGFRN	117293432	0.445000	0.25657	0.005000	0.12908	0.012000	0.07955	2.573000	0.46007	0.781000	0.33589	-0.254000	0.11334	CGG	.	.	none		0.597	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
USH2A	7399	hgsc.bcm.edu	37	1	216420482	216420482	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:216420482G>T	ENST00000307340.3	-	13	2640	c.2254C>A	c.(2254-2256)Cat>Aat	p.H752N	USH2A_ENST00000366943.2_Missense_Mutation_p.H752N|USH2A_ENST00000366942.3_Missense_Mutation_p.H752N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	752	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTGAGCCATGGAGGTTACAC	0.413										HNSCC(13;0.011)																											p.H752N		Atlas-SNP	.											.	USH2A	1168	.	0			c.C2254A						PASS	.						105.0	108.0	107.0					1																	216420482		2203	4300	6503	SO:0001583	missense	7399	exon13			AGCCATGGAGGTT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2254C>A	1.37:g.216420482G>T	ENSP00000305941:p.His752Asn	143.0	0.0	0		154.0	33.0	0.214286	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880963	0.33255	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.61742	0.08;0.08;0.08	5.89	1.43	0.22495	EGF-like, laminin (3);	0.310145	0.22620	N	0.057702	T	0.45696	0.1355	L	0.34521	1.04	0.28645	N	0.906962	B;P	0.42584	0.041;0.784	B;P	0.45753	0.04;0.492	T	0.33624	-0.9861	10	0.28530	T	0.3	.	6.7169	0.23308	0.2729:0.0:0.6066:0.1205	.	752;752	O75445-2;O75445	.;USH2A_HUMAN	N	752	ENSP00000305941:H752N;ENSP00000355910:H752N;ENSP00000355909:H752N	ENSP00000305941:H752N	H	-	1	0	USH2A	214487105	0.529000	0.26322	0.945000	0.38365	0.997000	0.91878	-0.016000	0.12613	0.393000	0.25203	0.655000	0.94253	CAT	.	.	none		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CDH26	60437	hgsc.bcm.edu	37	20	58587641	58587641	+	Intron	SNP	C	C	T	rs375717739		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr20:58587641C>T	ENST00000244047.5	+	15	2483				CDH26_ENST00000244049.3_Silent_p.S77S|CDH26_ENST00000348616.4_Silent_p.S785S|CDH26_ENST00000350849.6_Silent_p.S118S|CDH26_ENST00000497614.1_3'UTR			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			ACGTCTACAGCGAGGAAGGGG	0.547																																					p.S785S		Atlas-SNP	.											.	CDH26	229	.	0			c.C2355T						PASS	.	C	,	0,4406		0,0,2203	99.0	92.0	94.0		354,2355	-7.6	0.0	20		94	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CDH26	NM_021810.4,NM_177980.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	118/166,785/833	58587641	1,13005	2203	4300	6503	SO:0001627	intron_variant	60437	exon18			CTACAGCGAGGAA	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2172+5799C>T	20.37:g.58587641C>T		84.0	0.0	0		78.0	24.0	0.307692	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	ENST00000244047.5	37																																																																																				.	.	weak		0.547	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
MUC4	4585	hgsc.bcm.edu	37	3	195511131	195511131	+	Silent	SNP	C	C	T	rs71321826		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr3:195511131C>T	ENST00000463781.3	-	2	7779	c.7320G>A	c.(7318-7320)tcG>tcA	p.S2440S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S2440S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCCGAGGAAACGT	0.587																																					p.S2440S		Atlas-SNP	.											.	MUC4	1505	.	0			c.G7320A						PASS	.																																			SO:0001819	synonymous_variant	4585	exon2			GGATGCCGAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7320G>A	3.37:g.195511131C>T		59.0	0.0	0		89.0	7.0	0.0786517	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			C|0.500;T|0.500	0.500	weak		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DYNC1LI2	1783	hgsc.bcm.edu	37	16	66783159	66783159	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:66783159C>T	ENST00000258198.2	-	3	445	c.239G>A	c.(238-240)gGc>gAc	p.G80D	DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.G80D|RP11-61A14.4_ENST00000501143.1_lincRNA|DYNC1LI2_ENST00000443351.2_Missense_Mutation_p.G80D|DYNC1LI2_ENST00000440564.2_Intron	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	80					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TCCTTTTTTGCCATGCTCAGC	0.458																																					p.G80D		Atlas-SNP	.											.	DYNC1LI2	37	.	0			c.G239A						PASS	.						246.0	213.0	224.0					16																	66783159		2200	4300	6500	SO:0001583	missense	1783	exon3			TTTTTGCCATGCT	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.239G>A	16.37:g.66783159C>T	ENSP00000258198:p.Gly80Asp	100.0	0.0	0		88.0	4.0	0.0454545	NM_006141	A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	ENST00000258198.2	37	CCDS10818.1	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377507	0.42105	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000443351	T;T;T	0.28666	1.6;1.6;1.6	4.81	4.81	0.61882	.	0.164538	0.56097	D	0.000039	T	0.13286	0.0322	N	0.03608	-0.345	0.39621	D	0.97003	B;B;B	0.23735	0.0;0.09;0.022	B;B;B	0.29440	0.004;0.01;0.102	T	0.13442	-1.0509	10	0.07175	T	0.84	-23.9298	11.5313	0.50612	0.0:0.9183:0.0:0.0816	.	80;80;80	B4DHD8;B4DZP4;O43237	.;.;DC1L2_HUMAN	D	80	ENSP00000258198:G80D;ENSP00000368795:G80D;ENSP00000394289:G80D	ENSP00000258198:G80D	G	-	2	0	DYNC1LI2	65340660	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.649000	0.54417	2.494000	0.84150	0.455000	0.32223	GGC	.	.	none		0.458	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268846.1	NM_006141	
VN1R2	317701	hgsc.bcm.edu	37	19	53761881	53761881	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:53761881A>C	ENST00000341702.3	+	1	337	c.253A>C	c.(253-255)Acc>Ccc	p.T85P		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	85					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		agagaaacccaccaaacctgt	0.443																																					p.T85P		Atlas-SNP	.											.	VN1R2	71	.	0			c.A253C						PASS	.						43.0	44.0	44.0					19																	53761881		2193	4285	6478	SO:0001583	missense	317701	exon1			AAACCCACCAAAC	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.253A>C	19.37:g.53761881A>C	ENSP00000351244:p.Thr85Pro	109.0	0.0	0		114.0	35.0	0.307018	NM_173856	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	A	3.624	-0.076953	0.07184	.	.	ENSG00000196131	ENST00000341702	T	0.10005	2.92	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38757	-0.9646	9	0.62326	D	0.03	.	2.1718	0.03851	0.506:2.0E-4:1.0E-4:0.4937	.	85	Q8NFZ6	VN1R2_HUMAN	P	85	ENSP00000351244:T85P	ENSP00000351244:T85P	T	+	1	0	VN1R2	58453693	0.001000	0.12720	0.042000	0.18584	0.043000	0.13939	-0.066000	0.11598	0.115000	0.18071	0.113000	0.15668	ACC	.	.	none		0.443	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
CREBBP	1387	hgsc.bcm.edu	37	16	3789597	3789597	+	Missense_Mutation	SNP	C	C	A	rs200616542		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:3789597C>A	ENST00000262367.5	-	25	5071	c.4262G>T	c.(4261-4263)tGc>tTc	p.C1421F	CREBBP_ENST00000382070.3_Missense_Mutation_p.C1383F	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1421	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.C1421Y(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGGAGGGGGGCAATCAGAGCC	0.502			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.C1421F		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	CREBBP,NS,lymphoid_neoplasm,0,1	CREBBP	546	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G4262T						scavenged	.						75.0	70.0	71.0					16																	3789597		2197	4300	6497	SO:0001583	missense	1387	exon25			GGGGGGCAATCAG	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4262G>T	16.37:g.3789597C>A	ENSP00000262367:p.Cys1421Phe	74.0	1.0	0.0135135		76.0	45.0	0.592105	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	c	19.94	3.920342	0.73098	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.93133	-3.17;-3.17	5.36	5.36	0.76844	.	0.128977	0.56097	D	0.000038	D	0.97813	0.9282	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98507	1.0617	10	0.72032	D	0.01	-14.7453	19.4402	0.94817	0.0:1.0:0.0:0.0	.	1451;1421	Q4LE28;Q92793	.;CBP_HUMAN	F	1421;1451;1383;10	ENSP00000262367:C1421F;ENSP00000371502:C1383F	ENSP00000262367:C1421F	C	-	2	0	CREBBP	3729598	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.713000	0.84693	2.665000	0.90641	0.561000	0.74099	TGC	.	.	alt		0.502	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
BHLHB9	80823	hgsc.bcm.edu	37	X	102004884	102004884	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chrX:102004884G>T	ENST00000372735.1	+	4	1546	c.961G>T	c.(961-963)Gat>Tat	p.D321Y	BHLHB9_ENST00000457056.1_Missense_Mutation_p.D321Y|BHLHB9_ENST00000361229.4_Missense_Mutation_p.D321Y|BHLHB9_ENST00000447531.1_Missense_Mutation_p.D321Y|BHLHB9_ENST00000448867.1_Missense_Mutation_p.D321Y			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	321					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATGCTATATGGATTCTGAGGA	0.383																																					p.D321Y		Atlas-SNP	.											.	BHLHB9	60	.	0			c.G961T						PASS	.						83.0	79.0	80.0					X																	102004884		2203	4300	6503	SO:0001583	missense	80823	exon2			TATATGGATTCTG	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.961G>T	X.37:g.102004884G>T	ENSP00000361820:p.Asp321Tyr	179.0	0.0	0		154.0	38.0	0.246753	NM_001142530	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516286	0.27123	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	4.6	0.444	0.16592	Armadillo-type fold (1);	0.425883	0.20121	N	0.098805	T	0.28532	0.0706	L	0.38175	1.15	0.21445	N	0.999684	P	0.43231	0.801	P	0.49999	0.628	T	0.11421	-1.0588	9	.	.	.	-7.4256	6.7343	0.23401	0.5217:0.0:0.4783:0.0	.	321	Q6PI77	BHLH9_HUMAN	Y	321	ENSP00000403226:D321Y;ENSP00000354675:D321Y;ENSP00000405893:D321Y;ENSP00000391722:D321Y;ENSP00000361820:D321Y	.	D	+	1	0	BHLHB9	101891540	0.980000	0.34600	0.331000	0.25455	0.649000	0.38597	0.014000	0.13333	-0.059000	0.13154	-0.269000	0.10298	GAT	.	.	none		0.383	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
ADAM23	8745	hgsc.bcm.edu	37	2	207425911	207425911	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr2:207425911G>A	ENST00000264377.3	+	12	1557	c.1229G>A	c.(1228-1230)cGc>cAc	p.R410H	ADAM23_ENST00000374416.1_Missense_Mutation_p.R410H|ADAM23_ENST00000374415.3_Missense_Mutation_p.R410H	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	410	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R410H(2)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GTCTGTTCTCGCACAAGAGGA	0.413																																					p.R410H	Melanoma(194;1127 2130 19620 24042 27855)	Atlas-SNP	.											ADAM23_ENST00000374416,NS,carcinoma,0,2	ADAM23	239	2	2	Substitution - Missense(2)	prostate(2)	c.G1229A						PASS	.						155.0	160.0	158.0					2																	207425911		2203	4300	6503	SO:0001583	missense	8745	exon12			GTTCTCGCACAAG	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1229G>A	2.37:g.207425911G>A	ENSP00000264377:p.Arg410His	199.0	0.0	0		139.0	6.0	0.0431655	NM_003812	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.409037	0.42715	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.09630	2.96;2.96;2.96	5.92	3.8	0.43715	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.382911	0.21835	N	0.068402	T	0.06096	0.0158	N	0.17082	0.46	0.29434	N	0.859679	B	0.02656	0.0	B	0.04013	0.001	T	0.14420	-1.0473	10	0.34782	T	0.22	.	6.0539	0.19800	0.1747:0.0:0.6327:0.1926	.	410	O75077	ADA23_HUMAN	H	410;410;304;410	ENSP00000264377:R410H;ENSP00000363537:R410H;ENSP00000363536:R410H	ENSP00000264377:R410H	R	+	2	0	ADAM23	207134156	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	0.937000	0.28951	1.498000	0.48600	0.655000	0.94253	CGC	.	.	none		0.413	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	
CCDC132	55610	hgsc.bcm.edu	37	7	92887682	92887682	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr7:92887682T>C	ENST00000305866.5	+	8	682	c.554T>C	c.(553-555)gTa>gCa	p.V185A	CCDC132_ENST00000251739.5_Missense_Mutation_p.V185A|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000544910.1_Missense_Mutation_p.V155A|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000541136.1_5'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	185						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AGAACAGATGTACGGTTAAGT	0.303																																					p.V185A		Atlas-SNP	.											.	CCDC132	136	.	0			c.T554C						PASS	.						117.0	121.0	120.0					7																	92887682		2203	4300	6503	SO:0001583	missense	55610	exon8			CAGATGTACGGTT	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.554T>C	7.37:g.92887682T>C	ENSP00000307666:p.Val185Ala	255.0	0.0	0		281.0	61.0	0.217082	NM_024553	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106232	0.77096	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000458530	.	.	.	5.5	5.5	0.81552	Vacuolar protein sorting-associated protein 54 (1);	0.061028	0.64402	D	0.000004	T	0.60327	0.2260	L	0.46157	1.445	0.80722	D	1	P;P;B	0.51147	0.541;0.942;0.2	B;P;B	0.53549	0.329;0.729;0.049	T	0.55237	-0.8172	9	0.08837	T	0.75	-16.6226	15.9126	0.79482	0.0:0.0:0.0:1.0	.	155;185;185	F5H5U7;Q96JG6;Q96JG6-2	.;CC132_HUMAN;.	A	185;185;155;184	.	ENSP00000251739:V185A	V	+	2	0	CCDC132	92725618	1.000000	0.71417	0.980000	0.43619	0.955000	0.61496	8.040000	0.89188	2.222000	0.72286	0.477000	0.44152	GTA	.	.	none		0.303	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155920171	155920171	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:155920171G>A	ENST00000361247.4	-	21	2905	c.2806C>T	c.(2806-2808)Cgg>Tgg	p.R936W	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.R908W|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.R908W|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.R981W|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.R937W|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.R935W	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	936					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTTGCAGCCGCTCTTCGGGG	0.627																																					p.R936W	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											.	ARHGEF2	81	.	0			c.C2806T						PASS	.						58.0	55.0	56.0					1																	155920171		2203	4300	6503	SO:0001583	missense	9181	exon21			GCAGCCGCTCTTC	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2806C>T	1.37:g.155920171G>A	ENSP00000354837:p.Arg936Trp	65.0	0.0	0		72.0	16.0	0.222222	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300726	0.40694	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.69561	-0.4;-0.28;-0.29;-0.4;-0.41	5.98	5.06	0.68205	.	0.177972	0.27319	N	0.019911	T	0.42877	0.1222	N	0.19112	0.55	0.33849	D	0.632384	D;P;P;D	0.60575	0.975;0.916;0.95;0.988	B;B;P;B	0.46275	0.312;0.312;0.51;0.386	T	0.54111	-0.8342	10	0.62326	D	0.03	-22.727	12.5577	0.56263	0.0:0.0:0.8335:0.1665	.	980;936;935;937	D3DVA5;Q92974;Q92974-2;Q5VY93	.;ARHG2_HUMAN;.;.	W	908;936;937;908;935	ENSP00000315325:R908W;ENSP00000354837:R936W;ENSP00000357298:R937W;ENSP00000357299:R908W;ENSP00000314787:R935W	ENSP00000314787:R935W	R	-	1	2	ARHGEF2	154186795	1.000000	0.71417	0.973000	0.42090	0.242000	0.25591	4.760000	0.62235	1.518000	0.48934	-0.181000	0.13052	CGG	.	.	none		0.627	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
LAMA3	3909	hgsc.bcm.edu	37	18	21394444	21394444	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr18:21394444A>C	ENST00000313654.9	+	15	2107	c.1866A>C	c.(1864-1866)aaA>aaC	p.K622N	LAMA3_ENST00000399516.3_Missense_Mutation_p.K622N	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	622	Domain V.|Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATCTGGACAAAGAAAACCCCA	0.363																																					p.K622N		Atlas-SNP	.											.	LAMA3	397	.	0			c.A1866C						PASS	.						140.0	129.0	132.0					18																	21394444		1812	4088	5900	SO:0001583	missense	3909	exon15			GGACAAAGAAAAC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1866A>C	18.37:g.21394444A>C	ENSP00000324532:p.Lys622Asn	152.0	0.0	0		139.0	52.0	0.374101	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	11.46	1.645160	0.29246	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.54071	0.59;0.59	5.64	0.566	0.17317	EGF-like, laminin (3);	.	.	.	.	T	0.42381	0.1200	M	0.72118	2.19	0.80722	D	1	P;P	0.36392	0.551;0.551	B;B	0.31390	0.084;0.129	T	0.21484	-1.0244	9	0.21014	T	0.42	.	6.9004	0.24279	0.6634:0.1273:0.2093:0.0	.	622;622	Q6VU67;Q16787	.;LAMA3_HUMAN	N	622;622;620	ENSP00000324532:K622N;ENSP00000382432:K622N	ENSP00000324532:K622N	K	+	3	2	LAMA3	19648442	0.055000	0.20627	0.862000	0.33874	0.712000	0.41017	0.579000	0.23788	0.432000	0.26286	-0.256000	0.11100	AAA	.	.	none		0.363	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ARMC5	79798	hgsc.bcm.edu	37	16	31473872	31473872	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:31473872G>A	ENST00000563544.1	+	4	1550	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	ARMC5_ENST00000408912.3_Missense_Mutation_p.R430Q|ARMC5_ENST00000538189.1_Missense_Mutation_p.R367Q|RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000457010.2_Missense_Mutation_p.R335Q|ARMC5_ENST00000268314.4_Missense_Mutation_p.R335Q|ARMC5_ENST00000412665.2_Intron			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	335										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CGGCAGCGCCGGGATCCTAAT	0.647																																					p.R335Q		Atlas-SNP	.											ARMC5_ENST00000457010,NS,carcinoma,+1,2	ARMC5	94	2	0			c.G1004A						PASS	.						36.0	41.0	39.0					16																	31473872		1998	4168	6166	SO:0001583	missense	79798	exon3			AGCGCCGGGATCC	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1004G>A	16.37:g.31473872G>A	ENSP00000456877:p.Arg335Gln	17.0	0.0	0		26.0	10.0	0.384615	NM_024742	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	.	.	.	.	.	.	.	.	.	.	g	13.89	2.371251	0.42003	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	4.8	4.8	0.61643	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.53938	D	0.000055	T	0.31009	0.0783	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;P	0.72982	0.979;0.979;0.979;0.895	T	0.02596	-1.1136	10	0.15066	T	0.55	-5.4148	13.3511	0.60603	0.0:0.0:1.0:0.0	.	367;430;335;335	F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;ARMC5_HUMAN;.	Q	430;367;335;335	ENSP00000386125:R430Q;ENSP00000443995:R367Q;ENSP00000268314:R335Q;ENSP00000399561:R335Q	ENSP00000268314:R335Q	R	+	2	0	ARMC5	31381373	0.993000	0.37304	0.894000	0.35097	0.044000	0.14063	3.649000	0.54417	2.217000	0.71921	0.457000	0.33378	CGG	.	.	none		0.647	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
CLASP2	23122	hgsc.bcm.edu	37	3	33552202	33552202	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr3:33552202C>T	ENST00000468888.2	-	37	4235	c.4189G>A	c.(4189-4191)Gag>Aag	p.E1397K	CLASP2_ENST00000480013.1_Missense_Mutation_p.E1176K|CLASP2_ENST00000359576.5_Missense_Mutation_p.E1388K|CLASP2_ENST00000461133.3_Missense_Mutation_p.E1156K|CLASP2_ENST00000307312.7_Missense_Mutation_p.E878K|CLASP2_ENST00000399362.4_Missense_Mutation_p.E1396K|CLASP2_ENST00000539981.1_3'UTR			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1177					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ATGCACTGCTCTGGACTAATT	0.383																																					p.E1398K		Atlas-SNP	.											.	CLASP2	138	.	0			c.G4192A						PASS	.						97.0	84.0	88.0					3																	33552202		1950	4153	6103	SO:0001583	missense	23122	exon37			ACTGCTCTGGACT	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4189G>A	3.37:g.33552202C>T	ENSP00000419974:p.Glu1397Lys	191.0	0.0	0		160.0	49.0	0.30625	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	C	29.9	5.044175	0.93685	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000480013;ENST00000461133	T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	6.08	6.08	0.98989	.	0.099158	0.64402	D	0.000002	T	0.72653	0.3487	M	0.71581	2.175	0.58432	D	0.999999	B;P	0.35050	0.449;0.482	B;B	0.42593	0.107;0.392	T	0.65865	-0.6064	10	0.15952	T	0.53	-20.1545	20.6634	0.99662	0.0:1.0:0.0:0.0	.	1388;1396	F5H604;E7ERI8	.;.	K	1397;1396;1388;878;1176;1156	ENSP00000419974:E1397K;ENSP00000382297:E1396K;ENSP00000352581:E1388K;ENSP00000304743:E878K;ENSP00000417518:E1176K;ENSP00000419305:E1156K	ENSP00000304743:E878K	E	-	1	0	CLASP2	33527206	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.506000	0.81665	2.894000	0.99253	0.655000	0.94253	GAG	.	.	none		0.383	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
GATA3	2625	hgsc.bcm.edu	37	10	8100789	8100789	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr10:8100789G>A	ENST00000346208.3	+	3	1218	c.763G>A	c.(763-765)Gcc>Acc	p.A255T	GATA3_ENST00000379328.3_Missense_Mutation_p.A255T|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	255					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CAGGCCCAAGGCCCGGTCCAG	0.672			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.A255T		Atlas-SNP	.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3	182	.	0			c.G763A						PASS	.						22.0	26.0	25.0					10																	8100789		2200	4297	6497	SO:0001583	missense	2625	exon3			CCCAAGGCCCGGT	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.763G>A	10.37:g.8100789G>A	ENSP00000341619:p.Ala255Thr	13.0	0.0	0		13.0	4.0	0.307692	NM_002051	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	G	9.949	1.219508	0.22373	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99683	-4.03;-6.39	5.55	5.55	0.83447	.	0.114990	0.64402	D	0.000016	D	0.97108	0.9055	N	0.03983	-0.305	0.42059	D	0.991155	B;B	0.12630	0.001;0.006	B;B	0.13407	0.002;0.009	D	0.97432	1.0016	10	0.10377	T	0.69	-29.272	12.7969	0.57564	0.0747:0.0:0.9253:0.0	.	255;255	P23771;P23771-2	GATA3_HUMAN;.	T	255	ENSP00000368632:A255T;ENSP00000341619:A255T	ENSP00000341619:A255T	A	+	1	0	GATA3	8140795	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.681000	0.68175	2.607000	0.88179	0.561000	0.74099	GCC	.	.	none		0.672	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
MUC2	4583	hgsc.bcm.edu	37	11	1093424	1093424	+	Missense_Mutation	SNP	C	C	G	rs111642532		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr11:1093424C>G	ENST00000441003.2	+	30	5270	c.5243C>G	c.(5242-5244)aCc>aGc	p.T1748S	MUC2_ENST00000333592.6_Missense_Mutation_p.T36S|MUC2_ENST00000359061.5_Missense_Mutation_p.T1715S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1748S(1)|p.T1715S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacccatcaccaccaccacc	0.637																																					p.T1748S		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	2	2	Substitution - Missense(2)	prostate(2)	c.C5243G						scavenged	.						207.0	236.0	226.0					11																	1093424		2049	3988	6037	SO:0001583	missense	4583	exon30			CCATCACCACCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5243C>G	11.37:g.1093424C>G	ENSP00000415183:p.Thr1748Ser	67.0	1.0	0.0149254		64.0	3.0	0.046875	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.295	-0.977665	0.02197	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.12361	2.69;2.92;2.86	0.891	0.891	0.19224	.	2587.360000	0.00953	N	0.002994	T	0.11324	0.0276	.	.	.	0.09310	N	1	B	0.26876	0.162	B	0.17979	0.02	T	0.28681	-1.0036	9	0.49607	T	0.09	.	7.6247	0.28206	0.0:1.0:0.0:0.0	.	1748	E7EUV1	.	S	1748;1715;36	ENSP00000415183:T1748S;ENSP00000351956:T1715S;ENSP00000331373:T36S	ENSP00000331373:T36S	T	+	2	0	MUC2	1083424	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	0.014000	0.13333	0.801000	0.34066	0.195000	0.17529	ACC	C|0.500;G|0.500	0.500	weak		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SLITRK2	84631	hgsc.bcm.edu	37	X	144905286	144905286	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chrX:144905286G>A	ENST00000370490.1	+	1	5598	c.1343G>A	c.(1342-1344)aGc>aAc	p.S448N	SLITRK2_ENST00000428560.2_Missense_Mutation_p.S448N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.S448N|SLITRK2_ENST00000434188.2_Missense_Mutation_p.S448N|SLITRK2_ENST00000447897.2_Missense_Mutation_p.S448N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	448					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.S448I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGACTGCAGAGCTTGCAATAT	0.393																																					p.S448N		Atlas-SNP	.											.	SLITRK2	221	.	1	Substitution - Missense(1)	lung(1)	c.G1343A						PASS	.						137.0	142.0	140.0					X																	144905286		2203	4300	6503	SO:0001583	missense	84631	exon5			TGCAGAGCTTGCA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1343G>A	X.37:g.144905286G>A	ENSP00000359521:p.Ser448Asn	133.0	0.0	0		120.0	37.0	0.308333	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.344294	0.24339	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17	5.5	5.5	0.81552	.	0.207561	0.46758	D	0.000261	T	0.39545	0.1082	N	0.05078	-0.115	0.50313	D	0.999865	P	0.40066	0.701	P	0.44946	0.465	T	0.39961	-0.9588	10	0.02654	T	1	-11.1755	15.6243	0.76840	0.0:0.0:1.0:0.0	.	448	Q9H156	SLIK2_HUMAN	N	448	ENSP00000334374:S448N;ENSP00000411681:S448N;ENSP00000359521:S448N;ENSP00000397015:S448N;ENSP00000407347:S448N;ENSP00000412010:S448N	ENSP00000334374:S448N	S	+	2	0	SLITRK2	144712978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.233000	0.72320	2.285000	0.76669	0.600000	0.82982	AGC	.	.	none		0.393	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
CEP131	22994	hgsc.bcm.edu	37	17	79173545	79173545	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:79173545G>T	ENST00000269392.4	-	9	1244	c.997C>A	c.(997-999)Cgc>Agc	p.R333S	AZI1_ENST00000450824.2_Missense_Mutation_p.R333S|AZI1_ENST00000570482.2_5'Flank|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000374782.3_Missense_Mutation_p.R333S|AZI1_ENST00000575907.1_Missense_Mutation_p.R333S	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		333					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTGGCTTGGCGTGCCTTCTCC	0.692																																					p.R333S		Atlas-SNP	.											.	AZI1	145	.	0			c.C997A						PASS	.						63.0	56.0	58.0					17																	79173545		2201	4297	6498	SO:0001583	missense	22994	exon9			CTTGGCGTGCCTT																												ENST00000269392.4:c.997C>A	17.37:g.79173545G>T	ENSP00000269392:p.Arg333Ser	25.0	0.0	0		45.0	4.0	0.0888889	NM_014984	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37		.	.	.	.	.	.	.	.	.	.	G	17.28	3.349810	0.61183	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.26518	1.73;1.73;1.73	3.67	3.67	0.42095	.	0.060253	0.64402	D	0.000002	T	0.48732	0.1516	M	0.70275	2.135	0.51012	D	0.999904	D;D;D;D	0.76494	0.997;0.997;0.999;0.969	D;D;D;P	0.68765	0.917;0.917;0.96;0.806	T	0.56329	-0.7997	10	0.72032	D	0.01	-13.0848	15.5205	0.75862	0.0:0.0:1.0:0.0	.	333;333;333;333	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	S	333	ENSP00000393583:R333S;ENSP00000363914:R333S;ENSP00000269392:R333S	ENSP00000269392:R333S	R	-	1	0	AZI1	76788140	1.000000	0.71417	0.916000	0.36221	0.034000	0.12701	5.139000	0.64801	2.038000	0.60285	0.313000	0.20887	CGC	.	.	none		0.692	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
ITGA5	3678	hgsc.bcm.edu	37	12	54795600	54795600	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr12:54795600C>T	ENST00000293379.4	-	22	2527	c.2266G>A	c.(2266-2268)Gac>Aac	p.D756N	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	756					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TTCTTAGTGTCCCGGAGATGA	0.567																																					p.D756N		Atlas-SNP	.											.	ITGA5	99	.	0			c.G2266A						PASS	.						104.0	103.0	104.0					12																	54795600		2203	4300	6503	SO:0001583	missense	3678	exon22			TAGTGTCCCGGAG		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2266G>A	12.37:g.54795600C>T	ENSP00000293379:p.Asp756Asn	94.0	0.0	0		106.0	42.0	0.396226	NM_002205	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906611	0.92107	.	.	ENSG00000161638	ENST00000293379	T	0.45668	0.89	5.15	5.15	0.70609	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55477	-0.8135	10	0.44086	T	0.13	.	16.4804	0.84157	0.0:1.0:0.0:0.0	.	756	P08648	ITA5_HUMAN	N	756	ENSP00000293379:D756N	ENSP00000293379:D756N	D	-	1	0	ITGA5	53081867	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	6.874000	0.75546	2.567000	0.86603	0.655000	0.94253	GAC	.	.	none		0.567	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
OR7A10	390892	hgsc.bcm.edu	37	19	14951929	14951929	+	Missense_Mutation	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:14951929G>T	ENST00000248058.1	-	1	760	c.761C>A	c.(760-762)aCa>aAa	p.T254K		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					CCCTAAGCATGTACCATAAAA	0.493																																					p.T254K		Atlas-SNP	.											OR7A10,NS,carcinoma,-1,1	OR7A10	33	1	0			c.C761A						PASS	.						103.0	88.0	93.0					19																	14951929		2203	4300	6503	SO:0001583	missense	390892	exon1			AAGCATGTACCAT		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.761C>A	19.37:g.14951929G>T	ENSP00000248058:p.Thr254Lys	112.0	0.0	0		92.0	30.0	0.326087	NM_001005190	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	g	14.39	2.519896	0.44866	.	.	ENSG00000127515	ENST00000248058	T	0.00287	8.29	2.75	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40144	U	0.001177	T	0.01092	0.0036	H	0.98754	4.32	0.09310	N	1	D	0.64830	0.994	D	0.68943	0.961	T	0.24657	-1.0154	10	0.87932	D	0	.	9.5406	0.39248	0.0:0.2179:0.7821:0.0	.	254	O76100	OR7AA_HUMAN	K	254	ENSP00000248058:T254K	ENSP00000248058:T254K	T	-	2	0	OR7A10	14812929	0.008000	0.16893	0.001000	0.08648	0.236000	0.25371	1.536000	0.36072	0.499000	0.27970	0.134000	0.15878	ACA	.	.	none		0.493	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
SEMA5A	9037	hgsc.bcm.edu	37	5	9052036	9052036	+	Missense_Mutation	SNP	C	C	T	rs139882587		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr5:9052036C>T	ENST00000382496.5	-	20	3459	c.2794G>A	c.(2794-2796)Ggg>Agg	p.G932R	MIR4636_ENST00000582271.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	932	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTGGTGTTCCCGGAGCACTGG	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		17425	0.0		0.0	False		,,,				2504	0.001				p.G932R		Atlas-SNP	.											SEMA5A,colon,carcinoma,+2,1	SEMA5A	236	1	0			c.G2794A						PASS	.	C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	46.0	48.0	47.0		2794	4.2	0.6	5	dbSNP_134	47	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SEMA5A	NM_003966.2	125	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	932/1075	9052036	3,13003	2203	4300	6503	SO:0001583	missense	9037	exon20			TGTTCCCGGAGCA	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2794G>A	5.37:g.9052036C>T	ENSP00000371936:p.Gly932Arg	163.0	0.0	0		137.0	44.0	0.321168	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566959	0.65651	2.27E-4	2.33E-4	ENSG00000112902	ENST00000382496	T	0.22945	1.93	5.12	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.62233	0.2411	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73360	-0.4007	10	0.87932	D	0	.	11.7168	0.51659	0.0:0.9131:0.0:0.0869	.	932	Q13591	SEM5A_HUMAN	R	932	ENSP00000371936:G932R	ENSP00000371936:G932R	G	-	1	0	SEMA5A	9105036	1.000000	0.71417	0.601000	0.28877	0.266000	0.26442	7.573000	0.82421	1.287000	0.44583	0.655000	0.94253	GGG	C|1.000;T|0.000	0.000	strong		0.552	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
MAN1B1	11253	hgsc.bcm.edu	37	9	139981546	139981546	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr9:139981546C>T	ENST00000371589.4	+	1	168	c.95C>T	c.(94-96)gCc>gTc	p.A32V	AL807752.1_ENST00000596585.1_5'Flank|MAN1B1_ENST00000474902.1_5'Flank	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	32					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TGGGCCGTCGCCACCACTGTA	0.652																																					p.A32V		Atlas-SNP	.											.	MAN1B1	40	.	0			c.C95T						PASS	.						10.0	13.0	12.0					9																	139981546		2178	4265	6443	SO:0001583	missense	11253	exon1			CCGTCGCCACCAC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.95C>T	9.37:g.139981546C>T	ENSP00000360645:p.Ala32Val	43.0	0.0	0		48.0	12.0	0.25	NM_016219	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	ENST00000371589.4	37	CCDS7029.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382251	0.24944	.	.	ENSG00000177239	ENST00000371589	T	0.74106	-0.81	3.33	-0.544	0.11847	.	.	.	.	.	T	0.48660	0.1512	N	0.08118	0	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.36237	-0.9756	9	0.72032	D	0.01	.	2.3432	0.04265	0.404:0.2871:0.0:0.3089	.	32	Q9UKM7	MA1B1_HUMAN	V	32	ENSP00000360645:A32V	ENSP00000360645:A32V	A	+	2	0	MAN1B1	139101367	0.002000	0.14202	0.000000	0.03702	0.031000	0.12232	0.358000	0.20216	-0.242000	0.09667	0.462000	0.41574	GCC	.	.	none		0.652	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
HS3ST2	9956	hgsc.bcm.edu	37	16	22826243	22826243	+	Silent	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:22826243C>T	ENST00000261374.3	+	1	746	c.312C>T	c.(310-312)tcC>tcT	p.S104S		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	104					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		CCAACCACTCCGGCTCACCCA	0.716																																					p.S104S		Atlas-SNP	.											.	HS3ST2	59	.	0			c.C312T						PASS	.						7.0	9.0	8.0					16																	22826243		2158	4266	6424	SO:0001819	synonymous_variant	9956	exon1			CCACTCCGGCTCA	AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.312C>T	16.37:g.22826243C>T		47.0	0.0	0		66.0	21.0	0.318182	NM_006043	Q52LZ1	Silent	SNP	ENST00000261374.3	37	CCDS10606.1																																																																																			.	.	none		0.716	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274172	39274172	+	Silent	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:39274172G>T	ENST00000391413.2	-	1	434	c.396C>A	c.(394-396)ccC>ccA	p.P132P		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	132	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ggcagcaggtgggctggcagc	0.672																																					p.P132P		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,-2,2	KRTAP4-11	94	2	0			c.C396A						scavenged	.						7.0	12.0	11.0					17																	39274172		675	1578	2253	SO:0001819	synonymous_variant	653240	exon1			GCAGGTGGGCTGG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.396C>A	17.37:g.39274172G>T		68.0	1.0	0.0147059		64.0	3.0	0.046875	NM_033059	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																			.	.	none		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
FBXO18	84893	hgsc.bcm.edu	37	10	5960434	5960434	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr10:5960434T>C	ENST00000362091.4	+	13	2208	c.2093T>C	c.(2092-2094)cTc>cCc	p.L698P	FBXO18_ENST00000397269.3_Missense_Mutation_p.L185P|FBXO18_ENST00000379999.5_Missense_Mutation_p.L749P	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	698					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GTCTTCTATCTCACGCAGGTA	0.567																																					p.L749P		Atlas-SNP	.											.	FBXO18	108	.	0			c.T2246C						PASS	.						129.0	107.0	114.0					10																	5960434		2203	4300	6503	SO:0001583	missense	84893	exon14			TCTATCTCACGCA	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2093T>C	10.37:g.5960434T>C	ENSP00000355415:p.Leu698Pro	41.0	0.0	0		64.0	4.0	0.0625	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.736778	0.89482	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	D;D;D	0.96685	-4.09;-4.09;-4.09	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.99094	1.0841	10	0.87932	D	0	-22.7842	15.9978	0.80265	0.0:0.0:0.0:1.0	.	749;698;624	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	P	185;698;749	ENSP00000380439:L185P;ENSP00000355415:L698P;ENSP00000369335:L749P	ENSP00000355415:L698P	L	+	2	0	FBXO18	6000440	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.130000	0.77235	2.252000	0.74401	0.529000	0.55759	CTC	.	.	none		0.567	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
ANKRD11	29123	hgsc.bcm.edu	37	16	89352567	89352567	+	Missense_Mutation	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr16:89352567C>T	ENST00000301030.4	-	8	1232	c.772G>A	c.(772-774)Ggg>Agg	p.G258R	ANKRD11_ENST00000378330.2_Missense_Mutation_p.G258R	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	258					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGCGGGTTCCCTCCGTACCGC	0.582																																					p.G258R		Atlas-SNP	.											.	ANKRD11	195	.	0			c.G772A						PASS	.						122.0	121.0	121.0					16																	89352567		2198	4300	6498	SO:0001583	missense	29123	exon8			GGTTCCCTCCGTA	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.772G>A	16.37:g.89352567C>T	ENSP00000301030:p.Gly258Arg	38.0	0.0	0		53.0	19.0	0.358491	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	C	35	5.557873	0.96514	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.65178	-0.14;-0.14	6.11	6.11	0.99139	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.75133	0.3808	L	0.41906	1.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75068	-0.3448	10	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	258	Q6UB99	ANR11_HUMAN	R	258;258;272	ENSP00000301030:G258R;ENSP00000367581:G258R	ENSP00000301030:G258R	G	-	1	0	ANKRD11	87880068	1.000000	0.71417	0.756000	0.31282	0.773000	0.43773	7.527000	0.81931	2.906000	0.99361	0.655000	0.94253	GGG	.	.	none		0.582	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
TYR	7299	hgsc.bcm.edu	37	11	88911368	88911368	+	Missense_Mutation	SNP	G	G	A	rs149684917		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr11:88911368G>A	ENST00000263321.5	+	1	749	c.247G>A	c.(247-249)Gtc>Atc	p.V83I	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	83					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GTGGCCTTCCGTCTTTTATAA	0.512																																					p.V83I		Atlas-SNP	.											.	TYR	130	.	0			c.G247A						PASS	.	G	ILE/VAL	0,4402		0,0,2201	43.0	42.0	43.0		247	3.2	0.5	11	dbSNP_134	43	1,8597	1.2+/-3.3	0,1,4298	no	missense	TYR	NM_000372.4	29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	benign	83/530	88911368	1,12999	2201	4299	6500	SO:0001583	missense	7299	exon1			CCTTCCGTCTTTT	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.247G>A	11.37:g.88911368G>A	ENSP00000263321:p.Val83Ile	63.0	0.0	0		64.0	24.0	0.375	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	8.247	0.808214	0.16467	0.0	1.16E-4	ENSG00000077498	ENST00000263321	D	0.83591	-1.74	6.07	3.24	0.37175	Uncharacterised domain, di-copper centre (2);	0.232469	0.43919	N	0.000506	D	0.82834	0.5123	M	0.80508	2.5	0.35898	D	0.830158	B	0.21520	0.057	B	0.18561	0.022	T	0.80625	-0.1299	9	.	.	.	.	15.4391	0.75168	0.1263:0.0:0.8737:0.0	.	83	P14679	TYRO_HUMAN	I	83	ENSP00000263321:V83I	.	V	+	1	0	TYR	88551016	1.000000	0.71417	0.451000	0.26982	0.487000	0.33371	5.367000	0.66127	0.462000	0.27095	-0.940000	0.02684	GTC	G|1.000;A|0.000	0.000	weak		0.512	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
PYGB	5834	hgsc.bcm.edu	37	20	25264786	25264786	+	Missense_Mutation	SNP	T	T	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr20:25264786T>C	ENST00000216962.4	+	14	1777	c.1667T>C	c.(1666-1668)gTg>gCg	p.V556A		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	556					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GAGTACAAGGTGAAGATCAAC	0.537																																					p.V556A		Atlas-SNP	.											.	PYGB	84	.	0			c.T1667C						PASS	.						216.0	150.0	173.0					20																	25264786		2203	4300	6503	SO:0001583	missense	5834	exon14			ACAAGGTGAAGAT		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1667T>C	20.37:g.25264786T>C	ENSP00000216962:p.Val556Ala	114.0	0.0	0		87.0	25.0	0.287356	NM_002862	Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.498726	0.64298	.	.	ENSG00000100994	ENST00000216962	D	0.95069	-3.6	3.86	3.86	0.44501	.	0.060202	0.64402	D	0.000005	D	0.95802	0.8634	M	0.90870	3.155	0.80722	D	1	B	0.28208	0.203	B	0.37601	0.254	D	0.96223	0.9162	10	0.87932	D	0	-22.5788	12.7816	0.57480	0.0:0.0:0.0:1.0	.	556	P11216	PYGB_HUMAN	A	556	ENSP00000216962:V556A	ENSP00000216962:V556A	V	+	2	0	PYGB	25212786	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.626000	0.83164	1.761000	0.52028	0.379000	0.24179	GTG	.	.	none		0.537	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
MYO18A	399687	hgsc.bcm.edu	37	17	27448927	27448927	+	Missense_Mutation	SNP	C	C	T	rs201811476	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr17:27448927C>T	ENST00000527372.1	-	4	1316	c.1136G>A	c.(1135-1137)cGt>cAt	p.R379H	MYO18A_ENST00000354329.4_Missense_Mutation_p.R379H|MYO18A_ENST00000533112.1_Missense_Mutation_p.R379H|MYO18A_ENST00000531253.1_Missense_Mutation_p.R379H	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	379	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CAGCTTCACACGCACCTTCCC	0.612													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18179	0.0		0.001	False		,,,				2504	0.0				p.R379H	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.G1136A						PASS	.	C	HIS/ARG,HIS/ARG	1,4183		0,1,2091	112.0	113.0	113.0		1136,1136	5.6	1.0	17		113	0,8444		0,0,4222	no	missense,missense	MYO18A	NM_078471.3,NM_203318.1	29,29	0,1,6313	TT,TC,CC		0.0,0.0239,0.0079	probably-damaging,probably-damaging	379/2055,379/2040	27448927	1,12627	2092	4222	6314	SO:0001583	missense	399687	exon4			TTCACACGCACCT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1136G>A	17.37:g.27448927C>T	ENSP00000437073:p.Arg379His	58.0	0.0	0		49.0	17.0	0.346939	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	21.6	4.171334	0.78452	2.39E-4	0.0	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000531686	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	5.64	5.64	0.86602	.	0.054581	0.64402	D	0.000001	T	0.69160	0.3080	L	0.46157	1.445	0.37405	D	0.91299	P;D;D;D	0.63046	0.873;0.983;0.983;0.992	B;P;P;P	0.51582	0.26;0.674;0.584;0.477	T	0.74393	-0.3680	10	0.54805	T	0.06	.	7.7622	0.28959	0.0:0.8021:0.0:0.1979	.	48;379;379;379	Q92614-2;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	H	379;379;379;379;379;59	ENSP00000346291:R379H;ENSP00000435932:R379H;ENSP00000434228:R379H;ENSP00000437073:R379H	ENSP00000346291:R379H	R	-	2	0	MYO18A	24473053	0.999000	0.42202	0.963000	0.40424	0.991000	0.79684	3.661000	0.54503	2.655000	0.90218	0.655000	0.94253	CGT	C|0.999;T|0.001	0.001	strong		0.612	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
IKBKB	3551	hgsc.bcm.edu	37	8	42176069	42176069	+	Splice_Site	SNP	G	G	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr8:42176069G>T	ENST00000520810.1	+	13	1426		c.e13-1		IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000379708.3_Splice_Site|IKBKB_ENST00000520835.1_Splice_Site|IKBKB_ENST00000416505.2_Splice_Site	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta						B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TCTGTCTCCAGTTCAAGAGCC	0.493																																					.		Atlas-SNP	.											.	IKBKB	88	.	0			c.1064-1G>T						PASS	.						89.0	86.0	87.0					8																	42176069		2203	4300	6503	SO:0001630	splice_region_variant	3551	exon12			TCTCCAGTTCAAG	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.1241-1G>T	8.37:g.42176069G>T		95.0	0.0	0		132.0	39.0	0.295455	NM_001242778	B4DZ30|B4E0U4|O75327	Splice_Site	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124132	0.77436	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6681	0.95900	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IKBKB	42295226	1.000000	0.71417	0.997000	0.53966	0.841000	0.47740	7.789000	0.85783	2.740000	0.93945	0.555000	0.69702	.	.	.	none		0.493	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		Intron
SMARCA2	6595	hgsc.bcm.edu	37	9	2039776	2039776	+	Silent	SNP	A	A	G	rs376509101|rs13296987	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr9:2039776A>G	ENST00000382203.1	+	4	875	c.666A>G	c.(664-666)caA>caG	p.Q222Q	SMARCA2_ENST00000382194.1_Silent_p.Q222Q|SMARCA2_ENST00000357248.2_Silent_p.Q222Q|SMARCA2_ENST00000349721.2_Silent_p.Q222Q|RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000491574.1_3'UTR			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	222	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcaacagcagcagc	0.637													A|||	80	0.0159744	0.0333	0.0029	5008	,	,		13171	0.001		0.004	False		,,,				2504	0.0297				p.Q222Q		Atlas-SNP	.											SMARCA2_ENST00000349721,NS,carcinoma,0,2	SMARCA2	313	2	0			c.A666G						PASS	.						12.0	14.0	13.0					9																	2039776		2197	4275	6472	SO:0001819	synonymous_variant	6595	exon4			GCAGCAACAGCAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.666A>G	9.37:g.2039776A>G		87.0	0.0	0		86.0	7.0	0.0813954	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																			A|0.750;G|0.250	0.250	strong		0.637	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
PTPRS	5802	hgsc.bcm.edu	37	19	5222916	5222916	+	Missense_Mutation	SNP	C	C	T	rs62113240		TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:5222916C>T	ENST00000587303.1	-	17	2986	c.2887G>A	c.(2887-2889)Gtc>Atc	p.V963I	PTPRS_ENST00000262963.6_Missense_Mutation_p.V959I|PTPRS_ENST00000588012.1_Missense_Mutation_p.V941I|PTPRS_ENST00000592099.1_Intron|PTPRS_ENST00000372412.4_Missense_Mutation_p.V964I|PTPRS_ENST00000348075.2_Missense_Mutation_p.V941I|PTPRS_ENST00000353284.2_Intron|PTPRS_ENST00000357368.4_Missense_Mutation_p.V963I|PTPRS_ENST00000588552.1_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	963	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GTGTATTTGACGATGGCCCCG	0.741																																					p.V963I		Atlas-SNP	.											.	PTPRS	169	.	0			c.G2887A						PASS	.						4.0	6.0	6.0					19																	5222916		1894	3710	5604	SO:0001583	missense	5802	exon18			ATTTGACGATGGC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.2887G>A	19.37:g.5222916C>T	ENSP00000467537:p.Val963Ile	8.0	0.0	0		19.0	9.0	0.473684	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	9.675	1.147719	0.21288	.	.	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	4.01	0.642	0.17765	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.320832	0.23319	N	0.049473	T	0.26484	0.0647	N	0.11789	0.175	0.80722	D	1	B;B	0.12630	0.001;0.006	B;B	0.11329	0.002;0.006	T	0.06127	-1.0844	10	0.11794	T	0.64	.	7.107	0.25368	0.0:0.6232:0.0:0.3768	rs62113240	941;963	Q13332-6;Q13332	.;PTPRS_HUMAN	I	964;963;963;954;959;941	ENSP00000361489:V964I;ENSP00000349932:V963I;ENSP00000262963:V959I;ENSP00000269907:V941I	ENSP00000262963:V959I	V	-	1	0	PTPRS	5173916	0.966000	0.33281	0.984000	0.44739	0.983000	0.72400	0.897000	0.28390	0.039000	0.15632	0.557000	0.71058	GTC	.	.	weak		0.741	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
BCL10	8915	hgsc.bcm.edu	37	1	85736460	85736460	+	Missense_Mutation	SNP	T	T	G			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:85736460T>G	ENST00000370580.1	-	2	924	c.187A>C	c.(187-189)Aaa>Caa	p.K63Q		NM_003921.4	NP_003912.1	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	63	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				adaptive immune response (GO:0002250)|B cell apoptotic process (GO:0001783)|cell death (GO:0008219)|cellular defense response (GO:0006968)|cellular response to mechanical stimulus (GO:0071260)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interleukin-6 biosynthetic process (GO:0042226)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of mature B cell apoptotic process (GO:0002906)|neural tube closure (GO:0001843)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|regulation of T cell receptor signaling pathway (GO:0050856)|response to food (GO:0032094)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell apoptotic process (GO:0070231)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor signaling pathway (GO:0002224)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|NF-kappaB binding (GO:0051059)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	19				all cancers(265;0.0114)|Epithelial(280;0.0311)		CCAGCCCTTTTTCTACTTGAT	0.373			T	IGH@	MALT																																p.K63Q	NSCLC(34;993 1034 12176 32621 50182)	Atlas-SNP	.		Dom	yes		1	1p22	8915	B-cell CLL/lymphoma 10		L	.	BCL10	39	.	0			c.A187C						PASS	.						110.0	114.0	113.0					1																	85736460		2203	4300	6503	SO:0001583	missense	8915	exon2			CCCTTTTTCTACT	AJ006288	CCDS704.1	1p22	2008-07-18			ENSG00000142867	ENSG00000142867			989	protein-coding gene	gene with protein product	"""CARD-like apoptotic protein"", ""CARD-containing apoptotic signaling protein"", ""CARD containing molecule enhancing NF-kB"", ""caspase-recruiting domain-containing protein"", ""CARD-containing proapoptotic protein"""	603517				9989495	Standard	NM_003921		Approved	CARMEN, CIPER, mE10, c-E10, CLAP	uc021opd.1	O95999	OTTHUMG00000009965	ENST00000370580.1:c.187A>C	1.37:g.85736460T>G	ENSP00000359612:p.Lys63Gln	106.0	0.0	0		154.0	71.0	0.461039	NM_003921	Q5VUF1	Missense_Mutation	SNP	ENST00000370580.1	37	CCDS704.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250050	0.80024	.	.	ENSG00000142867	ENST00000370580;ENST00000271015;ENST00000394761	T	0.20463	2.07	5.69	5.69	0.88448	DEATH-like (2);Caspase Recruitment (2);	0.048742	0.85682	D	0.000000	T	0.29620	0.0739	L	0.53249	1.67	0.42293	D	0.992143	D	0.76494	0.999	D	0.68483	0.958	T	0.04509	-1.0946	10	0.66056	D	0.02	-31.1976	12.1424	0.54005	0.0:0.0:0.1427:0.8573	.	63	O95999	BCL10_HUMAN	Q	63	ENSP00000359612:K63Q	ENSP00000271015:K63Q	K	-	1	0	BCL10	85509048	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.576000	0.60915	2.291000	0.77112	0.533000	0.62120	AAA	.	.	none		0.373	BCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027612.1	NM_003921	
KIF13A	63971	hgsc.bcm.edu	37	6	17764996	17764996	+	Missense_Mutation	SNP	C	C	T	rs184686655	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr6:17764996C>T	ENST00000259711.6	-	39	4868	c.4763G>A	c.(4762-4764)cGt>cAt	p.R1588H	KIF13A_ENST00000378843.2_Missense_Mutation_p.R1540H|KIF13A_ENST00000378816.5_Missense_Mutation_p.R1553H|KIF13A_ENST00000378814.5_Missense_Mutation_p.R1540H|KIF13A_ENST00000378826.2_Missense_Mutation_p.R1553H	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1588					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGTAGGGCTACGGGACACTTC	0.502													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		19335	0.0		0.0	False		,,,				2504	0.0				p.R1588H		Atlas-SNP	.											.	KIF13A	276	.	0			c.G4763A						PASS	.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4005		0,1,2002	84.0	83.0	84.0		4658,4619,4619,4763	6.1	1.0	6		84	3,8327		0,3,4162	yes	missense,missense,missense,missense	KIF13A	NM_001105566.2,NM_001105567.2,NM_001105568.2,NM_022113.5	29,29,29,29	0,4,6164	TT,TC,CC		0.036,0.025,0.0324	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1553/1771,1540/1758,1540/1750,1588/1806	17764996	4,12332	2003	4165	6168	SO:0001583	missense	63971	exon39			GGGCTACGGGACA	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4763G>A	6.37:g.17764996C>T	ENSP00000259711:p.Arg1588His	97.0	0.0	0		86.0	28.0	0.325581	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	31	5.074668	0.94000	2.5E-4	3.6E-4	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	6.07	6.07	0.98685	.	0.275476	0.29280	N	0.012608	T	0.53126	0.1777	L	0.34521	1.04	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;P;D;P	0.81914	0.995;0.897;0.951;0.897	T	0.41431	-0.9509	10	0.36615	T	0.2	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	1540;1553;1588;1540	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	H	1540;592;1588;1553;1540;1553	ENSP00000368091:R1540H;ENSP00000425616:R592H;ENSP00000259711:R1588H;ENSP00000368103:R1553H;ENSP00000368120:R1540H;ENSP00000368093:R1553H	ENSP00000259711:R1588H	R	-	2	0	KIF13A	17872975	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	7.469000	0.80959	2.890000	0.99128	0.585000	0.79938	CGT	C|1.000;T|0.000	0.000	strong		0.502	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
PRG4	10216	hgsc.bcm.edu	37	1	186276961	186276961	+	Missense_Mutation	SNP	A	A	C	rs145338869	byFrequency	TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr1:186276961A>C	ENST00000445192.2	+	7	2155	c.2110A>C	c.(2110-2112)Act>Cct	p.T704P	PRG4_ENST00000367483.4_Missense_Mutation_p.T663P|PRG4_ENST00000367485.4_Missense_Mutation_p.T611P|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Missense_Mutation_p.T661P	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	704	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCCTAAGGAGACTGCTCCAAC	0.597																																					p.T704P		Atlas-SNP	.											PRG4,NS,malignant_melanoma,0,1	PRG4	259	1	0			c.A2110C						PASS	.	A	PRO/THR,PRO/THR,PRO/THR,PRO/THR	15,4391		0,15,2188	137.0	152.0	147.0		2110,1708,1831,1987	-5.2	0.0	1	dbSNP_134	147	0,8600		0,0,4300	no	missense,missense,missense,missense	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	38,38,38,38	0,15,6488	CC,CA,AA		0.0,0.3404,0.1153	benign,benign,benign,benign	704/1405,570/1271,611/1312,663/1364	186276961	15,12991	2203	4300	6503	SO:0001583	missense	10216	exon7			AAGGAGACTGCTC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2110A>C	1.37:g.186276961A>C	ENSP00000399679:p.Thr704Pro	67.0	0.0	0		113.0	6.0	0.0530973	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	-	2.283	-0.364165	0.05103	0.003404	0.0	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05025	3.55;3.65;3.51;3.65	2.61	-5.23	0.02798	.	0.580677	0.14221	N	0.333433	T	0.01627	0.0052	N	0.02011	-0.69	0.09310	N	0.999999	B;B;B;B	0.06786	0.001;0.001;0.0;0.001	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.39623	-0.9605	9	.	.	.	.	4.4579	0.11652	0.3649:0.3368:0.0:0.2984	.	570;611;704;663	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	P	661;570;663;611;704	ENSP00000356456:T661P;ENSP00000356453:T663P;ENSP00000356455:T611P;ENSP00000399679:T704P	.	T	+	1	0	PRG4	184543584	0.005000	0.15991	0.000000	0.03702	0.060000	0.15804	0.317000	0.19487	-1.717000	0.01385	0.138000	0.15974	ACT	A|0.996;C|0.004	0.004	strong		0.597	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
SETD1B	23067	hgsc.bcm.edu	37	12	122247634	122247634	+	Silent	SNP	C	C	T			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr12:122247634C>T	ENST00000604567.1	+	6	851	c.783C>T	c.(781-783)tgC>tgT	p.C261C	SETD1B_ENST00000542440.1_Silent_p.C261C|SETD1B_ENST00000267197.5_Silent_p.C261C			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	261					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						ATTCCAGCTGCCGCCTGGACA	0.647																																					p.C261C		Atlas-SNP	.											.	SETD1B	105	.	0			c.C783T						PASS	.						67.0	74.0	72.0					12																	122247634		692	1591	2283	SO:0001819	synonymous_variant	23067	exon5			CAGCTGCCGCCTG	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.783C>T	12.37:g.122247634C>T		44.0	0.0	0		55.0	17.0	0.309091	NM_015048	F6MFW1	Silent	SNP	ENST00000604567.1	37																																																																																				.	.	none		0.647	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
FAM162B	221303	hgsc.bcm.edu	37	6	117086652	117086652	+	Missense_Mutation	SNP	G	G	A			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr6:117086652G>A	ENST00000368557.4	-	1	234	c.88C>T	c.(88-90)Cgg>Tgg	p.R30W		NM_001085480.2	NP_001078949.1	Q5T6X4	F162B_HUMAN	family with sequence similarity 162, member B	30						integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)	6						GGTGCGGGCCGTCGCGTGGCC	0.746																																					p.R30W		Atlas-SNP	.											.	FAM162B	19	.	0			c.C88T						PASS	.						2.0	3.0	3.0					6																	117086652		1446	3410	4856	SO:0001583	missense	221303	exon1			CGGGCCGTCGCGT	BC038997	CCDS43497.1	6q22.31	2014-01-28	2008-06-05	2008-06-05	ENSG00000183807	ENSG00000183807			21549	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 189"""	C6orf189			Standard	NM_001085480		Approved	bA86F4.2	uc003pxi.2	Q5T6X4	OTTHUMG00000015446	ENST00000368557.4:c.88C>T	6.37:g.117086652G>A	ENSP00000357545:p.Arg30Trp	23.0	0.0	0		13.0	7.0	0.538462	NM_001085480	Q8IXW8	Missense_Mutation	SNP	ENST00000368557.4	37	CCDS43497.1	.	.	.	.	.	.	.	.	.	.	G	9.606	1.129940	0.21041	.	.	ENSG00000183807	ENST00000368557	T	0.31769	1.48	2.93	-3.02	0.05446	.	0.936775	0.08728	N	0.902552	T	0.05135	0.0137	N	0.17474	0.49	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39354	-0.9618	10	0.46703	T	0.11	0.0041	4.5061	0.11889	0.4972:0.2298:0.273:0.0	.	30	Q5T6X4	F162B_HUMAN	W	30	ENSP00000357545:R30W	ENSP00000357545:R30W	R	-	1	2	FAM162B	117193345	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.029000	0.12329	-0.773000	0.04596	-0.643000	0.03959	CGG	.	.	none		0.746	FAM162B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041965.1	XM_927381	
PCDHGA1	56114	hgsc.bcm.edu	37	5	140711241	140711241	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr5:140711241A>C	ENST00000517417.1	+	1	990	c.990A>C	c.(988-990)aaA>aaC	p.K330N	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.K330N|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	330	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATGGCTAAAGTTAAGGTAC	0.418																																					p.K330N		Atlas-SNP	.											.	PCDHGA1	397	.	0			c.A990C						PASS	.						70.0	69.0	70.0					5																	140711241		2203	4300	6503	SO:0001583	missense	56114	exon1			GGCTAAAGTTAAG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.990A>C	5.37:g.140711241A>C	ENSP00000431083:p.Lys330Asn	162.0	0.0	0		183.0	26.0	0.142077	NM_018912	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	A	1.463	-0.561832	0.03939	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01838	4.61;4.61	3.99	2.81	0.32909	Cadherin (5);Cadherin-like (1);	0.118831	0.37348	N	0.002129	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B;P	0.34815	0.061;0.47	B;B	0.33121	0.038;0.158	T	0.47873	-0.9083	10	0.72032	D	0.01	.	2.7623	0.05310	0.5109:0.0:0.1932:0.2958	.	330;330	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	N	330	ENSP00000431083:K330N;ENSP00000367345:K330N	ENSP00000367345:K330N	K	+	3	2	PCDHGA1	140691425	0.000000	0.05858	0.999000	0.59377	0.094000	0.18550	-1.649000	0.01993	0.698000	0.31739	-0.297000	0.09499	AAA	.	.	none		0.418	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
NLRP5	126206	hgsc.bcm.edu	37	19	56552307	56552307	+	Missense_Mutation	SNP	A	A	C			TCGA-GR-A4D9-01B-11D-A31X-10	TCGA-GR-A4D9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2628dbf8-af39-40c7-8cac-dc5f1d900038	a894d227-2be0-4820-b8b2-0e673e33fb95	g.chr19:56552307A>C	ENST00000390649.3	+	11	2806	c.2806A>C	c.(2806-2808)Aca>Cca	p.T936P		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	936					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTGTGGCATCACAGCCACGGG	0.542																																					p.T936P		Atlas-SNP	.											.	NLRP5	217	.	0			c.A2806C						PASS	.						69.0	69.0	69.0					19																	56552307		2005	4191	6196	SO:0001583	missense	126206	exon11			GGCATCACAGCCA	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2806A>C	19.37:g.56552307A>C	ENSP00000375063:p.Thr936Pro	62.0	0.0	0		58.0	6.0	0.103448	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114132	0.37339	.	.	ENSG00000171487	ENST00000390649	T	0.57107	0.42	4.37	-2.11	0.07187	.	0.889887	0.09138	N	0.843342	T	0.59783	0.2219	M	0.90595	3.13	0.09310	N	0.999999	B	0.32543	0.375	B	0.42653	0.394	T	0.60712	-0.7209	10	0.66056	D	0.02	.	1.426	0.02323	0.3361:0.1463:0.0903:0.4272	.	936	P59047	NALP5_HUMAN	P	936	ENSP00000375063:T936P	ENSP00000375063:T936P	T	+	1	0	NLRP5	61244119	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.019000	0.03622	-0.685000	0.05177	-1.155000	0.01812	ACA	.	.	none		0.542	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
