#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BCOR	54880	hgsc.bcm.edu	37	X	39911471	39911471	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:39911471delC	ENST00000378444.4	-	15	5387	c.5159delG	c.(5158-5160)agtfs	p.S1720fs	BCOR_ENST00000378455.4_Frame_Shift_Del_p.S1668fs|BCOR_ENST00000342274.4_Frame_Shift_Del_p.S1686fs|BCOR_ENST00000397354.3_Frame_Shift_Del_p.S1686fs|BCOR_ENST00000378463.1_Frame_Shift_Del_p.S563fs	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1720	Necessary and sufficient for interaction with PCGF1.				heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CAGCTCCTTACTTTCAGGGTT	0.493			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.S1720fs		Pindel,Atlas-Indel	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.5160delT						PASS	.						60.0	49.0	53.0					X																	39911471		2202	4300	6502	SO:0001589	frameshift_variant	54880	exon15			.	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.5159delG	X.37:g.39911471delC	ENSP00000367705:p.Ser1720fs	216.0	0.0	.		163.0	84.0	0.515	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Frame_Shift_Del	DEL	ENST00000378444.4	37	CCDS48093.1																																																																																			.	.	none		0.493	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
MAB21L1	4081	hgsc.bcm.edu	37	13	36050453	36050454	+	5'UTR	INS	-	-	GCTGCTGCTGCT			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr13:36050453_36050454insGCTGCTGCTGCT	ENST00000379919.4	-	0	378_379				NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)						anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		ctgctgctgctgctgctgctgc	0.55																																					.		Atlas-Indel	.											.	MAB21L1	52	.	0			.						PASS	.																																			SO:0001623	5_prime_UTR_variant	4081	.			.	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.-179->AGCAGCAGCAGC	13.37:g.36050453_36050454insGCTGCTGCTGCT		118.0	0.0	0		113.0	10.0	0.0884956	.	Q6I9T5	RNA	INS	ENST00000379919.4	37	CCDS9353.1																																																																																			.	.	none		0.550	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
TAS2R19	259294	hgsc.bcm.edu	37	12	11174305	11174306	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:11174305_11174306delGT	ENST00000390673.2	-	1	913_914	c.865_866delAC	c.(865-867)accfs	p.T289fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	289					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TGAAAGAAAGGTCTGTTTTAGC	0.441																																					p.289_289del		Pindel,Atlas-Indel	.											.	TAS2R19	30	.	0			c.866_867del						PASS	.																																			SO:0001589	frameshift_variant	259294	exon1			.	AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.865_866delAC	12.37:g.11174305_11174306delGT	ENSP00000375091:p.Thr289fs	116.0	0.0	.		81.0	35.0	0.432	NM_176888	Q3MIJ4|Q645X8	Frame_Shift_Del	DEL	ENST00000390673.2	37	CCDS8640.1																																																																																			.	.	none		0.441	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370080.1	NM_176888	
CIITA	4261	hgsc.bcm.edu	37	16	11000690	11000691	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr16:11000690_11000691delTG	ENST00000324288.8	+	11	1474_1475	c.1341_1342delTG	c.(1339-1344)tttgtcfs	p.V448fs	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	448	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AGTACGACTTTGTCTTCTCTGT	0.634			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.447_447del		Pindel,Atlas-Indel	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.1340_1341del						PASS	.																																			SO:0001589	frameshift_variant	4261	exon11			.	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.1341_1342delTG	16.37:g.11000690_11000691delTG	ENSP00000316328:p.Val448fs	67.0	0.0	.		73.0	24.0	0.329	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Frame_Shift_Del	DEL	ENST00000324288.8	37	CCDS10544.1																																																																																			.	.	none		0.634	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24909678	24909679	+	Frame_Shift_Ins	INS	-	-	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:24909678_24909679insG	ENST00000396432.2	-	9	1631_1632	c.1145_1146insC	c.(1144-1146)cagfs	p.Q382fs	ARHGAP21_ENST00000320481.6_Frame_Shift_Ins_p.Q169fs	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	381					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						AGTCTATGTGCTGATGGGAATT	0.381																																					p.Q382fs		Atlas-Indel	.											.	ARHGAP21	185	.	0			c.1146_1147insC						PASS	.																																			SO:0001589	frameshift_variant	57584	exon9			.	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1145_1146insC	10.37:g.24909678_24909679insG	ENSP00000379709:p.Gln382fs	160.0	0.0	0		141.0	55.0	0.390071	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Frame_Shift_Ins	INS	ENST00000396432.2	37	CCDS7144.2																																																																																			.	.	none		0.381	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
CCDC109B	55013	hgsc.bcm.edu	37	4	110605694	110605699	+	In_Frame_Del	DEL	CTGGCT	CTGGCT	-			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	CTGGCT	CTGGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:110605694_110605699delCTGGCT	ENST00000394650.4	+	6	841_846	c.708_713delCTGGCT	c.(706-714)gcctggctc>gcc	p.WL237del		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	237					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		GGGCACTGGCCTGGCTCACGTGGTGG	0.49																																					p.236_238del		Pindel,Atlas-Indel	.											.	CCDC109B	47	.	0			c.707_712del						PASS	.																																			SO:0001651	inframe_deletion	55013	exon6			.	BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.708_713delCTGGCT	4.37:g.110605694_110605699delCTGGCT	ENSP00000378145:p.Trp237_Leu238del	228.0	0.0	.		203.0	43.0	0.212	NM_017918	A8K4Y3|Q6IAC1	In_Frame_Del	DEL	ENST00000394650.4	37	CCDS3683.2																																																																																			.	.	none		0.490	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254865.1	NM_017918	
OSBPL3	26031	hgsc.bcm.edu	37	7	24843988	24843991	+	Frame_Shift_Del	DEL	TCTC	TCTC	-			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	TCTC	TCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr7:24843988_24843991delTCTC	ENST00000313367.2	-	22	2961_2964	c.2510_2513delGAGA	c.(2509-2514)agagaafs	p.RE837fs	OSBPL3_ENST00000353930.1_Frame_Shift_Del_p.RE801fs|OSBPL3_ENST00000352860.1_Frame_Shift_Del_p.RE806fs|OSBPL3_ENST00000487020.1_5'UTR|OSBPL3_ENST00000409069.1_Frame_Shift_Del_p.RE770fs|OSBPL3_ENST00000431825.2_Frame_Shift_Del_p.RE770fs|OSBPL3_ENST00000396431.1_Frame_Shift_Del_p.RE806fs|OSBPL3_ENST00000396429.1_Frame_Shift_Del_p.RE801fs	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	837					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CCGCCGCCTTTCTCTCTGCAGTTG	0.451																																					p.837_838del		Pindel,Atlas-Indel	.											.	OSBPL3	100	.	0			c.2511_2514del						PASS	.																																			SO:0001589	frameshift_variant	26031	exon22			.	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.2510_2513delGAGA	7.37:g.24843988_24843991delTCTC	ENSP00000315410:p.Arg837fs	266.0	0.0	.		187.0	62.0	0.332	NM_015550	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Frame_Shift_Del	DEL	ENST00000313367.2	37	CCDS5390.1																																																																																			.	.	none		0.451	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
MYO9B	4650	hgsc.bcm.edu	37	19	17308611	17308612	+	Frame_Shift_Ins	INS	-	-	CG			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:17308611_17308612insCG	ENST00000594824.1	+	23	4204_4205	c.4057_4058insCG	c.(4057-4059)accfs	p.T1353fs	MYO9B_ENST00000397274.2_Frame_Shift_Ins_p.T1353fs|MYO9B_ENST00000595618.1_Frame_Shift_Ins_p.T1353fs			Q13459	MYO9B_HUMAN	myosin IXB	1353	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GGAGAGGCGCACCTCCTTCTCC	0.515																																					p.T1353fs		Pindel,Atlas-Indel	.											.	MYO9B	264	.	0			c.4057_4058insCG						PASS	.																																			SO:0001589	frameshift_variant	4650	exon23			.		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		Exception_encountered	19.37:g.17308611_17308612insCG	ENSP00000471367:p.Thr1353fs	58.0	0.0	.		50.0	13.0	0.260	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Frame_Shift_Ins	INS	ENST00000594824.1	37																																																																																				.	.	none		0.515	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
C10orf71	118461	hgsc.bcm.edu	37	10	50533936	50533937	+	Frame_Shift_Ins	INS	-	-	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:50533936_50533937insC	ENST00000374144.3	+	3	3634_3635	c.3346_3347insC	c.(3346-3348)gccfs	p.A1116fs	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1116										endometrium(1)	1						CCTGACCCACGCCCTCGTGTGG	0.658																																					p.A1116fs		Atlas-Indel	.											.	C10orf71	179	.	0			c.3346_3347insC						PASS	.																																			SO:0001589	frameshift_variant	118461	exon3			.	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3349dupC	10.37:g.50533939_50533939dupC	ENSP00000363259:p.Ala1116fs	73.0	0.0	0		34.0	11.0	0.323529	NM_001135196	A0AVL8	Frame_Shift_Ins	INS	ENST00000374144.3	37	CCDS44387.1																																																																																			.	.	none		0.658	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230309	23230310	+	In_Frame_Ins	INS	-	-	TTT			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23230309_23230310insTTT	ENST00000526893.1	+	1	350_351	c.76_77insTTT	c.(76-78)ctg>cTTTtg	p.26_26L>LL	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000532223.2_In_Frame_Ins_p.26_26L>LL|IGLL5_ENST00000531372.1_In_Frame_Ins_p.26_26L>LL	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	26						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCGCTGGCCCCTGCTGCTGCTG	0.663																																					p.L26delinsLL		Pindel,Atlas-Indel	.											.	IGLL5	26	.	0			c.76_77insTTT						PASS	.																																			SO:0001652	inframe_insertion	100423062	exon1			.	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	Exception_encountered	22.37:g.23230309_23230310insTTT	ENSP00000431254:p.Leu29dup	100.0	0.0	.		116.0	22.0	0.190	NM_001178126		In_Frame_Ins	INS	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.663	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
PIM1	5292	hgsc.bcm.edu	37	6	37138592	37138592	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138592G>A	ENST00000373509.5	+	2	499	c.126G>A	c.(124-126)ccG>ccA	p.P42P		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	133					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGGTGGGCCCGCTACTGGGCA	0.721			T	BCL6	NHL																																p.P133P		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G399A						PASS	.						21.0	32.0	28.0					6																	37138592		2169	4267	6436	SO:0001819	synonymous_variant	5292	exon2			GGGCCCGCTACTG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.126G>A	6.37:g.37138592G>A		60.0	0.0	0		54.0	24.0	0.444444	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.721	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PRDM9	56979	hgsc.bcm.edu	37	5	23527377	23527377	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:23527377G>A	ENST00000296682.3	+	11	2362	c.2180G>A	c.(2179-2181)cGg>cAg	p.R727Q		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	727					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GAGTGTGGGCGGGGCTTTAGC	0.597										HNSCC(3;0.000094)																											p.R727Q		Atlas-SNP	.											PRDM9,colon,carcinoma,+1,1	PRDM9	344	1	0			c.G2180A						PASS	.						20.0	22.0	21.0					5																	23527377		2038	4098	6136	SO:0001583	missense	56979	exon11			GTGGGCGGGGCTT	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2180G>A	5.37:g.23527377G>A	ENSP00000296682:p.Arg727Gln	178.0	0.0	0		127.0	41.0	0.322835	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	3.932	-0.015891	0.07681	.	.	ENSG00000164256	ENST00000296682	T	0.18960	2.18	2.88	0.835	0.18886	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12135	0.0295	L	0.31157	0.91	0.09310	N	0.999999	P	0.38395	0.629	B	0.32805	0.153	T	0.17048	-1.0382	9	0.52906	T	0.07	.	5.2268	0.15399	0.4789:0.0:0.5211:0.0	.	727	Q9NQV7	PRDM9_HUMAN	Q	727	ENSP00000296682:R727Q	ENSP00000296682:R727Q	R	+	2	0	PRDM9	23563134	0.001000	0.12720	0.609000	0.28983	0.002000	0.02628	0.105000	0.15333	0.186000	0.20125	-0.378000	0.06908	CGG	.	.	none		0.597	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
KLHL21	9903	hgsc.bcm.edu	37	1	6662386	6662386	+	Missense_Mutation	SNP	G	G	T	rs531955371		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:6662386G>T	ENST00000377658.4	-	1	543	c.492C>A	c.(490-492)caC>caA	p.H164Q	KLHL21_ENST00000377663.3_Missense_Mutation_p.H164Q|KLHL21_ENST00000467612.1_Intron|KLHL21_ENST00000463043.1_Intron	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	164	BACK.				chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		GCTCGCCCACGTGGCGCAGAA	0.706																																					p.H164Q		Atlas-SNP	.											.	KLHL21	27	.	0			c.C492A						PASS	.						4.0	5.0	5.0					1																	6662386		2027	4033	6060	SO:0001583	missense	9903	exon1			GCCCACGTGGCGC	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.492C>A	1.37:g.6662386G>T	ENSP00000366886:p.His164Gln	41.0	0.0	0		16.0	8.0	0.5	NM_014851	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	37	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	G	36	5.617529	0.96649	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.70045	-0.45;-0.45	4.05	4.05	0.47172	BTB/Kelch-associated (2);	0.050845	0.85682	D	0.000000	T	0.74030	0.3663	M	0.71920	2.185	0.80722	D	1	D;D	0.54397	0.966;0.958	P;P	0.51453	0.67;0.619	T	0.79685	-0.1700	10	0.72032	D	0.01	.	16.0713	0.80936	0.0:0.0:1.0:0.0	.	164;164	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	Q	164	ENSP00000366886:H164Q;ENSP00000366891:H164Q	ENSP00000366886:H164Q	H	-	3	2	KLHL21	6584973	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.765000	0.62271	2.189000	0.69895	0.462000	0.41574	CAC	.	.	none		0.706	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
ZNF608	57507	hgsc.bcm.edu	37	5	124079845	124079845	+	Missense_Mutation	SNP	T	T	A	rs371493737		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:124079845T>A	ENST00000306315.5	-	1	1273	c.838A>T	c.(838-840)Atg>Ttg	p.M280L	ZNF608_ENST00000504926.1_Intron	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	280							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTTACCAACATAGAGTTTCCC	0.557																																					p.M280L		Atlas-SNP	.											.	ZNF608	117	.	0			c.A838T						PASS	.						138.0	144.0	142.0					5																	124079845		2105	4156	6261	SO:0001583	missense	57507	exon1			CCAACATAGAGTT	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.838A>T	5.37:g.124079845T>A	ENSP00000307746:p.Met280Leu	171.0	0.0	0		142.0	61.0	0.429577	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	T	4.006	-0.001568	0.07819	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.37584	1.19	5.08	-3.65	0.04502	.	0.561470	0.17591	N	0.168770	T	0.12135	0.0295	N	0.08118	0	0.24410	N	0.994665	B	0.02656	0.0	B	0.01281	0.0	T	0.33954	-0.9848	10	0.02654	T	1	-3.1328	8.444	0.32830	0.1156:0.484:0.0:0.4004	.	280	Q9ULD9	ZN608_HUMAN	L	280	ENSP00000307746:M280L	ENSP00000307746:M280L	M	-	1	0	ZNF608	124107744	0.976000	0.34144	0.948000	0.38648	0.992000	0.81027	0.083000	0.14871	-0.868000	0.04058	-0.254000	0.11334	ATG	.	.	alt		0.557	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
FAT3	120114	hgsc.bcm.edu	37	11	92577432	92577432	+	Silent	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:92577432G>C	ENST00000298047.6	+	18	10916	c.10899G>C	c.(10897-10899)gtG>gtC	p.V3633V	FAT3_ENST00000533797.1_5'Flank|FAT3_ENST00000409404.2_Silent_p.V3633V|FAT3_ENST00000525166.1_Silent_p.V3483V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3633	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCATTGATGTGGTCGTGCATG	0.547										TCGA Ovarian(4;0.039)																											p.V3633V		Atlas-SNP	.											.	FAT3	1822	.	0			c.G10899C						PASS	.						138.0	143.0	141.0					11																	92577432		2167	4274	6441	SO:0001819	synonymous_variant	120114	exon18			TGATGTGGTCGTG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10899G>C	11.37:g.92577432G>C		89.0	0.0	0		69.0	30.0	0.434783	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.	.	none		0.547	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
PIM1	5292	hgsc.bcm.edu	37	6	37139104	37139104	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37139104C>T	ENST00000373509.5	+	4	817	c.444C>T	c.(442-444)ttC>ttT	p.F148F		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	239	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCAGCTTCTTCTGGCAGGTGC	0.617			T	BCL6	NHL																																p.F239F		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C717T						PASS	.						47.0	56.0	53.0					6																	37139104		2202	4299	6501	SO:0001819	synonymous_variant	5292	exon4			CTTCTTCTGGCAG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.444C>T	6.37:g.37139104C>T		110.0	0.0	0		95.0	46.0	0.484211	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.617	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PTPRZ1	5803	hgsc.bcm.edu	37	7	121652288	121652288	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr7:121652288T>G	ENST00000393386.2	+	12	3599	c.3188T>G	c.(3187-3189)gTt>gGt	p.V1063G	PTPRZ1_ENST00000449182.1_Intron|PTPRZ1_ENST00000483028.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1063					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AATGAGATGGTTTACCCTTCT	0.358																																					p.V1063G		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.T3188G						PASS	.						111.0	114.0	113.0					7																	121652288		2203	4300	6503	SO:0001583	missense	5803	exon12			AGATGGTTTACCC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3188T>G	7.37:g.121652288T>G	ENSP00000377047:p.Val1063Gly	146.0	0.0	0		109.0	55.0	0.504587	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	T	9.433	1.086036	0.20390	.	.	ENSG00000106278	ENST00000393386	T	0.42900	0.96	5.68	-1.26	0.09376	.	0.776615	0.11659	N	0.542035	T	0.31420	0.0796	L	0.51422	1.61	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10636	-1.0621	10	0.33940	T	0.23	.	6.1933	0.20536	0.0:0.4622:0.2766:0.2612	.	1063	P23471	PTPRZ_HUMAN	G	1063	ENSP00000377047:V1063G	ENSP00000377047:V1063G	V	+	2	0	PTPRZ1	121439524	0.007000	0.16637	0.798000	0.32154	0.983000	0.72400	-0.397000	0.07269	-0.102000	0.12197	-0.299000	0.09455	GTT	.	.	none		0.358	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
KLHL21	9903	hgsc.bcm.edu	37	1	6662376	6662376	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:6662376G>A	ENST00000377658.4	-	1	553	c.502C>T	c.(502-504)Ctg>Ttg	p.L168L	KLHL21_ENST00000377663.3_Silent_p.L168L|KLHL21_ENST00000467612.1_Intron|KLHL21_ENST00000463043.1_Intron	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	168	BACK.				chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		TCGGCGCCCAGCTCGCCCACG	0.706																																					p.L168L		Atlas-SNP	.											.	KLHL21	27	.	0			c.C502T						PASS	.						4.0	4.0	4.0					1																	6662376		1941	3902	5843	SO:0001819	synonymous_variant	9903	exon1			CGCCCAGCTCGCC	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.502C>T	1.37:g.6662376G>A		37.0	0.0	0		14.0	8.0	0.571429	NM_014851	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Silent	SNP	ENST00000377658.4	37	CCDS30575.1																																																																																			.	.	none		0.706	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
ESRRG	2104	hgsc.bcm.edu	37	1	216680418	216680418	+	Missense_Mutation	SNP	C	C	G	rs200999094		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:216680418C>G	ENST00000408911.3	-	7	1393	c.1240G>C	c.(1240-1242)Gct>Cct	p.A414P	ESRRG_ENST00000493748.1_Missense_Mutation_p.A391P|ESRRG_ENST00000360012.3_Missense_Mutation_p.A391P|ESRRG_ENST00000493603.1_Missense_Mutation_p.A391P|ESRRG_ENST00000366938.2_Missense_Mutation_p.A391P|ESRRG_ENST00000366937.1_Missense_Mutation_p.A426P|ESRRG_ENST00000359162.2_Missense_Mutation_p.A391P|ESRRG_ENST00000366940.2_Missense_Mutation_p.A391P|ESRRG_ENST00000361395.2_Missense_Mutation_p.A391P|ESRRG_ENST00000487276.1_Missense_Mutation_p.A391P|ESRRG_ENST00000463665.1_Missense_Mutation_p.A352P|ESRRG_ENST00000361525.3_Missense_Mutation_p.A391P|ESRRG_ENST00000391890.3_Missense_Mutation_p.A398P	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	414					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ATCTTGCCAGCTCGACGAGGG	0.507																																					p.A426P		Atlas-SNP	.											.	ESRRG	111	.	0			c.G1276C						PASS	.						122.0	107.0	112.0					1																	216680418		2203	4300	6503	SO:0001583	missense	2104	exon8			TGCCAGCTCGACG	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.1240G>C	1.37:g.216680418C>G	ENSP00000386171:p.Ala414Pro	205.0	0.0	0		150.0	69.0	0.46	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265011	0.80358	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748	D;D;D;D;D;D;D;D;D;D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08;-4.08	5.14	5.14	0.70334	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.049439	0.85682	D	0.000000	D	0.97779	0.9271	M	0.70275	2.135	0.80722	D	1	B;P;D	0.56287	0.065;0.937;0.975	B;D;P	0.67725	0.083;0.953;0.654	D	0.98581	1.0650	10	0.72032	D	0.01	.	18.6137	0.91295	0.0:1.0:0.0:0.0	.	352;426;414	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	P	391;391;426;414;391;391;391;391;391;398;352;391;391;391	ENSP00000355225:A391P;ENSP00000355907:A391P;ENSP00000355904:A426P;ENSP00000386171:A414P;ENSP00000352077:A391P;ENSP00000354584:A391P;ENSP00000355905:A391P;ENSP00000353108:A391P;ENSP00000419594:A391P;ENSP00000375761:A398P;ENSP00000418629:A352P;ENSP00000419155:A391P;ENSP00000417374:A391P	ENSP00000346386:A391P	A	-	1	0	ESRRG	214747041	1.000000	0.71417	0.261000	0.24466	0.984000	0.73092	7.818000	0.86416	2.395000	0.81488	0.561000	0.74099	GCT	C|0.999;T|0.001	.	alt		0.507	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
NUAK1	9891	hgsc.bcm.edu	37	12	106460866	106460866	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:106460866C>T	ENST00000261402.2	-	7	3079	c.1700G>A	c.(1699-1701)cGc>cAc	p.R567H		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	567					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						ACTGGAAGGGCGGCTGTAGCT	0.632																																					p.R567H		Atlas-SNP	.											NUAK1_ENST00000261402,NS,malignant_melanoma,-1,2	NUAK1	196	2	0			c.G1700A						scavenged	.						32.0	38.0	36.0					12																	106460866		2202	4300	6502	SO:0001583	missense	9891	exon7			GAAGGGCGGCTGT	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1700G>A	12.37:g.106460866C>T	ENSP00000261402:p.Arg567His	110.0	1.0	0.00909091		99.0	25.0	0.252525	NM_014840	A7MD39|Q96KA8	Missense_Mutation	SNP	ENST00000261402.2	37	CCDS31892.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941751	0.92526	.	.	ENSG00000074590	ENST00000261402	D	0.82893	-1.66	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000014	D	0.90082	0.6902	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	D	0.90088	0.4175	10	0.62326	D	0.03	.	19.7554	0.96287	0.0:1.0:0.0:0.0	.	567	O60285	NUAK1_HUMAN	H	567	ENSP00000261402:R567H	ENSP00000261402:R567H	R	-	2	0	NUAK1	104984996	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.717000	0.68446	2.665000	0.90641	0.563000	0.77884	CGC	.	.	none		0.632	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2	NM_014840	
OR9A4	130075	hgsc.bcm.edu	37	7	141618791	141618791	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr7:141618791T>C	ENST00000548136.1	+	1	175	c.116T>C	c.(115-117)aTg>aCg	p.M39T	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					GTGACATTAATGGGAAACACA	0.443																																					p.M39T		Atlas-SNP	.											.	OR9A4	58	.	0			c.T116C						PASS	.						195.0	204.0	201.0					7																	141618791		2201	4300	6501	SO:0001583	missense	130075	exon1			CATTAATGGGAAA		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.116T>C	7.37:g.141618791T>C	ENSP00000448789:p.Met39Thr	225.0	0.0	0		195.0	91.0	0.466667	NM_001001656	B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	.	0.401	-0.918492	0.02396	.	.	ENSG00000258083	ENST00000548136	T	0.00457	7.29	3.88	2.71	0.32032	.	.	.	.	.	T	0.00210	0.0006	N	0.12611	0.24	0.21290	N	0.999731	B	0.06786	0.001	B	0.08055	0.003	T	0.31916	-0.9926	9	0.02654	T	1	-2.566	7.6507	0.28346	0.0:0.1051:0.0:0.8949	.	39	Q8NGU2	OR9A4_HUMAN	T	39	ENSP00000448789:M39T	ENSP00000386148:M39T	M	+	2	0	OR9A4	141265260	0.000000	0.05858	0.974000	0.42286	0.352000	0.29268	0.602000	0.24134	0.652000	0.30806	-0.288000	0.09946	ATG	.	.	none		0.443	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
PDE3A	5139	hgsc.bcm.edu	37	12	20787920	20787920	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:20787920A>G	ENST00000359062.3	+	8	1971	c.1931A>G	c.(1930-1932)gAg>gGg	p.E644G	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	644					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GATGAAACAGAGTGCCTGAGA	0.423																																					p.E644G		Atlas-SNP	.											.	PDE3A	184	.	0			c.A1931G						PASS	.						149.0	127.0	135.0					12																	20787920		2203	4300	6503	SO:0001583	missense	5139	exon8			AAACAGAGTGCCT		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1931A>G	12.37:g.20787920A>G	ENSP00000351957:p.Glu644Gly	74.0	0.0	0		51.0	20.0	0.392157	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.971029	0.53614	.	.	ENSG00000172572	ENST00000359062	T	0.64991	-0.13	5.64	4.5	0.54988	.	3.679390	0.00550	N	0.000256	T	0.69895	0.3162	L	0.55481	1.735	0.45995	D	0.998804	P	0.50443	0.935	P	0.49528	0.614	T	0.50440	-0.8828	10	0.42905	T	0.14	.	11.0409	0.47831	0.9266:0.0:0.0734:0.0	.	644	Q14432	PDE3A_HUMAN	G	644	ENSP00000351957:E644G	ENSP00000351957:E644G	E	+	2	0	PDE3A	20679187	1.000000	0.71417	0.816000	0.32577	0.078000	0.17371	6.704000	0.74639	0.984000	0.38629	0.528000	0.53228	GAG	.	.	none		0.423	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
SEMA4A	64218	hgsc.bcm.edu	37	1	156146494	156146494	+	Silent	SNP	G	G	A	rs185601992	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:156146494G>A	ENST00000368285.3	+	15	2259	c.1992G>A	c.(1990-1992)ccG>ccA	p.P664P	SEMA4A_ENST00000355014.2_Silent_p.P664P|SEMA4A_ENST00000368286.2_Silent_p.P532P|SEMA4A_ENST00000368284.1_Silent_p.P532P|SEMA4A_ENST00000368282.1_Silent_p.P664P	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	664					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					TGAAGGTCCCGTTGACCAGGG	0.607													G|||	3	0.000599042	0.0	0.0	5008	,	,		19484	0.003		0.0	False		,,,				2504	0.0				p.P664P		Atlas-SNP	.											.	SEMA4A	75	.	0			c.G1992A						PASS	.	G	,,,	0,4406		0,0,2203	66.0	62.0	63.0		1992,1992,1596,1992	-4.4	0.9	1		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEMA4A	NM_001193300.1,NM_001193301.1,NM_001193302.1,NM_022367.3	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	664/762,664/762,532/630,664/762	156146494	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64218	exon15			GGTCCCGTTGACC	AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.1992G>A	1.37:g.156146494G>A		73.0	0.0	0		119.0	65.0	0.546219	NM_001193300	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Silent	SNP	ENST00000368285.3	37	CCDS1132.1																																																																																			G|0.999;A|0.001	0.001	strong		0.607	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2	NM_022367	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	229.0	0.0	0		348.0	54.0	0.155172	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
KIF17	57576	hgsc.bcm.edu	37	1	21031118	21031118	+	Silent	SNP	C	C	T	rs373442401		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:21031118C>T	ENST00000247986.2	-	5	1255	c.945G>A	c.(943-945)gcG>gcA	p.A315A	KIF17_ENST00000375044.1_Silent_p.A215A|KIF17_ENST00000400463.3_Silent_p.A315A			Q9P2E2	KIF17_HUMAN	kinesin family member 17	315	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		AGTTGTTGTCCGCAGGCGACA	0.617																																					p.A315A		Atlas-SNP	.											KIF17,NS,carcinoma,-2,1	KIF17	130	1	0			c.G945A						PASS	.	C	,	0,4406		0,0,2203	156.0	120.0	132.0		945,945	-10.2	0.0	1		132	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	KIF17	NM_001122819.1,NM_020816.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	315/1029,315/1030	21031118	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57576	exon5			GTTGTCCGCAGGC	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.945G>A	1.37:g.21031118C>T		196.0	0.0	0		133.0	57.0	0.428571	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																			.	.	none		0.617	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
C10orf71	118461	hgsc.bcm.edu	37	10	50533942	50533942	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:50533942G>C	ENST00000374144.3	+	3	3640	c.3352G>C	c.(3352-3354)Gtg>Ctg	p.V1118L	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1118										endometrium(1)	1						CCACGCCCTCGTGTGGGAGGG	0.657																																					p.V1118L		Atlas-SNP	.											.	C10orf71	179	.	0			c.G3352C						PASS	.						21.0	25.0	24.0					10																	50533942		692	1591	2283	SO:0001583	missense	118461	exon3			GCCCTCGTGTGGG	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3352G>C	10.37:g.50533942G>C	ENSP00000363259:p.Val1118Leu	72.0	0.0	0		37.0	16.0	0.432432	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299071	0.40694	.	.	ENSG00000177354	ENST00000374144	T	0.04406	3.63	5.38	-4.86	0.03132	.	2.277970	0.02380	N	0.078691	T	0.02571	0.0078	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.41034	-0.9531	8	0.09084	T	0.74	.	5.7483	0.18132	0.4766:0.0:0.2649:0.2586	.	.	.	.	L	1118	ENSP00000363259:V1118L	ENSP00000363259:V1118L	V	+	1	0	C10orf71	50203948	0.000000	0.05858	0.000000	0.03702	0.391000	0.30476	-1.398000	0.02509	-1.114000	0.02977	-0.339000	0.08088	GTG	.	.	none		0.657	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
SLC12A1	6557	hgsc.bcm.edu	37	15	48500287	48500287	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr15:48500287C>A	ENST00000558405.1	+	1	385	c.371C>A	c.(370-372)cCc>cAc	p.P124H	SLC12A1_ENST00000380993.3_Missense_Mutation_p.P124H|SLC12A1_ENST00000330289.6_Missense_Mutation_p.P124H|SLC12A1_ENST00000396577.3_Missense_Mutation_p.P124H|SLC12A1_ENST00000561031.1_Missense_Mutation_p.P124H			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	124					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	ATCAGTGGGCCCAAGGTCAAC	0.478																																					p.P124H		Atlas-SNP	.											SLC12A1,NS,carcinoma,0,1	SLC12A1	243	1	0			c.C371A						PASS	.						89.0	85.0	86.0					15																	48500287		2198	4297	6495	SO:0001583	missense	6557	exon2			GTGGGCCCAAGGT		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.371C>A	15.37:g.48500287C>A	ENSP00000453409:p.Pro124His	47.0	0.0	0		46.0	40.0	0.869565	NM_001184832	A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024341	0.35701	.	.	ENSG00000074803	ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.95756	-3.8;-3.8;-3.8	5.58	5.58	0.84498	Amino acid permease, N-terminal (1);	0.450963	0.26019	N	0.026831	D	0.86514	0.5951	N	0.02539	-0.55	0.32795	N	0.50066	P;B	0.39071	0.658;0.0	B;B	0.41894	0.369;0.003	D	0.86476	0.1788	10	0.39692	T	0.17	.	5.6925	0.17837	0.1763:0.6718:0.0:0.1519	.	124;124	Q8IUN5;Q13621	.;S12A1_HUMAN	H	124	ENSP00000370381:P124H;ENSP00000379822:P124H;ENSP00000331550:P124H	ENSP00000331550:P124H	P	+	2	0	SLC12A1	46287579	0.988000	0.35896	1.000000	0.80357	0.939000	0.58152	1.453000	0.35167	2.624000	0.88883	0.655000	0.94253	CCC	.	.	none		0.478	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
CALHM2	51063	hgsc.bcm.edu	37	10	105209154	105209154	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:105209154T>A	ENST00000260743.5	-	3	1068	c.545A>T	c.(544-546)tAt>tTt	p.Y182F	CALHM2_ENST00000369788.3_Missense_Mutation_p.Y182F|CALHM2_ENST00000494180.1_5'Flank|CALHM2_ENST00000393235.1_Missense_Mutation_p.Y182F|RP11-225H22.7_ENST00000608063.1_RNA	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	182					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						CTGGGACTCATACCTGAGCCT	0.602																																					p.Y182F		Atlas-SNP	.											.	CALHM2	30	.	0			c.A545T						PASS	.						67.0	70.0	69.0					10																	105209154		2194	4283	6477	SO:0001583	missense	51063	exon3			GACTCATACCTGA	BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.545A>T	10.37:g.105209154T>A	ENSP00000260743:p.Tyr182Phe	25.0	0.0	0		41.0	14.0	0.341463	NM_015916	D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	ENST00000260743.5	37	CCDS7549.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617645	0.87359	.	.	ENSG00000138172	ENST00000369788;ENST00000260743;ENST00000393235	T;T;T	0.18502	2.21;2.21;2.21	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	M	0.80183	2.485	0.53005	D	0.999965	D;P	0.89917	1.0;0.86	D;P	0.83275	0.996;0.528	T	0.46693	-0.9173	10	0.02654	T	1	-3.6496	15.6983	0.77517	0.0:0.0:0.0:1.0	.	182;182	Q9HA72-2;Q9HA72	.;CAHM2_HUMAN	F	182	ENSP00000358803:Y182F;ENSP00000260743:Y182F;ENSP00000376927:Y182F	ENSP00000260743:Y182F	Y	-	2	0	CALHM2	105199144	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	6.980000	0.76160	2.112000	0.64535	0.459000	0.35465	TAT	.	.	none		0.602	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050159.1	NM_015916	
IRF2BP2	359948	hgsc.bcm.edu	37	1	234744253	234744253	+	Missense_Mutation	SNP	C	C	T	rs565711940		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:234744253C>T	ENST00000366609.3	-	1	1018	c.988G>A	c.(988-990)Gcc>Acc	p.A330T	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.A330T	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GCAGTCAGGGCCGGCTCCTTC	0.637																																					p.A330T		Atlas-SNP	.											.	IRF2BP2	37	.	0			c.G988A						PASS	.						22.0	21.0	21.0					1																	234744253		2200	4300	6500	SO:0001583	missense	359948	exon1			TCAGGGCCGGCTC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.988G>A	1.37:g.234744253C>T	ENSP00000355568:p.Ala330Thr	58.0	0.0	0		61.0	29.0	0.47541	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	ENST00000366609.3	37	CCDS1602.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406532	0.62399	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.32023	1.5;1.47	4.81	3.9	0.45041	.	0.264544	0.37053	N	0.002279	T	0.25121	0.0610	L	0.44542	1.39	0.35796	D	0.822801	B;B	0.19331	0.02;0.035	B;B	0.16289	0.007;0.015	T	0.19353	-1.0308	10	0.33940	T	0.23	-5.1635	10.9107	0.47108	0.0:0.9118:0.0:0.0882	.	330;330	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	T	330	ENSP00000355569:A330T;ENSP00000355568:A330T	ENSP00000355568:A330T	A	-	1	0	IRF2BP2	232810876	0.961000	0.32948	1.000000	0.80357	0.998000	0.95712	1.793000	0.38764	1.230000	0.43646	0.561000	0.74099	GCC	.	.	none		0.637	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
MYH2	4620	hgsc.bcm.edu	37	17	10430004	10430004	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:10430004G>A	ENST00000245503.5	-	30	4483	c.4099C>T	c.(4099-4101)Ctg>Ttg	p.L1367L	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Silent_p.L1367L|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1367					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCCTTGGACAGTGCTCTCTGC	0.617																																					p.L1367L		Atlas-SNP	.											.	MYH2	390	.	0			c.C4099T						PASS	.						185.0	168.0	174.0					17																	10430004		2203	4300	6503	SO:0001819	synonymous_variant	4620	exon30			TGGACAGTGCTCT		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4099C>T	17.37:g.10430004G>A		215.0	0.0	0		179.0	76.0	0.424581	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	37	CCDS11156.1																																																																																			.	.	none		0.617	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
STX16	8675	hgsc.bcm.edu	37	20	57227165	57227165	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:57227165A>G	ENST00000371141.4	+	1	827	c.103A>G	c.(103-105)Agc>Ggc	p.S35G	STX16_ENST00000359617.4_5'UTR|STX16_ENST00000371132.4_Intron|STX16_ENST00000496003.1_3'UTR|STX16_ENST00000361830.3_Missense_Mutation_p.S35G|STX16_ENST00000361770.5_Intron|STX16_ENST00000355957.5_Intron|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.S35G|STX16_ENST00000358029.4_Missense_Mutation_p.S35G	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	35					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CATCACCTCCAGCCCTCTGCA	0.567																																					p.S35G		Atlas-SNP	.											.	STX16	36	.	0			c.A103G						PASS	.						100.0	82.0	88.0					20																	57227165		2203	4300	6503	SO:0001583	missense	8675	exon1			ACCTCCAGCCCTC	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.103A>G	20.37:g.57227165A>G	ENSP00000360183:p.Ser35Gly	44.0	0.0	0		32.0	18.0	0.5625	NM_001134772	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	ENST00000371141.4	37	CCDS13468.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.828198	0.50845	.	.	ENSG00000124222	ENST00000371141;ENST00000358029;ENST00000361830	T;T;T	0.47177	0.87;0.85;0.87	4.81	4.81	0.61882	.	0.097247	0.41396	U	0.000888	T	0.29749	0.0743	N	0.22421	0.69	0.80722	D	1	B;B	0.32620	0.063;0.378	B;B	0.29785	0.039;0.107	T	0.10019	-1.0648	10	0.19590	T	0.45	.	9.9808	0.41813	0.8301:0.1699:0.0:0.0	.	35;35	Q6GMS8;O14662	.;STX16_HUMAN	G	35	ENSP00000360183:S35G;ENSP00000350723:S35G;ENSP00000354445:S35G	ENSP00000432101:S35G	S	+	1	0	STX16	56660571	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.061000	0.71148	2.018000	0.59344	0.533000	0.62120	AGC	.	.	none		0.567	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	
GPR125	166647	hgsc.bcm.edu	37	4	22389666	22389666	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:22389666G>A	ENST00000334304.5	-	19	3897	c.3628C>T	c.(3628-3630)Cgg>Tgg	p.R1210W	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1210					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TTGCCCAGCCGGCTTTTAGGT	0.542																																					p.R1210W		Atlas-SNP	.											.	GPR125	118	.	0			c.C3628T						PASS	.						93.0	86.0	89.0					4																	22389666		2203	4300	6503	SO:0001583	missense	166647	exon19			CCAGCCGGCTTTT	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3628C>T	4.37:g.22389666G>A	ENSP00000334952:p.Arg1210Trp	271.0	0.0	0		196.0	88.0	0.44898	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065055	0.36470	.	.	ENSG00000152990	ENST00000334304	T	0.54675	0.56	5.9	5.05	0.67936	.	0.057434	0.64402	D	0.000002	T	0.65678	0.2714	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.69142	0.962;0.609	T	0.64884	-0.6302	10	0.39692	T	0.17	-0.8166	11.9432	0.52913	0.0:0.132:0.7307:0.1373	.	1067;1210	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	W	1210	ENSP00000334952:R1210W	ENSP00000334952:R1210W	R	-	1	2	GPR125	21998764	1.000000	0.71417	0.037000	0.18230	0.260000	0.26232	6.194000	0.72082	1.471000	0.48121	0.650000	0.86243	CGG	.	.	none		0.542	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
HMHA1	23526	hgsc.bcm.edu	37	19	1080926	1080926	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:1080926G>T	ENST00000313093.2	+	17	2284	c.2053G>T	c.(2053-2055)Gcc>Tcc	p.A685S	HMHA1_ENST00000590214.1_Missense_Mutation_p.A712S|HMHA1_ENST00000586866.1_Missense_Mutation_p.A689S|HMHA1_ENST00000590577.1_Missense_Mutation_p.A320S|HMHA1_ENST00000543365.1_Missense_Mutation_p.A568S|HMHA1_ENST00000536472.1_Missense_Mutation_p.A553S|HMHA1_ENST00000539243.2_Missense_Mutation_p.A701S	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	685					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCCGGTGGCCGTGCCCAG	0.706																																					p.A701S		Atlas-SNP	.											.	HMHA1	78	.	0			c.G2101T						PASS	.						14.0	16.0	16.0					19																	1080926		2194	4289	6483	SO:0001583	missense	23526	exon17			CCGGTGGCCGTGC	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.2053G>T	19.37:g.1080926G>T	ENSP00000316772:p.Ala685Ser	81.0	0.0	0		92.0	41.0	0.445652	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	37	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330792	0.41297	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.22134	2.0;2.02;1.98;1.97	3.33	3.33	0.38152	.	0.213079	0.39759	N	0.001277	T	0.26159	0.0638	L	0.58101	1.795	0.35266	D	0.780041	D;P;P;P;P	0.56287	0.975;0.939;0.9;0.884;0.816	P;P;B;B;B	0.50659	0.647;0.554;0.351;0.4;0.225	T	0.26849	-1.0091	10	0.19147	T	0.46	-16.9373	10.0523	0.42223	0.0:0.207:0.793:0.0	.	553;701;320;568;685	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	S	701;685;685;553;679;568	ENSP00000439601:A701S;ENSP00000316772:A685S;ENSP00000445109:A553S;ENSP00000438979:A568S	ENSP00000316772:A685S	A	+	1	0	HMHA1	1031926	0.984000	0.35163	0.254000	0.24359	0.156000	0.22039	1.499000	0.35671	1.871000	0.54225	0.491000	0.48974	GCC	.	.	none		0.706	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
LHX5	64211	hgsc.bcm.edu	37	12	113901352	113901352	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:113901352G>A	ENST00000261731.3	-	5	1425	c.852C>T	c.(850-852)ggC>ggT	p.G284G		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	284					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						CGTAGTAGTCGCCTTGGTAGT	0.721																																					p.G284G		Atlas-SNP	.											.	LHX5	39	.	0			c.C852T						PASS	.						11.0	13.0	13.0					12																	113901352		2154	4167	6321	SO:0001819	synonymous_variant	64211	exon5			GTAGTCGCCTTGG	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.852C>T	12.37:g.113901352G>A		35.0	0.0	0		44.0	29.0	0.659091	NM_022363	Q32MA4	Silent	SNP	ENST00000261731.3	37	CCDS9171.1																																																																																			.	.	none		0.721	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230403	23230403	+	Missense_Mutation	SNP	G	G	A	rs530312149	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23230403G>A	ENST00000526893.1	+	1	444	c.170G>A	c.(169-171)gGa>gAa	p.G57E	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.G57E|IGLL5_ENST00000531372.1_Missense_Mutation_p.G57E	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	57						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCCTCAGTTGGAAGCAGCCGA	0.657													G|||	4	0.000798722	0.0	0.0	5008	,	,		10551	0.0		0.004	False		,,,				2504	0.0				p.G57E		Atlas-SNP	.											.	IGLL5	26	.	0			c.G170A						PASS	.																																			SO:0001583	missense	100423062	exon1			CAGTTGGAAGCAG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.170G>A	22.37:g.23230403G>A	ENSP00000431254:p.Gly57Glu	112.0	0.0	0		102.0	45.0	0.441176	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608516	0.46527	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00581	6.43;6.42	3.92	0.609	0.17575	.	.	.	.	.	T	0.00468	0.0015	L	0.32530	0.975	0.09310	N	1	B	0.30584	0.286	B	0.23018	0.043	T	0.44190	-0.9344	9	0.29301	T	0.29	.	4.1265	0.10129	0.218:0.194:0.588:0.0	.	57	B9A064	IGLL5_HUMAN	E	57	ENSP00000436353:G57E;ENSP00000431254:G57E	ENSP00000431254:G57E	G	+	2	0	IGLL5	21560403	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.009000	0.12765	0.224000	0.20940	0.643000	0.83706	GGA	.	.	none		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ALG8	79053	hgsc.bcm.edu	37	11	77815052	77815052	+	Silent	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:77815052A>G	ENST00000299626.5	-	12	1394	c.1323T>C	c.(1321-1323)agT>agC	p.S441S	ALG8_ENST00000532552.2_5'UTR|ALG8_ENST00000376156.3_Silent_p.S441S	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	441					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)			NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			GTGACGAAATACTATATATGG	0.269																																					p.S441S		Atlas-SNP	.											.	ALG8	54	.	0			c.T1323C						PASS	.						25.0	29.0	28.0					11																	77815052		2166	4252	6418	SO:0001819	synonymous_variant	79053	exon12			CGAAATACTATAT	AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.1323T>C	11.37:g.77815052A>G		217.0	0.0	0		228.0	117.0	0.513158	NM_024079	A6NDW6|O60860	Silent	SNP	ENST00000299626.5	37	CCDS8258.1	.	.	.	.	.	.	.	.	.	.	A	9.014	0.983159	0.18889	.	.	ENSG00000159063	ENST00000530608;ENST00000532306	.	.	.	5.66	4.54	0.55810	.	.	.	.	.	T	0.56673	0.2001	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54964	-0.8214	4	.	.	.	-10.9941	6.8814	0.24174	0.8312:0.0:0.1688:0.0	.	.	.	.	A	143;228	.	.	V	-	2	0	ALG8	77492700	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.624000	0.46444	2.147000	0.66899	0.533000	0.62120	GTA	.	.	none		0.269	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022420	32022420	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022420G>T	ENST00000396556.2	-	1	374	c.252C>A	c.(250-252)taC>taA	p.Y84*	OSBPL10_ENST00000438237.2_Nonsense_Mutation_p.Y84*|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	84	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GGAGGTTGGTGTATTTGCTGA	0.716																																					p.Y84X		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C252A						PASS	.						23.0	23.0	23.0					3																	32022420		2199	4294	6493	SO:0001587	stop_gained	114884	exon1			GTTGGTGTATTTG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.252C>A	3.37:g.32022420G>T	ENSP00000379804:p.Tyr84*	89.0	0.0	0		78.0	33.0	0.423077	NM_017784	B4E212|Q9BTU5	Nonsense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	39	7.644893	0.98409	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	.	.	.	4.13	4.13	0.48395	.	0.088789	0.47093	D	0.000246	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-10.6464	14.2571	0.66060	0.0:0.0:1.0:0.0	.	.	.	.	X	84	.	ENSP00000379804:Y84X	Y	-	3	2	OSBPL10	31997424	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.299000	0.78831	2.301000	0.77427	0.462000	0.41574	TAC	.	.	none		0.716	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
OTX2	5015	hgsc.bcm.edu	37	14	57268664	57268664	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr14:57268664C>G	ENST00000555006.1	-	4	1067	c.659G>C	c.(658-660)aGt>aCt	p.S220T	OTX2_ENST00000339475.5_Missense_Mutation_p.S228T|OTX2_ENST00000554788.1_3'UTR|RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000408990.3_Missense_Mutation_p.S220T			P32243	OTX2_HUMAN	orthodenticle homeobox 2	220					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					ACCCATGGGACTGAGTGTGGC	0.527																																					p.S228T		Atlas-SNP	.											.	OTX2	47	.	0			c.G683C						PASS	.						128.0	116.0	120.0					14																	57268664		2203	4300	6503	SO:0001583	missense	5015	exon3			ATGGGACTGAGTG	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.659G>C	14.37:g.57268664C>G	ENSP00000452336:p.Ser220Thr	161.0	0.0	0		154.0	77.0	0.5	NM_001270525	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.495794	0.44352	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.53	5.53	0.82687	Transcription factor Otx, C-terminal (1);	0.113525	0.39759	N	0.001270	D	0.94042	0.8091	M	0.80616	2.505	0.80722	D	1	B;D	0.56746	0.171;0.977	B;P	0.60886	0.364;0.88	D	0.93918	0.7203	10	0.59425	D	0.04	.	18.6325	0.91364	0.0:1.0:0.0:0.0	.	228;220	F1T0D1;P32243	.;OTX2_HUMAN	T	228;220;220;228	ENSP00000343819:S228T;ENSP00000386185:S220T;ENSP00000452336:S220T;ENSP00000451357:S228T	ENSP00000343819:S228T	S	-	2	0	OTX2	56338417	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.882000	0.98803	0.655000	0.94253	AGT	.	.	none		0.527	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022391	32022391	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022391C>T	ENST00000396556.2	-	1	403	c.281G>A	c.(280-282)aGg>aAg	p.R94K	OSBPL10_ENST00000438237.2_Splice_Site_p.R94K|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	94	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GGCGCGTTACCTGTTCTGCCA	0.687																																					p.R94K		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G281A						PASS	.						18.0	19.0	18.0					3																	32022391		2198	4284	6482	SO:0001630	splice_region_variant	114884	exon1			CGTTACCTGTTCT	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.281+1G>A	3.37:g.32022391C>T		77.0	0.0	0		70.0	34.0	0.485714	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883001	0.91740	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.72282	0.94;-0.64	3.84	3.84	0.44239	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.89065	0.6609	H	0.97918	4.105	0.38634	D	0.951444	D;P	0.57257	0.979;0.818	D;D	0.71414	0.973;0.93	D	0.93430	0.6784	9	.	.	.	-10.3747	13.6161	0.62108	0.0:1.0:0.0:0.0	.	94;94	B4E212;Q9BXB5	.;OSB10_HUMAN	K	94	ENSP00000379804:R94K;ENSP00000406124:R94K	.	R	-	2	0	OSBPL10	31997395	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	3.335000	0.52105	2.140000	0.66376	0.462000	0.41574	AGG	.	.	none		0.687	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		Missense_Mutation
TBL1XR1	79718	hgsc.bcm.edu	37	3	176756174	176756174	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:176756174C>A	ENST00000430069.1	-	11	1233	c.974G>T	c.(973-975)tGt>tTt	p.C325F	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.C325F			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	325					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.C325S(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			ATCTGTACTACAAGAAGCAAA	0.373																																					p.C325F		Atlas-SNP	.											TBL1XR1,NS,carcinoma,0,1	TBL1XR1	87	1	1	Substitution - Missense(1)	lung(1)	c.G974T						PASS	.						110.0	98.0	102.0					3																	176756174		1878	4117	5995	SO:0001583	missense	79718	exon11			GTACTACAAGAAG	AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.974G>T	3.37:g.176756174C>A	ENSP00000405574:p.Cys325Phe	128.0	0.0	0		104.0	99.0	0.951923	NM_024665	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753034	0.89753	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758	D;D	0.81996	-1.56;-1.56	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93074	0.7795	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93618	0.6945	10	0.66056	D	0.02	-5.1506	19.0789	0.93173	0.0:1.0:0.0:0.0	.	325	Q9BZK7	TBL1R_HUMAN	F	325;325;187	ENSP00000405574:C325F;ENSP00000413251:C325F	ENSP00000405574:C325F	C	-	2	0	TBL1XR1	178238868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.787000	0.85759	2.754000	0.94517	0.585000	0.79938	TGT	.	.	none		0.373	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
ZNF493	284443	hgsc.bcm.edu	37	19	21607740	21607740	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:21607740A>C	ENST00000355504.4	+	2	2161	c.1895A>C	c.(1894-1896)aAg>aCg	p.K632T	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.K760T	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	632					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AGTAGACATAAGATAATTCAT	0.368																																					p.K760T		Atlas-SNP	.											.	ZNF493	178	.	0			c.A2279C						PASS	.						46.0	49.0	48.0					19																	21607740		2203	4298	6501	SO:0001583	missense	284443	exon4			GACATAAGATAAT	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1895A>C	19.37:g.21607740A>C	ENSP00000347691:p.Lys632Thr	178.0	0.0	0		143.0	65.0	0.454545	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	11.22	1.573663	0.28092	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.28454	1.61;1.61	1.17	-0.519	0.11939	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22666	0.0547	L	0.31476	0.935	0.20196	N	0.99993	P;B	0.39404	0.672;0.041	B;B	0.42495	0.389;0.031	T	0.22382	-1.0218	9	0.72032	D	0.01	.	5.2131	0.15329	0.7454:0.0:0.0:0.2546	.	632;760	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	T	760;632	ENSP00000376110:K760T;ENSP00000347691:K632T	ENSP00000347691:K632T	K	+	2	0	ZNF493	21399580	0.000000	0.05858	0.008000	0.14137	0.048000	0.14542	0.259000	0.18405	0.474000	0.27392	0.332000	0.21555	AAG	.	.	none		0.368	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
CUL1	8454	hgsc.bcm.edu	37	7	148454103	148454103	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr7:148454103T>C	ENST00000325222.4	+	4	623	c.344T>C	c.(343-345)gTa>gCa	p.V115A	CUL1_ENST00000409469.1_Missense_Mutation_p.V115A|CUL1_ENST00000602748.1_Missense_Mutation_p.V115A	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	115					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GATGAGAGTGTACTGAAATTC	0.338																																					p.V115A		Atlas-SNP	.											.	CUL1	80	.	0			c.T344C						PASS	.						134.0	136.0	135.0					7																	148454103		2203	4300	6503	SO:0001583	missense	8454	exon4			AGAGTGTACTGAA	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.344T>C	7.37:g.148454103T>C	ENSP00000326804:p.Val115Ala	104.0	0.0	0		131.0	48.0	0.366412	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.714714	0.89112	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583	T;T	0.30182	1.54;1.54	4.74	4.74	0.60224	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	M	0.73598	2.24	0.80722	D	1	P	0.46020	0.871	P	0.51550	0.673	T	0.53401	-0.8444	10	0.72032	D	0.01	-16.5964	14.5335	0.67942	0.0:0.0:0.0:1.0	.	115	Q13616	CUL1_HUMAN	A	115;115;73	ENSP00000387160:V115A;ENSP00000326804:V115A	ENSP00000326804:V115A	V	+	2	0	CUL1	148085036	1.000000	0.71417	0.978000	0.43139	0.992000	0.81027	7.759000	0.85235	1.912000	0.55364	0.528000	0.53228	GTA	.	.	none		0.338	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
VMP1	81671	hgsc.bcm.edu	37	17	57915672	57915672	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:57915672G>A	ENST00000262291.4	+	11	1301	c.991G>A	c.(991-993)Ggt>Agt	p.G331S	VMP1_ENST00000545362.1_Missense_Mutation_p.G275S|VMP1_ENST00000536180.1_Missense_Mutation_p.G234S|MIR21_ENST00000362134.1_RNA|VMP1_ENST00000539763.1_Missense_Mutation_p.G139S|VMP1_ENST00000588617.1_Splice_Site|VMP1_ENST00000537567.1_Missense_Mutation_p.G197S	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	331					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						CCCCGGCATAGGTCCATCTCT	0.468																																					p.G331S		Atlas-SNP	.											.	VMP1	49	.	0			c.G991A						PASS	.						83.0	80.0	81.0					17																	57915672		2203	4300	6503	SO:0001583	missense	81671	exon11			GGCATAGGTCCAT		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.991G>A	17.37:g.57915672G>A	ENSP00000262291:p.Gly331Ser	211.0	1.0	0.00473934		231.0	114.0	0.493506	NM_030938	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	37	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	G	34	5.348786	0.95807	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.73923	0.3649	L	0.56124	1.755	0.80722	D	1	P;P;P;D	0.56287	0.895;0.805;0.93;0.975	P;B;P;P	0.60173	0.839;0.333;0.54;0.87	T	0.67440	-0.5670	9	0.29301	T	0.29	-2.9829	20.422	0.99049	0.0:0.0:1.0:0.0	.	197;234;275;331	B4DED7;B4DGZ7;F5H2J3;Q96GC9	.;.;.;VMP1_HUMAN	S	331;197;139;234;275	.	ENSP00000262291:G331S	G	+	1	0	VMP1	55270454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.624000	0.98398	2.832000	0.97577	0.655000	0.94253	GGT	.	.	none		0.468	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
ITIH2	3698	hgsc.bcm.edu	37	10	7780636	7780636	+	Silent	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:7780636C>A	ENST00000358415.4	+	16	2176	c.2010C>A	c.(2008-2010)gcC>gcA	p.A670A	ITIH2_ENST00000379587.4_Silent_p.A659A	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	670	O-glycosylated at three sites.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						CGTCTTGGGCCAATCCTTCAC	0.532																																					p.A670A		Atlas-SNP	.											ITIH2,NS,neuroblastoma,0,1	ITIH2	144	1	0			c.C2010A						PASS	.						130.0	111.0	118.0					10																	7780636		2203	4300	6503	SO:0001819	synonymous_variant	3698	exon16			TTGGGCCAATCCT	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.2010C>A	10.37:g.7780636C>A		95.0	0.0	0		76.0	31.0	0.407895	NM_002216	Q14659|Q15484|Q5T986	Silent	SNP	ENST00000358415.4	37	CCDS31141.1																																																																																			.	.	none		0.532	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	NM_002216	
PCDH1	5097	hgsc.bcm.edu	37	5	141244191	141244191	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:141244191A>T	ENST00000394536.3	-	3	1844	c.1705T>A	c.(1705-1707)Tct>Act	p.S569T	PCDH1_ENST00000536585.1_Missense_Mutation_p.S547T|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000287008.3_Missense_Mutation_p.S569T|PCDH1_ENST00000456271.1_Missense_Mutation_p.S557T	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	569	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CGATCCAGAGATGTCTTCACC	0.577																																					p.S569T	Ovarian(132;1609 1739 4190 14731 45037)	Atlas-SNP	.											.	PCDH1	119	.	0			c.T1705A						PASS	.						54.0	45.0	49.0					5																	141244191		2203	4300	6503	SO:0001583	missense	5097	exon3			CCAGAGATGTCTT	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1705T>A	5.37:g.141244191A>T	ENSP00000378043:p.Ser569Thr	63.0	0.0	0		64.0	41.0	0.640625	NM_032420	Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	a	8.695	0.908454	0.17833	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.76	5.76	0.90799	Cadherin (4);Cadherin-like (1);	0.290510	0.24988	N	0.034015	T	0.30916	0.0780	N	0.17594	0.5	0.29962	N	0.819276	B;B	0.29085	0.232;0.115	B;B	0.29524	0.103;0.062	T	0.26258	-1.0108	10	0.29301	T	0.29	.	10.1435	0.42749	0.8323:0.1677:0.0:0.0	.	569;569	Q08174;Q08174-2	PCDH1_HUMAN;.	T	569;569;557;580;547	ENSP00000287008:S569T;ENSP00000378043:S569T;ENSP00000403497:S557T;ENSP00000350122:S580T;ENSP00000438825:S547T	ENSP00000287008:S569T	S	-	1	0	PCDH1	141224375	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.850000	0.62889	2.212000	0.71576	0.454000	0.30748	TCT	.	.	none		0.577	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
LMF1	64788	hgsc.bcm.edu	37	16	919924	919924	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr16:919924G>A	ENST00000262301.11	-	9	1393	c.1375C>T	c.(1375-1377)Cac>Tac	p.H459Y	LMF1_ENST00000568897.1_Missense_Mutation_p.H242Y|LMF1_ENST00000399843.2_Missense_Mutation_p.H459Y|LMF1_ENST00000543238.1_Missense_Mutation_p.H222Y|LMF1_ENST00000568268.1_5'Flank	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	459					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				AGGCGGTAGTGGTACGGGGAG	0.667																																					p.H459Y		Atlas-SNP	.											.	LMF1	42	.	0			c.C1375T						PASS	.						48.0	60.0	56.0					16																	919924		2134	4222	6356	SO:0001583	missense	64788	exon9			GGTAGTGGTACGG	AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1375C>T	16.37:g.919924G>A	ENSP00000262301:p.His459Tyr	82.0	0.0	0		67.0	37.0	0.552239	NM_022773	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	37	CCDS45373.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219622	0.58560	.	.	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000540070;ENST00000545827;ENST00000543238	T;T;T	0.25579	1.79;1.79;1.79	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	M	0.78285	2.405	0.80722	D	1	P	0.46859	0.885	P	0.55222	0.771	T	0.53012	-0.8498	10	0.87932	D	0	-7.2329	17.1986	0.86900	0.0:0.0:1.0:0.0	.	459	Q96S06	LMF1_HUMAN	Y	459;459;242;213;222	ENSP00000262301:H459Y;ENSP00000382737:H459Y;ENSP00000437418:H222Y	ENSP00000262301:H459Y	H	-	1	0	LMF1	859925	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.661000	0.98601	2.406000	0.81754	0.561000	0.74099	CAC	.	.	none		0.667	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773	
ADCK4	79934	hgsc.bcm.edu	37	19	41216028	41216028	+	Silent	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:41216028G>T	ENST00000324464.3	-	5	604	c.303C>A	c.(301-303)ggC>ggA	p.G101G	ADCK4_ENST00000243583.6_Silent_p.G101G|RNU6-195P_ENST00000411352.1_RNA|ADCK4_ENST00000450541.1_Silent_p.G101G	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	101						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			CTAGCCCCAAGCCCACAGCCA	0.577																																					p.G101G		Atlas-SNP	.											.	ADCK4	92	.	0			c.C303A						PASS	.						98.0	79.0	85.0					19																	41216028		2203	4300	6503	SO:0001819	synonymous_variant	79934	exon5			CCCCAAGCCCACA	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.303C>A	19.37:g.41216028G>T		74.0	0.0	0		117.0	75.0	0.641026	NM_001142555	Q8TAJ1|Q9HA52	Silent	SNP	ENST00000324464.3	37	CCDS12562.1																																																																																			.	.	none		0.577	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462731.1	NM_024876	
BCR	613	hgsc.bcm.edu	37	22	23523322	23523322	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23523322C>T	ENST00000305877.8	+	1	926	c.175C>T	c.(175-177)Ctg>Ttg	p.L59L	BCR_ENST00000398512.5_Silent_p.L59L|BCR_ENST00000359540.3_Silent_p.L59L	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	59	Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CATGATCTACCTGCAGACGTT	0.682			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.L59L		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.C175T						PASS	.						21.0	22.0	22.0					22																	23523322		2186	4278	6464	SO:0001819	synonymous_variant	613	exon1			ATCTACCTGCAGA		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.175C>T	22.37:g.23523322C>T		69.0	0.0	0		78.0	31.0	0.397436	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																			.	.	none		0.682	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022613	32022613	+	Missense_Mutation	SNP	C	C	T	rs549917934	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022613C>T	ENST00000396556.2	-	1	181	c.59G>A	c.(58-60)aGc>aAc	p.S20N	OSBPL10_ENST00000438237.2_Missense_Mutation_p.S20N|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	20					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		ACGgctgctgctgcggctgct	0.791																																					p.S20N		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G59A						PASS	.						2.0	3.0	2.0					3																	32022613		709	1576	2285	SO:0001583	missense	114884	exon1			CTGCTGCTGCGGC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.59G>A	3.37:g.32022613C>T	ENSP00000379804:p.Ser20Asn	85.0	0.0	0		113.0	48.0	0.424779	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691082	0.48097	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.23552	1.9;2.19	4.02	4.02	0.46733	.	0.741172	0.11593	N	0.548529	T	0.18964	0.0455	N	0.14661	0.345	0.32706	N	0.512265	P;P	0.51791	0.9;0.948	B;B	0.43783	0.289;0.431	T	0.11616	-1.0580	10	0.35671	T	0.21	-3.7958	14.0918	0.64995	0.0:1.0:0.0:0.0	.	20;20	B4E212;Q9BXB5	.;OSB10_HUMAN	N	20	ENSP00000379804:S20N;ENSP00000406124:S20N	ENSP00000379804:S20N	S	-	2	0	OSBPL10	31997617	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.559000	0.45888	2.262000	0.75019	0.298000	0.19748	AGC	.	.	none		0.791	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
ITPKB	3707	hgsc.bcm.edu	37	1	226924565	226924565	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:226924565C>A	ENST00000272117.3	-	1	594	c.595G>T	c.(595-597)Gaa>Taa	p.E199*	ITPKB_ENST00000366784.1_Nonsense_Mutation_p.E199*|ITPKB_ENST00000429204.1_Nonsense_Mutation_p.E199*			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	199					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GTCCTCCGTTCCTCGCTCCGG	0.667																																					p.E199X	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G595T						PASS	.						30.0	36.0	34.0					1																	226924565		2198	4284	6482	SO:0001587	stop_gained	3707	exon2			TCCGTTCCTCGCT	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.595G>T	1.37:g.226924565C>A	ENSP00000272117:p.Glu199*	26.0	0.0	0		46.0	22.0	0.478261	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Nonsense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	42	9.419618	0.99166	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	.	.	.	4.6	4.6	0.57074	.	0.000000	0.51477	D	0.000083	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	14.432	0.67257	0.0:1.0:0.0:0.0	.	.	.	.	X	199	.	ENSP00000272117:E199X	E	-	1	0	ITPKB	224991188	0.009000	0.17119	0.972000	0.41901	0.939000	0.58152	0.733000	0.26087	2.374000	0.81015	0.561000	0.74099	GAA	.	.	none		0.667	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
DSC3	1825	hgsc.bcm.edu	37	18	28587034	28587034	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr18:28587034T>A	ENST00000360428.4	-	12	1807	c.1727A>T	c.(1726-1728)gAa>gTa	p.E576V	DSC3_ENST00000434452.1_Missense_Mutation_p.E576V	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	576	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TTGAAGTATTTCTGGTGGATT	0.353																																					p.E576V		Atlas-SNP	.											.	DSC3	225	.	0			c.A1727T						PASS	.						113.0	104.0	107.0					18																	28587034		2203	4300	6503	SO:0001583	missense	1825	exon12			AGTATTTCTGGTG	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1727A>T	18.37:g.28587034T>A	ENSP00000353608:p.Glu576Val	226.0	0.0	0		220.0	57.0	0.259091	NM_024423	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	t	5.327	0.245623	0.10077	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.59772	0.24;0.24	5.26	-0.00853	0.14005	Cadherin (3);Cadherin-like (2);	0.240961	0.21231	N	0.077980	T	0.37100	0.0991	L	0.28740	0.885	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.13683	-1.0500	10	0.26408	T	0.33	.	6.246	0.20818	0.2308:0.0:0.4129:0.3563	.	576;576	Q14574;Q14574-2	DSC3_HUMAN;.	V	576	ENSP00000353608:E576V;ENSP00000392068:E576V	ENSP00000353608:E576V	E	-	2	0	DSC3	26841032	0.004000	0.15560	0.991000	0.47740	0.314000	0.28054	0.122000	0.15687	0.426000	0.26116	-0.363000	0.07495	GAA	.	.	none		0.353	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
FNDC3B	64778	hgsc.bcm.edu	37	3	172025174	172025174	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:172025174C>T	ENST00000336824.4	+	10	1182	c.1083C>T	c.(1081-1083)tcC>tcT	p.S361S	FNDC3B_ENST00000416957.1_Silent_p.S361S|FNDC3B_ENST00000415807.2_Silent_p.S361S	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	361	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGTACAATTCCGTAAAGGGAT	0.493																																					p.S361S		Atlas-SNP	.											.	FNDC3B	118	.	0			c.C1083T						PASS	.						152.0	130.0	137.0					3																	172025174		2203	4300	6503	SO:0001819	synonymous_variant	64778	exon10			CAATTCCGTAAAG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1083C>T	3.37:g.172025174C>T		103.0	0.0	0		82.0	42.0	0.512195	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	CCDS3217.1																																																																																			.	.	none		0.493	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
PHF2	5253	hgsc.bcm.edu	37	9	96416812	96416812	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr9:96416812T>A	ENST00000359246.4	+	7	1274	c.907T>A	c.(907-909)Tac>Aac	p.Y303N	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	303	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CGACAAATGCTACAAGTGCAT	0.587																																					p.Y303N		Atlas-SNP	.											.	PHF2	113	.	0			c.T907A						PASS	.						133.0	117.0	123.0					9																	96416812		2203	4300	6503	SO:0001583	missense	5253	exon7			AAATGCTACAAGT	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.907T>A	9.37:g.96416812T>A	ENSP00000352185:p.Tyr303Asn	64.0	0.0	0		42.0	15.0	0.357143	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.888902	0.91814	.	.	ENSG00000197724	ENST00000359246	T	0.73258	-0.73	5.12	5.12	0.69794	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.87047	0.6080	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90098	0.4182	10	0.87932	D	0	-25.2923	15.0746	0.72066	0.0:0.0:0.0:1.0	.	303	O75151	PHF2_HUMAN	N	303	ENSP00000352185:Y303N	ENSP00000352185:Y303N	Y	+	1	0	PHF2	95456633	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.781000	0.85668	2.136000	0.66102	0.477000	0.44152	TAC	.	.	none		0.587	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
LIN28B	389421	hgsc.bcm.edu	37	6	105526426	105526426	+	Missense_Mutation	SNP	C	C	T	rs201716597		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:105526426C>T	ENST00000345080.4	+	4	724	c.521C>T	c.(520-522)gCg>gTg	p.A174V		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	174					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CAGCCACCCGCGAGTTCTCAG	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		20262	0.0		0.001	False		,,,				2504	0.0				p.A174V		Atlas-SNP	.											.	LIN28B	17	.	0			c.C521T						PASS	.						91.0	82.0	85.0					6																	105526426		2203	4300	6503	SO:0001583	missense	389421	exon4			CACCCGCGAGTTC	AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.521C>T	6.37:g.105526426C>T	ENSP00000344401:p.Ala174Val	58.0	0.0	0		34.0	30.0	0.882353	NM_001004317	A1L165|B2RPN6|Q5TCM4	Missense_Mutation	SNP	ENST00000345080.4	37	CCDS34504.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	5.567	0.289449	0.10567	.	.	ENSG00000187772	ENST00000345080	.	.	.	6.02	3.12	0.35913	.	0.509217	0.22018	N	0.065761	T	0.18841	0.0452	L	0.40543	1.245	0.09310	N	1	B	0.17852	0.024	B	0.08055	0.003	T	0.16276	-1.0408	9	0.31617	T	0.26	2.6381	13.409	0.60931	0.0:0.7984:0.0:0.2016	.	174	Q6ZN17	LN28B_HUMAN	V	174	.	ENSP00000344401:A174V	A	+	2	0	LIN28B	105633119	0.781000	0.28676	0.002000	0.10522	0.165000	0.22458	3.304000	0.51866	0.093000	0.17368	-0.797000	0.03246	GCG	C|1.000;T|0.000	0.000	strong		0.527	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041646.2	NM_001004317	
BRINP2	57795	hgsc.bcm.edu	37	1	177250054	177250054	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:177250054C>A	ENST00000361539.4	+	8	2054	c.1742C>A	c.(1741-1743)aCc>aAc	p.T581N	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	581					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											AAGAACAGCACCCTGGAGCCT	0.562																																					p.T581N		Atlas-SNP	.											.	FAM5B	191	.	0			c.C1742A						PASS	.						59.0	54.0	56.0					1																	177250054		2203	4300	6503	SO:0001583	missense	57795	exon8			ACAGCACCCTGGA		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1742C>A	1.37:g.177250054C>A	ENSP00000354481:p.Thr581Asn	104.0	0.0	0		89.0	45.0	0.505618	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528306	0.64860	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.18174	2.23	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.991	T	0.46119	-0.9214	10	0.62326	D	0.03	-26.8652	18.4386	0.90656	0.0:1.0:0.0:0.0	.	476;581	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	N	334;581	ENSP00000354481:T581N	ENSP00000354481:T581N	T	+	2	0	FAM5B	175516677	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.707000	0.84623	2.443000	0.82685	0.313000	0.20887	ACC	.	.	none		0.562	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
ABHD3	171586	hgsc.bcm.edu	37	18	19283631	19283631	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr18:19283631G>A	ENST00000289119.2	-	2	379	c.240C>T	c.(238-240)taC>taT	p.Y80Y	ABHD3_ENST00000580981.1_Silent_p.Y80Y|ABHD3_ENST00000578270.1_5'UTR|ABHD3_ENST00000579875.1_5'UTR	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	80						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						CCGTCGGGTAGTACGTTTCTG	0.537																																					p.Y80Y		Atlas-SNP	.											.	ABHD3	32	.	0			c.C240T						PASS	.						84.0	78.0	80.0					18																	19283631		2203	4300	6503	SO:0001819	synonymous_variant	171586	exon2			CGGGTAGTACGTT	AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.240C>T	18.37:g.19283631G>A		91.0	0.0	0		105.0	34.0	0.32381	NM_138340	B0YIV0|B7Z5C2|O43411	Silent	SNP	ENST00000289119.2	37	CCDS32802.1																																																																																			.	.	none		0.537	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444757.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21330979	21330979	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr18:21330979G>A	ENST00000313654.9	+	5	1023	c.782G>A	c.(781-783)cGt>cAt	p.R261H	LAMA3_ENST00000399516.3_Missense_Mutation_p.R261H	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	261	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATCCGCTTGCGTTTTCTTAGA	0.468																																					p.R261H		Atlas-SNP	.											.	LAMA3	397	.	0			c.G782A						PASS	.						116.0	114.0	115.0					18																	21330979		1887	4117	6004	SO:0001583	missense	3909	exon5			GCTTGCGTTTTCT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.782G>A	18.37:g.21330979G>A	ENSP00000324532:p.Arg261His	210.0	0.0	0		267.0	86.0	0.322097	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.63|13.63	2.294832|2.294832	0.40594|0.40594	.|.	.|.	ENSG00000053747|ENSG00000053747	ENST00000416669|ENST00000313654;ENST00000399516;ENST00000538801	.|T;T	.|0.76709	.|-1.04;-1.04	5.64|5.64	4.77|4.77	0.60923|0.60923	.|Laminin, N-terminal (3);	.|.	.|.	.|.	.|.	.|T	.|0.74921	.|0.3780	M|M	0.71920|0.71920	2.185|2.185	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.16396	.|0.017;0.011;0.008	.|B;B;B	.|0.15052	.|0.004;0.006;0.012	.|T	.|0.70901	.|-0.4746	.|9	.|0.37606	.|T	.|0.19	.|.	11.2504|11.2504	0.49022|0.49022	0.1911:0.0:0.8089:0.0|0.1911:0.0:0.8089:0.0	.|.	.|261;261;261	.|F5H8G3;Q6VU67;Q16787	.|.;.;LAMA3_HUMAN	.|H	-1|261	.|ENSP00000324532:R261H;ENSP00000382432:R261H	.|ENSP00000324532:R261H	.|R	+|+	.|2	.|0	LAMA3|LAMA3	19584977|19584977	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.724000|0.724000	0.41520|0.41520	1.510000|1.510000	0.35790|0.35790	1.390000|1.390000	0.46547|0.46547	-0.119000|-0.119000	0.15052|0.15052	.|CGT	.	.	none		0.468	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
RBBP7	5931	hgsc.bcm.edu	37	X	16881137	16881137	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:16881137A>C	ENST00000380087.2	-	3	608	c.248T>G	c.(247-249)gTa>gGa	p.V83G	RBBP7_ENST00000380084.4_Missense_Mutation_p.V127G|RBBP7_ENST00000404022.1_Missense_Mutation_p.V83G			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	83					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					GGGAATATGTACTCGAGCAAC	0.423																																					p.V127G		Atlas-SNP	.											.	RBBP7	58	.	0			c.T380G						PASS	.						162.0	133.0	143.0					X																	16881137		2203	4300	6503	SO:0001583	missense	5931	exon3			ATATGTACTCGAG	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.248T>G	X.37:g.16881137A>C	ENSP00000369427:p.Val83Gly	191.0	0.0	0		193.0	177.0	0.917098	NM_001198719	Q5JP00	Missense_Mutation	SNP	ENST00000380087.2	37	CCDS14179.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.617623	0.87359	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000416035;ENST00000468092	T;T;T;T	0.75260	-0.71;-0.92;-0.75;-0.77	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.90707	0.7084	H	0.96833	3.89	0.80722	D	1	P;D;D	0.63880	0.954;0.989;0.993	D;D;D	0.87578	0.995;0.998;0.997	D	0.93493	0.6837	10	0.87932	D	0	1.766	14.2069	0.65739	1.0:0.0:0.0:0.0	.	83;83;127	E9PC52;Q16576;Q5JP00	.;RBBP7_HUMAN;.	G	83;127;83;3;49	ENSP00000369427:V83G;ENSP00000369424:V127G;ENSP00000386068:V83G;ENSP00000392714:V3G	ENSP00000369424:V127G	V	-	2	0	RBBP7	16791058	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	9.283000	0.95860	1.954000	0.56735	0.481000	0.45027	GTA	.	.	none		0.423	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
POLR1A	25885	hgsc.bcm.edu	37	2	86302316	86302316	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:86302316G>A	ENST00000263857.6	-	12	1826	c.1448C>T	c.(1447-1449)gCg>gTg	p.A483V	POLR1A_ENST00000409681.1_Missense_Mutation_p.A483V			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	483					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GTTGATGACCGCTTGCCTAAG	0.552																																					p.A483V		Atlas-SNP	.											POLR1A,NS,carcinoma,0,1	POLR1A	137	1	0			c.C1448T						scavenged	.						36.0	38.0	37.0					2																	86302316		2009	4181	6190	SO:0001583	missense	25885	exon12			ATGACCGCTTGCC	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.1448C>T	2.37:g.86302316G>A	ENSP00000263857:p.Ala483Val	144.0	1.0	0.00694444		109.0	42.0	0.385321	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084366	0.55861	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.68025	-0.3;-0.3	5.01	5.01	0.66863	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.101743	0.64402	D	0.000003	T	0.81375	0.4809	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.80358	-0.1416	10	0.38643	T	0.18	-15.9554	18.1227	0.89577	0.0:0.0:1.0:0.0	.	483	O95602	RPA1_HUMAN	V	483	ENSP00000263857:A483V;ENSP00000386300:A483V	ENSP00000263857:A483V	A	-	2	0	POLR1A	86155827	1.000000	0.71417	1.000000	0.80357	0.425000	0.31504	9.165000	0.94761	2.606000	0.88127	0.655000	0.94253	GCG	.	.	none		0.552	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
SPATA9	83890	hgsc.bcm.edu	37	5	94994492	94994492	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:94994492C>T	ENST00000274432.8	-	5	741	c.600G>A	c.(598-600)gaG>gaA	p.E200E	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	200					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		CAAACATAGGCTCCGAAAGCA	0.418																																					p.E200E		Atlas-SNP	.											.	SPATA9	17	.	0			c.G600A						PASS	.						112.0	104.0	107.0					5																	94994492		2203	4299	6502	SO:0001819	synonymous_variant	83890	exon5			CATAGGCTCCGAA	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.600G>A	5.37:g.94994492C>T		190.0	0.0	0		207.0	91.0	0.439614	NM_031952	A8K8H3|Q4G122|Q86X33|Q8NA28	Silent	SNP	ENST00000274432.8	37	CCDS4076.1																																																																																			.	.	none		0.418	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
PKP1	5317	hgsc.bcm.edu	37	1	201252908	201252908	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:201252908G>A	ENST00000352845.3	+	1	78	c.78G>A	c.(76-78)ccG>ccA	p.P26P	PKP1_ENST00000263946.3_Silent_p.P26P|PKP1_ENST00000367324.3_Silent_p.P26P			Q13835	PKP1_HUMAN	plakophilin 1	26					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						TGGCTTTGCCGTCGGACCAAA	0.612																																					p.P26P		Atlas-SNP	.											.	PKP1	127	.	0			c.G78A						PASS	.						109.0	86.0	94.0					1																	201252908		2203	4300	6503	SO:0001819	synonymous_variant	5317	exon1			TTTGCCGTCGGAC	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.78G>A	1.37:g.201252908G>A		81.0	0.0	0		85.0	35.0	0.411765	NM_001005337	O00645|Q14CA0|Q15152	Silent	SNP	ENST00000352845.3	37	CCDS30966.1																																																																																			.	.	none		0.612	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
LRRTM4	80059	hgsc.bcm.edu	37	2	77746080	77746080	+	Silent	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:77746080G>T	ENST00000409093.1	-	3	1251	c.915C>A	c.(913-915)tcC>tcA	p.S305S	LRRTM4_ENST00000409884.1_Silent_p.S305S|LRRTM4_ENST00000409088.3_Silent_p.S305S|LRRTM4_ENST00000409282.1_Silent_p.S306S|LRRTM4_ENST00000409911.1_Silent_p.S306S			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	305					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		ACAATGTGATGGATATTAATG	0.353																																					p.S305S		Atlas-SNP	.											.	LRRTM4	334	.	0			c.C915A						PASS	.						45.0	40.0	42.0					2																	77746080		1858	4108	5966	SO:0001819	synonymous_variant	80059	exon3			TGTGATGGATATT	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.915C>A	2.37:g.77746080G>T		134.0	0.0	0		96.0	43.0	0.447917	NM_024993	Q4FZ98|Q6UXJ7	Silent	SNP	ENST00000409093.1	37	CCDS46346.1																																																																																			.	.	none		0.353	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
COL21A1	81578	hgsc.bcm.edu	37	6	55924958	55924958	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:55924958G>A	ENST00000244728.5	-	28	2863	c.2466C>T	c.(2464-2466)tcC>tcT	p.S822S	COL21A1_ENST00000535941.1_Silent_p.S822S|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Silent_p.S819S|COL21A1_ENST00000370808.2_Intron	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	822					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AGCCATGTTGGGACAGGCAAT	0.493																																					p.S822S		Atlas-SNP	.											.	COL21A1	201	.	0			c.C2466T						PASS	.						49.0	48.0	48.0					6																	55924958		1846	4088	5934	SO:0001819	synonymous_variant	81578	exon28			ATGTTGGGACAGG	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2466C>T	6.37:g.55924958G>A		235.0	0.0	0		216.0	102.0	0.472222	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1																																																																																			.	.	none		0.493	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
AGTR2	186	hgsc.bcm.edu	37	X	115303934	115303934	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:115303934T>G	ENST00000371906.4	+	3	591	c.401T>G	c.(400-402)tTt>tGt	p.F134C		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	134					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	AGCATTTTTTTTATCACCTGC	0.388																																					p.F134C		Atlas-SNP	.											.	AGTR2	62	.	0			c.T401G						PASS	.						178.0	171.0	173.0					X																	115303934		2203	4300	6503	SO:0001583	missense	186	exon3			TTTTTTTTATCAC	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.401T>G	X.37:g.115303934T>G	ENSP00000360973:p.Phe134Cys	345.0	0.0	0		249.0	228.0	0.915663	NM_000686	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.277816	0.59758	.	.	ENSG00000180772	ENST00000371906	T	0.39229	1.09	4.69	4.69	0.59074	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58509	0.2127	L	0.59912	1.85	0.54753	D	0.999987	D	0.89917	1.0	D	0.85130	0.997	T	0.61753	-0.6998	10	0.87932	D	0	-12.1196	11.0559	0.47918	0.0:0.0:0.0:1.0	.	134	P50052	AGTR2_HUMAN	C	134	ENSP00000360973:F134C	ENSP00000360973:F134C	F	+	2	0	AGTR2	115217962	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.023000	0.70848	1.734000	0.51633	0.412000	0.27726	TTT	.	.	none		0.388	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
ROS1	6098	hgsc.bcm.edu	37	6	117686814	117686814	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:117686814A>G	ENST00000368508.3	-	19	3101	c.2903T>C	c.(2902-2904)cTg>cCg	p.L968P	ROS1_ENST00000368507.3_Missense_Mutation_p.L963P|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	968	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ACCATTCCACAGGATTTGAAA	0.403			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.L968P		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.T2903C						PASS	.						62.0	58.0	59.0					6																	117686814		2203	4300	6503	SO:0001583	missense	6098	exon19			TTCCACAGGATTT	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2903T>C	6.37:g.117686814A>G	ENSP00000357494:p.Leu968Pro	175.0	1.0	0.00571429		83.0	64.0	0.771084	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.787844	0.31593	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.54675	0.56;0.56	4.98	0.875	0.19130	.	0.587883	0.14154	N	0.337834	T	0.19406	0.0466	N	0.19112	0.55	0.80722	D	1	B	0.26258	0.145	B	0.36608	0.229	T	0.12734	-1.0536	10	0.45353	T	0.12	.	3.3358	0.07101	0.5397:0.2614:0.0729:0.126	.	968	P08922	ROS1_HUMAN	P	968;963	ENSP00000357494:L968P;ENSP00000357493:L963P	ENSP00000357493:L963P	L	-	2	0	ROS1	117793507	0.989000	0.36119	0.945000	0.38365	0.870000	0.49936	0.937000	0.28951	-0.027000	0.13873	-0.299000	0.09455	CTG	.	.	none		0.403	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230360	23230360	+	Missense_Mutation	SNP	G	G	A	rs6003368	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23230360G>A	ENST00000526893.1	+	1	401	c.127G>A	c.(127-129)Gtt>Att	p.V43I	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.V43I|IGLL5_ENST00000531372.1_Missense_Mutation_p.V43I	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	43						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCGCCCAATGGTTGCACCGCA	0.672																																					p.W7X		Atlas-SNP	.											.	IGLL5	26	.	0			c.G21A						PASS	.																																			SO:0001583	missense	100423062	exon1			CCAATGGTTGCAC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.127G>A	22.37:g.23230360G>A	ENSP00000431254:p.Val43Ile	104.0	0.0	0		101.0	47.0	0.465347	NM_001256296		Nonsense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.827	1.187440	0.21870	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00568	6.53;6.53	3.92	0.473	0.16763	.	.	.	.	.	T	0.00300	0.0009	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.10450	0.005	T	0.44034	-0.9354	9	0.49607	T	0.09	.	2.3416	0.04261	0.1095:0.1927:0.4993:0.1985	rs6003368;rs6003368	43	B9A064	IGLL5_HUMAN	I	43	ENSP00000436353:V43I;ENSP00000431254:V43I	ENSP00000431254:V43I	V	+	1	0	IGLL5	21560360	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.128000	0.03247	0.192000	0.20272	0.643000	0.83706	GTT	G|1.000;|0.000	.	weak		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
C20orf194	25943	hgsc.bcm.edu	37	20	3302910	3302910	+	Splice_Site	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:3302910C>A	ENST00000252032.9	-	16	1378		c.e16-1		C20orf194_ENST00000453730.2_Splice_Site	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194											NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						CGGTACAATTCTAGGAGGGGA	0.418																																					.		Atlas-SNP	.											.	C20orf194	83	.	0			c.1311-1G>T						PASS	.						80.0	74.0	76.0					20																	3302910		1877	4105	5982	SO:0001630	splice_region_variant	25943	exon17			ACAATTCTAGGAG	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1311-1G>T	20.37:g.3302910C>A		59.0	0.0	0		44.0	17.0	0.386364	NM_001009984	Q66K86|Q6P2R9|Q9UFX9	Splice_Site	SNP	ENST00000252032.9	37	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387063	0.61956	.	.	ENSG00000088854	ENST00000252032;ENST00000453730	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0876	0.72167	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C20orf194	3250910	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	4.403000	0.59729	2.622000	0.88805	0.655000	0.94253	.	.	.	none		0.418	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984	Intron
RFX1	5989	hgsc.bcm.edu	37	19	14076565	14076565	+	Silent	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:14076565C>G	ENST00000254325.4	-	15	2220	c.1986G>C	c.(1984-1986)ctG>ctC	p.L662L		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	662					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TGGCTTTGGGCAGTCGCTTCT	0.612																																					p.L662L		Atlas-SNP	.											.	RFX1	63	.	0			c.G1986C						PASS	.						139.0	121.0	127.0					19																	14076565		2203	4300	6503	SO:0001819	synonymous_variant	5989	exon15			TTTGGGCAGTCGC		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.1986G>C	19.37:g.14076565C>G		66.0	0.0	0		50.0	27.0	0.54	NM_002918		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																			.	.	none		0.612	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
PNLIPRP3	119548	hgsc.bcm.edu	37	10	118220524	118220524	+	Silent	SNP	C	C	A	rs199970109	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:118220524C>A	ENST00000369230.3	+	6	758	c.612C>A	c.(610-612)gtC>gtA	p.V204V		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	204					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.V204V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CAAAGGAAGTCAGGCTAGACC	0.438																																					p.V204V		Atlas-SNP	.											PNLIPRP3,NS,carcinoma,0,1	PNLIPRP3	101	1	1	Substitution - coding silent(1)	lung(1)	c.C612A						PASS	.						125.0	113.0	117.0					10																	118220524		2203	4300	6503	SO:0001819	synonymous_variant	119548	exon6			GGAAGTCAGGCTA	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.612C>A	10.37:g.118220524C>A		172.0	0.0	0		187.0	57.0	0.304813	NM_001011709		Silent	SNP	ENST00000369230.3	37	CCDS31292.1																																																																																			C|0.999;T|0.001	.	alt		0.438	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	
MBOAT2	129642	hgsc.bcm.edu	37	2	9028160	9028160	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:9028160C>T	ENST00000305997.3	-	5	637	c.439G>A	c.(439-441)Gaa>Aaa	p.E147K	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	147					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.E147K(1)	MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCATGAATTTCGCAAGCCAAA	0.274																																					p.E147K	Ovarian(194;1699 3813 22401)	Atlas-SNP	.											MBOAT2,caecum,carcinoma,0,2	MBOAT2	36	2	1	Substitution - Missense(1)	large_intestine(1)	c.G439A						PASS	.						68.0	78.0	74.0					2																	9028160		2201	4292	6493	SO:0001583	missense	129642	exon5			GAATTTCGCAAGC	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.439G>A	2.37:g.9028160C>T	ENSP00000302177:p.Glu147Lys	531.0	1.0	0.00188324		456.0	218.0	0.47807	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	37	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458328	0.84317	.	.	ENSG00000143797	ENST00000305997;ENST00000462696	T;T	0.74421	-0.84;-0.84	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.83046	0.5169	M	0.70595	2.14	0.58432	D	0.999992	D;D	0.62365	0.991;0.991	P;P	0.56612	0.802;0.802	D	0.83379	0.0011	10	0.52906	T	0.07	-24.9514	17.9261	0.88983	0.0:1.0:0.0:0.0	.	147;147	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	K	147;124	ENSP00000302177:E147K;ENSP00000417409:E124K	ENSP00000302177:E147K	E	-	1	0	MBOAT2	8945611	1.000000	0.71417	0.967000	0.41034	0.919000	0.55068	5.638000	0.67861	2.767000	0.95098	0.655000	0.94253	GAA	.	.	none		0.274	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
NUF2	83540	hgsc.bcm.edu	37	1	163318812	163318812	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:163318812T>C	ENST00000271452.3	+	13	1481	c.1202T>C	c.(1201-1203)aTt>aCt	p.I401T	NUF2_ENST00000367900.3_Missense_Mutation_p.I401T|NUF2_ENST00000524800.1_Missense_Mutation_p.I354T	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	401	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					ATCCAAAAAATTAAACTTGGA	0.338																																					p.I401T		Atlas-SNP	.											.	NUF2	138	.	0			c.T1202C						PASS	.						60.0	64.0	63.0					1																	163318812		2203	4299	6502	SO:0001583	missense	83540	exon13			AAAAAATTAAACT	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1202T>C	1.37:g.163318812T>C	ENSP00000271452:p.Ile401Thr	369.0	0.0	0		276.0	124.0	0.449275	NM_145697	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	37	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	T	1.373	-0.585581	0.03827	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.34072	1.45;1.38;1.38	5.5	3.13	0.36017	.	0.485095	0.24628	N	0.036908	T	0.09291	0.0229	L	0.34521	1.04	0.29837	N	0.829583	B;B	0.23058	0.079;0.079	B;B	0.21546	0.035;0.035	T	0.21793	-1.0235	9	0.17832	T	0.49	-1.6075	7.0329	0.24977	0.1477:0.0:0.1549:0.6974	.	354;401	E9PQC4;Q9BZD4	.;NUF2_HUMAN	T	354;401;401	ENSP00000436888:I354T;ENSP00000356875:I401T;ENSP00000271452:I401T	ENSP00000271452:I401T	I	+	2	0	NUF2	161585436	0.007000	0.16637	0.000000	0.03702	0.330000	0.28571	0.855000	0.27805	0.484000	0.27630	-0.301000	0.09380	ATT	.	.	none		0.338	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	
TIAM1	7074	hgsc.bcm.edu	37	21	32617950	32617950	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr21:32617950C>T	ENST00000286827.3	-	7	1909	c.1438G>A	c.(1438-1440)Gac>Aac	p.D480N	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.D480N	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	480	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GACCTGCCGTCGCTCTCGTAG	0.527																																					p.D480N		Atlas-SNP	.											.	TIAM1	522	.	0			c.G1438A						PASS	.						72.0	63.0	66.0					21																	32617950		2203	4300	6503	SO:0001583	missense	7074	exon7			TGCCGTCGCTCTC		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1438G>A	21.37:g.32617950C>T	ENSP00000286827:p.Asp480Asn	90.0	0.0	0		99.0	51.0	0.515152	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376098	0.82682	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.29655	1.56;1.56	5.22	5.22	0.72569	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	N	0.17474	0.49	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.989;0.994;0.994;0.994	T	0.32745	-0.9895	10	0.41790	T	0.15	.	18.9723	0.92719	0.0:1.0:0.0:0.0	.	480;480;321;480	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	N	480;321;480	ENSP00000286827:D480N;ENSP00000441570:D480N	ENSP00000286827:D480N	D	-	1	0	TIAM1	31539821	1.000000	0.71417	0.363000	0.25875	0.950000	0.60333	7.628000	0.83189	2.717000	0.92951	0.650000	0.86243	GAC	.	.	none		0.527	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
CSMD1	64478	hgsc.bcm.edu	37	8	2964161	2964161	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr8:2964161C>A	ENST00000520002.1	-	47	7396	c.6841G>T	c.(6841-6843)Gat>Tat	p.D2281Y	CSMD1_ENST00000542608.1_Missense_Mutation_p.D2280Y|CSMD1_ENST00000602557.1_Missense_Mutation_p.D2281Y|CSMD1_ENST00000537824.1_Missense_Mutation_p.D2280Y|CSMD1_ENST00000400186.3_Missense_Mutation_p.D2281Y|CSMD1_ENST00000602723.1_Missense_Mutation_p.D2281Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2281	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTCACAAAATCTCCTAGAAGA	0.468																																					p.D2280Y		Atlas-SNP	.											.	CSMD1	1469	.	0			c.G6838T						PASS	.						45.0	46.0	46.0					8																	2964161		1923	4128	6051	SO:0001583	missense	64478	exon46			CAAAATCTCCTAG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6841G>T	8.37:g.2964161C>A	ENSP00000430733:p.Asp2281Tyr	70.0	0.0	0		49.0	20.0	0.408163	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.42|17.42	3.385605|3.385605	0.61956|0.61956	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.67171|.	-0.25;-0.25;-0.25;-0.25|.	5.31|5.31	5.31|5.31	0.75309|0.75309	Complement control module (2);Sushi/SCR/CCP (3);|.	0.062552|.	0.64402|.	D|.	0.000011|.	D|D	0.87446|0.87446	0.6179|0.6179	H|H	0.94264|0.94264	3.515|3.515	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	D|D	0.90900|0.90900	0.4768|0.4768	10|5	0.52906|.	T|.	0.07|.	.|.	18.9876|18.9876	0.92779|0.92779	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2281;2281;2280|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	Y|I	2281;2281;2142;2280;2280|1760	ENSP00000383047:D2281Y;ENSP00000430733:D2281Y;ENSP00000441462:D2280Y;ENSP00000446243:D2280Y|.	ENSP00000320445:D2142Y|.	D|R	-|-	1|2	0|0	CSMD1|CSMD1	2951568|2951568	1.000000|1.000000	0.71417|0.71417	0.804000|0.804000	0.32291|0.32291	0.196000|0.196000	0.23810|0.23810	7.113000|7.113000	0.77095|0.77095	2.476000|2.476000	0.83614|0.83614	0.557000|0.557000	0.71058|0.71058	GAT|AGA	.	.	none		0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CCDC89	220388	hgsc.bcm.edu	37	11	85396761	85396761	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:85396761C>T	ENST00000316398.3	-	1	559	c.413G>A	c.(412-414)cGc>cAc	p.R138H	CREBZF_ENST00000531515.1_5'Flank|CREBZF_ENST00000534224.1_5'Flank	NM_152723.1	NP_689936.1	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	138						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	15		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ATCCTTGAAGCGGAGCATCAA	0.517																																					p.R138H		Atlas-SNP	.											.	CCDC89	45	.	0			c.G413A						PASS	.						105.0	92.0	96.0					11																	85396761		2203	4299	6502	SO:0001583	missense	220388	exon1			TTGAAGCGGAGCA	AK095478	CCDS8270.1	11q14.1	2006-03-16			ENSG00000179071	ENSG00000179071			26762	protein-coding gene	gene with protein product						12477932	Standard	NM_152723		Approved	FLJ38159	uc001pau.1	Q8N998	OTTHUMG00000166976	ENST00000316398.3:c.413G>A	11.37:g.85396761C>T	ENSP00000320649:p.Arg138His	109.0	0.0	0		92.0	44.0	0.478261	NM_152723		Missense_Mutation	SNP	ENST00000316398.3	37	CCDS8270.1	.	.	.	.	.	.	.	.	.	.	c	16.35	3.099386	0.56183	.	.	ENSG00000179071	ENST00000316398	.	.	.	5.53	4.62	0.57501	.	0.712446	0.14115	N	0.340425	T	0.51007	0.1649	M	0.76002	2.32	0.32187	N	0.579655	B	0.22211	0.066	B	0.17098	0.017	T	0.56214	-0.8016	8	.	.	.	-8.569	9.1248	0.36807	0.0:0.7911:0.0:0.2089	.	138	Q8N998	CCD89_HUMAN	H	138	.	.	R	-	2	0	CCDC89	85074409	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	1.958000	0.40402	1.346000	0.45694	-0.141000	0.14075	CGC	.	.	none		0.517	CCDC89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392182.1	NM_152723	
BBX	56987	hgsc.bcm.edu	37	3	107524323	107524323	+	3'UTR	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:107524323A>C	ENST00000325805.8	+	0	3132				BBX_ENST00000416476.2_Missense_Mutation_p.K612N|BBX_ENST00000402543.1_3'UTR|BBX_ENST00000406780.1_3'UTR|BBX_ENST00000415149.2_3'UTR			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)						bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TTCATTGTAAAACATTGTGCT	0.488																																					p.K612N		Atlas-SNP	.											.	BBX	156	.	0			c.A1836C						PASS	.						75.0	73.0	74.0					3																	107524323		2203	4300	6503	SO:0001624	3_prime_UTR_variant	56987	exon17			TTGTAAAACATTG	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.*19A>C	3.37:g.107524323A>C		143.0	0.0	0		119.0	66.0	0.554622	NM_001276286	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.112854	0.37242	.	.	ENSG00000114439	ENST00000416476	D	0.99014	-5.33	6.16	5.01	0.66863	.	.	.	.	.	D	0.98096	0.9372	.	.	.	0.80722	D	1	P	0.52577	0.954	P	0.45310	0.476	D	0.97243	0.9892	8	0.87932	D	0	.	12.2288	0.54476	0.9341:0.0:0.0659:0.0	.	612	A2RRM7	.	N	612	ENSP00000403860:K612N	ENSP00000403860:K612N	K	+	3	2	BBX	109007013	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.850000	0.55918	1.148000	0.42385	0.528000	0.53228	AAA	.	.	none		0.488	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
PIM1	5292	hgsc.bcm.edu	37	6	37139045	37139045	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37139045C>G	ENST00000373509.5	+	4	758	c.385C>G	c.(385-387)Ctc>Gtc	p.L129V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGTGCAAGATCTCTTCGACTT	0.632			T	BCL6	NHL																																p.L220V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C658G						PASS	.						82.0	96.0	91.0					6																	37139045		2203	4300	6503	SO:0001583	missense	5292	exon4			CAAGATCTCTTCG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.385C>G	6.37:g.37139045C>G	ENSP00000362608:p.Leu129Val	97.0	0.0	0		76.0	30.0	0.394737	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025243	0.75390	.	.	ENSG00000137193	ENST00000373509	T	0.42131	0.98	4.28	4.28	0.50868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000005	T	0.64316	0.2587	M	0.86864	2.845	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.72597	-0.4245	10	0.87932	D	0	.	16.8746	0.86048	0.0:1.0:0.0:0.0	.	220	P11309	PIM1_HUMAN	V	129	ENSP00000362608:L129V	ENSP00000362608:L129V	L	+	1	0	PIM1	37247023	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	5.539000	0.67199	2.371000	0.80710	0.549000	0.68633	CTC	.	.	none		0.632	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
NIPA2	81614	hgsc.bcm.edu	37	15	23006258	23006258	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr15:23006258T>C	ENST00000337451.3	-	8	1658	c.1046A>G	c.(1045-1047)aAt>aGt	p.N349S	NIPA2_ENST00000398013.3_Missense_Mutation_p.N349S|NIPA2_ENST00000398014.2_Missense_Mutation_p.N349S|NIPA2_ENST00000539711.2_Missense_Mutation_p.N330S|NIPA2_ENST00000359727.4_Missense_Mutation_p.N330S	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	349						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		TCGGGAGACATTTTCACCAGT	0.333																																					p.N349S		Atlas-SNP	.											.	NIPA2	49	.	0			c.A1046G						PASS	.						67.0	69.0	69.0					15																	23006258		2203	4299	6502	SO:0001583	missense	81614	exon10			GAGACATTTTCAC	AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.1046A>G	15.37:g.23006258T>C	ENSP00000337618:p.Asn349Ser	78.0	0.0	0		75.0	28.0	0.373333	NM_001184889	F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	ENST00000337451.3	37	CCDS10010.1	.	.	.	.	.	.	.	.	.	.	T	4.537	0.099732	0.08681	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D	0.89343	-2.5;-2.5;-2.5	5.76	3.47	0.39725	.	0.270973	0.41712	D	0.000834	T	0.69842	0.3156	N	0.08118	0	0.23138	N	0.998235	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56420	-0.7982	10	0.02654	T	1	-7.2012	4.7	0.12822	0.0:0.2748:0.1546:0.5706	.	330;349	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	S	349;349;330;349;330	ENSP00000337618:N349S;ENSP00000381096:N349S;ENSP00000352762:N330S	ENSP00000337618:N349S	N	-	2	0	NIPA2	20557699	0.849000	0.29639	0.375000	0.26029	0.637000	0.38172	1.381000	0.34362	0.537000	0.28751	-0.274000	0.10170	AAT	.	.	none		0.333	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251137.1	NM_030922	
DUOX1	53905	hgsc.bcm.edu	37	15	45439820	45439820	+	Nonsense_Mutation	SNP	C	C	T	rs143543011		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr15:45439820C>T	ENST00000321429.4	+	20	2919	c.2512C>T	c.(2512-2514)Cga>Tga	p.R838*	DUOX1_ENST00000389037.3_Nonsense_Mutation_p.R838*|DUOX1_ENST00000561166.1_Nonsense_Mutation_p.R484*	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	838	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCTGTCCTTCCGAGAGTTCCT	0.572																																					p.R838X		Atlas-SNP	.											.	DUOX1	125	.	0			c.C2512T						PASS	.	C	stop/ARG,stop/ARG	0,4396		0,0,2198	57.0	51.0	53.0		2512,2512	4.4	1.0	15	dbSNP_134	53	1,8593	1.2+/-3.3	0,1,4296	no	stop-gained,stop-gained	DUOX1	NM_017434.3,NM_175940.1	,	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	,	838/1552,838/1552	45439820	1,12989	2198	4297	6495	SO:0001587	stop_gained	53905	exon20			TCCTTCCGAGAGT	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2512C>T	15.37:g.45439820C>T	ENSP00000317997:p.Arg838*	92.0	0.0	0		98.0	14.0	0.142857	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Nonsense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	C	42	9.282840	0.99123	0.0	1.16E-4	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	.	.	.	5.29	4.38	0.52667	.	0.119039	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.5202	6.7146	0.23296	0.175:0.7368:0.0:0.0882	.	.	.	.	X	838	.	ENSP00000317997:R838X	R	+	1	2	DUOX1	43227112	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.797000	0.38804	1.465000	0.48006	0.655000	0.94253	CGA	C|1.000;T|0.000	0.000	weak		0.572	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
ROPN1L	83853	hgsc.bcm.edu	37	5	10465050	10465050	+	Silent	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:10465050A>C	ENST00000503804.1	+	6	1205	c.684A>C	c.(682-684)gtA>gtC	p.V228V	ROPN1L_ENST00000274134.4_Silent_p.V228V|ROPN1L_ENST00000510520.1_Intron			Q96C74	ROP1L_HUMAN	rhophilin associated tail protein 1-like	228					epithelial cilium movement (GO:0003351)|regulation of protein phosphorylation (GO:0001932)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)	14						CTGAAGATGTAGGCCATTAAT	0.363																																					p.V228V		Atlas-SNP	.											.	ROPN1L	33	.	0			c.A684C						PASS	.						66.0	74.0	71.0					5																	10465050		2203	4299	6502	SO:0001819	synonymous_variant	83853	exon5			AGATGTAGGCCAT	AF239723	CCDS3879.1	5p15	2011-01-20	2011-01-20		ENSG00000145491	ENSG00000145491			24060	protein-coding gene	gene with protein product	"""radial spoke head 11 homolog (Chlamydomonas)"""	611756	"""ropporin 1-like"""			11278869	Standard	NM_031916		Approved	ASP, FLJ25776, RSPH11	uc021xwo.1	Q96C74	OTTHUMG00000090507	ENST00000503804.1:c.684A>C	5.37:g.10465050A>C		382.0	0.0	0		296.0	132.0	0.445946	NM_031916	D3DTC9|Q9BZX0	Silent	SNP	ENST00000503804.1	37	CCDS3879.1																																																																																			.	.	none		0.363	ROPN1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367033.1	NM_031916	
NISCH	11188	hgsc.bcm.edu	37	3	52521970	52521970	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:52521970G>T	ENST00000479054.1	+	17	2534	c.2462G>T	c.(2461-2463)aGc>aTc	p.S821I	NISCH_ENST00000345716.4_Missense_Mutation_p.S821I			Q9Y2I1	NISCH_HUMAN	nischarin	821	Interaction with LIMK. {ECO:0000250}.|Interaction with PAK1. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	ATGCTGTGTAGCCCCATCCTC	0.637																																					p.S821I		Atlas-SNP	.											.	NISCH	97	.	0			c.G2462T						PASS	.																																			SO:0001583	missense	11188	exon16			TGTGTAGCCCCAT	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.2462G>T	3.37:g.52521970G>T	ENSP00000418232:p.Ser821Ile	54.0	0.0	0		25.0	17.0	0.68	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154440	0.38021	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000414197	T;T	0.08008	3.14;3.14	5.04	3.91	0.45181	.	0.473507	0.24508	N	0.037909	T	0.04634	0.0126	N	0.19112	0.55	0.29426	N	0.860202	B	0.30824	0.296	B	0.23275	0.045	T	0.17837	-1.0356	10	0.32370	T	0.25	-32.2783	7.2654	0.26227	0.1185:0.0:0.7221:0.1594	.	821	Q9Y2I1	NISCH_HUMAN	I	821;821;165	ENSP00000418232:S821I;ENSP00000339958:S821I	ENSP00000339958:S821I	S	+	2	0	NISCH	52497010	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.986000	0.40677	2.504000	0.84457	0.561000	0.74099	AGC	.	.	none		0.637	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
FOXB2	442425	hgsc.bcm.edu	37	9	79635701	79635701	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr9:79635701G>A	ENST00000376708.1	+	1	1131	c.1131G>A	c.(1129-1131)gcG>gcA	p.A377A		NM_001013735.1	NP_001013757.1	Q5VYV0	FOXB2_HUMAN	forkhead box B2	377					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(8)|ovary(1)	10						CCGTGTCCGCGCTGCAGCCGG	0.741																																					p.A377A		Atlas-SNP	.											.	FOXB2	71	.	0			c.G1131A						PASS	.						5.0	7.0	6.0					9																	79635701		2097	4106	6203	SO:0001819	synonymous_variant	442425	exon1			GTCCGCGCTGCAG		CCDS35045.1	9q21.2	2008-02-05			ENSG00000204612	ENSG00000204612		"""Forkhead boxes"""	23315	protein-coding gene	gene with protein product							Standard	NM_001013735		Approved	bA159H20.4	uc004ako.1	Q5VYV0	OTTHUMG00000020051	ENST00000376708.1:c.1131G>A	9.37:g.79635701G>A		37.0	0.0	0		54.0	27.0	0.5	NM_001013735		Silent	SNP	ENST00000376708.1	37	CCDS35045.1																																																																																			.	.	none		0.741	FOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052745.1	NM_001013735	
NCAM2	4685	hgsc.bcm.edu	37	21	22656515	22656515	+	Splice_Site	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr21:22656515G>A	ENST00000400546.1	+	3	381	c.132G>A	c.(130-132)gcG>gcA	p.A44A	NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000535285.1_Splice_Site_p.A69A	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	44	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TCTTTGCAGCGATTGGTGAAC	0.328																																					p.A44A		Atlas-SNP	.											.	NCAM2	220	.	0			c.G132A						PASS	.						101.0	90.0	94.0					21																	22656515		1827	4072	5899	SO:0001630	splice_region_variant	4685	exon3			TGCAGCGATTGGT		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.131-1G>A	21.37:g.22656515G>A		109.0	0.0	0		81.0	43.0	0.530864	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																			.	.	none		0.328	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	Silent
PRRT3	285368	hgsc.bcm.edu	37	3	9991706	9991706	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:9991706T>C	ENST00000412055.1	-	2	223	c.94A>G	c.(94-96)Agg>Ggg	p.R32G	PRRT3_ENST00000411976.2_Missense_Mutation_p.R32G|PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	32						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						TCAAGTGGCCTGGGAAAGCCC	0.632																																					p.R32G		Atlas-SNP	.											.	PRRT3	35	.	0			c.A94G						PASS	.						40.0	45.0	43.0					3																	9991706		1875	4109	5984	SO:0001583	missense	285368	exon2			GTGGCCTGGGAAA	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.94A>G	3.37:g.9991706T>C	ENSP00000392511:p.Arg32Gly	72.0	0.0	0		72.0	37.0	0.513889	NM_207351	Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	ENST00000412055.1	37	CCDS43049.1	.	.	.	.	.	.	.	.	.	.	T	6.596	0.478299	0.12521	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.22336	2.27;1.96	3.99	-0.116	0.13555	.	0.770020	0.11482	N	0.559607	T	0.11922	0.0290	L	0.32530	0.975	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.32295	-0.9912	9	.	.	.	-1.4593	2.4229	0.04453	0.208:0.2375:0.0:0.5545	.	32;32	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	G	32	ENSP00000392511:R32G;ENSP00000404512:R32G	.	R	-	1	2	PRRT3	9966706	0.099000	0.21834	0.007000	0.13788	0.098000	0.18820	0.390000	0.20768	0.198000	0.20407	0.455000	0.32223	AGG	.	.	none		0.632	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
PTPN18	26469	hgsc.bcm.edu	37	2	131130741	131130741	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:131130741C>T	ENST00000175756.5	+	15	1428	c.1327C>T	c.(1327-1329)Cgc>Tgc	p.R443C	PTPN18_ENST00000347849.3_Missense_Mutation_p.R336C	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	443					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					TTTCAACCTGCGCATTGGGAG	0.617																																					p.R443C		Atlas-SNP	.											PTPN18,colon,carcinoma,0,1	PTPN18	42	1	0			c.C1327T						PASS	.						41.0	38.0	39.0					2																	131130741		2203	4300	6503	SO:0001583	missense	26469	exon15			AACCTGCGCATTG	X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.1327C>T	2.37:g.131130741C>T	ENSP00000175756:p.Arg443Cys	87.0	0.0	0		56.0	23.0	0.410714	NM_014369	B4E1E6|Q53P42	Missense_Mutation	SNP	ENST00000175756.5	37	CCDS2161.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083313	0.76642	.	.	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	T;T	0.36699	2.13;1.24	5.29	5.29	0.74685	.	0.000000	0.39146	N	0.001451	T	0.56485	0.1988	L	0.59436	1.845	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.999	T	0.57974	-0.7718	10	0.87932	D	0	.	14.8028	0.69929	0.0:1.0:0.0:0.0	.	422;443;336	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	C	443;336;422	ENSP00000175756:R443C;ENSP00000310092:R336C	ENSP00000175756:R443C	R	+	1	0	PTPN18	130847211	0.996000	0.38824	1.000000	0.80357	0.449000	0.32228	3.714000	0.54889	2.634000	0.89283	0.655000	0.94253	CGC	.	.	none		0.617	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2		
OR1M1	125963	hgsc.bcm.edu	37	19	9204160	9204160	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:9204160G>T	ENST00000429566.3	+	1	306	c.240G>T	c.(238-240)aaG>aaT	p.K80N		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CCATCCCTAAGATGCTGGTGA	0.537																																					p.K80N		Atlas-SNP	.											.	OR1M1	52	.	0			c.G240T						PASS	.						95.0	69.0	78.0					19																	9204160		2203	4300	6503	SO:0001583	missense	125963	exon1			CCCTAAGATGCTG		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.240G>T	19.37:g.9204160G>T	ENSP00000401966:p.Lys80Asn	160.0	0.0	0		147.0	71.0	0.482993	NM_001004456	B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	g	11.79	1.744634	0.30865	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	D	0.85861	-2.04	3.49	0.0484	0.14285	GPCR, rhodopsin-like superfamily (1);	0.204155	0.34223	N	0.004148	D	0.86184	0.5872	L	0.52266	1.64	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.75479	-0.3303	10	0.72032	D	0.01	.	4.1085	0.10049	0.4185:0.1742:0.4073:0.0	.	80	Q8NGA1	OR1M1_HUMAN	N	83;80	ENSP00000401966:K80N	ENSP00000303195:K83N	K	+	3	2	OR1M1	9065160	0.000000	0.05858	0.927000	0.36925	0.440000	0.31957	-0.125000	0.10579	-0.000000	0.14550	0.400000	0.26472	AAG	.	.	none		0.537	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1		
PCDHA11	56138	hgsc.bcm.edu	37	5	140249903	140249903	+	Silent	SNP	G	G	A	rs372041974		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:140249903G>A	ENST00000398640.2	+	1	1215	c.1215G>A	c.(1213-1215)tcG>tcA	p.S405S	PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	405	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTACTACTCGTTGGTGCTGG	0.617																																					p.S405S		Atlas-SNP	.											.	PCDHA11	209	.	0			c.G1215A						PASS	.	G	,,,,,,,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	156.0	146.0	149.0		,,1215,,,,,,,,,,,,1215	-11.4	0.0	5		149	0,8600		0,0,4300	no	intron,intron,coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHA9,PCDHA11,PCDHA10,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018901.2,NM_018902.3,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1,NM_031860.1,NM_031861.1	,,,,,,,,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,,,,,,,	,,405/950,,,,,,,,,,,,405/811	140249903	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56138	exon1			CTACTCGTTGGTG	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1215G>A	5.37:g.140249903G>A		178.0	0.0	0		140.0	60.0	0.428571	NM_018902	B2RN58|O75279	Silent	SNP	ENST00000398640.2	37	CCDS47284.1																																																																																			.	.	weak		0.617	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100220	27100220	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:27100220G>T	ENST00000607124.1	-	1	309	c.310C>A	c.(310-312)Cct>Act	p.P104T	HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.P104T|HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.P104T			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	104					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						AACTCCCCAGGCAGCAGCAGG	0.602																																					p.P104T		Atlas-SNP	.											.	HIST1H2BJ	21	.	0			c.C310A						PASS	.						80.0	82.0	82.0					6																	27100220		2203	4300	6503	SO:0001583	missense	8970	exon1			CCCCAGGCAGCAG	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.310C>A	6.37:g.27100220G>T	ENSP00000476136:p.Pro104Thr	81.0	0.0	0		55.0	28.0	0.509091	NM_021058	B2R4J4|O60816	Missense_Mutation	SNP	ENST00000607124.1	37	CCDS4618.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145750	0.57044	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.60672	0.17;0.17	4.06	4.06	0.47325	Histone-fold (2);	0.000000	0.43747	U	0.000526	T	0.80696	0.4672	H	0.97077	3.935	0.53688	D	0.999973	D	0.89917	1.0	D	0.79108	0.992	D	0.87167	0.2218	10	0.87932	D	0	.	14.5496	0.68057	0.0:0.0:1.0:0.0	.	104	P06899	H2B1J_HUMAN	T	104	ENSP00000445633:P104T;ENSP00000342886:P104T	ENSP00000342886:P104T	P	-	1	0	HIST1H2BJ	27208199	1.000000	0.71417	1.000000	0.80357	0.219000	0.24729	6.815000	0.75242	2.210000	0.71456	0.585000	0.79938	CCT	.	.	none		0.602	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
ZCCHC8	55596	hgsc.bcm.edu	37	12	122958280	122958280	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:122958280C>T	ENST00000336229.4	-	14	2018	c.1888G>A	c.(1888-1890)Gta>Ata	p.V630I	ZCCHC8_ENST00000543897.1_Missense_Mutation_p.V392I|ZCCHC8_ENST00000536306.1_Missense_Mutation_p.V392I|ZCCHC8_ENST00000538116.1_Missense_Mutation_p.V241I	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	630					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		CAGTTTGGTACGACACTGCCA	0.493																																					p.V630I		Atlas-SNP	.											.	ZCCHC8	56	.	0			c.G1888A						PASS	.						156.0	155.0	155.0					12																	122958280		1960	4140	6100	SO:0001583	missense	55596	exon14			TTGGTACGACACT	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1888G>A	12.37:g.122958280C>T	ENSP00000337313:p.Val630Ile	159.0	0.0	0		267.0	161.0	0.602996	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	C	10.54	1.379058	0.24944	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.78	-0.726	0.11170	.	0.855254	0.10528	N	0.664129	T	0.27629	0.0679	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.26224	-1.0109	10	0.37606	T	0.19	0.0081	1.0127	0.01501	0.2262:0.3504:0.1053:0.318	.	630	Q6NZY4	ZCHC8_HUMAN	I	392;392;630;241	ENSP00000441423:V392I;ENSP00000438993:V392I;ENSP00000337313:V630I;ENSP00000440028:V241I	ENSP00000337313:V630I	V	-	1	0	ZCCHC8	121524233	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.257000	0.08745	-0.449000	0.07117	-0.827000	0.03088	GTA	.	.	none		0.493	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
OR5L1	219437	hgsc.bcm.edu	37	11	55579714	55579714	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:55579714A>G	ENST00000333973.2	+	1	861	c.772A>G	c.(772-774)Att>Gtt	p.I258V		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				AGTCCTTTCCATTTATTGCAG	0.512																																					p.I258V		Atlas-SNP	.											.	OR5L1	145	.	0			c.A772G						PASS	.						120.0	104.0	109.0					11																	55579714		2200	4296	6496	SO:0001583	missense	219437	exon1			CTTTCCATTTATT	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.772A>G	11.37:g.55579714A>G	ENSP00000335529:p.Ile258Val	98.0	0.0	0		90.0	45.0	0.5	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	a	10.21	1.286627	0.23478	.	.	ENSG00000186117	ENST00000333973	T	0.00076	8.76	4.12	-2.28	0.06826	GPCR, rhodopsin-like superfamily (1);	0.509225	0.18083	N	0.152222	T	0.00073	0.0002	N	0.16130	0.375	0.09310	N	1	B	0.02656	0.0	B	0.12837	0.008	T	0.30909	-0.9962	10	0.72032	D	0.01	-12.5116	5.7752	0.18275	0.4031:0.4296:0.1673:0.0	.	258	Q8NGL2	OR5L1_HUMAN	V	258	ENSP00000335529:I258V	ENSP00000335529:I258V	I	+	1	0	OR5L1	55336290	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	0.358000	0.20216	-0.300000	0.08895	-0.815000	0.03128	ATT	.	.	none		0.512	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
NECAB3	63941	hgsc.bcm.edu	37	20	32246320	32246320	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:32246320G>T	ENST00000246190.6	-	10	1088	c.1033C>A	c.(1033-1035)Ctg>Atg	p.L345M	NECAB3_ENST00000375238.4_Missense_Mutation_p.L311M|RP1-63M2.6_ENST00000607224.1_RNA|NECAB3_ENST00000606525.1_5'UTR	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	345	ABM.				protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						AACTCATACAGGGTGAAGGAG	0.627																																					p.L345M		Atlas-SNP	.											.	NECAB3	27	.	0			c.C1033A						PASS	.						158.0	168.0	165.0					20																	32246320		2078	4218	6296	SO:0001583	missense	63941	exon10			CATACAGGGTGAA	AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.1033C>A	20.37:g.32246320G>T	ENSP00000246190:p.Leu345Met	91.0	0.0	0		69.0	39.0	0.565217	NM_031232	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Missense_Mutation	SNP	ENST00000246190.6	37	CCDS42866.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.670715	0.29693	.	.	ENSG00000125967	ENST00000375238;ENST00000246190	T;T	0.31510	1.49;1.49	5.01	1.96	0.26148	Dimeric alpha-beta barrel (1);Antibiotic biosynthesis monooxygenase (1);	0.150264	0.45867	D	0.000337	T	0.38241	0.1033	L	0.41824	1.3	0.43787	D	0.996328	D;P;B	0.67145	0.996;0.688;0.348	D;P;B	0.74348	0.983;0.525;0.28	T	0.06534	-1.0821	10	0.32370	T	0.25	-16.9783	6.7897	0.23693	0.16:0.1438:0.6962:0.0	.	222;345;311	E1P5N3;Q96P71;Q96P71-2	.;NECA3_HUMAN;.	M	311;345	ENSP00000364386:L311M;ENSP00000246190:L345M	ENSP00000246190:L345M	L	-	1	2	NECAB3	31709981	1.000000	0.71417	0.739000	0.30968	0.373000	0.29922	1.387000	0.34430	0.157000	0.19338	0.561000	0.74099	CTG	.	.	none		0.627	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078724.2		
PIM1	5292	hgsc.bcm.edu	37	6	37139128	37139128	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37139128G>A	ENST00000373509.5	+	4	841	c.468G>A	c.(466-468)cgG>cgA	p.R156R		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	247	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGGCCGTGCGGCACTGCCACA	0.617			T	BCL6	NHL																																p.R247R		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G741A						PASS	.						42.0	48.0	46.0					6																	37139128		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			CGTGCGGCACTGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.468G>A	6.37:g.37139128G>A		109.0	0.0	0		98.0	48.0	0.489796	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.617	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
OSBPL10	114884	hgsc.bcm.edu	37	3	32022431	32022431	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022431G>A	ENST00000396556.2	-	1	363	c.241C>T	c.(241-243)Ctc>Ttc	p.L81F	OSBPL10_ENST00000438237.2_Missense_Mutation_p.L81F|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	81	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		TATTTGCTGAGCACGCCCTCG	0.736																																					p.L81F		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C241T						PASS	.						22.0	22.0	22.0					3																	32022431		2197	4295	6492	SO:0001583	missense	114884	exon1			TGCTGAGCACGCC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.241C>T	3.37:g.32022431G>A	ENSP00000379804:p.Leu81Phe	89.0	0.0	0		76.0	37.0	0.486842	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001027	0.74818	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.71341	-0.56;-0.23	4.13	4.13	0.48395	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.208621	0.31872	N	0.006927	D	0.89132	0.6628	H	0.97340	3.985	0.32435	N	0.547512	D;D	0.89917	0.997;1.0	D;D	0.97110	0.939;1.0	D	0.92912	0.6348	10	0.87932	D	0	-9.416	14.2571	0.66060	0.0:0.0:1.0:0.0	.	81;81	B4E212;Q9BXB5	.;OSB10_HUMAN	F	81	ENSP00000379804:L81F;ENSP00000406124:L81F	ENSP00000379804:L81F	L	-	1	0	OSBPL10	31997435	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.609000	0.61148	2.301000	0.77427	0.462000	0.41574	CTC	.	.	none		0.736	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
OR5M10	390167	hgsc.bcm.edu	37	11	56345145	56345145	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:56345145G>C	ENST00000526812.2	-	1	118	c.53C>G	c.(52-54)aCa>aGa	p.T18R		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TGGGTCGTCTGTCAGTCCTAA	0.463																																					p.T18R		Atlas-SNP	.											.	OR5M10	56	.	0			c.C53G						PASS	.						156.0	146.0	149.0					11																	56345145		1908	4132	6040	SO:0001583	missense	390167	exon1			TCGTCTGTCAGTC	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.53C>G	11.37:g.56345145G>C	ENSP00000436004:p.Thr18Arg	228.0	0.0	0		153.0	63.0	0.411765	NM_001004741	B9EIL9	Missense_Mutation	SNP	ENST00000526812.2	37	CCDS53630.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845689	0.32606	.	.	ENSG00000254834	ENST00000526812	T	0.00438	7.42	4.04	4.04	0.47022	.	.	.	.	.	T	0.00998	0.0033	M	0.82716	2.605	0.09310	N	1	D	0.58268	0.982	P	0.59115	0.852	T	0.44452	-0.9327	9	0.72032	D	0.01	.	10.7138	0.46000	0.0:0.0:0.8092:0.1908	.	18	Q6IEU7	OR5MA_HUMAN	R	18	ENSP00000436004:T18R	ENSP00000436004:T18R	T	-	2	0	OR5M10	56101721	0.101000	0.21875	0.969000	0.41365	0.083000	0.17756	2.759000	0.47573	2.238000	0.73509	0.632000	0.83419	ACA	.	.	none		0.463	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
FAT4	79633	hgsc.bcm.edu	37	4	126241904	126241904	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:126241904C>G	ENST00000394329.3	+	1	4351	c.4338C>G	c.(4336-4338)gaC>gaG	p.D1446E		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1446	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CTGCACATGACCCTGATGCAG	0.398																																					p.D1446E		Atlas-SNP	.											.	FAT4	1752	.	0			c.C4338G						PASS	.						147.0	135.0	139.0					4																	126241904		1910	4138	6048	SO:0001583	missense	79633	exon1			ACATGACCCTGAT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4338C>G	4.37:g.126241904C>G	ENSP00000377862:p.Asp1446Glu	155.0	0.0	0		96.0	45.0	0.46875	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949004	0.53186	.	.	ENSG00000196159	ENST00000394329	T	0.73897	-0.79	4.8	1.91	0.25777	Cadherin (4);Cadherin-like (1);	0.000000	0.35585	U	0.003110	D	0.88175	0.6366	H	0.96430	3.82	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.85987	0.1486	10	0.87932	D	0	.	7.2653	0.26226	0.0:0.3824:0.0:0.6176	.	1446	Q6V0I7	FAT4_HUMAN	E	1446	ENSP00000377862:D1446E	ENSP00000377862:D1446E	D	+	3	2	FAT4	126461354	1.000000	0.71417	0.953000	0.39169	0.801000	0.45260	1.008000	0.29872	0.169000	0.19679	0.655000	0.94253	GAC	.	.	none		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022574	32022574	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022574C>T	ENST00000396556.2	-	1	220	c.98G>A	c.(97-99)tGc>tAc	p.C33Y	OSBPL10_ENST00000438237.2_Missense_Mutation_p.C33Y|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	33					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CGCCAGAGAGCAGGAGGGCGA	0.766																																					p.C33Y		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G98A						PASS	.						1.0	2.0	2.0					3																	32022574		814	1720	2534	SO:0001583	missense	114884	exon1			AGAGAGCAGGAGG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.98G>A	3.37:g.32022574C>T	ENSP00000379804:p.Cys33Tyr	72.0	0.0	0		70.0	35.0	0.5	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317836	0.40996	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.21734	1.99;2.31	4.07	4.07	0.47477	.	0.908584	0.09077	N	0.851908	T	0.12561	0.0305	N	0.08118	0	0.27201	N	0.960169	B;B	0.18461	0.028;0.028	B;B	0.12156	0.007;0.007	T	0.07252	-1.0782	10	0.59425	D	0.04	-4.5991	10.0692	0.42322	0.0:0.7946:0.2054:0.0	.	33;33	B4E212;Q9BXB5	.;OSB10_HUMAN	Y	33	ENSP00000379804:C33Y;ENSP00000406124:C33Y	ENSP00000379804:C33Y	C	-	2	0	OSBPL10	31997578	0.942000	0.31987	1.000000	0.80357	0.923000	0.55619	0.426000	0.21363	2.271000	0.75665	0.313000	0.20887	TGC	.	.	none		0.766	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
LIMD1	8994	hgsc.bcm.edu	37	3	45636456	45636456	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:45636456T>C	ENST00000273317.4	+	1	106	c.85T>C	c.(85-87)Ttc>Ctc	p.F29L	LIMD1_ENST00000440097.1_Missense_Mutation_p.F29L|AC099539.1_ENST00000516118.1_RNA|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	29					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		GGATGGGCTCTTCCGAGTGGA	0.552																																					p.F29L		Atlas-SNP	.											.	LIMD1	34	.	0			c.T85C						PASS	.						69.0	69.0	69.0					3																	45636456		2203	4300	6503	SO:0001583	missense	8994	exon1			GGGCTCTTCCGAG	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.85T>C	3.37:g.45636456T>C	ENSP00000273317:p.Phe29Leu	95.0	0.0	0		43.0	37.0	0.860465	NM_014240	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	37	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.993146	0.93167	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.73258	-0.73;-0.49	4.22	4.22	0.49857	.	0.140211	0.48286	D	0.000190	T	0.73140	0.3549	N	0.24115	0.695	0.50171	D	0.999852	D	0.69078	0.997	D	0.70716	0.97	T	0.76740	-0.2848	10	0.66056	D	0.02	.	13.3316	0.60490	0.0:0.0:0.0:1.0	.	29	Q9UGP4	LIMD1_HUMAN	L	29	ENSP00000394537:F29L;ENSP00000273317:F29L	ENSP00000273317:F29L	F	+	1	0	LIMD1	45611460	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.626000	0.83164	1.550000	0.49438	0.379000	0.24179	TTC	.	.	none		0.552	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
SEL1L2	80343	hgsc.bcm.edu	37	20	13866955	13866955	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:13866955T>A	ENST00000284951.5	-	9	953	c.879A>T	c.(877-879)gaA>gaT	p.E293D	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Missense_Mutation_p.E293D			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	293						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						CATCTCCTCTTTCTGCCAAAA	0.358																																					p.E293D		Atlas-SNP	.											.	SEL1L2	103	.	0			c.A879T						PASS	.						138.0	126.0	130.0					20																	13866955		1826	4081	5907	SO:0001583	missense	80343	exon9			TCCTCTTTCTGCC	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.879A>T	20.37:g.13866955T>A	ENSP00000284951:p.Glu293Asp	233.0	0.0	0		197.0	89.0	0.451777	NM_001271539	B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	37		.	.	.	.	.	.	.	.	.	.	T	13.98	2.397408	0.42512	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.54479	0.57;0.57	5.78	5.78	0.91487	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000003	T	0.49372	0.1553	N	0.12637	0.245	0.37334	D	0.910102	B;D	0.64830	0.086;0.994	B;D	0.70716	0.05;0.97	T	0.48885	-0.8995	10	0.07813	T	0.8	-26.0605	12.5063	0.55984	0.0:0.0:0.0:1.0	.	293;293	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	D	293	ENSP00000367312:E293D;ENSP00000284951:E293D	ENSP00000284951:E293D	E	-	3	2	SEL1L2	13814955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.496000	0.35638	2.205000	0.71048	0.454000	0.30748	GAA	.	.	none		0.358	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229	
CYB5R3	1727	hgsc.bcm.edu	37	22	43024249	43024249	+	Silent	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:43024249T>C	ENST00000352397.5	-	5	624	c.372A>G	c.(370-372)ggA>ggG	p.G124G	CYB5R3_ENST00000361740.4_Silent_p.G157G|CYB5R3_ENST00000407623.3_Silent_p.G101G|CYB5R3_ENST00000396303.3_Silent_p.G101G|CYB5R3_ENST00000402438.1_Silent_p.G101G|CYB5R3_ENST00000407332.1_Silent_p.G101G	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	124	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	ACATCTTCCCTCCAGCGGGAA	0.602																																					p.G157G		Atlas-SNP	.											.	CYB5R3	31	.	0			c.A471G						PASS	.						150.0	148.0	149.0					22																	43024249		2203	4300	6503	SO:0001819	synonymous_variant	1727	exon5			CTTCCCTCCAGCG	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.372A>G	22.37:g.43024249T>C		53.0	0.0	0		53.0	13.0	0.245283	NM_001171660	B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Silent	SNP	ENST00000352397.5	37	CCDS33658.1																																																																																			.	.	none		0.602	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1		
HSPA1L	3305	hgsc.bcm.edu	37	6	31778920	31778920	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:31778920G>A	ENST00000375654.4	-	2	1019	c.830C>T	c.(829-831)tCg>tTg	p.S277L	HSPA1L_ENST00000417199.3_Missense_Mutation_p.S277L	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	277					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GGTGCTGGACGACAGGGTCCT	0.527																																					p.S277L		Atlas-SNP	.											.	HSPA1L	185	.	0			c.C830T						PASS	.						65.0	72.0	70.0					6																	31778920		2203	4300	6503	SO:0001583	missense	3305	exon2			CTGGACGACAGGG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.830C>T	6.37:g.31778920G>A	ENSP00000364805:p.Ser277Leu	110.0	0.0	0		133.0	61.0	0.458647	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408085	0.83340	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.02525	4.26;4.26	5.4	5.4	0.78164	.	0.000000	0.30575	N	0.009335	T	0.29223	0.0727	H	0.99906	4.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60717	-0.7208	10	0.87932	D	0	-13.5603	16.7131	0.85391	0.0:0.0:1.0:0.0	.	277	P34931	HS71L_HUMAN	L	277;277;222;167	ENSP00000364805:S277L;ENSP00000387691:S277L	ENSP00000364804:S222L	S	-	2	0	HSPA1L	31886899	1.000000	0.71417	0.988000	0.46212	0.967000	0.64934	5.202000	0.65169	2.810000	0.96702	0.585000	0.79938	TCG	.	.	none		0.527	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
ACTG1	71	hgsc.bcm.edu	37	17	79479013	79479013	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:79479013C>G	ENST00000575842.1	-	2	705	c.279G>C	c.(277-279)gaG>gaC	p.E93D	ACTG1_ENST00000331925.2_Missense_Mutation_p.E93D|RP13-766D20.2_ENST00000430912.1_RNA|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000573283.1_Missense_Mutation_p.E93D|ACTG1_ENST00000575087.1_Missense_Mutation_p.E93D			P63261	ACTG_HUMAN	actin, gamma 1	93					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			CCACGCGCAGCTCGTTGTAGA	0.617																																					p.E93D		Atlas-SNP	.											.	ACTG1	55	.	0			c.G279C						PASS	.						56.0	60.0	59.0					17																	79479013		2202	4300	6502	SO:0001583	missense	71	exon3			GCGCAGCTCGTTG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.279G>C	17.37:g.79479013C>G	ENSP00000458162:p.Glu93Asp	85.0	0.0	0		101.0	56.0	0.554455	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.388120	0.25118	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.94897	-3.55	3.99	3.02	0.34903	.	0.000000	0.64402	D	0.000001	D	0.97554	0.9199	M	0.91354	3.2	0.46654	D	0.999145	P	0.39748	0.686	D	0.68353	0.957	D	0.97644	1.0150	10	0.87932	D	0	.	10.5389	0.45020	0.0:0.9026:0.0:0.0974	.	93	P63261	ACTG_HUMAN	D	93	ENSP00000331514:E93D	ENSP00000331514:E93D	E	-	3	2	ACTG1	77093608	1.000000	0.71417	0.984000	0.44739	0.011000	0.07611	4.453000	0.60061	0.903000	0.36546	-0.251000	0.11542	GAG	.	.	none		0.617	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
TRIOBP	11078	hgsc.bcm.edu	37	22	38153834	38153834	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:38153834C>T	ENST00000406386.3	+	16	6157	c.5902C>T	c.(5902-5904)Cgc>Tgc	p.R1968C	TRIOBP_ENST00000407319.2_Missense_Mutation_p.R255C|TRIOBP_ENST00000403663.2_Missense_Mutation_p.R255C	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1968					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CACTCCTGACCGCCTGGCCAA	0.716																																					p.R1968C		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C5902T						PASS	.						5.0	7.0	6.0					22																	38153834		2074	4027	6101	SO:0001583	missense	11078	exon16			CCTGACCGCCTGG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5902C>T	22.37:g.38153834C>T	ENSP00000384312:p.Arg1968Cys	51.0	0.0	0		56.0	21.0	0.375	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.39|17.39	3.378678|3.378678	0.61735|0.61735	.|.	.|.	ENSG00000100106|ENSG00000100106	ENST00000428075|ENST00000406386;ENST00000407319;ENST00000403663;ENST00000418339;ENST00000417857	.|T	.|0.22743	.|1.94	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|.	.|.	.|.	.|.	T|T	0.39886|0.39886	0.1095|0.1095	M|M	0.61703|0.61703	1.905|1.905	0.22389|0.22389	N|N	0.999146|0.999146	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.68039	.|0.955;0.945;0.93	T|T	0.25502|0.25502	-1.0130|-1.0130	5|9	.|0.72032	.|D	.|0.01	.|.	8.7704|8.7704	0.34728|0.34728	0.0:0.7687:0.1523:0.079|0.0:0.7687:0.1523:0.079	.|.	.|255;255;1968	.|F8W6V6;F2Z2W0;Q9H2D6	.|.;.;TARA_HUMAN	L|C	208|1968;255;255;214;184	.|ENSP00000384312:R1968C	.|ENSP00000386026:R255C	P|R	+|+	2|1	0|0	TRIOBP|TRIOBP	36483780|36483780	0.632000|0.632000	0.27172|0.27172	0.974000|0.974000	0.42286|0.42286	0.895000|0.895000	0.52256|0.52256	1.766000|1.766000	0.38491|0.38491	2.413000|2.413000	0.81919|0.81919	0.561000|0.561000	0.74099|0.74099	CCG|CGC	.	.	none		0.716	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
MYO5B	4645	hgsc.bcm.edu	37	18	47518736	47518736	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr18:47518736A>C	ENST00000285039.7	-	6	977	c.678T>G	c.(676-678)atT>atG	p.I226M		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	226	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGTCAAAGCCAATCTGGATGT	0.502																																					p.I226M		Atlas-SNP	.											.	MYO5B	178	.	0			c.T678G						PASS	.						242.0	227.0	232.0					18																	47518736		1969	4160	6129	SO:0001583	missense	4645	exon6			AAAGCCAATCTGG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.678T>G	18.37:g.47518736A>C	ENSP00000285039:p.Ile226Met	177.0	0.0	0		168.0	39.0	0.232143	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.517619	0.64634	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.90563	-2.69	5.65	-10.9	0.00192	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.94338	0.8180	M	0.87682	2.9	0.80722	D	1	D;D	0.57257	0.979;0.979	D;P	0.66084	0.941;0.83	D	0.94766	0.7940	10	0.87932	D	0	.	22.7498	0.99975	0.3171:0.0:0.6829:0.0	.	225;226	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	M	226;225	ENSP00000285039:I226M	ENSP00000285039:I226M	I	-	3	3	MYO5B	45772734	0.552000	0.26505	0.251000	0.24312	0.946000	0.59487	-0.123000	0.10611	-2.356000	0.00613	-0.899000	0.02877	ATT	.	.	none		0.502	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
PIM1	5292	hgsc.bcm.edu	37	6	37139097	37139097	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37139097G>A	ENST00000373509.5	+	4	810	c.437G>A	c.(436-438)aGc>aAc	p.S146N		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CTGGCCCGCAGCTTCTTCTGG	0.612			T	BCL6	NHL																																p.S237N		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,carcinoma,+1,3	PIM1	71	3	0			c.G710A						scavenged	.						51.0	60.0	57.0					6																	37139097		2202	4300	6502	SO:0001583	missense	5292	exon4			CCCGCAGCTTCTT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.437G>A	6.37:g.37139097G>A	ENSP00000362608:p.Ser146Asn	117.0	1.0	0.00854701		93.0	44.0	0.473118	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567906	0.28003	.	.	ENSG00000137193	ENST00000373509	T	0.65364	-0.15	4.36	4.36	0.52297	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.376195	0.29355	N	0.012392	T	0.28599	0.0708	N	0.20304	0.555	0.31131	N	0.707701	B	0.06786	0.001	B	0.10450	0.005	T	0.05289	-1.0894	10	0.17832	T	0.49	.	15.8069	0.78520	0.0:0.0:1.0:0.0	.	237	P11309	PIM1_HUMAN	N	146	ENSP00000362608:S146N	ENSP00000362608:S146N	S	+	2	0	PIM1	37247075	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.004000	0.57068	2.254000	0.74563	0.448000	0.29417	AGC	.	.	none		0.612	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PPP5C	5536	hgsc.bcm.edu	37	19	46878959	46878959	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:46878959C>T	ENST00000012443.4	+	3	565	c.462C>T	c.(460-462)ggC>ggT	p.G154G	PPP5C_ENST00000391919.1_Silent_p.G48G	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	154					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CCATCGCGGGCGACGAGCACA	0.582																																					p.G154G		Atlas-SNP	.											PPP5C,NS,carcinoma,0,1	PPP5C	44	1	0			c.C462T						PASS	.						60.0	49.0	53.0					19																	46878959		2203	4299	6502	SO:0001819	synonymous_variant	5536	exon3			CGCGGGCGACGAG		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.462C>T	19.37:g.46878959C>T		91.0	0.0	0		109.0	67.0	0.614679	NM_006247	Q16722|Q53XV2	Silent	SNP	ENST00000012443.4	37	CCDS12684.1																																																																																			.	.	none		0.582	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24909679	24909679	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:24909679T>G	ENST00000396432.2	-	9	1631	c.1145A>C	c.(1144-1146)cAg>cCg	p.Q382P	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.Q169P	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	381					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GTCTATGTGCTGATGGGAATT	0.383																																					p.Q382P		Atlas-SNP	.											.	ARHGAP21	185	.	0			c.A1145C						PASS	.						64.0	62.0	63.0					10																	24909679		2203	4300	6503	SO:0001583	missense	57584	exon9			ATGTGCTGATGGG	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1145A>C	10.37:g.24909679T>G	ENSP00000379709:p.Gln382Pro	160.0	0.0	0		140.0	56.0	0.4	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	T	21.0	4.080051	0.76528	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.58652	2.26;2.28;0.32;0.32	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.76227	0.3958	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79322	-0.1851	10	0.87932	D	0	.	16.0697	0.80914	0.0:0.0:0.0:1.0	.	372;381	F8W9U9;Q5T5U3	.;RHG21_HUMAN	P	382;371;169;372;382;217	ENSP00000379709:Q382P;ENSP00000365604:Q169P;ENSP00000365592:Q372P;ENSP00000405018:Q382P	ENSP00000365604:Q169P	Q	-	2	0	ARHGAP21	24949685	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.563000	0.82314	2.260000	0.74910	0.528000	0.53228	CAG	.	.	none		0.383	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
ARHGEF3	50650	hgsc.bcm.edu	37	3	56763546	56763546	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:56763546G>A	ENST00000296315.3	-	10	1501	c.1333C>T	c.(1333-1335)Cgt>Tgt	p.R445C	ARHGEF3_ENST00000496106.1_Missense_Mutation_p.R451C|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.R416C|ARHGEF3_ENST00000413728.2_Missense_Mutation_p.R451C|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.R477C	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	445	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TTGGCTTGACGAATACAGTTA	0.488																																					p.R477C		Atlas-SNP	.											ARHGEF3_ENST00000413728,NS,carcinoma,0,4	ARHGEF3	128	4	0			c.C1429T						scavenged	.						125.0	127.0	126.0					3																	56763546		2203	4300	6503	SO:0001583	missense	50650	exon13			CTTGACGAATACA	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.1333C>T	3.37:g.56763546G>A	ENSP00000296315:p.Arg445Cys	292.0	2.0	0.00684932		260.0	122.0	0.469231	NM_001128615	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226831	0.79576	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.95	5.95	0.96441	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	M	0.72118	2.19	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.987;0.992;0.999;0.994;0.987;0.997	T	0.63328	-0.6662	10	0.87932	D	0	-11.142	20.3789	0.98926	0.0:0.0:1.0:0.0	.	451;416;243;477;445;451	E9PG37;E7EU49;Q9NR81-4;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;ARHG3_HUMAN;.	C	445;477;451;451;416	ENSP00000296315:R445C;ENSP00000341071:R477C;ENSP00000410922:R451C;ENSP00000420420:R451C;ENSP00000418826:R416C	ENSP00000296315:R445C	R	-	1	0	ARHGEF3	56738586	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.366000	0.59492	2.826000	0.97356	0.563000	0.77884	CGT	.	.	none		0.488	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
UTRN	7402	hgsc.bcm.edu	37	6	145148756	145148756	+	Silent	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:145148756A>G	ENST00000367545.3	+	67	9543	c.9543A>G	c.(9541-9543)caA>caG	p.Q3181Q	UTRN_ENST00000367526.4_Silent_p.Q736Q	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3181					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCCCCTCACAATCTCCTCAAC	0.368																																					p.Q3181Q		Atlas-SNP	.											.	UTRN	327	.	0			c.A9543G						PASS	.						70.0	68.0	69.0					6																	145148756		2203	4300	6503	SO:0001819	synonymous_variant	7402	exon67			CTCACAATCTCCT	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9543A>G	6.37:g.145148756A>G		146.0	0.0	0		59.0	45.0	0.762712	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	3.934	-0.015659	0.07681	.	.	ENSG00000152818	ENST00000367524	.	.	.	5.78	2.9	0.33743	.	.	.	.	.	T	0.28732	0.0712	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.17137	-1.0379	4	.	.	.	.	2.5299	0.04700	0.209:0.1277:0.5314:0.1319	.	.	.	.	S	212	.	.	N	+	2	0	UTRN	145190449	1.000000	0.71417	0.995000	0.50966	0.674000	0.39518	1.026000	0.30103	0.337000	0.23665	-0.321000	0.08615	AAT	.	.	none		0.368	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
KRT1	3848	hgsc.bcm.edu	37	12	53069243	53069243	+	Missense_Mutation	SNP	T	T	C	rs77846840|rs540699806|rs267607656	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:53069243T>C	ENST00000252244.3	-	9	1727	c.1669A>G	c.(1669-1671)Agc>Ggc	p.S557G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						ccgtagctgctacctccggag	0.682																																					p.S557G		Atlas-SNP	.											.	KRT1	110	.	3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)	c.A1669G						PASS	.						4.0	4.0	4.0					12																	53069243		1805	3566	5371	SO:0001583	missense	3848	exon9			AGCTGCTACCTCC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669A>G	12.37:g.53069243T>C	ENSP00000252244:p.Ser557Gly	11.0	0.0	0		26.0	12.0	0.461538	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	t	12.77	2.037794	0.35989	.	.	ENSG00000167768	ENST00000252244	T	0.81247	-1.47	3.63	0.628	0.17681	.	.	.	.	.	T	0.54711	0.1875	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48490	-0.9031	8	0.07644	T	0.81	.	5.639	0.17552	0.0:0.6406:0.1602:0.1993	.	557	P04264	K2C1_HUMAN	G	557	ENSP00000252244:S557G	ENSP00000252244:S557G	S	-	1	0	KRT1	51355510	0.000000	0.05858	0.034000	0.17996	0.201000	0.24016	-0.192000	0.09587	-0.104000	0.12154	-1.598000	0.00824	AGC	T|0.500;C|0.500	0.500	weak		0.682	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
KCNA3	3738	hgsc.bcm.edu	37	1	111216563	111216563	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:111216563C>T	ENST00000369769.2	-	1	1092	c.869G>A	c.(868-870)aGc>aAc	p.S290N		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	290					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	ATCGGAGAAGCTGGAGGCTCC	0.617																																					p.S290N		Atlas-SNP	.											.	KCNA3	91	.	0			c.G869A						PASS	.						63.0	66.0	65.0					1																	111216563		2203	4300	6503	SO:0001583	missense	3738	exon1			GAGAAGCTGGAGG	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.869G>A	1.37:g.111216563C>T	ENSP00000358784:p.Ser290Asn	58.0	0.0	0		56.0	25.0	0.446429	NM_002232	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	.	.	.	.	.	.	.	.	.	.	C	7.305	0.613728	0.14066	.	.	ENSG00000177272	ENST00000369769	D	0.97404	-4.37	5.04	4.11	0.48088	.	0.311416	0.29861	U	0.011005	D	0.88983	0.6586	L	0.34521	1.04	0.39488	D	0.968005	B	0.14012	0.009	B	0.17433	0.018	D	0.84153	0.0424	10	0.17369	T	0.5	.	10.7352	0.46120	0.1908:0.8092:0.0:0.0	.	290	P22001	KCNA3_HUMAN	N	290	ENSP00000358784:S290N	ENSP00000358784:S290N	S	-	2	0	KCNA3	111018086	.	.	1.000000	0.80357	0.982000	0.71751	.	.	1.090000	0.41315	0.655000	0.94253	AGC	.	.	none		0.617	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022619	32022619	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022619C>T	ENST00000396556.2	-	1	175	c.53G>A	c.(52-54)aGc>aAc	p.S18N	OSBPL10_ENST00000438237.2_Missense_Mutation_p.S18N|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	18					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		gctgctgcggctgctgctgtt	0.796																																					p.S18N		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G53A						PASS	.						2.0	3.0	2.0					3																	32022619		664	1482	2146	SO:0001583	missense	114884	exon1			CTGCGGCTGCTGC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.53G>A	3.37:g.32022619C>T	ENSP00000379804:p.Ser18Asn	89.0	0.0	0		114.0	60.0	0.526316	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925701	0.52759	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.23754	1.89;2.21	3.91	3.91	0.45181	.	1.365760	0.06023	N	0.651587	T	0.18964	0.0455	N	0.14661	0.345	0.32030	N	0.59962	B;B	0.27498	0.18;0.18	B;B	0.18871	0.023;0.023	T	0.08066	-1.0740	10	0.49607	T	0.09	.	13.8256	0.63348	0.0:1.0:0.0:0.0	.	18;18	B4E212;Q9BXB5	.;OSB10_HUMAN	N	18	ENSP00000379804:S18N;ENSP00000406124:S18N	ENSP00000379804:S18N	S	-	2	0	OSBPL10	31997623	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	2.935000	0.48963	2.196000	0.70406	0.298000	0.19748	AGC	.	.	none		0.796	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
POU2F2	5452	hgsc.bcm.edu	37	19	42600043	42600043	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:42600043G>A	ENST00000526816.2	-	9	717	c.702C>T	c.(700-702)aaC>aaT	p.N234N	POU2F2_ENST00000533720.1_Silent_p.N218N|POU2F2_ENST00000529952.1_Silent_p.N234N|POU2F2_ENST00000389341.5_Silent_p.N218N|POU2F2_ENST00000560558.1_Silent_p.N179N|POU2F2_ENST00000560398.1_Silent_p.N240N|POU2F2_ENST00000342301.4_Silent_p.N234N|POU2F2_ENST00000529067.1_Silent_p.N218N			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	234	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GGCTGAAGTCGTTGCCGTAGA	0.637																																					p.N234N		Atlas-SNP	.											.	POU2F2	106	.	0			c.C702T						PASS	.						114.0	114.0	114.0					19																	42600043		2203	4300	6503	SO:0001819	synonymous_variant	5452	exon9			GAAGTCGTTGCCG		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.702C>T	19.37:g.42600043G>A		60.0	0.0	0		116.0	28.0	0.241379	NM_001207025	Q16648|Q7M4M8|Q9BRS4	Silent	SNP	ENST00000526816.2	37	CCDS56095.1																																																																																			.	.	none		0.637	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
SPHKAP	80309	hgsc.bcm.edu	37	2	228882550	228882550	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:228882550G>A	ENST00000392056.3	-	7	3066	c.3020C>T	c.(3019-3021)aCg>aTg	p.T1007M	SPHKAP_ENST00000344657.5_Missense_Mutation_p.T1007M	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1007						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.T1007M(4)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GTGCTCGTCCGTCTTCCTCTT	0.517																																					p.T1007M		Atlas-SNP	.											SPHKAP_ENST00000392056,NS,carcinoma,0,4	SPHKAP	750	4	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.C3020T						scavenged	.						91.0	79.0	83.0					2																	228882550		2203	4300	6503	SO:0001583	missense	80309	exon7			TCGTCCGTCTTCC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3020C>T	2.37:g.228882550G>A	ENSP00000375909:p.Thr1007Met	149.0	1.0	0.00671141		131.0	59.0	0.450382	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965491	0.74131	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.20738	2.06;2.05	6.08	6.08	0.98989	.	0.044434	0.85682	D	0.000000	T	0.38268	0.1034	L	0.29908	0.895	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.975;0.964;0.993	T	0.06826	-1.0805	10	0.87932	D	0	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	38;1007;1007	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	M	1007	ENSP00000375909:T1007M;ENSP00000339886:T1007M	ENSP00000339886:T1007M	T	-	2	0	SPHKAP	228590794	1.000000	0.71417	0.553000	0.28255	0.787000	0.44495	9.020000	0.93667	2.894000	0.99253	0.655000	0.94253	ACG	.	.	none		0.517	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
PIM1	5292	hgsc.bcm.edu	37	6	37138332	37138332	+	5'UTR	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138332C>G	ENST00000373509.5	+	0	354					NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CGTCCCTGCGCCGACATCCTG	0.697			T	BCL6	NHL																																p.A85G		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C254G						PASS	.						22.0	22.0	22.0					6																	37138332		2198	4297	6495	SO:0001623	5_prime_UTR_variant	5292	exon1			CCTGCGCCGACAT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.-20C>G	6.37:g.37138332C>G		63.0	0.0	0		38.0	18.0	0.473684	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.697	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
C10orf71	118461	hgsc.bcm.edu	37	10	50533940	50533940	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:50533940T>C	ENST00000374144.3	+	3	3638	c.3350T>C	c.(3349-3351)cTc>cCc	p.L1117P	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1117										endometrium(1)	1						ACCCACGCCCTCGTGTGGGAG	0.657																																					p.L1117P		Atlas-SNP	.											.	C10orf71	179	.	0			c.T3350C						PASS	.						20.0	24.0	23.0					10																	50533940		692	1591	2283	SO:0001583	missense	118461	exon3			ACGCCCTCGTGTG	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3350T>C	10.37:g.50533940T>C	ENSP00000363259:p.Leu1117Pro	73.0	0.0	0		36.0	13.0	0.361111	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305585	0.60305	.	.	ENSG00000177354	ENST00000374144	T	0.05258	3.47	5.38	-0.584	0.11702	.	0.498207	0.15004	N	0.285973	T	0.04543	0.0124	L	0.32530	0.975	0.09310	N	1	.	.	.	.	.	.	T	0.37009	-0.9724	8	0.32370	T	0.25	.	1.3367	0.02146	0.1493:0.2989:0.1343:0.4176	.	.	.	.	P	1117	ENSP00000363259:L1117P	ENSP00000363259:L1117P	L	+	2	0	C10orf71	50203946	0.000000	0.05858	0.030000	0.17652	0.421000	0.31385	0.464000	0.21988	0.040000	0.15660	0.402000	0.26972	CTC	.	.	none		0.657	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
MUC4	4585	hgsc.bcm.edu	37	3	195512623	195512623	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:195512623G>C	ENST00000463781.3	-	2	6287	c.5828C>G	c.(5827-5829)tCc>tGc	p.S1943C	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1943C|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGGGCTAGT	0.587																																					p.S1943C		Atlas-SNP	.											.	MUC4	1505	.	0			c.C5828G						PASS	.						47.0	42.0	43.0					3																	195512623		690	1590	2280	SO:0001583	missense	4585	exon2			GCTGAGGAAGGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5828C>G	3.37:g.195512623G>C	ENSP00000417498:p.Ser1943Cys	277.0	0.0	0		242.0	35.0	0.144628	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.707	0.499207	0.12762	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.31;1.33	.	.	.	.	.	.	.	.	T	0.22975	0.0555	N	0.19112	0.55	0.09310	N	1	P	0.50156	0.932	P	0.46299	0.511	T	0.07578	-1.0765	7	.	.	.	.	2.9304	0.05797	0.3911:0.0:0.6089:0.0	.	1943	E7ESK3	.	C	1943	ENSP00000417498:S1943C;ENSP00000420243:S1943C	.	S	-	2	0	MUC4	196997018	0.007000	0.16637	0.012000	0.15200	0.011000	0.07611	0.759000	0.26461	0.488000	0.27723	0.064000	0.15345	TCC	.	.	none		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
JAM3	83700	hgsc.bcm.edu	37	11	134019043	134019043	+	Silent	SNP	C	C	T	rs200279211		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:134019043C>T	ENST00000299106.4	+	9	1059	c.900C>T	c.(898-900)ggC>ggT	p.G300G	JAM3_ENST00000441717.3_Silent_p.G249G|NCAPD3_ENST00000526787.2_5'Flank|JAM3_ENST00000529443.2_Silent_p.G345G			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3	300					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		CTTTGCAGGGCGACTTCAGAC	0.517													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18213	0.0		0.0	False		,,,				2504	0.0				p.G300G		Atlas-SNP	.											.	JAM3	41	.	0			c.C900T						PASS	.						138.0	122.0	127.0					11																	134019043		2201	4297	6498	SO:0001819	synonymous_variant	83700	exon9			GCAGGGCGACTTC	AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.900C>T	11.37:g.134019043C>T		155.0	0.0	0		145.0	66.0	0.455172	NM_032801	B3KWG9|Q8WWL8|Q96FL1	Silent	SNP	ENST00000299106.4	37	CCDS8494.2	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	6.819	0.520209	0.13005	.	.	ENSG00000166086	ENST00000529443	.	.	.	6.04	-9.11	0.00711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1871	0.65612	0.0:0.2635:0.0769:0.6596	.	.	.	.	X	254	.	.	R	+	1	2	JAM3	133524253	0.021000	0.18746	0.743000	0.31040	0.986000	0.74619	-1.218000	0.02976	-1.497000	0.01826	-0.251000	0.11542	CGA	C|1.000;T|0.000	0.000	strong		0.517	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393303.4	NM_032801	
PIM1	5292	hgsc.bcm.edu	37	6	37138591	37138591	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138591C>T	ENST00000373509.5	+	2	498	c.125C>T	c.(124-126)cCg>cTg	p.P42L		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	133					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	CAGGTGGGCCCGCTACTGGGC	0.721			T	BCL6	NHL																																p.P133L		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C398T						PASS	.						21.0	32.0	28.0					6																	37138591		2169	4265	6434	SO:0001583	missense	5292	exon2			TGGGCCCGCTACT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.125C>T	6.37:g.37138591C>T	ENSP00000362608:p.Pro42Leu	59.0	0.0	0		53.0	23.0	0.433962	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544320	0.65198	.	.	ENSG00000137193	ENST00000373509	T	0.13778	2.56	4.96	3.06	0.35304	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.260132	0.31415	N	0.007693	T	0.04407	0.0121	N	0.24115	0.695	0.49051	D	0.99974	P	0.37955	0.612	B	0.37422	0.249	T	0.29701	-1.0003	10	0.72032	D	0.01	.	10.5527	0.45099	0.0:0.7869:0.1356:0.0775	.	133	P11309	PIM1_HUMAN	L	42	ENSP00000362608:P42L	ENSP00000362608:P42L	P	+	2	0	PIM1	37246569	0.992000	0.36948	1.000000	0.80357	0.987000	0.75469	5.339000	0.65953	1.157000	0.42530	0.549000	0.68633	CCG	.	.	none		0.721	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
DNAH7	56171	hgsc.bcm.edu	37	2	196852948	196852948	+	Silent	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:196852948A>G	ENST00000312428.6	-	13	1459	c.1359T>C	c.(1357-1359)agT>agC	p.S453S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	453	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GTTTAGACTTACTTTCCTAAA	0.308																																					p.S453S		Atlas-SNP	.											.	DNAH7	512	.	0			c.T1359C						PASS	.						59.0	56.0	57.0					2																	196852948		1803	4063	5866	SO:0001819	synonymous_variant	56171	exon13			AGACTTACTTTCC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.1359T>C	2.37:g.196852948A>G		273.0	0.0	0		202.0	79.0	0.391089	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.	.	none		0.308	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
CXorf22	170063	hgsc.bcm.edu	37	X	35969413	35969413	+	Silent	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:35969413T>C	ENST00000297866.5	+	5	888	c.822T>C	c.(820-822)aaT>aaC	p.N274N		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	274										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GTGTATACAATAATAGCCCAG	0.403																																					p.N274N		Atlas-SNP	.											.	CXorf22	272	.	0			c.T822C						PASS	.						64.0	57.0	59.0					X																	35969413		2202	4300	6502	SO:0001819	synonymous_variant	170063	exon5			ATACAATAATAGC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.822T>C	X.37:g.35969413T>C		230.0	0.0	0		208.0	189.0	0.908654	NM_152632	Q5JRM8|Q8N6X8	Silent	SNP	ENST00000297866.5	37	CCDS14237.2																																																																																			.	.	none		0.403	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
FAT2	2196	hgsc.bcm.edu	37	5	150922299	150922299	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:150922299A>G	ENST00000261800.5	-	9	8401	c.8389T>C	c.(8389-8391)Ttt>Ctt	p.F2797L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2797	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAGCCTCAAATACAGGCCTA	0.488																																					p.F2797L		Atlas-SNP	.											.	FAT2	465	.	0			c.T8389C						PASS	.						152.0	141.0	145.0					5																	150922299		2203	4300	6503	SO:0001583	missense	2196	exon9			CCTCAAATACAGG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8389T>C	5.37:g.150922299A>G	ENSP00000261800:p.Phe2797Leu	112.0	0.0	0		98.0	52.0	0.530612	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499120	0.64298	.	.	ENSG00000086570	ENST00000261800	T	0.51325	0.71	5.79	5.79	0.91817	Cadherin (2);Cadherin-like (1);	0.000000	0.64402	D	0.000004	T	0.67401	0.2889	M	0.67625	2.065	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.69224	-0.5201	10	0.56958	D	0.05	.	16.1296	0.81418	1.0:0.0:0.0:0.0	.	2797	Q9NYQ8	FAT2_HUMAN	L	2797	ENSP00000261800:F2797L	ENSP00000261800:F2797L	F	-	1	0	FAT2	150902492	1.000000	0.71417	0.939000	0.37840	0.888000	0.51559	9.262000	0.95591	2.216000	0.71823	0.379000	0.24179	TTT	.	.	none		0.488	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
ENPEP	2028	hgsc.bcm.edu	37	4	111398089	111398089	+	Silent	SNP	G	G	A	rs373421438		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:111398089G>A	ENST00000265162.5	+	1	861	c.519G>A	c.(517-519)gcG>gcA	p.A173A		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	173					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TGGTCGAGGCGGAGGAAGAGC	0.597																																					p.A173A		Atlas-SNP	.											.	ENPEP	149	.	0			c.G519A						PASS	.						82.0	91.0	88.0					4																	111398089		2203	4300	6503	SO:0001819	synonymous_variant	2028	exon1			CGAGGCGGAGGAA	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.519G>A	4.37:g.111398089G>A		73.0	0.0	0		58.0	26.0	0.448276	NM_001977	Q504U2	Silent	SNP	ENST00000265162.5	37	CCDS3691.1																																																																																			.	.	alt		0.597	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
COL12A1	1303	hgsc.bcm.edu	37	6	75890902	75890902	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:75890902A>C	ENST00000322507.8	-	11	2226	c.1917T>G	c.(1915-1917)agT>agG	p.S639R	COL12A1_ENST00000483888.2_Missense_Mutation_p.S639R|COL12A1_ENST00000416123.2_Missense_Mutation_p.S639R|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	639	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTTCTGAAAAACTAAGATCCT	0.343																																					p.S639R		Atlas-SNP	.											.	COL12A1	385	.	0			c.T1917G						PASS	.						53.0	54.0	54.0					6																	75890902		1854	4083	5937	SO:0001583	missense	1303	exon11			TGAAAAACTAAGA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1917T>G	6.37:g.75890902A>C	ENSP00000325146:p.Ser639Arg	117.0	0.0	0		100.0	44.0	0.44	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	A	4.453	0.083928	0.08583	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.57907	0.37;0.37;0.37	5.68	-11.4	0.00090	Fibronectin, type III (4);	0.724585	0.13526	N	0.381263	T	0.06826	0.0174	N	0.11789	0.175	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.13953	-1.0490	10	0.16896	T	0.51	.	5.1045	0.14777	0.1741:0.0703:0.443:0.3126	.	639;639	D6RGG3;Q99715	.;COCA1_HUMAN	R	639	ENSP00000325146:S639R;ENSP00000412864:S639R;ENSP00000421216:S639R	ENSP00000325146:S639R	S	-	3	2	COL12A1	75947622	0.000000	0.05858	0.011000	0.14972	0.633000	0.38033	-1.183000	0.03079	-1.983000	0.00987	-0.341000	0.08007	AGT	.	.	none		0.343	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
AMOTL1	154810	hgsc.bcm.edu	37	11	94583365	94583365	+	Missense_Mutation	SNP	G	G	A	rs566138044		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:94583365G>A	ENST00000433060.2	+	7	1876	c.1735G>A	c.(1735-1737)Gag>Aag	p.E579K	AMOTL1_ENST00000317837.9_Intron|AMOTL1_ENST00000317829.8_Missense_Mutation_p.E529K	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	579					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GAGACACATCGAGATCCTGGA	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		19935	0.001		0.0	False		,,,				2504	0.0				p.E579K		Atlas-SNP	.											.	AMOTL1	95	.	0			c.G1735A						PASS	.						46.0	55.0	52.0					11																	94583365		2025	4179	6204	SO:0001583	missense	154810	exon7			CACATCGAGATCC	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1735G>A	11.37:g.94583365G>A	ENSP00000387739:p.Glu579Lys	70.0	0.0	0		58.0	37.0	0.637931	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664939	0.88251	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000433060	T;T	0.25749	1.78;1.78	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.41050	0.1142	M	0.70275	2.135	0.80722	D	1	P;B	0.36183	0.542;0.111	B;B	0.43251	0.413;0.051	T	0.13656	-1.0501	10	0.46703	T	0.11	-34.7551	20.088	0.97803	0.0:0.0:1.0:0.0	.	529;579	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	K	529;585;579	ENSP00000320968:E529K;ENSP00000387739:E579K	ENSP00000320968:E529K	E	+	1	0	AMOTL1	94223013	1.000000	0.71417	0.989000	0.46669	0.980000	0.70556	9.578000	0.98200	2.739000	0.93911	0.655000	0.94253	GAG	.	.	none		0.522	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
SYNE2	23224	hgsc.bcm.edu	37	14	64593362	64593362	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr14:64593362A>G	ENST00000344113.4	+	73	13966	c.13754A>G	c.(13753-13755)aAg>aGg	p.K4585R	SYNE2_ENST00000394768.2_Missense_Mutation_p.K970R|SYNE2_ENST00000554584.1_Missense_Mutation_p.K4536R|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.K1219R|SYNE2_ENST00000358025.3_Missense_Mutation_p.K4585R|SYNE2_ENST00000357395.3_Missense_Mutation_p.K970R	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4585					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTAAGTGACAAGAAGGGTGAT	0.478																																					p.K4585R		Atlas-SNP	.											.	SYNE2	577	.	0			c.A13754G						PASS	.						144.0	142.0	143.0					14																	64593362		2203	4300	6503	SO:0001583	missense	23224	exon73			GTGACAAGAAGGG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13754A>G	14.37:g.64593362A>G	ENSP00000341781:p.Lys4585Arg	74.0	0.0	0		98.0	54.0	0.55102	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	9.978	1.227366	0.22542	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.65916	0.7;4.01;0.7;-0.18;4.06;4.01	5.87	4.62	0.57501	.	0.111585	0.38720	N	0.001585	T	0.64461	0.2600	L	0.32530	0.975	0.80722	D	1	D;D;P	0.60575	0.988;0.962;0.617	P;P;B	0.61201	0.885;0.767;0.221	T	0.62058	-0.6934	10	0.39692	T	0.17	.	10.0189	0.42031	0.903:0.0:0.097:0.0	.	970;4585;4585	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	R	4585;970;4585;4536;4536;1219;970	ENSP00000350719:K4585R;ENSP00000349969:K970R;ENSP00000341781:K4585R;ENSP00000452570:K4536R;ENSP00000450831:K1219R;ENSP00000378249:K970R	ENSP00000261678:K4536R	K	+	2	0	SYNE2	63663115	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	2.708000	0.47152	0.909000	0.36697	0.533000	0.62120	AAG	.	.	none		0.478	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
FGF21	26291	hgsc.bcm.edu	37	19	49261218	49261218	+	Missense_Mutation	SNP	G	G	A	rs142980324		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:49261218G>A	ENST00000593756.1	+	4	943	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	FUT1_ENST00000310160.3_5'Flank|FGF21_ENST00000222157.3_Missense_Mutation_p.R124Q			Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21	124					cell-cell signaling (GO:0007267)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|regulation of low-density lipoprotein particle clearance (GO:0010988)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		TGCAGCTTCCGGGAGCTGCTT	0.582																																					p.R124Q		Atlas-SNP	.											.	FGF21	21	.	0			c.G371A						PASS	.	G	GLN/ARG	0,4402		0,0,2201	158.0	173.0	168.0		371	3.4	1.0	19	dbSNP_134	168	4,8592	3.7+/-12.6	0,4,4294	yes	missense	FGF21	NM_019113.2	43	0,4,6495	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging	124/210	49261218	4,12994	2201	4298	6499	SO:0001583	missense	26291	exon3			GCTTCCGGGAGCT	AB021975	CCDS12734.1	19q13.33	2012-09-20			ENSG00000105550	ENSG00000105550			3678	protein-coding gene	gene with protein product		609436				10858549	Standard	XM_005258731		Approved		uc002pko.1	Q9NSA1		ENST00000593756.1:c.371G>A	19.37:g.49261218G>A	ENSP00000471477:p.Arg124Gln	96.0	0.0	0		151.0	94.0	0.622517	NM_019113	Q8N683	Missense_Mutation	SNP	ENST00000593756.1	37	CCDS12734.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814192	0.70912	0.0	4.65E-4	ENSG00000105550	ENST00000222157	D	0.81579	-1.51	4.44	3.4	0.38934	.	0.076506	0.49916	D	0.000128	T	0.80969	0.4726	M	0.74258	2.255	0.37112	D	0.900381	D	0.53745	0.962	P	0.48270	0.572	T	0.82814	-0.0271	10	0.46703	T	0.11	-15.5157	8.3528	0.32312	0.1087:0.0:0.8913:0.0	.	124	Q9NSA1	FGF21_HUMAN	Q	124	ENSP00000222157:R124Q	ENSP00000222157:R124Q	R	+	2	0	FGF21	53953030	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.173000	0.31920	1.220000	0.43490	0.511000	0.50034	CGG	G|1.000;A|0.000	0.000	weak		0.582	FGF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466200.1		
TEKT1	83659	hgsc.bcm.edu	37	17	6719262	6719262	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:6719262C>A	ENST00000338694.2	-	4	505	c.376G>T	c.(376-378)Gac>Tac	p.D126Y	TEKT1_ENST00000535086.1_5'UTR	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	126						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TGCACCAGGTCAATGCCAATG	0.557																																					p.D126Y		Atlas-SNP	.											.	TEKT1	49	.	0			c.G376T						PASS	.						148.0	93.0	112.0					17																	6719262		2203	4300	6503	SO:0001583	missense	83659	exon4			CCAGGTCAATGCC		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.376G>T	17.37:g.6719262C>A	ENSP00000341346:p.Asp126Tyr	69.0	0.0	0		32.0	16.0	0.5	NM_053285	D3DTM7	Missense_Mutation	SNP	ENST00000338694.2	37	CCDS11083.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924476	0.52653	.	.	ENSG00000167858	ENST00000338694	T	0.05513	3.43	5.04	5.04	0.67666	.	0.048168	0.85682	D	0.000000	T	0.35393	0.0930	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.47661	-0.9100	10	0.87932	D	0	.	16.2605	0.82541	0.0:1.0:0.0:0.0	.	126	Q969V4	TEKT1_HUMAN	Y	126	ENSP00000341346:D126Y	ENSP00000341346:D126Y	D	-	1	0	TEKT1	6659986	1.000000	0.71417	0.971000	0.41717	0.127000	0.20565	6.303000	0.72794	2.535000	0.85469	0.655000	0.94253	GAC	.	.	none		0.557	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
ESR2	2100	hgsc.bcm.edu	37	14	64749642	64749642	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr14:64749642G>A	ENST00000341099.4	-	2	479	c.62C>T	c.(61-63)tCc>tTc	p.S21F	ESR2_ENST00000555483.1_5'Flank|ESR2_ENST00000353772.3_Missense_Mutation_p.S21F|ESR2_ENST00000554572.1_Missense_Mutation_p.S21F|ESR2_ENST00000555278.1_Missense_Mutation_p.S21F|ESR2_ENST00000542956.1_Missense_Mutation_p.S21F|ESR2_ENST00000557772.1_Missense_Mutation_p.S21F|ESR2_ENST00000267525.6_Missense_Mutation_p.S21F|ESR2_ENST00000358599.5_Missense_Mutation_p.S21F|ESR2_ENST00000357782.2_Missense_Mutation_p.S21F|ESR2_ENST00000553796.1_Missense_Mutation_p.S21F	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	21	Modulating.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GGGTAAGATGGATTGACTGCA	0.443																																					p.S21F		Atlas-SNP	.											.	ESR2	82	.	0			c.C62T						PASS	.						138.0	133.0	135.0					14																	64749642		2203	4300	6503	SO:0001583	missense	2100	exon1			AAGATGGATTGAC	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.62C>T	14.37:g.64749642G>A	ENSP00000343925:p.Ser21Phe	145.0	0.0	0		145.0	74.0	0.510345	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065179	0.36470	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.91894	-2.9;-2.89;-2.85;-2.85;-2.85;-2.93;-2.91;-2.93;-2.91;-2.76;-2.46	5.56	5.56	0.83823	Estrogen receptor beta, N-terminal (1);	0.421595	0.25701	N	0.028864	D	0.95316	0.8480	M	0.64997	1.995	0.09310	N	1	D;D;D;D;D	0.89917	0.998;1.0;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.994;0.999;0.996;0.996;0.998	D	0.90007	0.4118	10	0.48119	T	0.1	.	17.708	0.88314	0.0:0.0:1.0:0.0	.	21;21;21;21;21	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	F	21	ENSP00000452485:S21F;ENSP00000441792:S21F;ENSP00000450699:S21F;ENSP00000335551:S21F;ENSP00000351412:S21F;ENSP00000450488:S21F;ENSP00000452426:S21F;ENSP00000350427:S21F;ENSP00000451582:S21F;ENSP00000343925:S21F;ENSP00000267525:S21F	ENSP00000267525:S21F	S	-	2	0	ESR2	63819395	0.923000	0.31300	0.019000	0.16419	0.047000	0.14425	5.705000	0.68355	2.616000	0.88540	0.563000	0.77884	TCC	.	.	none		0.443	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
TAOK2	9344	hgsc.bcm.edu	37	16	29996996	29996996	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr16:29996996C>T	ENST00000308893.4	+	15	2849	c.1806C>T	c.(1804-1806)ccC>ccT	p.P602P	TAOK2_ENST00000279394.3_Silent_p.P602P|TAOK2_ENST00000416441.2_Silent_p.P429P|TAOK2_ENST00000543033.1_Silent_p.P602P	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	602					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						AGGAGAACCCCAGCACTCCCA	0.697																																					p.P602P		Atlas-SNP	.											TAOK2_ENST00000308893,NS,carcinoma,+2,2	TAOK2	142	2	0			c.C1806T						PASS	.						15.0	15.0	15.0					16																	29996996		2193	4294	6487	SO:0001819	synonymous_variant	9344	exon15			GAACCCCAGCACT	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.1806C>T	16.37:g.29996996C>T		43.0	0.0	0		27.0	14.0	0.518519	NM_004783	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	ENST00000308893.4	37	CCDS10663.1																																																																																			.	.	none		0.697	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255152.2	NM_016151	
RND2	8153	hgsc.bcm.edu	37	17	41174312	41174312	+	5'Flank	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:41174312C>T	ENST00000587250.2	+	0	0				RND2_ENST00000544533.1_5'Flank|VAT1_ENST00000587173.1_Missense_Mutation_p.A10T|VAT1_ENST00000420567.3_5'Flank|VAT1_ENST00000355653.3_Missense_Mutation_p.A10T			P52198	RND2_HUMAN	Rho family GTPase 2						GTP catabolic process (GO:0006184)|positive regulation of collateral sprouting (GO:0048672)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCGGTCGCTGCCTCGGCTACC	0.711																																					p.A10T		Atlas-SNP	.											.	VAT1	19	.	0			c.G28A						PASS	.						5.0	5.0	5.0					17																	41174312		1687	3256	4943	SO:0001631	upstream_gene_variant	10493	exon1			TCGCTGCCTCGGC	X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830			18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN			Standard	XM_005257706		Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817		17.37:g.41174312C>T	Exception_encountered	27.0	0.0	0		23.0	15.0	0.652174	NM_006373	A8K2D4|O00690|O00734|Q5U0P6|Q99535	Missense_Mutation	SNP	ENST00000587250.2	37	CCDS11452.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372722	0.24857	.	.	ENSG00000108828	ENST00000355653;ENST00000315674	T	0.56103	0.48	3.74	3.74	0.42951	.	1.527300	0.03644	N	0.240005	T	0.35038	0.0918	N	0.08118	0	0.80722	D	1	B;B	0.33694	0.421;0.421	B;B	0.22386	0.039;0.039	T	0.04495	-1.0947	10	0.27082	T	0.32	.	14.4573	0.67425	0.0:1.0:0.0:0.0	.	10;10	B4DPX4;Q99536	.;VAT1_HUMAN	T	10	ENSP00000347872:A10T	ENSP00000326121:A10T	A	-	1	0	VAT1	38427838	0.993000	0.37304	0.963000	0.40424	0.142000	0.21351	1.476000	0.35420	1.913000	0.55393	0.555000	0.69702	GCA	.	.	none		0.711	RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453111.2	NM_005440	
ARHGEF40	55701	hgsc.bcm.edu	37	14	21550212	21550212	+	Missense_Mutation	SNP	G	G	T	rs114591848	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr14:21550212G>T	ENST00000298694.4	+	14	3312	c.3185G>T	c.(3184-3186)cGg>cTg	p.R1062L	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.R1062L			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1062						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CTGCTGGGCCGGGCTAGGGGG	0.667																																					p.R1062L		Atlas-SNP	.											.	ARHGEF40	84	.	0			c.G3185T						PASS	.						11.0	11.0	11.0					14																	21550212		2177	4255	6432	SO:0001583	missense	55701	exon14			TGGGCCGGGCTAG		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3185G>T	14.37:g.21550212G>T	ENSP00000298694:p.Arg1062Leu	41.0	0.0	0		20.0	16.0	0.8	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537891	0.85917	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02682	4.25;4.2	5.54	5.54	0.83059	.	0.000000	0.49305	D	0.000156	T	0.03959	0.0111	N	0.24115	0.695	0.39374	D	0.966145	B;B;D	0.56035	0.371;0.229;0.974	P;B;P	0.46629	0.461;0.174;0.522	T	0.51260	-0.8728	10	0.62326	D	0.03	.	14.8575	0.70351	0.0:0.0:1.0:0.0	.	1062;1062;348	Q8TER5-4;Q8TER5;Q8TER5-2	.;ARH40_HUMAN;.	L	1062	ENSP00000298694:R1062L;ENSP00000298693:R1062L	ENSP00000298693:R1062L	R	+	2	0	ARHGEF40	20620052	0.898000	0.30612	0.982000	0.44146	0.865000	0.49528	5.132000	0.64758	2.884000	0.98904	0.655000	0.94253	CGG	G|0.997;A|0.003	.	alt		0.667	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
OSBPL10	114884	hgsc.bcm.edu	37	3	32022573	32022573	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022573G>A	ENST00000396556.2	-	1	221	c.99C>T	c.(97-99)tgC>tgT	p.C33C	OSBPL10_ENST00000438237.2_Silent_p.C33C|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	33					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CCGCCAGAGAGCAGGAGGGCG	0.771																																					p.C33C		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C99T						PASS	.						1.0	2.0	2.0					3																	32022573		809	1712	2521	SO:0001819	synonymous_variant	114884	exon1			CAGAGAGCAGGAG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.99C>T	3.37:g.32022573G>A		71.0	0.0	0		71.0	33.0	0.464789	NM_017784	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1																																																																																			.	.	none		0.771	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
LILRA2	11027	hgsc.bcm.edu	37	19	55086869	55086869	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:55086869G>T	ENST00000251377.3	+	6	935	c.802G>T	c.(802-804)Ggt>Tgt	p.G268C	LILRA2_ENST00000391737.1_Missense_Mutation_p.G256C|LILRA2_ENST00000251376.3_Missense_Mutation_p.G268C|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.G268C|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	268	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCAGCGCCCTGGTTGGCAGCC	0.627																																					p.G268C		Atlas-SNP	.											.	LILRA2	99	.	0			c.G802T						PASS	.						79.0	77.0	78.0					19																	55086869		2203	4300	6503	SO:0001583	missense	11027	exon5			CGCCCTGGTTGGC	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.802G>T	19.37:g.55086869G>T	ENSP00000251377:p.Gly268Cys	123.0	0.0	0		135.0	47.0	0.348148	NM_001130917	O75020	Missense_Mutation	SNP	ENST00000251377.3	37	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722701	0.30503	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.00745	5.75;5.75;5.75;5.75;5.75	2.26	-0.112	0.13572	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.720370	0.01616	N	0.022766	T	0.06554	0.0168	H	0.95224	3.64	0.09310	N	1	B;D;D;D	0.89917	0.239;1.0;1.0;1.0	B;D;D;D	0.79108	0.2;0.992;0.992;0.987	T	0.27773	-1.0064	10	0.72032	D	0.01	.	2.6785	0.05087	0.1735:0.0:0.5315:0.295	.	268;256;268;268	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	C	268;268;268;268;256	ENSP00000388131:G268C;ENSP00000251377:G268C;ENSP00000375618:G268C;ENSP00000251376:G268C;ENSP00000375617:G256C	ENSP00000251376:G268C	G	+	1	0	LILRA2	59778681	.	.	0.000000	0.03702	0.012000	0.07955	.	.	0.034000	0.15491	0.400000	0.26472	GGT	.	.	none		0.627	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
C17orf104	284071	hgsc.bcm.edu	37	17	42751550	42751550	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:42751550A>G	ENST00000409122.2	+	8	2987	c.2845A>G	c.(2845-2847)Aca>Gca	p.T949A	RP11-1072C15.4_ENST00000591628.1_RNA	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	949										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						GAGAGGTGAAACAAACAAACA	0.328																																					p.T949A		Atlas-SNP	.											.	C17orf104	75	.	0			c.A2845G						PASS	.						87.0	67.0	73.0					17																	42751550		692	1591	2283	SO:0001583	missense	284071	exon8			GGTGAAACAAACA		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2845A>G	17.37:g.42751550A>G	ENSP00000386452:p.Thr949Ala	75.0	0.0	0		72.0	31.0	0.430556	NM_001145080	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	ENST00000409122.2	37	CCDS45703.2	.	.	.	.	.	.	.	.	.	.	A	0.210	-1.037054	0.02013	.	.	ENSG00000180336	ENST00000409122	T	0.29655	1.56	5.96	2.35	0.29111	.	.	.	.	.	T	0.16300	0.0392	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07966	-1.0745	9	0.25106	T	0.35	-11.6212	4.1762	0.10353	0.3833:0.0:0.4451:0.1716	.	949	A2RUB1	CQ104_HUMAN	A	949	ENSP00000386452:T949A	ENSP00000386452:T949A	T	+	1	0	C17orf104	40107076	0.371000	0.25056	1.000000	0.80357	0.990000	0.78478	0.306000	0.19279	0.714000	0.32081	-0.250000	0.11733	ACA	.	.	none		0.328	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
SEMA5A	9037	hgsc.bcm.edu	37	5	9119196	9119196	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:9119196G>A	ENST00000382496.5	-	15	2504	c.1839C>T	c.(1837-1839)atC>atT	p.I613I		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	613	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CCTGGAAGCCGATCCCACAGG	0.657																																					p.I613I		Atlas-SNP	.											.	SEMA5A	236	.	0			c.C1839T						PASS	.						52.0	47.0	48.0					5																	9119196		2203	4300	6503	SO:0001819	synonymous_variant	9037	exon15			GAAGCCGATCCCA	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1839C>T	5.37:g.9119196G>A		100.0	0.0	0		90.0	34.0	0.377778	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1																																																																																			.	.	none		0.657	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
ZNF700	90592	hgsc.bcm.edu	37	19	12059331	12059331	+	Nonsense_Mutation	SNP	T	T	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:12059331T>G	ENST00000254321.5	+	4	635	c.492T>G	c.(490-492)taT>taG	p.Y164*	ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Nonsense_Mutation_p.Y146*|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CAAAGCCATATAAGTGTCAAC	0.413																																					p.Y167X		Atlas-SNP	.											.	ZNF700	81	.	0			c.T501G						PASS	.						140.0	136.0	137.0					19																	12059331		2203	4300	6503	SO:0001587	stop_gained	90592	exon4			GCCATATAAGTGT	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.492T>G	19.37:g.12059331T>G	ENSP00000254321:p.Tyr164*	137.0	0.0	0		128.0	65.0	0.507812	NM_001271848	B9EGU4	Nonsense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	t	25.0	4.596718	0.86953	.	.	ENSG00000196757	ENST00000254321	.	.	.	0.554	0.554	0.17241	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.34	0.15979	0.0:1.0E-4:0.0:0.9999	.	.	.	.	X	164	.	ENSP00000254321:Y164X	Y	+	3	2	ZNF700	11920331	0.063000	0.20901	0.469000	0.27204	0.758000	0.43043	-0.370000	0.07523	0.450000	0.26774	0.254000	0.18369	TAT	.	.	none		0.413	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
BCR	613	hgsc.bcm.edu	37	22	23523331	23523331	+	Silent	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23523331T>C	ENST00000305877.8	+	1	935	c.184T>C	c.(184-186)Ttg>Ctg	p.L62L	BCR_ENST00000398512.5_Silent_p.L62L|BCR_ENST00000359540.3_Silent_p.L62L	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	62	Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CCTGCAGACGTTGCTGGCCAA	0.687			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.L62L		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.T184C						PASS	.						22.0	22.0	22.0					22																	23523331		2186	4274	6460	SO:0001819	synonymous_variant	613	exon1			CAGACGTTGCTGG		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.184T>C	22.37:g.23523331T>C		73.0	0.0	0		78.0	41.0	0.525641	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																			.	.	none		0.687	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
ASB11	140456	hgsc.bcm.edu	37	X	15301725	15301725	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:15301725G>A	ENST00000480796.1	-	7	924	c.874C>T	c.(874-876)Cgc>Tgc	p.R292C	ASB11_ENST00000537676.1_Missense_Mutation_p.R271C|ASB11_ENST00000344384.4_Missense_Mutation_p.R271C|ASB11_ENST00000380470.3_Missense_Mutation_p.R275C			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	292	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					ACACACAGGCGGCAGAGCTGG	0.522																																					p.R292C		Atlas-SNP	.											.	ASB11	79	.	0			c.C874T						PASS	.						118.0	99.0	106.0					X																	15301725		2203	4300	6503	SO:0001583	missense	140456	exon7			ACAGGCGGCAGAG	AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.874C>T	X.37:g.15301725G>A	ENSP00000417914:p.Arg292Cys	56.0	0.0	0		67.0	65.0	0.970149	NM_080873	E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	ENST00000480796.1	37	CCDS14164.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321100	0.81580	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	5.72	5.72	0.89469	SOCS protein, C-terminal (3);	0.000000	0.64402	D	0.000010	D	0.94321	0.8175	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95462	0.8544	10	0.72032	D	0.01	-19.864	14.3095	0.66407	0.0:0.0:0.8516:0.1484	.	275;292;271	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	C	271;275;271;292	ENSP00000445465:R271C;ENSP00000369837:R275C;ENSP00000343408:R271C;ENSP00000417914:R292C	ENSP00000343408:R271C	R	-	1	0	ASB11	15211646	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.183000	0.72002	2.398000	0.81561	0.544000	0.68410	CGC	.	.	none		0.522	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2		
PLCG2	5336	hgsc.bcm.edu	37	16	81819709	81819709	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr16:81819709G>A	ENST00000359376.3	+	2	329	c.115G>A	c.(115-117)Gag>Aag	p.E39K		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	39	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GTCCACCCCCGAGCGGAGAAC	0.592																																					p.E39K		Atlas-SNP	.											.	PLCG2	276	.	0			c.G115A						PASS	.						56.0	63.0	61.0					16																	81819709		2048	4182	6230	SO:0001583	missense	5336	exon2			ACCCCCGAGCGGA		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.115G>A	16.37:g.81819709G>A	ENSP00000352336:p.Glu39Lys	61.0	0.0	0		59.0	29.0	0.491525	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	G	35	5.583922	0.96578	.	.	ENSG00000197943	ENST00000359376	T	0.58797	0.31	5.14	5.14	0.70334	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.054632	0.64402	D	0.000001	T	0.68091	0.2963	M	0.79693	2.465	0.80722	D	1	D	0.62365	0.991	P	0.47402	0.546	T	0.75494	-0.3298	10	0.66056	D	0.02	.	18.5992	0.91242	0.0:0.0:1.0:0.0	.	39	P16885	PLCG2_HUMAN	K	39	ENSP00000352336:E39K	ENSP00000352336:E39K	E	+	1	0	PLCG2	80377210	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	9.443000	0.97568	2.388000	0.81334	0.655000	0.94253	GAG	.	.	none		0.592	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
BTG2	7832	hgsc.bcm.edu	37	1	203274876	203274876	+	Splice_Site	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:203274876G>T	ENST00000290551.4	+	1	213	c.142G>T	c.(142-144)Gag>Tag	p.E48*	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	48					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GGCACTCACAGGTGAGCGCAT	0.706																																					p.E48X		Atlas-SNP	.											.	BTG2	16	.	0			c.G142T						PASS	.						10.0	12.0	12.0					1																	203274876		1996	3876	5872	SO:0001630	splice_region_variant	7832	exon1			CTCACAGGTGAGC		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.142+1G>T	1.37:g.203274876G>T		70.0	0.0	0		65.0	30.0	0.461538	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Nonsense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	g	37	6.127598	0.97305	.	.	ENSG00000159388	ENST00000290551	.	.	.	4.23	4.23	0.50019	.	0.072934	0.52532	D	0.000079	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-12.437	15.3407	0.74293	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000290551:E48X	E	+	1	0	BTG2	201541499	1.000000	0.71417	0.996000	0.52242	0.542000	0.35054	8.401000	0.90202	2.199000	0.70637	0.471000	0.43371	GAG	.	.	none		0.706	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	Nonsense_Mutation
NELL1	4745	hgsc.bcm.edu	37	11	20948897	20948897	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:20948897A>G	ENST00000357134.5	+	8	955	c.803A>G	c.(802-804)cAt>cGt	p.H268R	NELL1_ENST00000298925.5_Missense_Mutation_p.H296R|NELL1_ENST00000532434.1_Missense_Mutation_p.H268R|NELL1_ENST00000325319.5_Missense_Mutation_p.H211R	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	268					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GAAAACTGTCATTGTGAGAAG	0.398																																					p.H268R		Atlas-SNP	.											.	NELL1	179	.	0			c.A803G						PASS	.						137.0	129.0	132.0					11																	20948897		2203	4300	6503	SO:0001583	missense	4745	exon8			ACTGTCATTGTGA	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.803A>G	11.37:g.20948897A>G	ENSP00000349654:p.His268Arg	83.0	0.0	0		65.0	30.0	0.461538	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.081924	0.76528	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70055	0.3180	L	0.36672	1.1	0.58432	D	0.999997	D;D;D;D	0.71674	0.996;0.993;0.998;0.985	D;D;D;P	0.77557	0.99;0.977;0.923;0.637	T	0.66052	-0.6019	10	0.23302	T	0.38	-19.4505	15.9803	0.80105	1.0:0.0:0.0:0.0	.	211;296;268;268	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	R	296;268;211;268	ENSP00000298925:H296R;ENSP00000349654:H268R;ENSP00000317837:H211R;ENSP00000437170:H268R	ENSP00000298925:H296R	H	+	2	0	NELL1	20905473	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	8.701000	0.91331	2.170000	0.68504	0.455000	0.32223	CAT	.	.	none		0.398	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
ZNF43	7594	hgsc.bcm.edu	37	19	21991819	21991819	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:21991819T>G	ENST00000354959.4	-	4	1189	c.1020A>C	c.(1018-1020)aaA>aaC	p.K340N	ZNF43_ENST00000598381.1_Missense_Mutation_p.K334N|ZNF43_ENST00000595461.1_Missense_Mutation_p.K334N|ZNF43_ENST00000594012.1_Missense_Mutation_p.K334N	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ATGTGTAGGGTTTCTCTCCAG	0.383																																					p.K349N		Atlas-SNP	.											.	ZNF43	152	.	0			c.A1047C						PASS	.						51.0	54.0	53.0					19																	21991819		2203	4297	6500	SO:0001583	missense	7594	exon4			GTAGGGTTTCTCT	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1020A>C	19.37:g.21991819T>G	ENSP00000347045:p.Lys340Asn	114.0	0.0	0		74.0	28.0	0.378378	NM_001256653	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	T	12.87	2.068339	0.36470	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.26067	1.76	1.76	-1.03	0.10102	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38480	0.1042	M	0.84511	2.7	0.28494	N	0.914327	P	0.45715	0.865	P	0.49665	0.618	T	0.35450	-0.9788	9	0.87932	D	0	.	6.1831	0.20482	0.0:0.4532:0.0:0.5468	.	340	P17038	ZNF43_HUMAN	N	339;340	ENSP00000347045:K340N	ENSP00000347045:K340N	K	-	3	2	ZNF43	21783659	0.187000	0.23238	0.000000	0.03702	0.039000	0.13416	-0.311000	0.08124	-0.521000	0.06426	0.254000	0.18369	AAA	.	.	none		0.383	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
FANCD2	2177	hgsc.bcm.edu	37	3	10080992	10080992	+	Missense_Mutation	SNP	G	G	A	rs41291203		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:10080992G>A	ENST00000419585.1	+	8	682	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	FANCD2_ENST00000431693.1_Missense_Mutation_p.R174Q|FANCD2_ENST00000287647.3_Missense_Mutation_p.R174Q|FANCD2_ENST00000383807.1_Missense_Mutation_p.R174Q|RNU6-670P_ENST00000364312.1_RNA|FANCD2_ENST00000383806.1_Missense_Mutation_p.R174Q|FANCD2_ENST00000438741.1_3'UTR			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	174	Interaction with FANCE.				DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AACATACCTCGACTCATTGTC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				g|||	1	0.000199681	0.0	0.0	5008	,	,		18397	0.0		0.001	False		,,,				2504	0.0				p.R174Q		Atlas-SNP	.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	253	.	0			c.G521A						PASS	.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	85.0	78.0	80.0		521,521	4.8	1.0	3	dbSNP_127	80	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FANCD2	NM_001018115.1,NM_033084.3	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	174/1452,174/1472	10080992	1,13005	2203	4300	6503	SO:0001583	missense	2177	exon8	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TACCTCGACTCAT	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.521G>A	3.37:g.10080992G>A	ENSP00000398754:p.Arg174Gln	193.0	0.0	0		129.0	58.0	0.449612	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	22.7	4.326378	0.81690	0.0	1.16E-4	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585;ENST00000431693	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.68	4.81	0.61882	.	0.109676	0.64402	D	0.000010	T	0.62768	0.2455	M	0.81682	2.555	0.42202	D	0.991775	D;D;P	0.53462	0.96;0.96;0.848	B;P;B	0.47376	0.421;0.545;0.241	T	0.63056	-0.6722	10	0.27082	T	0.32	.	11.7293	0.51726	0.0845:0.0:0.9155:0.0	rs41291203	174;174;174	Q9BXW9-2;Q9BXW9;Q9BXW9-4	.;FACD2_HUMAN;.	Q	174	ENSP00000287647:R174Q;ENSP00000373318:R174Q;ENSP00000373317:R174Q;ENSP00000398754:R174Q;ENSP00000399354:R174Q	ENSP00000287647:R174Q	R	+	2	0	FANCD2	10055992	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.865000	0.56033	2.689000	0.91719	0.579000	0.79373	CGA	G|1.000;A|0.000	0.000	strong		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
KANK4	163782	hgsc.bcm.edu	37	1	62739545	62739545	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:62739545C>G	ENST00000371153.4	-	3	1609	c.1231G>C	c.(1231-1233)Gac>Cac	p.D411H	KANK4_ENST00000371150.1_5'Flank|KANK4_ENST00000354381.3_Intron	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	411						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						ACCATCACGTCCGTCTGGCCC	0.517																																					p.D411H		Atlas-SNP	.											KANK4,right_upper_lobe,carcinoma,+2,1	KANK4	135	1	0			c.G1231C						PASS	.						197.0	166.0	176.0					1																	62739545		2203	4300	6503	SO:0001583	missense	163782	exon3			TCACGTCCGTCTG	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1231G>C	1.37:g.62739545C>G	ENSP00000360195:p.Asp411His	170.0	0.0	0		131.0	56.0	0.427481	NM_181712	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	CCDS620.1	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567050	0.65651	.	.	ENSG00000132854	ENST00000371153	T	0.62498	0.02	5.67	5.67	0.87782	.	0.000000	0.41097	D	0.000950	T	0.77598	0.4154	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.78848	-0.2042	10	0.72032	D	0.01	-16.8446	19.3774	0.94517	0.0:1.0:0.0:0.0	.	411	Q5T7N3	KANK4_HUMAN	H	411	ENSP00000360195:D411H	ENSP00000360195:D411H	D	-	1	0	KANK4	62512133	0.973000	0.33851	0.178000	0.23040	0.004000	0.04260	2.844000	0.48246	2.677000	0.91161	0.561000	0.74099	GAC	.	.	none		0.517	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712	
HNRNPA1	3178	hgsc.bcm.edu	37	12	54676988	54676988	+	Nonsense_Mutation	SNP	G	G	T	rs367836050|rs539863165	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:54676988G>T	ENST00000340913.6	+	8	930	c.877G>T	c.(877-879)Gga>Tga	p.G293*	RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000330752.8_Intron|HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000547276.1_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	293	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						CTATAACAACGGAGGCGGAGG	0.537																																					p.G293X	Colon(83;502 1289 8436 16406 24870)	Atlas-SNP	.											.	HNRNPA1	72	.	0			c.G877T						PASS	.						46.0	66.0	59.0					12																	54676988		2040	4175	6215	SO:0001587	stop_gained	3178	exon8			AACAACGGAGGCG	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.877G>T	12.37:g.54676988G>T	ENSP00000341826:p.Gly293*	72.0	0.0	0		101.0	36.0	0.356436	NM_031157	A8K4Z8|Q3MIB7|Q6PJZ7	Nonsense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153932	0.78114	.	.	ENSG00000135486	ENST00000340913	.	.	.	2.8	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	9.9561	0.41668	0.0:0.2089:0.7911:0.0	.	.	.	.	X	293	.	ENSP00000341826:G293X	G	+	1	0	HNRNPA1	52963255	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.265000	0.58865	0.753000	0.32945	0.455000	0.32223	GGA	.	.	alt		0.537	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
F11	2160	hgsc.bcm.edu	37	4	187194287	187194287	+	Missense_Mutation	SNP	C	C	T	rs367856671		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:187194287C>T	ENST00000403665.2	+	4	633	c.281C>T	c.(280-282)gCg>gTg	p.A94V	F11_ENST00000264692.4_Missense_Mutation_p.A94V|F11_ENST00000492972.2_Missense_Mutation_p.A94V	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	94	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	AGGACAGCAGCGATTTCTGGG	0.368																																					p.A94V		Atlas-SNP	.											.	F11	65	.	0			c.C281T						PASS	.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	96.0	90.0	92.0		281	5.4	1.0	4		92	0,8600		0,0,4300	no	missense	F11	NM_000128.3	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	94/626	187194287	1,13005	2203	4300	6503	SO:0001583	missense	2160	exon4			CAGCAGCGATTTC	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.281C>T	4.37:g.187194287C>T	ENSP00000384957:p.Ala94Val	334.0	1.0	0.00299401		221.0	84.0	0.380091	NM_000128	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	CCDS3847.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765645	0.90020	2.27E-4	0.0	ENSG00000088926	ENST00000403665;ENST00000264692;ENST00000492972	D;D;D	0.89196	-2.48;-2.48;-2.48	5.45	5.45	0.79879	Apple domain (2);PAN-1 domain (1);Apple-like (1);	0.000000	0.85682	D	0.000000	D	0.94215	0.8143	M	0.76574	2.34	0.50467	D	0.999877	D	0.89917	1.0	D	0.97110	1.0	D	0.94070	0.7334	10	0.52906	T	0.07	.	17.8567	0.88765	0.0:1.0:0.0:0.0	.	94	P03951	FA11_HUMAN	V	94	ENSP00000384957:A94V;ENSP00000264692:A94V;ENSP00000424479:A94V	ENSP00000264692:A94V	A	+	2	0	F11	187431281	0.983000	0.35010	0.962000	0.40283	0.969000	0.65631	2.603000	0.46266	2.565000	0.86533	0.557000	0.71058	GCG	.	.	weak		0.368	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4		
COL11A1	1301	hgsc.bcm.edu	37	1	103463891	103463891	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:103463891C>A	ENST00000370096.3	-	25	2483	c.2171G>T	c.(2170-2172)gGa>gTa	p.G724V	COL11A1_ENST00000358392.2_Missense_Mutation_p.G736V|COL11A1_ENST00000353414.4_Missense_Mutation_p.G685V|COL11A1_ENST00000512756.1_Missense_Mutation_p.G608V|COL11A1_ENST00000461720.1_5'Flank	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	724	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G736V(1)|p.G724V(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCAGGAAGTCCAGCAAGTCC	0.303																																					p.G736V		Atlas-SNP	.											.	COL11A1	972	.	2	Substitution - Missense(2)	lung(2)	c.G2207T						PASS	.						38.0	40.0	39.0					1																	103463891		2202	4299	6501	SO:0001583	missense	1301	exon25			GGAAGTCCAGCAA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2171G>T	1.37:g.103463891C>A	ENSP00000359114:p.Gly724Val	567.0	1.0	0.00176367		401.0	166.0	0.413965	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521145	0.85600	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.99524	0.9830	H	0.97131	3.945	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.998	D	0.98152	1.0442	10	0.87932	D	0	.	18.9689	0.92707	0.0:1.0:0.0:0.0	.	608;685;736;724	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	V	724;736;685;608	ENSP00000359114:G724V;ENSP00000351163:G736V;ENSP00000302551:G685V;ENSP00000426533:G608V	ENSP00000302551:G685V	G	-	2	0	COL11A1	103236479	1.000000	0.71417	0.971000	0.41717	0.962000	0.63368	5.505000	0.66981	2.494000	0.84150	0.467000	0.42956	GGA	.	.	none		0.303	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
KDM2B	84678	hgsc.bcm.edu	37	12	121881588	121881588	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:121881588C>T	ENST00000377071.4	-	17	2532	c.2460G>A	c.(2458-2460)tcG>tcA	p.S820S	KDM2B_ENST00000377069.4_Intron|KDM2B_ENST00000542973.1_Silent_p.S188S|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	820					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						ACGTTTGAAGCGATGAGGCCT	0.607											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S820S		Atlas-SNP	.											KDM2B_ENST00000377071,rectum,carcinoma,-1,2	KDM2B	218	2	0			c.G2460A						PASS	.						37.0	43.0	41.0					12																	121881588		1976	4158	6134	SO:0001819	synonymous_variant	84678	exon17			TTGAAGCGATGAG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2460G>A	12.37:g.121881588C>T		14.0	0.0	0	1514	14.0	13.0	0.928571	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	ENST00000377071.4	37	CCDS41850.1																																																																																			.	.	none		0.607	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
AMOTL1	154810	hgsc.bcm.edu	37	11	94554798	94554798	+	Silent	SNP	G	G	A	rs370986721		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr11:94554798G>A	ENST00000433060.2	+	4	1365	c.1224G>A	c.(1222-1224)ccG>ccA	p.P408P	AMOTL1_ENST00000317837.9_Intron|AMOTL1_ENST00000539727.1_3'UTR|AMOTL1_ENST00000317829.8_Silent_p.P358P	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	408					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TCTCCCTGCCGCTTCCACTCC	0.667																																					p.P408P		Atlas-SNP	.											.	AMOTL1	95	.	0			c.G1224A						PASS	.	A		0,4158		0,0,2079	26.0	32.0	30.0		1224	-10.5	0.0	11		30	1,8427		0,1,4213	no	coding-synonymous	AMOTL1	NM_130847.2		0,1,6292	AA,AG,GG		0.0119,0.0,0.0079		408/957	94554798	1,12585	2079	4214	6293	SO:0001819	synonymous_variant	154810	exon4			CCTGCCGCTTCCA	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1224G>A	11.37:g.94554798G>A		58.0	0.0	0		71.0	33.0	0.464789	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Silent	SNP	ENST00000433060.2	37	CCDS44712.1																																																																																			.	.	weak		0.667	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37732263	37732263	+	Silent	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr8:37732263T>C	ENST00000330843.4	-	3	1404	c.1392A>G	c.(1390-1392)gaA>gaG	p.E464E	RAB11FIP1_ENST00000523182.1_5'Flank|RAB11FIP1_ENST00000522727.1_Silent_p.E316E|RAB11FIP1_ENST00000287263.4_Silent_p.E464E|RAB11FIP1_ENST00000524118.1_Silent_p.E316E	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	464					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TCAGCATGCCTTCCTTCTCCC	0.567																																					p.E464E		Atlas-SNP	.											.	RAB11FIP1	105	.	0			c.A1392G						PASS	.						175.0	171.0	172.0					8																	37732263		2203	4300	6503	SO:0001819	synonymous_variant	80223	exon3			CATGCCTTCCTTC	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1392A>G	8.37:g.37732263T>C		133.0	0.0	0		137.0	60.0	0.437956	NM_025151	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Silent	SNP	ENST00000330843.4	37	CCDS34882.1																																																																																			.	.	none		0.567	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
MAGI2	9863	hgsc.bcm.edu	37	7	79082451	79082451	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr7:79082451C>T	ENST00000354212.4	-	1	439	c.186G>A	c.(184-186)tcG>tcA	p.S62S	MAGI2-AS3_ENST00000426835.1_RNA|MAGI2-AS3_ENST00000422093.1_RNA|MAGI2-AS3_ENST00000451809.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2-AS3_ENST00000448195.1_RNA|MAGI2_ENST00000419488.1_Silent_p.S62S|MAGI2-AS3_ENST00000414797.1_RNA|MAGI2-AS3_ENST00000446159.1_RNA|MAGI2_ENST00000522391.1_Silent_p.S62S|MAGI2-AS3_ENST00000429408.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	62	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCAGCTCCTCCGACACCAATT	0.637																																					p.S62S		Atlas-SNP	.											MAGI2,caecum,carcinoma,0,1	MAGI2	246	1	0			c.G186A						PASS	.						54.0	59.0	57.0					7																	79082451		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon1			CTCCTCCGACACC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.186G>A	7.37:g.79082451C>T		81.0	0.0	0		45.0	20.0	0.444444	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	37	CCDS5594.1																																																																																			.	.	none		0.637	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
KLHL1	57626	hgsc.bcm.edu	37	13	70370951	70370951	+	Silent	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr13:70370951A>G	ENST00000377844.4	-	7	2317	c.1558T>C	c.(1558-1560)Ttg>Ctg	p.L520L	KLHL1_ENST00000545028.1_Silent_p.L327L	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	520					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACAGTGTTCAATGTCTTTAAG	0.423																																					p.L520L		Atlas-SNP	.											.	KLHL1	164	.	0			c.T1558C						PASS	.						208.0	177.0	188.0					13																	70370951		2203	4300	6503	SO:0001819	synonymous_variant	57626	exon7			TGTTCAATGTCTT	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1558T>C	13.37:g.70370951A>G		209.0	0.0	0		152.0	69.0	0.453947	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	37	CCDS9445.1																																																																																			.	.	none		0.423	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
PIM1	5292	hgsc.bcm.edu	37	6	37138951	37138951	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138951C>T	ENST00000373509.5	+	4	664	c.291C>T	c.(289-291)agC>agT	p.S97S		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	188					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGAAGGTGAGCTCGGGTTTCT	0.647			T	BCL6	NHL																																p.S188S		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,+1,5	PIM1	71	5	0			c.C564T						PASS	.						82.0	92.0	89.0					6																	37138951		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			GGTGAGCTCGGGT		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.291C>T	6.37:g.37138951C>T		53.0	0.0	0		48.0	24.0	0.5	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.647	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
RNF113B	140432	hgsc.bcm.edu	37	13	98829048	98829048	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr13:98829048C>T	ENST00000267291.6	-	1	471	c.443G>A	c.(442-444)cGg>cAg	p.R148Q	FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000319562.6_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	148							zinc ion binding (GO:0008270)	p.R148Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			GTGGATTCCCCGGTAGATGTG	0.647																																					p.R148Q		Atlas-SNP	.											RNF113B,mouth,carcinoma,0,1	RNF113B	41	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G443A						PASS	.						98.0	83.0	88.0					13																	98829048		2203	4300	6503	SO:0001583	missense	140432	exon1			ATTCCCCGGTAGA	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.443G>A	13.37:g.98829048C>T	ENSP00000267291:p.Arg148Gln	49.0	0.0	0		59.0	26.0	0.440678	NM_178861	Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597649	0.46318	.	.	ENSG00000139797	ENST00000267291	T	0.40476	1.03	1.16	1.16	0.20824	.	0.000000	0.85682	U	0.000000	T	0.48370	0.1496	M	0.83852	2.665	0.46901	D	0.999244	D	0.53151	0.958	P	0.47744	0.556	T	0.55879	-0.8071	10	0.72032	D	0.01	.	8.184	0.31328	0.0:1.0:0.0:0.0	.	148	Q8IZP6	R113B_HUMAN	Q	148	ENSP00000267291:R148Q	ENSP00000267291:R148Q	R	-	2	0	RNF113B	97627049	1.000000	0.71417	0.981000	0.43875	0.035000	0.12851	3.538000	0.53597	0.936000	0.37367	0.484000	0.47621	CGG	.	.	none		0.647	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3	NM_178861	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022569	32022569	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:32022569G>A	ENST00000396556.2	-	1	225	c.103C>T	c.(103-105)Ctg>Ttg	p.L35L	OSBPL10_ENST00000438237.2_Silent_p.L35L|ZNF860_ENST00000360311.4_5'Flank	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	35					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CGGCCCGCCAGAGAGCAGGAG	0.781																																					p.L35L		Atlas-SNP	.											.	OSBPL10	160	.	0			c.C103T						PASS	.						1.0	2.0	2.0					3																	32022569		772	1638	2410	SO:0001819	synonymous_variant	114884	exon1			CCGCCAGAGAGCA	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.103C>T	3.37:g.32022569G>A		67.0	0.0	0		72.0	35.0	0.486111	NM_017784	B4E212|Q9BTU5	Silent	SNP	ENST00000396556.2	37	CCDS2651.1																																																																																			.	.	none		0.781	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
IDO1	3620	hgsc.bcm.edu	37	8	39782769	39782769	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr8:39782769C>T	ENST00000518237.1	+	9	1374	c.735C>T	c.(733-735)gaC>gaT	p.D245D	IDO1_ENST00000522495.1_Silent_p.D245D|RP11-44K6.3_ENST00000517623.1_RNA	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	245					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	AGCTATCAGACGGTCTGGTGT	0.463																																					p.D245D		Atlas-SNP	.											.	IDO1	43	.	0			c.C735T						PASS	.						39.0	41.0	40.0					8																	39782769		1880	4108	5988	SO:0001819	synonymous_variant	3620	exon9			ATCAGACGGTCTG	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.735C>T	8.37:g.39782769C>T		158.0	0.0	0		165.0	66.0	0.4	NM_002164	Q540B4	Silent	SNP	ENST00000518237.1	37	CCDS47847.1																																																																																			.	.	none		0.463	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376987.1	NM_002164	
DGCR8	54487	hgsc.bcm.edu	37	22	20079074	20079074	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:20079074C>T	ENST00000351989.3	+	6	1852	c.1423C>T	c.(1423-1425)Cag>Tag	p.Q475*	DGCR8_ENST00000407755.1_Nonsense_Mutation_p.Q475*|DGCR8_ENST00000383024.2_Nonsense_Mutation_p.Q475*	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	475	Necessary for heme-binding and pri-miRNA processing.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GAAGCGGAAGCAGGCGGAGTC	0.478																																					p.Q475X		Atlas-SNP	.											.	DGCR8	53	.	0			c.C1423T						PASS	.						157.0	174.0	168.0					22																	20079074		2203	4300	6503	SO:0001587	stop_gained	54487	exon6			CGGAAGCAGGCGG	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1423C>T	22.37:g.20079074C>T	ENSP00000263209:p.Gln475*	69.0	0.0	0		56.0	28.0	0.5	NM_001190326	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Nonsense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	C	42	9.193922	0.99096	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	.	.	.	4.62	4.62	0.57501	.	0.058892	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-13.2898	17.2464	0.87029	0.0:1.0:0.0:0.0	.	.	.	.	X	475	.	ENSP00000263209:Q475X	Q	+	1	0	DGCR8	18459074	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	5.593000	0.67550	2.380000	0.81148	0.591000	0.81541	CAG	.	.	none		0.478	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		
BTBD11	121551	hgsc.bcm.edu	37	12	108011111	108011111	+	Missense_Mutation	SNP	G	G	A	rs190270378	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:108011111G>A	ENST00000280758.5	+	9	2657	c.2129G>A	c.(2128-2130)cGt>cAt	p.R710H	RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Missense_Mutation_p.R710H|BTBD11_ENST00000357167.4_Missense_Mutation_p.R247H	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	710						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CTGTTGGAGCGTGGTGCCGAT	0.483													G|||	3	0.000599042	0.0008	0.0	5008	,	,		21085	0.001		0.001	False		,,,				2504	0.0				p.R710H		Atlas-SNP	.											BTBD11,colon,carcinoma,+1,1	BTBD11	122	1	0			c.G2129A						scavenged	.						113.0	122.0	119.0					12																	108011111		2203	4300	6503	SO:0001583	missense	121551	exon9			TGGAGCGTGGTGC	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2129G>A	12.37:g.108011111G>A	ENSP00000280758:p.Arg710His	193.0	2.0	0.0103627		210.0	121.0	0.57619	NM_001018072	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	G	18.33	3.599668	0.66332	.	.	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.62498	0.02;0.02;0.02	5.49	5.49	0.81192	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.59810	0.2221	N	0.03177	-0.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.80764	0.975;0.994;0.795	T	0.63457	-0.6633	10	0.19590	T	0.45	.	19.3748	0.94503	0.0:0.0:1.0:0.0	.	247;710;710	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	H	710;710;247	ENSP00000280758:R710H;ENSP00000447319:R710H;ENSP00000349690:R247H	ENSP00000280758:R710H	R	+	2	0	BTBD11	106535241	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.810000	0.75216	2.572000	0.86782	0.655000	0.94253	CGT	G|0.999;A|0.001	0.001	strong		0.483	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
ANKRD11	29123	hgsc.bcm.edu	37	16	89348402	89348402	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr16:89348402G>A	ENST00000301030.4	-	9	5008	c.4548C>T	c.(4546-4548)gaC>gaT	p.D1516D	ANKRD11_ENST00000378330.2_Silent_p.D1516D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1516	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCCTGGACTTGTCTTTGAGCA	0.622																																					p.D1516D		Atlas-SNP	.											.	ANKRD11	195	.	0			c.C4548T						PASS	.						71.0	68.0	69.0					16																	89348402		2198	4300	6498	SO:0001819	synonymous_variant	29123	exon9			GGACTTGTCTTTG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4548C>T	16.37:g.89348402G>A		132.0	0.0	0		156.0	58.0	0.371795	NM_001256183	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			.	.	none		0.622	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
GATA3	2625	hgsc.bcm.edu	37	10	8100507	8100507	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:8100507G>A	ENST00000346208.3	+	3	936	c.481G>A	c.(481-483)Gtc>Atc	p.V161I	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Missense_Mutation_p.V161I			P23771	GATA3_HUMAN	GATA binding protein 3	161					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GCCGAAGGACGTCTCCCCGGA	0.721			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.V161I		Atlas-SNP	.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3	182	.	0			c.G481A						PASS	.						36.0	42.0	40.0					10																	8100507		2201	4297	6498	SO:0001583	missense	2625	exon3			AAGGACGTCTCCC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.481G>A	10.37:g.8100507G>A	ENSP00000341619:p.Val161Ile	51.0	0.0	0		42.0	16.0	0.380952	NM_002051	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.563049	0.65538	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96491	-4.03;-4.01	5.55	5.55	0.83447	.	0.056766	0.64402	D	0.000001	D	0.96131	0.8739	M	0.83012	2.62	0.58432	D	0.999997	P;P	0.47302	0.7;0.893	B;B	0.39465	0.041;0.3	D	0.96314	0.9231	10	0.51188	T	0.08	-15.1001	19.5043	0.95108	0.0:0.0:1.0:0.0	.	161;161	P23771;P23771-2	GATA3_HUMAN;.	I	161	ENSP00000368632:V161I;ENSP00000341619:V161I	ENSP00000341619:V161I	V	+	1	0	GATA3	8140513	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.722000	0.84778	2.607000	0.88179	0.561000	0.74099	GTC	.	.	none		0.721	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
SIRT7	51547	hgsc.bcm.edu	37	17	79872227	79872227	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:79872227C>T	ENST00000328666.6	-	7	821	c.759G>A	c.(757-759)gcG>gcA	p.A253A	PCYT2_ENST00000571105.1_5'Flank|PCYT2_ENST00000570388.1_5'Flank|PCYT2_ENST00000538721.2_5'Flank|PCYT2_ENST00000538936.2_5'Flank	NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	253	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CCTCGGTCGCCGCTTCCCAGT	0.627																																					p.A253A		Atlas-SNP	.											.	SIRT7	37	.	0			c.G759A						PASS	.						48.0	42.0	44.0					17																	79872227		2203	4299	6502	SO:0001819	synonymous_variant	51547	exon7			GGTCGCCGCTTCC	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.759G>A	17.37:g.79872227C>T		54.0	0.0	0		67.0	27.0	0.402985	NM_016538	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Silent	SNP	ENST00000328666.6	37	CCDS11792.1																																																																																			.	.	none		0.627	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439961.1	NM_016538	
PTPRF	5792	hgsc.bcm.edu	37	1	44084821	44084821	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr1:44084821C>T	ENST00000359947.4	+	27	4934	c.4594C>T	c.(4594-4596)Cgg>Tgg	p.R1532W	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.R1523W|PTPRF_ENST00000422171.2_Missense_Mutation_p.R891W|PTPRF_ENST00000372414.3_Missense_Mutation_p.R1532W|PTPRF_ENST00000372413.3_Missense_Mutation_p.R1523W	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1532	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTTCCTACGACGGGTCAAGGC	0.632																																					p.R1532W		Atlas-SNP	.											.	PTPRF	172	.	0			c.C4594T						PASS	.						50.0	45.0	47.0					1																	44084821		2203	4300	6503	SO:0001583	missense	5792	exon27			CTACGACGGGTCA	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4594C>T	1.37:g.44084821C>T	ENSP00000353030:p.Arg1532Trp	45.0	0.0	0		41.0	21.0	0.512195	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.47|15.47	2.842593|2.842593	0.51057|0.51057	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000412568;ENST00000414879	D;D;D;D;D;D|.	0.84298|.	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83|.	5.42|5.42	3.24|3.24	0.37175|0.37175	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);|.	0.000000|.	0.31323|.	N|.	0.007859|.	D|D	0.85008|0.85008	0.5599|0.5599	H|H	0.94183|0.94183	3.505|3.505	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.999;0.999;0.998;0.997;1.0|.	D|D	0.89646|0.89646	0.3866|0.3866	10|5	0.87932|.	D|.	0|.	.|.	14.1802|14.1802	0.65568|0.65568	0.393:0.607:0.0:0.0|0.393:0.607:0.0:0.0	.|.	1177;891;1109;1523;1532|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	W|M	1532;1523;1532;1523;891;604|915;956	ENSP00000353030:R1532W;ENSP00000398822:R1523W;ENSP00000361491:R1532W;ENSP00000361490:R1523W;ENSP00000387885:R891W;ENSP00000361484:R604W|.	ENSP00000353030:R1532W|.	R|T	+|+	1|2	2|0	PTPRF|PTPRF	43857408|43857408	0.005000|0.005000	0.15991|0.15991	1.000000|1.000000	0.80357|0.80357	0.709000|0.709000	0.40893|0.40893	0.051000|0.051000	0.14141|0.14141	1.389000|1.389000	0.46526|0.46526	0.561000|0.561000	0.74099|0.74099	CGG|ACG	.	.	none		0.632	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
CILP2	148113	hgsc.bcm.edu	37	19	19656250	19656250	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:19656250C>T	ENST00000291495.5	+	8	2981	c.2896C>T	c.(2896-2898)Cgc>Tgc	p.R966C	CILP2_ENST00000586018.1_Missense_Mutation_p.R972C	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	966						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CCCACGCACCCGCGGCCAGCT	0.677																																					p.R966C		Atlas-SNP	.											.	CILP2	84	.	0			c.C2896T						PASS	.						16.0	18.0	17.0					19																	19656250		2196	4294	6490	SO:0001583	missense	148113	exon8			CGCACCCGCGGCC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2896C>T	19.37:g.19656250C>T	ENSP00000291495:p.Arg966Cys	35.0	0.0	0		40.0	19.0	0.475	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300104	0.23650	.	.	ENSG00000160161	ENST00000291495	T	0.10192	2.9	5.79	4.73	0.59995	.	0.632272	0.16163	N	0.226641	T	0.11836	0.0288	L	0.46157	1.445	0.09310	N	0.999999	P;P	0.50819	0.939;0.939	B;B	0.42522	0.326;0.39	T	0.14282	-1.0478	10	0.54805	T	0.06	-8.0753	9.6471	0.39875	0.1599:0.6858:0.1543:0.0	.	966;966	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	C	966	ENSP00000291495:R966C	ENSP00000291495:R966C	R	+	1	0	CILP2	19517250	0.000000	0.05858	0.006000	0.13384	0.010000	0.07245	0.965000	0.29319	1.419000	0.47118	0.555000	0.69702	CGC	.	.	none		0.677	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
PIM1	5292	hgsc.bcm.edu	37	6	37138563	37138563	+	Missense_Mutation	SNP	C	C	T	rs34095970		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138563C>T	ENST00000373509.5	+	2	470	c.97C>T	c.(97-99)Ccc>Tcc	p.P33S		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	124					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GGAGAAGGAGCCCCTGGAGTC	0.701			T	BCL6	NHL																																p.P124S		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C370T						PASS	.						21.0	31.0	28.0					6																	37138563		2155	4262	6417	SO:0001583	missense	5292	exon2			AAGGAGCCCCTGG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.97C>T	6.37:g.37138563C>T	ENSP00000362608:p.Pro33Ser	48.0	0.0	0		41.0	19.0	0.463415	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997735	0.35226	.	.	ENSG00000137193	ENST00000373509	T	0.69040	-0.37	4.64	3.75	0.43078	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000001	T	0.21267	0.0512	N	0.08118	0	0.48901	D	0.999723	B	0.12013	0.005	B	0.06405	0.002	T	0.22836	-1.0205	10	0.02654	T	1	.	12.1438	0.54012	0.0:0.9152:0.0:0.0848	.	124	P11309	PIM1_HUMAN	S	33	ENSP00000362608:P33S	ENSP00000362608:P33S	P	+	1	0	PIM1	37246541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.980000	0.40618	2.294000	0.77228	0.549000	0.68633	CCC	.	.	none		0.701	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138804	37138804	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138804G>C	ENST00000373509.5	+	3	610	c.237G>C	c.(235-237)gaG>gaC	p.E79D		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	170					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.E79D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	ACTGGGGAGAGCTGGTGAGTG	0.687			T	BCL6	NHL																																p.E170D		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,4	PIM1	71	4	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G510C						PASS	.						51.0	53.0	52.0					6																	37138804		2203	4300	6503	SO:0001583	missense	5292	exon3			GGGAGAGCTGGTG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.237G>C	6.37:g.37138804G>C	ENSP00000362608:p.Glu79Asp	73.0	0.0	0		68.0	33.0	0.485294	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.939366	0.34189	.	.	ENSG00000137193	ENST00000373509	T	0.66280	-0.2	4.44	0.389	0.16269	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.068351	0.56097	D	0.000034	T	0.16938	0.0407	N	0.11023	0.085	0.34210	D	0.674133	B	0.15473	0.013	B	0.14578	0.011	T	0.02345	-1.1173	10	0.37606	T	0.19	.	4.6029	0.12363	0.4591:0.0:0.3935:0.1474	.	170	P11309	PIM1_HUMAN	D	79	ENSP00000362608:E79D	ENSP00000362608:E79D	E	+	3	2	PIM1	37246782	0.728000	0.28080	0.985000	0.45067	0.975000	0.68041	0.054000	0.14205	-0.042000	0.13535	0.549000	0.68633	GAG	.	.	none		0.687	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PRICKLE2	166336	hgsc.bcm.edu	37	3	64085223	64085223	+	Missense_Mutation	SNP	C	C	T	rs139750623		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:64085223C>T	ENST00000295902.6	-	8	2624	c.2039G>A	c.(2038-2040)cGc>cAc	p.R680H	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.R736H|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	680	Arg-rich.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TCGGAAACGGCGGTTGTCGTC	0.647																																					p.R680H		Atlas-SNP	.											PRICKLE2,colon,carcinoma,-1,1	PRICKLE2	88	1	0			c.G2039A						PASS	.						44.0	47.0	46.0					3																	64085223		2203	4300	6503	SO:0001583	missense	166336	exon8			AAACGGCGGTTGT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2039G>A	3.37:g.64085223C>T	ENSP00000295902:p.Arg680His	55.0	0.0	0		53.0	25.0	0.471698	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926661	0.34002	.	.	ENSG00000163637	ENST00000295902	D	0.84944	-1.92	5.63	4.76	0.60689	.	0.082334	0.53938	D	0.000057	T	0.75250	0.3824	N	0.25647	0.755	0.58432	D	0.999994	B	0.10296	0.003	B	0.06405	0.002	T	0.68903	-0.5286	10	0.33141	T	0.24	-33.4654	10.4637	0.44594	0.0:0.8524:0.0:0.1476	.	680	Q7Z3G6	PRIC2_HUMAN	H	680	ENSP00000295902:R680H	ENSP00000295902:R680H	R	-	2	0	PRICKLE2	64060263	1.000000	0.71417	0.918000	0.36340	0.854000	0.48673	3.606000	0.54095	1.382000	0.46385	0.591000	0.81541	CGC	.	.	none		0.647	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
KBTBD13	390594	hgsc.bcm.edu	37	15	65370255	65370255	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr15:65370255G>A	ENST00000432196.2	+	1	1102	c.1102G>A	c.(1102-1104)Gcc>Acc	p.A368T	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	368					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CCTGCACTGCGCCATCGACTG	0.672																																					p.A368T		Atlas-SNP	.											.	KBTBD13	9	.	0			c.G1102A						PASS	.						25.0	26.0	26.0					15																	65370255		1921	3918	5839	SO:0001583	missense	390594	exon1			CACTGCGCCATCG		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.1102G>A	15.37:g.65370255G>A	ENSP00000388723:p.Ala368Thr	62.0	0.0	0		90.0	30.0	0.333333	NM_001101362		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	.	.	.	.	.	.	.	.	.	.	G	6.881	0.532018	0.13127	.	.	ENSG00000234438	ENST00000432196	T	0.64991	-0.13	4.98	4.0	0.46444	Kelch-type beta propeller (1);	.	.	.	.	T	0.44767	0.1309	N	0.25647	0.755	0.26618	N	0.972717	B	0.13594	0.008	B	0.08055	0.003	T	0.17167	-1.0378	9	0.21540	T	0.41	.	7.5467	0.27770	0.0841:0.0:0.75:0.1659	.	368	C9JR72	KBTBD_HUMAN	T	368	ENSP00000388723:A368T	ENSP00000388723:A368T	A	+	1	0	KBTBD13	63157308	0.871000	0.30034	0.982000	0.44146	0.815000	0.46073	1.333000	0.33816	2.307000	0.77673	0.561000	0.74099	GCC	.	.	none		0.672	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230323	23230323	+	Silent	SNP	T	T	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23230323T>C	ENST00000526893.1	+	1	364	c.90T>C	c.(88-90)ggT>ggC	p.G30G	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000532223.2_Silent_p.G30G|IGLL5_ENST00000531372.1_Silent_p.G30G	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	30						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TGCTGCTGGGTCTGGCCATGG	0.667																																					p.G30G		Atlas-SNP	.											.	IGLL5	26	.	0			c.T90C						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GCTGGGTCTGGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.90T>C	22.37:g.23230323T>C		89.0	0.0	0		97.0	37.0	0.381443	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
HIST1H2AM	8336	hgsc.bcm.edu	37	6	27860549	27860549	+	Missense_Mutation	SNP	C	C	G	rs191325870		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:27860549C>G	ENST00000359611.2	-	1	414	c.379G>C	c.(379-381)Gct>Cct	p.A127P	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	127						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						TTGCCCTTAGCTTTGTGGTGG	0.483																																					p.A127P		Atlas-SNP	.											.	HIST1H2AM	27	.	0			c.G379C						PASS	.						121.0	117.0	118.0					6																	27860549		2203	4300	6503	SO:0001583	missense	8336	exon1			CCTTAGCTTTGTG	X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.379G>C	6.37:g.27860549C>G	ENSP00000352627:p.Ala127Pro	227.0	0.0	0		194.0	92.0	0.474227	NM_003514	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359611.2	37	CCDS4639.1	.	.	.	.	.	.	.	.	.	.	C	9.216	1.032045	0.19590	.	.	ENSG00000233224	ENST00000359611	T	0.44083	0.93	4.15	4.15	0.48705	.	0.000000	0.30068	U	0.010482	T	0.33059	0.0850	L	0.34521	1.04	0.34490	D	0.70489	.	.	.	.	.	.	T	0.16482	-1.0401	8	0.44086	T	0.13	.	16.2401	0.82402	0.0:1.0:0.0:0.0	.	.	.	.	P	127	ENSP00000352627:A127P	ENSP00000352627:A127P	A	-	1	0	HIST1H2AM	27968528	0.991000	0.36638	1.000000	0.80357	0.272000	0.26649	3.089000	0.50183	2.601000	0.87937	0.655000	0.94253	GCT	C|1.000;T|0.000	.	alt		0.483	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514	
EIF2S2	8894	hgsc.bcm.edu	37	20	32677684	32677684	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:32677684C>T	ENST00000374980.2	-	9	1075	c.854G>A	c.(853-855)cGa>cAa	p.R285Q		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	285					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						GTCCGGTGATCGGCATGTGTG	0.448																																					p.R285Q		Atlas-SNP	.											EIF2S2,NS,carcinoma,-1,3	EIF2S2	32	3	0			c.G854A						PASS	.						139.0	118.0	125.0					20																	32677684		2203	4300	6503	SO:0001583	missense	8894	exon9			GGTGATCGGCATG	M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.854G>A	20.37:g.32677684C>T	ENSP00000364119:p.Arg285Gln	107.0	0.0	0		78.0	33.0	0.423077	NM_003908	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	ENST00000374980.2	37	CCDS13231.1	.	.	.	.	.	.	.	.	.	.	C	35	5.436758	0.96168	.	.	ENSG00000125977	ENST00000374980	T	0.48201	0.82	6.07	6.07	0.98685	Translation initiation factor IF2/IF5, zinc-binding (1);Translation initiation factor IF2/IF5 (2);	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	L	0.54965	1.715	0.80722	D	1	P;D;D	0.69078	0.784;0.997;0.997	B;D;D	0.72982	0.19;0.979;0.979	T	0.65479	-0.6158	10	0.66056	D	0.02	-8.2387	20.6439	0.99570	0.0:1.0:0.0:0.0	.	285;285;285	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	Q	285	ENSP00000364119:R285Q	ENSP00000364119:R285Q	R	-	2	0	EIF2S2	32141345	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.786000	0.85741	2.884000	0.98904	0.655000	0.94253	CGA	.	.	none		0.448	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078765.2	NM_003908	
TOM1L1	10040	hgsc.bcm.edu	37	17	53007452	53007452	+	Silent	SNP	C	C	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr17:53007452C>A	ENST00000575882.1	+	8	1092	c.739C>A	c.(739-741)Cgg>Agg	p.R247R	TOM1L1_ENST00000540336.1_Silent_p.R135R|TOM1L1_ENST00000572158.1_Silent_p.R240R|TOM1L1_ENST00000570371.1_Silent_p.R247R|TOM1L1_ENST00000575333.1_Silent_p.R247R|TOM1L1_ENST00000348161.4_Silent_p.R170R|TOM1L1_ENST00000536554.1_Silent_p.R170R|TOM1L1_ENST00000445275.2_Silent_p.R247R	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	247	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						TAAAACAGGTCGGGAGATGCA	0.423																																					p.R247R		Atlas-SNP	.											TOM1L1,caecum,carcinoma,-1,1	TOM1L1	33	1	0			c.C739A						scavenged	.						165.0	152.0	157.0					17																	53007452		2203	4300	6503	SO:0001819	synonymous_variant	10040	exon8			ACAGGTCGGGAGA	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.739C>A	17.37:g.53007452C>A		103.0	1.0	0.00970874		103.0	41.0	0.398058	NM_005486	Q53G06|Q8N749	Silent	SNP	ENST00000575882.1	37	CCDS11582.1																																																																																			.	.	none		0.423	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439029.2	NM_005486	
FOXS1	2307	hgsc.bcm.edu	37	20	30433068	30433068	+	Missense_Mutation	SNP	G	G	A	rs140637242		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:30433068G>A	ENST00000375978.3	-	1	352	c.278C>T	c.(277-279)aCg>aTg	p.T93M		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	93					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						AGGGTCCAGCGTCCAGTAGCT	0.667																																					p.T93M		Atlas-SNP	.											.	FOXS1	29	.	0			c.C278T						PASS	.	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	70.0	58.0	62.0		278	5.0	1.0	20	dbSNP_134	62	0,8600		0,0,4300	no	missense	FOXS1	NM_004118.3	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	93/331	30433068	2,13004	2203	4300	6503	SO:0001583	missense	2307	exon1			TCCAGCGTCCAGT	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.278C>T	20.37:g.30433068G>A	ENSP00000365145:p.Thr93Met	47.0	0.0	0		44.0	18.0	0.409091	NM_004118	Q96D28	Missense_Mutation	SNP	ENST00000375978.3	37	CCDS13192.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541894	0.85917	4.54E-4	0.0	ENSG00000179772	ENST00000375978	D	0.95788	-3.81	4.98	4.98	0.66077	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.49916	D	0.000130	D	0.95909	0.8668	L	0.53617	1.68	0.80722	D	1	D	0.61080	0.989	P	0.54312	0.748	D	0.96332	0.9244	10	0.87932	D	0	.	16.9787	0.86321	0.0:0.0:1.0:0.0	.	93	O43638	FOXS1_HUMAN	M	93	ENSP00000365145:T93M	ENSP00000365145:T93M	T	-	2	0	FOXS1	29896729	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	9.657000	0.98554	2.605000	0.88082	0.555000	0.69702	ACG	G|1.000;A|0.000	0.000	weak		0.667	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118	
CYLC1	1538	hgsc.bcm.edu	37	X	83127996	83127996	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:83127996G>T	ENST00000329312.4	+	4	317	c.280G>T	c.(280-282)Gcc>Tcc	p.A94S		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	94					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TTACACAGCTGCCAGGGAACA	0.373																																					p.A94S		Atlas-SNP	.											.	CYLC1	272	.	0			c.G280T						PASS	.						39.0	37.0	38.0					X																	83127996		2201	4294	6495	SO:0001583	missense	1538	exon4			ACAGCTGCCAGGG	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.280G>T	X.37:g.83127996G>T	ENSP00000331556:p.Ala94Ser	214.0	0.0	0		157.0	143.0	0.910828	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	13.83	2.353949	0.41700	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.51817	0.69	4.58	-1.37	0.09056	.	.	.	.	.	T	0.33206	0.0855	L	0.49126	1.545	0.09310	N	1	B;B	0.28636	0.218;0.218	B;B	0.25140	0.058;0.058	T	0.30504	-0.9976	9	0.52906	T	0.07	4.0792	0.8651	0.01202	0.1939:0.1371:0.3069:0.3621	.	94;94	P35663;F5H4V5	CYLC1_HUMAN;.	S	94	ENSP00000331556:A94S	ENSP00000331556:A94S	A	+	1	0	CYLC1	83014652	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.925000	0.03992	-0.564000	0.06070	-0.191000	0.12829	GCC	.	.	none		0.373	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
MMP16	4325	hgsc.bcm.edu	37	8	89128762	89128762	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr8:89128762G>T	ENST00000286614.6	-	6	1338	c.1057C>A	c.(1057-1059)Ctt>Att	p.L353I	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	353					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCACGACGAAGAATAGCTAGA	0.428																																					p.L353I		Atlas-SNP	.											MMP16,NS,carcinoma,+1,1	MMP16	176	1	0			c.C1057A						PASS	.						100.0	98.0	99.0					8																	89128762		2203	4300	6503	SO:0001583	missense	4325	exon6			GACGAAGAATAGC	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1057C>A	8.37:g.89128762G>T	ENSP00000286614:p.Leu353Ile	216.0	0.0	0		139.0	65.0	0.467626	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736234	0.69189	.	.	ENSG00000156103	ENST00000286614	T	0.08193	3.12	5.73	5.73	0.89815	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.17238	0.0414	L	0.31845	0.965	0.80722	D	1	D;P	0.64830	0.994;0.543	P;P	0.60117	0.869;0.812	T	0.05517	-1.0880	10	0.16896	T	0.51	.	20.2786	0.98501	0.0:0.0:1.0:0.0	.	353;353	P51512-2;P51512	.;MMP16_HUMAN	I	353	ENSP00000286614:L353I	ENSP00000286614:L353I	L	-	1	0	MMP16	89197878	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.868000	0.98415	0.557000	0.71058	CTT	.	.	none		0.428	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
NUP153	9972	hgsc.bcm.edu	37	6	17629629	17629629	+	Missense_Mutation	SNP	A	A	C	rs141169660	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:17629629A>C	ENST00000262077.2	-	18	2800	c.2801T>G	c.(2800-2802)aTa>aGa	p.I934R	NUP153_ENST00000537253.1_Missense_Mutation_p.I965R	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	934					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGACACACCTATTTTGAATCC	0.373																																					p.I934R		Atlas-SNP	.											.	NUP153	116	.	0			c.T2801G						PASS	.						74.0	81.0	79.0					6																	17629629		2203	4300	6503	SO:0001583	missense	9972	exon18			ACACCTATTTTGA	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2801T>G	6.37:g.17629629A>C	ENSP00000262077:p.Ile934Arg	145.0	0.0	0		125.0	55.0	0.44	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698550	0.30142	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.07114	3.23;3.22	5.73	0.639	0.17747	.	0.539300	0.16784	N	0.199661	T	0.02688	0.0081	L	0.36672	1.1	0.32725	N	0.509803	P;B;B	0.43519	0.809;0.29;0.421	P;B;B	0.45232	0.474;0.095;0.095	T	0.47381	-0.9122	10	0.16896	T	0.51	-0.2277	8.855	0.35223	0.7261:0.0:0.2739:0.0	.	965;914;934	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	R	934;914;965	ENSP00000262077:I934R;ENSP00000444029:I965R	ENSP00000262077:I934R	I	-	2	0	NUP153	17737608	1.000000	0.71417	0.412000	0.26496	0.483000	0.33249	3.701000	0.54793	-0.044000	0.13491	-0.912000	0.02778	ATA	A|0.999;G|0.001	.	alt		0.373	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
FAM198B	51313	hgsc.bcm.edu	37	4	159092159	159092159	+	Silent	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr4:159092159G>T	ENST00000296530.8	-	2	990	c.369C>A	c.(367-369)ggC>ggA	p.G123G	RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000393807.5_Silent_p.G123G|RP11-597D13.9_ENST00000509463.1_RNA|RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000585682.1_Silent_p.G123G|FAM198B_ENST00000592057.1_Silent_p.G123G|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	123						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						GCTTCACGGTGCCACGGATAT	0.622																																					p.G123G		Atlas-SNP	.											.	FAM198B	134	.	0			c.C369A						PASS	.						84.0	80.0	81.0					4																	159092159		2203	4300	6503	SO:0001819	synonymous_variant	51313	exon2			CACGGTGCCACGG		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.369C>A	4.37:g.159092159G>T		62.0	0.0	0		63.0	23.0	0.365079	NM_016613	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Silent	SNP	ENST00000296530.8	37	CCDS3798.1																																																																																			.	.	none		0.622	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
CDKN2A	1029	hgsc.bcm.edu	37	9	21994305	21994305	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr9:21994305A>G	ENST00000579755.1	-	1	318	c.26T>C	c.(25-27)cTc>cCc	p.L9P	RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2A_ENST00000494262.1_Intron|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2A_ENST00000498628.2_Intron|RP11-149I2.4_ENST00000578935.1_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2A_ENST00000361570.3_Missense_Mutation_p.L50P|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|CDKN2A_ENST00000470819.2_Intron|CDKN2A_ENST00000530628.2_Missense_Mutation_p.L9P|CDKN2B-AS1_ENST00000577551.1_RNA			P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	0					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(198)|p.0(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCGAATCCGGAGGGTCACCAA	0.726		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.L9P		Atlas-SNP	.											.	CDKN2A	4810	.	199	Whole gene deletion(199)	haematopoietic_and_lymphoid_tissue(34)|central_nervous_system(31)|lung(31)|skin(16)|kidney(14)|oesophagus(11)|bone(10)|pancreas(10)|urinary_tract(7)|breast(6)|soft_tissue(5)|thyroid(4)|pleura(4)|large_intestine(3)|stomach(3)|liver(3)|ovary(3)|upper_aerodigestive_tract(1)|vulva(1)|biliary_tract(1)|autonomic_ganglia(1)	c.T26C						PASS	.						11.0	13.0	12.0					9																	21994305		2177	4270	6447	SO:0001583	missense	1029	exon1			ATCCGGAGGGTCA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000579755.1:c.26T>C	9.37:g.21994305A>G	ENSP00000462950:p.Leu9Pro	53.0	0.0	0		24.0	21.0	0.875	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000579755.1	37	CCDS6511.2	.	.	.	.	.	.	.	.	.	.	A	14.39	2.522002	0.44866	.	.	ENSG00000147889	ENST00000361570;ENST00000530628	T;T	0.79141	-1.24;-1.24	4.23	4.23	0.50019	.	0.212553	0.23638	N	0.046047	T	0.65238	0.2672	N	0.08118	0	0.19775	N	0.999957	P	0.50710	0.938	P	0.48982	0.597	T	0.60616	-0.7228	10	0.72032	D	0.01	.	9.888	0.41272	1.0:0.0:0.0:0.0	.	50	Q8N726	CD2A2_HUMAN	P	50;9	ENSP00000355153:L50P;ENSP00000432664:L9P	ENSP00000355153:L50P	L	-	2	0	CDKN2A	21984305	0.982000	0.34865	0.153000	0.22517	0.221000	0.24807	2.190000	0.42630	1.917000	0.55516	0.454000	0.30748	CTC	.	.	none		0.726	CDKN2A-004	KNOWN	NMD_exception|upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051918.5	NM_000077	
LEUTX	342900	hgsc.bcm.edu	37	19	40276412	40276412	+	Silent	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:40276412G>T	ENST00000396841.4	+	3	308	c.144G>T	c.(142-144)ggG>ggT	p.G48G		NM_001143832.1	NP_001137304.1	A8MZ59	LEUTX_HUMAN	leucine twenty homeobox	48					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|kidney(1)|skin(2)	5						CATCACTAGGGCCAGCAAACC	0.522																																					p.G48G		Atlas-SNP	.											.	LEUTX	7	.	0			c.G144T						PASS	.						97.0	94.0	95.0					19																	40276412		692	1591	2283	SO:0001819	synonymous_variant	342900	exon3			ACTAGGGCCAGCA			19q13.2	2011-06-20			ENSG00000213921	ENSG00000213921		"""Homeoboxes / PRD class"""	31953	protein-coding gene	gene with protein product							Standard	NM_001143832		Approved		uc010xvg.2	A8MZ59		ENST00000396841.4:c.144G>T	19.37:g.40276412G>T		95.0	0.0	0		133.0	50.0	0.37594	NM_001143832		Silent	SNP	ENST00000396841.4	37		.	.	.	.	.	.	.	.	.	.	.	2.257	-0.370097	0.05069	.	.	ENSG00000213921	ENST00000556180	.	.	.	2.66	2.66	0.31614	.	.	.	.	.	T	0.26629	0.0651	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21008	-1.0258	4	.	.	.	.	4.68	0.12731	0.85:0.0:0.15:0.0	.	.	.	.	V	103	.	.	G	+	2	0	LEUTX	44968252	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.838000	0.04372	0.447000	0.26695	-0.269000	0.10298	GGC	.	.	none		0.522	LEUTX-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000410828.3	XM_001129035	
HELZ2	85441	hgsc.bcm.edu	37	20	62195768	62195768	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr20:62195768C>T	ENST00000467148.1	-	8	4476	c.4407G>A	c.(4405-4407)ccG>ccA	p.P1469P	HELZ2_ENST00000427522.2_Silent_p.P900P	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1469					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGCCGGCACCCGGGTGCTGCC	0.711																																					p.P1469P		Atlas-SNP	.											.	.	.	.	0			c.G4407A						PASS	.						5.0	5.0	5.0					20																	62195768		2046	4119	6165	SO:0001819	synonymous_variant	85441	exon9			GGCACCCGGGTGC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4407G>A	20.37:g.62195768C>T		26.0	0.0	0		21.0	12.0	0.571429	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.	.	none		0.711	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
PIM2	11040	hgsc.bcm.edu	37	X	48775918	48775918	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:48775918G>A	ENST00000376509.4	-	2	255	c.66C>T	c.(64-66)ggC>ggT	p.G22G		NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	22					apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						CCCGATCCTTGCCTCCTACGC	0.677																																					p.G22G		Atlas-SNP	.											.	PIM2	31	.	0			c.C66T						PASS	.						27.0	25.0	26.0					X																	48775918		2203	4299	6502	SO:0001819	synonymous_variant	11040	exon2			ATCCTTGCCTCCT	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.66C>T	X.37:g.48775918G>A		83.0	0.0	0		75.0	65.0	0.866667	NM_006875	A8K4G6|Q99739	Silent	SNP	ENST00000376509.4	37	CCDS14312.1																																																																																			.	.	none		0.677	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060805.1		
SCN2A	6326	hgsc.bcm.edu	37	2	166201313	166201313	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:166201313C>T	ENST00000375437.2	+	16	3101	c.2811C>T	c.(2809-2811)cgC>cgT	p.R937R	SCN2A_ENST00000357398.3_Silent_p.R937R|SCN2A_ENST00000283256.6_Silent_p.R937R|SCN2A_ENST00000375427.2_Silent_p.R937R	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	937					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCGTGTTCCGCGTGCTGTGTG	0.488																																					p.R937R		Atlas-SNP	.											.	SCN2A	589	.	0			c.C2811T						PASS	.						254.0	221.0	232.0					2																	166201313		2203	4300	6503	SO:0001819	synonymous_variant	6326	exon15			GTTCCGCGTGCTG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2811C>T	2.37:g.166201313C>T		341.0	1.0	0.00293255		263.0	134.0	0.509506	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1																																																																																			.	.	none		0.488	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
TMEM52B	120939	hgsc.bcm.edu	37	12	10339160	10339160	+	Silent	SNP	C	C	T	rs145013082	byFrequency	TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr12:10339160C>T	ENST00000381923.2	+	5	683	c.279C>T	c.(277-279)caC>caT	p.H93H	TMEM52B_ENST00000536952.1_Silent_p.H93H|TMEM52B_ENST00000298530.3_Silent_p.H73H			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	93						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTTTCGATCACGACAGCACTC	0.522																																					p.H73H		Atlas-SNP	.											.	.	.	.	0			c.C219T						PASS	.	C		0,4406		0,0,2203	97.0	87.0	91.0		219	-6.6	0.9	12	dbSNP_134	91	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	C12orf59	NM_153022.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		73/164	10339160	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	120939	exon3			CGATCACGACAGC	AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.279C>T	12.37:g.10339160C>T		84.0	0.0	0		67.0	26.0	0.38806	NM_153022	Q96NA7	Silent	SNP	ENST00000381923.2	37																																																																																				C|1.000;T|0.000	0.000	strong		0.522	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000399645.1	NM_153022	
MYD88	4615	hgsc.bcm.edu	37	3	38182641	38182641	+	Nonstop_Mutation	SNP	T	T	C	rs387907272		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr3:38182641T>C	ENST00000495303.1	+	3	483	c.478T>C	c.(478-480)Tga>Cga	p.*160R	MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000417037.2_Missense_Mutation_p.L273P|MYD88_ENST00000443433.2_Nonstop_Mutation_p.*205R|MYD88_ENST00000396334.3_Missense_Mutation_p.L265P|MYD88_ENST00000424893.1_Missense_Mutation_p.L220P	NM_001172566.1	NP_001166037.1	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	0	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)	p.L265P(188)		breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAGAAGCGACTGATCCCCATC	0.552			Mis		ABC-DLBCL								T|||	1	0.000199681	0.0	0.0	5008	,	,		22034	0.0		0.001	False		,,,				2504	0.0				p.X205R		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	MYD88,NS,lymphoid_neoplasm,0,828	MYD88	900	828	188	Substitution - Missense(188)	haematopoietic_and_lymphoid_tissue(188)	c.T613C						PASS	.						148.0	119.0	129.0					3																	38182641		2203	4300	6503	SO:0001578	stop_lost	4615	exon4			AGCGACTGATCCC	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000495303.1:c.478T>C	3.37:g.38182641T>C	ENSP00000417848:p.*160Argext*8	65.0	0.0	0		55.0	27.0	0.490909	NM_001172569	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000495303.1	37	CCDS54568.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.85|18.85	3.710754|3.710754	0.68730|0.68730	.|.	.|.	ENSG00000172936|ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158|ENST00000495303;ENST00000443433	T;T;T;T|.	0.15487|.	2.42;2.42;2.42;2.42|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Toll/interleukin-1 receptor homology (TIR) domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.71676|.	0.3368|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.998;0.999;0.999|.	T|.	0.70626|.	-0.4820|.	9|.	0.87932|.	D|.	0|.	-17.9268|-17.9268	15.535|15.535	0.75996|0.75996	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	207;252;241|.	Q99836-2;Q99836;B4E3D6|.	.;MYD88_HUMAN;.|.	P|R	273;265;220;272;241|160;205	ENSP00000401399:L273P;ENSP00000379625:L265P;ENSP00000389979:L220P;ENSP00000391753:L272P|.	ENSP00000379625:L265P|.	L|X	+|+	2|1	0|0	MYD88|MYD88	38157645|38157645	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.639000|7.639000	0.83342|0.83342	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	CTG|TGA	.	.	none		0.552	MYD88-008	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000342700.1	NM_002468	
BCR	613	hgsc.bcm.edu	37	22	23523318	23523318	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:23523318C>T	ENST00000305877.8	+	1	922	c.171C>T	c.(169-171)atC>atT	p.I57I	BCR_ENST00000398512.5_Silent_p.I57I|BCR_ENST00000359540.3_Silent_p.I57I	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	57	Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TCCGCATGATCTACCTGCAGA	0.677			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.I57I		Atlas-SNP	.		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR	74	.	0			c.C171T						PASS	.						21.0	23.0	22.0					22																	23523318		2187	4281	6468	SO:0001819	synonymous_variant	613	exon1			CATGATCTACCTG		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.171C>T	22.37:g.23523318C>T		71.0	0.0	0		78.0	32.0	0.410256	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	ENST00000305877.8	37	CCDS13806.1																																																																																			.	.	none		0.677	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
FZD7	8324	hgsc.bcm.edu	37	2	202899479	202899479	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr2:202899479G>A	ENST00000286201.1	+	1	170	c.109G>A	c.(109-111)Gga>Aga	p.G37R	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	37					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						GCCGTACCACGGAGAGAAGGG	0.711																																					p.G37R		Atlas-SNP	.											.	FZD7	70	.	0			c.G109A						PASS	.						69.0	62.0	65.0					2																	202899479		2203	4300	6503	SO:0001583	missense	8324	exon1			TACCACGGAGAGA	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.109G>A	2.37:g.202899479G>A	ENSP00000286201:p.Gly37Arg	46.0	0.0	0		56.0	28.0	0.5	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	37	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423917	0.43020	.	.	ENSG00000155760	ENST00000286201	T	0.75704	-0.96	4.36	3.47	0.39725	.	0.211632	0.38492	U	0.001662	T	0.67202	0.2868	L	0.32530	0.975	0.52501	D	0.99995	P	0.48089	0.905	P	0.45913	0.497	T	0.66756	-0.5843	10	0.48119	T	0.1	.	11.8692	0.52511	0.0864:0.0:0.9136:0.0	.	37	O75084	FZD7_HUMAN	R	37	ENSP00000286201:G37R	ENSP00000286201:G37R	G	+	1	0	FZD7	202607724	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.093000	0.71422	0.799000	0.34018	0.313000	0.20887	GGA	.	.	none		0.711	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
PIK3AP1	118788	hgsc.bcm.edu	37	10	98405403	98405403	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr10:98405403A>C	ENST00000339364.5	-	8	1321	c.1202T>G	c.(1201-1203)cTc>cGc	p.L401R	PIK3AP1_ENST00000371110.2_Missense_Mutation_p.L223R|PIK3AP1_ENST00000468783.1_5'UTR	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	401					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		GTGACTCTTGAGCATGTCCAC	0.567																																					p.L401R		Atlas-SNP	.											.	PIK3AP1	111	.	0			c.T1202G						PASS	.						141.0	111.0	121.0					10																	98405403		2203	4300	6503	SO:0001583	missense	118788	exon8			CTCTTGAGCATGT	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1202T>G	10.37:g.98405403A>C	ENSP00000339826:p.Leu401Arg	118.0	0.0	0		125.0	44.0	0.352	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	37	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421619	0.83559	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	T;T	0.26223	2.52;1.75	5.81	5.81	0.92471	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.48077	0.1480	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.42015	-0.9476	10	0.52906	T	0.07	-14.782	15.3374	0.74269	1.0:0.0:0.0:0.0	.	401	Q6ZUJ8	BCAP_HUMAN	R	401;223	ENSP00000339826:L401R;ENSP00000360151:L223R	ENSP00000339826:L401R	L	-	2	0	PIK3AP1	98395393	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.299000	0.89946	2.210000	0.71456	0.533000	0.62120	CTC	.	.	none		0.567	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
HDAC8	55869	hgsc.bcm.edu	37	X	71571612	71571612	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chrX:71571612C>T	ENST00000373573.3	-	10	1423	c.1082G>A	c.(1081-1083)cGa>cAa	p.R361Q	HDAC8_ENST00000373589.4_Missense_Mutation_p.R270Q|HDAC8_ENST00000429103.2_Missense_Mutation_p.R166Q|HDAC8_ENST00000373583.1_Intron	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	361					chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	TTGTTGGATTCGGTGGGGCTC	0.547													C|||	1	0.000264901	0.0008	0.0	3775	,	,		14175	0.0		0.0	False		,,,				2504	0.0				p.R361Q		Atlas-SNP	.											.	HDAC8	18	.	0			c.G1082A						PASS	.						217.0	148.0	171.0					X																	71571612		2203	4300	6503	SO:0001583	missense	55869	exon10			TGGATTCGGTGGG	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.1082G>A	X.37:g.71571612C>T	ENSP00000362674:p.Arg361Gln	76.0	0.0	0		71.0	61.0	0.859155	NM_018486	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	ENST00000373573.3	37	CCDS14420.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849435	0.51270	.	.	ENSG00000147099	ENST00000373573;ENST00000373589;ENST00000429103	T;T;T	0.80123	-1.34;-1.34;-1.34	4.79	3.0	0.34707	Histone deacetylase domain (1);	0.346769	0.32719	N	0.005733	T	0.55641	0.1933	N	0.03608	-0.345	0.80722	D	1	B;B	0.12013	0.005;0.0	B;B	0.01281	0.0;0.0	T	0.51718	-0.8670	10	0.54805	T	0.06	-1.3077	5.1597	0.15054	0.0:0.6597:0.0:0.3403	.	270;361	B4DKN0;Q9BY41	.;HDAC8_HUMAN	Q	361;270;166	ENSP00000362674:R361Q;ENSP00000362691:R270Q;ENSP00000388459:R166Q	ENSP00000362674:R361Q	R	-	2	0	HDAC8	71488337	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.434000	0.34958	1.105000	0.41606	0.436000	0.28706	CGA	.	.	none		0.547	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057193.2	NM_018486	
RNF180	285671	hgsc.bcm.edu	37	5	63626166	63626166	+	Silent	SNP	C	C	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr5:63626166C>T	ENST00000389100.4	+	7	1584	c.1512C>T	c.(1510-1512)agC>agT	p.S504S		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	504					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TAAAACAAAGCTTTCAGAAAT	0.313																																					p.S504S		Atlas-SNP	.											.	RNF180	94	.	0			c.C1512T						PASS	.						52.0	47.0	48.0					5																	63626166		692	1591	2283	SO:0001819	synonymous_variant	285671	exon7			ACAAAGCTTTCAG	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1512C>T	5.37:g.63626166C>T		327.0	0.0	0		258.0	105.0	0.406977	NM_001113561	Q0JSU3|Q495A8|Q8NBD1	Silent	SNP	ENST00000389100.4	37	CCDS47219.1																																																																																			.	.	none		0.313	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532	
FOXA3	3171	hgsc.bcm.edu	37	19	46375993	46375993	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:46375993G>A	ENST00000302177.2	+	2	927	c.730G>A	c.(730-732)Gcg>Acg	p.A244T		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	244					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CACCACCCCCGCGGCCACAGT	0.697																																					p.A244T		Atlas-SNP	.											.	FOXA3	19	.	0			c.G730A						PASS	.						5.0	7.0	6.0					19																	46375993		2062	4117	6179	SO:0001583	missense	3171	exon2			ACCCCCGCGGCCA	L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.730G>A	19.37:g.46375993G>A	ENSP00000304004:p.Ala244Thr	25.0	0.0	0		36.0	23.0	0.638889	NM_004497	A9LYI5|Q53F16|Q9UMW9	Missense_Mutation	SNP	ENST00000302177.2	37	CCDS12677.1	.	.	.	.	.	.	.	.	.	.	G	0.470	-0.884804	0.02530	.	.	ENSG00000170608	ENST00000302177	D	0.91521	-2.86	3.31	-0.315	0.12746	.	1.202840	0.06199	N	0.682958	T	0.79845	0.4516	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.62973	-0.6740	10	0.13470	T	0.59	.	3.8218	0.08839	0.2781:0.3989:0.323:0.0	.	244	P55318	FOXA3_HUMAN	T	244	ENSP00000304004:A244T	ENSP00000304004:A244T	A	+	1	0	FOXA3	51067833	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.193000	0.09573	0.005000	0.14708	-0.476000	0.04901	GCG	.	.	none		0.697	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461682.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138577	37138577	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37138577G>T	ENST00000373509.5	+	2	484	c.111G>T	c.(109-111)caG>caT	p.Q37H		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	128					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.Q37H(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TGGAGTCGCAGTACCAGGTGG	0.706			T	BCL6	NHL																																p.Q128H		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,2	PIM1	71	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G384T						PASS	.						22.0	32.0	28.0					6																	37138577		2167	4268	6435	SO:0001583	missense	5292	exon2			GTCGCAGTACCAG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.111G>T	6.37:g.37138577G>T	ENSP00000362608:p.Gln37His	52.0	0.0	0		41.0	18.0	0.439024	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866670	0.32977	.	.	ENSG00000137193	ENST00000373509	T	0.13901	2.55	4.64	0.515	0.17013	Protein kinase-like domain (1);	0.470425	0.18904	N	0.127947	T	0.01695	0.0054	N	0.08118	0	0.29021	N	0.886284	B	0.09022	0.002	B	0.04013	0.001	T	0.45056	-0.9287	10	0.41790	T	0.15	.	5.1594	0.15053	0.3201:0.2369:0.443:0.0	.	128	P11309	PIM1_HUMAN	H	37	ENSP00000362608:Q37H	ENSP00000362608:Q37H	Q	+	3	2	PIM1	37246555	0.171000	0.23029	0.997000	0.53966	0.994000	0.84299	-0.639000	0.05446	0.154000	0.19237	0.549000	0.68633	CAG	.	.	none		0.706	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
PIM1	5292	hgsc.bcm.edu	37	6	37139209	37139209	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:37139209G>C	ENST00000373509.5	+	4	922	c.549G>C	c.(547-549)aaG>aaC	p.K183N		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	274	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCGAGCTCAAGCTCATCGACT	0.647			T	BCL6	NHL																																p.K274N		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G822C						PASS	.						31.0	32.0	32.0					6																	37139209		2203	4300	6503	SO:0001583	missense	5292	exon4			GCTCAAGCTCATC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.549G>C	6.37:g.37139209G>C	ENSP00000362608:p.Lys183Asn	70.0	0.0	0		64.0	26.0	0.40625	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735520	0.69189	.	.	ENSG00000137193	ENST00000373509	T	0.22336	1.96	4.36	3.47	0.39725	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.062020	0.64402	D	0.000006	T	0.48169	0.1485	H	0.98786	4.33	0.54753	D	0.999984	D	0.69078	0.997	D	0.71414	0.973	T	0.57642	-0.7776	10	0.66056	D	0.02	.	5.5129	0.16890	0.3296:0.0:0.6704:0.0	.	274	P11309	PIM1_HUMAN	N	183	ENSP00000362608:K183N	ENSP00000362608:K183N	K	+	3	2	PIM1	37247187	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.356000	0.44116	1.020000	0.39573	0.448000	0.29417	AAG	.	.	none		0.647	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
APOL2	23780	hgsc.bcm.edu	37	22	36623579	36623579	+	Silent	SNP	T	T	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr22:36623579T>A	ENST00000249066.6	-	6	1361	c.885A>T	c.(883-885)tcA>tcT	p.S295S	APOL2_ENST00000451256.2_Silent_p.S407S|APOL2_ENST00000358502.5_Silent_p.S295S	NM_145637.1	NP_663612.1	Q9BQE5	APOL2_HUMAN	apolipoprotein L, 2	295					acute-phase response (GO:0006953)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|maternal process involved in female pregnancy (GO:0060135)|multicellular organismal development (GO:0007275)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|membrane (GO:0016020)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(2)	9						GCAAGTGCTTTGACTCATATG	0.562																																					p.S295S		Atlas-SNP	.											.	APOL2	20	.	0			c.A885T						PASS	.						104.0	109.0	107.0					22																	36623579		2203	4300	6503	SO:0001819	synonymous_variant	23780	exon5			GTGCTTTGACTCA	AF324224	CCDS43014.1	22q12.3	2013-09-20			ENSG00000128335	ENSG00000128335		"""Apolipoproteins"""	619	protein-coding gene	gene with protein product	"""apolipoprotein L-II"""	607252				10591208, 11374903	Standard	NM_145637		Approved	APOL-II	uc003apa.3	Q9BQE5	OTTHUMG00000150634	ENST00000249066.6:c.885A>T	22.37:g.36623579T>A		140.0	0.0	0		163.0	79.0	0.484663	NM_030882	B0QYK7|O95915|Q59GW9|Q5TH96|Q969T6|Q9BT28|Q9UGT1|Q9UH10	Silent	SNP	ENST00000249066.6	37	CCDS43014.1																																																																																			.	.	none		0.562	APOL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319279.1	NM_145637	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		Atlas-SNP	.											.	ZNF814	93	.	0			c.C968A						PASS	.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	238.0	0.0	0		363.0	57.0	0.157025	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
HIST1H2BD	3017	hgsc.bcm.edu	37	6	26158724	26158724	+	Silent	SNP	G	G	A			TCGA-GS-A9TT-01A-11D-A382-10	TCGA-GS-A9TT-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e6b849d0-569e-4f4a-aba6-25227d709267	ddddacd6-a277-4d16-bc20-4201b0fe2008	g.chr6:26158724G>A	ENST00000289316.2	+	1	351	c.327G>A	c.(325-327)aaG>aaA	p.K109K	HIST1H2BD_ENST00000377777.4_Silent_p.K109K	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	109					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						AGCTGGCCAAGCACGCCGTGT	0.587																																					p.K109K		Atlas-SNP	.											.	HIST1H2BD	45	.	0			c.G327A						PASS	.						73.0	80.0	78.0					6																	26158724		2203	4300	6503	SO:0001819	synonymous_variant	3017	exon1			GGCCAAGCACGCC	M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.327G>A	6.37:g.26158724G>A		127.0	0.0	0		110.0	48.0	0.436364	NM_021063		Silent	SNP	ENST00000289316.2	37	CCDS4587.1																																																																																			.	.	none		0.587	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040088.1	NM_021063	
