#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BMP3	651	hgsc.bcm.edu	37	4	81967644	81967644	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr4:81967644delA	ENST00000282701.2	+	2	1389	c.1069delA	c.(1069-1071)aaafs	p.K358fs		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	358					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						GCAGACCCTGAAAAAGGCAAG	0.478																																					p.L356fs		Atlas-Indel	.											.	BMP3	59	.	0			c.1068delG						PASS	.						74.0	71.0	72.0					4																	81967644		2203	4300	6503	SO:0001589	frameshift_variant	651	exon2			.	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.1069delA	4.37:g.81967644delA	ENSP00000282701:p.Lys358fs	135.0	0.0	0		115.0	19.0	0.165217	NM_001201	Q4VAS5	Frame_Shift_Del	DEL	ENST00000282701.2	37	CCDS3588.1																																																																																			.	.	none		0.478	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1		
ANKRD11	29123	hgsc.bcm.edu	37	16	89351721	89351722	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr16:89351721_89351722insT	ENST00000301030.4	-	9	1688_1689	c.1228_1229insA	c.(1228-1230)acgfs	p.T410fs	ANKRD11_ENST00000378330.2_Frame_Shift_Ins_p.T410fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	410					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTCGTCCGACGTGTCTGACAGG	0.47																																					p.T410fs		Pindel,Atlas-Indel	.											.	ANKRD11	195	.	0			c.1229_1230insA						PASS	.																																			SO:0001589	frameshift_variant	29123	exon9			.	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1229dupA	16.37:g.89351722_89351722dupT	ENSP00000301030:p.Thr410fs	180.0	0.0	.		181.0	30.0	0.166	NM_001256183	Q6NTG1|Q6QMF8	Frame_Shift_Ins	INS	ENST00000301030.4	37	CCDS32513.1																																																																																			.	.	none		0.470	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
SETD1B	23067	hgsc.bcm.edu	37	12	122248124	122248125	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr12:122248124_122248125delAG	ENST00000604567.1	+	6	1341_1342	c.1273_1274delAG	c.(1273-1275)agtfs	p.S425fs	SETD1B_ENST00000267197.5_Frame_Shift_Del_p.S425fs|SETD1B_ENST00000542440.1_Frame_Shift_Del_p.S425fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	425	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GGCCCGCGACAGTGGGGAGTTC	0.703																																					p.424_425del		Atlas-Indel	.											.	SETD1B	105	.	0			c.1272_1273del						PASS	.																																			SO:0001589	frameshift_variant	23067	exon5			.	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1273_1274delAG	12.37:g.122248124_122248125delAG	ENSP00000474253:p.Ser425fs	62.0	0.0	0		38.0	10.0	0.263158	NM_015048	F6MFW1	Frame_Shift_Del	DEL	ENST00000604567.1	37																																																																																				.	.	none		0.703	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
OR6C74	254783	hgsc.bcm.edu	37	12	55641766	55641767	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr12:55641766_55641767insA	ENST00000343870.4	+	1	785_786	c.695_696insA	c.(694-699)agaaaafs	p.RK232fs		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						TCTCAACAGAGAAAAAAAGCAT	0.401																																					p.R232fs		Atlas-Indel	.											.	OR6C74	52	.	0			c.695_696insA						PASS	.																																			SO:0001589	frameshift_variant	254783	exon1			.		CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.702dupA	12.37:g.55641773_55641773dupA	ENSP00000342836:p.Arg232fs	172.0	0.0	0		178.0	35.0	0.196629	NM_001005490		Frame_Shift_Ins	INS	ENST00000343870.4	37	CCDS31816.1																																																																																			.	.	none		0.401	OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1		
SCN1A	6323	hgsc.bcm.edu	37	2	166930005	166930006	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:166930005_166930006insT	ENST00000303395.4	-	1	125_126	c.126_127insA	c.(124-129)aaagatfs	p.D43fs	SCN1A_ENST00000375405.3_Frame_Shift_Ins_p.D43fs|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Frame_Shift_Ins_p.D43fs|SCN1A_ENST00000423058.2_Frame_Shift_Ins_p.D43fs|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	43					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.K42N(4)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCGTCGTCATCTTTTTTGTCTG	0.446																																					p.D43fs		Pindel,Atlas-Indel	.											.	SCN1A	641	.	4	Substitution - Missense(4)	lung(4)	c.127_128insA						PASS	.																																			SO:0001589	frameshift_variant	6323	exon1			.	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.127dupA	2.37:g.166930011_166930011dupT	ENSP00000303540:p.Asp43fs	377.0	0.0	.		338.0	51.0	0.151	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Frame_Shift_Ins	INS	ENST00000303395.4	37	CCDS54413.1																																																																																			.	.	none		0.446	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
EXOSC10	5394	hgsc.bcm.edu	37	1	11132231	11132403	+	Intron	DEL	ATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA	ATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA	-	rs141236631|rs540446773|rs185746441|rs543623805|rs112859827	byFrequency	TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	ATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA	ATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr1:11132231_11132403delATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA	ENST00000376936.4	-	20	2207				EXOSC10_ENST00000304457.7_Intron|EXOSC10_ENST00000544779.1_Intron|RP4-635E18.7_ENST00000452378.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		TTGCTGATCTATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAAAATCCCTATT	0.41																																					.	Colon(179;105 1987 14326 27364 29542)	Pindel	.											.	EXOSC10	59	.	0			.						PASS	.																																			SO:0001627	intron_variant	5394	.			.	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.2158-3TTAGCAATAAAGCCAGCATGAAATTTATTTTTCATGCCCTTAGATTTGAAAATTTATGACTTAGAATGTGTGTACTTCTTAGGTTAACCTGCCCTTCGTCACCTCATGAAAAGTAAGACAGACTTAGGTGGCTGACTTTGGAGGGTTTTTTTTGTTATATTTGCTTTCATTAT>-	1.37:g.11132231_11132403delATAATGAAAGCAAATATAACAAAAAAAACCCTCCAAAGTCAGCCACCTAAGTCTGTCTTACTTTTCATGAGGTGACGAAGGGCAGGTTAACCTAAGAAGTACACACATTCTAAGTCATAAATTTTCAAATCTAAGGGCATGAAAAATAAATTTCATGCTGGCTTTATTGCTAA		49.0	0.0	.		44.0	11.0	0.250	.	B1AKQ0|B1AKQ1|Q15158	Splice_Site	DEL	ENST00000376936.4	37	CCDS30584.1																																																																																			.	.	none		0.410	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
ICT1	3396	hgsc.bcm.edu	37	17	73008803	73008803	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:73008803C>G	ENST00000301585.5	+	1	35	c.22C>G	c.(22-24)Cgc>Ggc	p.R8G		NM_001545.1	NP_001536.1	Q14197	ICT1_HUMAN	immature colon carcinoma transcript 1	8			R -> P (in dbSNP:rs3744206).		mitochondrial translational termination (GO:0070126)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|translation release factor activity, codon nonspecific (GO:0016150)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)|urinary_tract(1)	6	all_lung(278;0.226)					CAGGTGCCTGCGCTGGGGCCT	0.697											OREG0024724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R8G		Atlas-SNP	.											ICT1,NS,carcinoma,-1,1	ICT1	17	1	0			c.C22G						PASS	.						10.0	9.0	9.0					17																	73008803		2150	4208	6358	SO:0001583	missense	3396	exon1			TGCCTGCGCTGGG	X81788	CCDS11711.1	17q25	2014-02-12				ENSG00000167862			5359	protein-coding gene	gene with protein product		603000				8575443, 20186120	Standard	NM_001545		Approved	DS-1	uc002jmm.3	Q14197		ENST00000301585.5:c.22C>G	17.37:g.73008803C>G	ENSP00000301585:p.Arg8Gly	40.0	0.0	0	1142	35.0	7.0	0.2	NM_001545	B2RAD1|Q53HM7|Q53Y11	Missense_Mutation	SNP	ENST00000301585.5	37	CCDS11711.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.274396	0.23307	.	.	ENSG00000167862	ENST00000301585	T	0.26810	1.71	5.58	4.33	0.51752	.	0.565130	0.17342	N	0.177719	T	0.17789	0.0427	N	0.24115	0.695	0.09310	N	0.999997	B	0.28055	0.199	B	0.24974	0.057	T	0.16158	-1.0412	10	0.62326	D	0.03	-4.1944	10.3113	0.43710	0.0:0.8818:0.0:0.1182	.	8	Q14197	ICT1_HUMAN	G	8	ENSP00000301585:R8G	ENSP00000301585:R8G	R	+	1	0	ICT1	70520398	0.002000	0.14202	0.649000	0.29536	0.023000	0.10783	0.523000	0.22925	0.962000	0.38057	0.655000	0.94253	CGC	.	.	none		0.697	ICT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445314.1	NM_001545	
NACAD	23148	hgsc.bcm.edu	37	7	45125119	45125119	+	Silent	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr7:45125119G>A	ENST00000490531.2	-	2	679	c.660C>T	c.(658-660)taC>taT	p.Y220Y		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	220					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CGGCCGTAATGTAGGAGCCCG	0.687																																					p.Y220Y		Atlas-SNP	.											.	NACAD	44	.	0			c.C660T						PASS	.						21.0	29.0	26.0					7																	45125119		692	1591	2283	SO:0001819	synonymous_variant	23148	exon2			CGTAATGTAGGAG	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.660C>T	7.37:g.45125119G>A		74.0	0.0	0		84.0	15.0	0.178571	NM_001146334		Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																			.	.	none		0.687	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
CYP4F12	66002	hgsc.bcm.edu	37	19	15794330	15794330	+	Silent	SNP	C	C	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:15794330C>A	ENST00000550308.1	+	7	1055	c.675C>A	c.(673-675)atC>atA	p.I225I	CYP4F12_ENST00000324632.10_Silent_p.I225I	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	225					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	TTGCCACCATCTTGGAGCTCA	0.542																																					p.I225I		Atlas-SNP	.											.	CYP4F12	89	.	0			c.C675A						PASS	.						71.0	71.0	71.0					19																	15794330		2201	4300	6501	SO:0001819	synonymous_variant	66002	exon7			CACCATCTTGGAG	AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.675C>A	19.37:g.15794330C>A		111.0	0.0	0		96.0	20.0	0.208333	NM_023944	E7ET51|O60389|Q5JPJ7|Q9HCS1	Silent	SNP	ENST00000550308.1	37	CCDS42517.1																																																																																			.	.	none		0.542	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378938.9		
ZNF285	26974	hgsc.bcm.edu	37	19	44891217	44891217	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:44891217T>C	ENST00000330997.4	-	4	1254	c.1190A>G	c.(1189-1191)gAg>gGg	p.E397G	ZNF285_ENST00000544719.2_Missense_Mutation_p.E397G|ZNF285_ENST00000591679.1_Missense_Mutation_p.E404G|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E397G(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GTAGGGCTTCTCTCCAGTGTG	0.483																																					p.E397G		Atlas-SNP	.											ZNF285,NS,carcinoma,0,2	ZNF285	86	2	2	Substitution - Missense(2)	prostate(2)	c.A1190G						scavenged	.						57.0	56.0	57.0					19																	44891217		2203	4300	6503	SO:0001583	missense	26974	exon4			GGCTTCTCTCCAG	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1190A>G	19.37:g.44891217T>C	ENSP00000333595:p.Glu397Gly	76.0	1.0	0.0131579		92.0	4.0	0.0434783	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812415	0.70912	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.27557	1.66	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53012	0.1770	M	0.75150	2.29	0.34602	D	0.716652	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.933	T	0.67393	-0.5682	9	0.87932	D	0	.	11.1099	0.48226	0.0:0.0:0.0:1.0	.	421;397	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	420;397	ENSP00000333595:E397G	ENSP00000333595:E397G	E	-	2	0	ZNF285	49583057	1.000000	0.71417	0.745000	0.31077	0.941000	0.58515	7.429000	0.80309	1.308000	0.44962	0.248000	0.18094	GAG	.	.	none		0.483	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
SUPT6H	6830	hgsc.bcm.edu	37	17	27016480	27016480	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:27016480G>T	ENST00000314616.6	+	25	3526	c.3243G>T	c.(3241-3243)gaG>gaT	p.E1081D	SUPT6H_ENST00000347486.4_Missense_Mutation_p.E1081D	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1081	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AATCAGCCGAGGATGCCAATC	0.517																																					p.E1081D		Atlas-SNP	.											.	SUPT6H	165	.	0			c.G3243T						PASS	.						97.0	87.0	90.0					17																	27016480		2203	4300	6503	SO:0001583	missense	6830	exon25			AGCCGAGGATGCC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3243G>T	17.37:g.27016480G>T	ENSP00000319104:p.Glu1081Asp	80.0	0.0	0		88.0	4.0	0.0454545	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160282	0.38119	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.61	1.4	0.22301	Tex RuvX-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	L	0.43554	1.36	0.80722	D	1	P	0.37688	0.605	B	0.30401	0.115	T	0.09357	-1.0678	9	0.30854	T	0.27	-23.0781	9.5962	0.39576	0.3447:0.0:0.6553:0.0	.	1081	Q7KZ85	SPT6H_HUMAN	D	1081	.	ENSP00000319104:E1081D	E	+	3	2	SUPT6H	24040607	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.535000	0.23114	0.314000	0.23086	0.655000	0.94253	GAG	.	.	none		0.517	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
ASAP3	55616	hgsc.bcm.edu	37	1	23779193	23779193	+	Silent	SNP	T	T	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr1:23779193T>C	ENST00000336689.3	-	4	464	c.420A>G	c.(418-420)cgA>cgG	p.R140R	ASAP3_ENST00000437606.2_Silent_p.R140R	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	140					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						GACTCACCTGTCGACCGTCCC	0.577																																					p.R140R		Atlas-SNP	.											.	ASAP3	65	.	0			c.A420G						PASS	.						184.0	173.0	177.0					1																	23779193		2203	4300	6503	SO:0001819	synonymous_variant	55616	exon4			CACCTGTCGACCG	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.420A>G	1.37:g.23779193T>C		94.0	0.0	0		71.0	14.0	0.197183	NM_001143778	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	ENST00000336689.3	37	CCDS235.1																																																																																			.	.	none		0.577	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
APEH	327	hgsc.bcm.edu	37	3	49718542	49718542	+	Silent	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:49718542G>A	ENST00000296456.5	+	15	1708	c.1308G>A	c.(1306-1308)ggG>ggA	p.G436G	APEH_ENST00000438011.1_Silent_p.G436G	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	436					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGAAAGTTGGGTTCCTGCCTT	0.597																																					p.G436G		Atlas-SNP	.											.	APEH	45	.	0			c.G1308A						PASS	.						113.0	105.0	108.0					3																	49718542		2203	4300	6503	SO:0001819	synonymous_variant	327	exon15			AGTTGGGTTCCTG	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1308G>A	3.37:g.49718542G>A		94.0	0.0	0		65.0	20.0	0.307692	NM_001640	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	37	CCDS2801.1																																																																																			.	.	none		0.597	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
MUC13	56667	hgsc.bcm.edu	37	3	124646710	124646710	+	Silent	SNP	T	T	A	rs76825834		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:124646710T>A	ENST00000311075.3	-	2	218	c.180A>T	c.(178-180)acA>acT	p.T60T	MUC13_ENST00000497378.1_5'Flank	NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	60	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						TTGGGAAAGGTGTATTTGCTG	0.458																																					p.T60T		Atlas-SNP	.											.	MUC13	57	.	0			c.A180T						PASS	.						214.0	213.0	213.0					3																	124646710		2203	4300	6503	SO:0001819	synonymous_variant	56667	exon2			GAAAGGTGTATTT	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.180A>T	3.37:g.124646710T>A		123.0	0.0	0		121.0	7.0	0.0578512	NM_033049	Q6UWD9|Q9NXT5	Silent	SNP	ENST00000311075.3	37																																																																																				.	.	weak		0.458	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000355714.1	NM_033049	
ZNF804B	219578	hgsc.bcm.edu	37	7	88963200	88963200	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr7:88963200A>C	ENST00000333190.4	+	4	1513	c.904A>C	c.(904-906)Att>Ctt	p.I302L		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	302							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAACTCTAAAATTTTGCAAGA	0.343										HNSCC(36;0.09)																											p.I302L		Atlas-SNP	.											ZNF804B,NS,carcinoma,0,1	ZNF804B	322	1	0			c.A904C						PASS	.						51.0	52.0	51.0					7																	88963200		2203	4299	6502	SO:0001583	missense	219578	exon4			TCTAAAATTTTGC	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.904A>C	7.37:g.88963200A>C	ENSP00000329638:p.Ile302Leu	132.0	0.0	0		160.0	37.0	0.23125	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	2.668	-0.278204	0.05679	.	.	ENSG00000182348	ENST00000333190	T	0.05081	3.5	5.14	-1.67	0.08238	.	0.708385	0.13164	N	0.408832	T	0.03959	0.0111	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.42949	-0.9421	10	0.22706	T	0.39	-4.674	2.5809	0.04818	0.4096:0.3386:0.1418:0.11	.	302	A4D1E1	Z804B_HUMAN	L	302	ENSP00000329638:I302L	ENSP00000329638:I302L	I	+	1	0	ZNF804B	88801136	0.140000	0.22579	0.018000	0.16275	0.236000	0.25371	1.179000	0.31993	-0.158000	0.11040	0.533000	0.62120	ATT	.	.	none		0.343	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
FLNC	2318	hgsc.bcm.edu	37	7	128475620	128475620	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr7:128475620G>A	ENST00000325888.8	+	2	854	c.593G>A	c.(592-594)tGc>tAc	p.C198Y	FLNC_ENST00000346177.6_Missense_Mutation_p.C198Y	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	198	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGGACAACTGCGCCCCCGGT	0.622																																					p.C198Y		Atlas-SNP	.											.	FLNC	339	.	0			c.G593A						PASS	.						33.0	38.0	37.0					7																	128475620		2072	4218	6290	SO:0001583	missense	2318	exon2			ACAACTGCGCCCC	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.593G>A	7.37:g.128475620G>A	ENSP00000327145:p.Cys198Tyr	23.0	0.0	0		40.0	19.0	0.475	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815232	0.70912	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.93763	-3.28;-3.28	5.63	5.63	0.86233	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.95085	0.8408	L	0.35854	1.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95581	0.8646	10	0.87932	D	0	.	18.6585	0.91463	0.0:0.0:1.0:0.0	.	198;198	Q14315-2;Q14315	.;FLNC_HUMAN	Y	198	ENSP00000327145:C198Y;ENSP00000344002:C198Y	ENSP00000327145:C198Y	C	+	2	0	FLNC	128262856	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	9.869000	0.99810	2.659000	0.90383	0.561000	0.74099	TGC	.	.	none		0.622	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
CCDC60	160777	hgsc.bcm.edu	37	12	119942901	119942901	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr12:119942901C>T	ENST00000327554.2	+	7	1141	c.676C>T	c.(676-678)Cga>Tga	p.R226*	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	226										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TCCCACAATGCGAGTCACCAA	0.517																																					p.R226X		Atlas-SNP	.											.	CCDC60	84	.	0			c.C676T						PASS	.						56.0	62.0	60.0					12																	119942901		2203	4300	6503	SO:0001587	stop_gained	160777	exon7			ACAATGCGAGTCA	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.676C>T	12.37:g.119942901C>T	ENSP00000333374:p.Arg226*	49.0	0.0	0		50.0	10.0	0.2	NM_178499		Nonsense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	C	39	7.310390	0.98203	.	.	ENSG00000183273	ENST00000327554	.	.	.	5.07	5.07	0.68467	.	0.000000	0.45867	D	0.000322	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.7268	13.9816	0.64308	0.0:1.0:0.0:0.0	.	.	.	.	X	226	.	.	R	+	1	2	CCDC60	118427284	0.888000	0.30383	0.020000	0.16555	0.003000	0.03518	3.549000	0.53681	2.340000	0.79590	0.650000	0.86243	CGA	.	.	none		0.517	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
CPS1	1373	hgsc.bcm.edu	37	2	211464275	211464275	+	Silent	SNP	T	T	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:211464275T>C	ENST00000233072.5	+	14	1735	c.1539T>C	c.(1537-1539)gcT>gcC	p.A513A	CPS1_ENST00000430249.2_Silent_p.A519A|CPS1_ENST00000451903.2_Silent_p.A62A	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	513					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GCCAGACAGCTCTGAACTGTG	0.428																																					p.A519A		Atlas-SNP	.											.	CPS1	485	.	0			c.T1557C						PASS	.						114.0	117.0	116.0					2																	211464275		2203	4300	6503	SO:0001819	synonymous_variant	1373	exon15			GACAGCTCTGAAC	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1539T>C	2.37:g.211464275T>C		125.0	0.0	0		116.0	24.0	0.206897	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	T	9.241	1.038216	0.19669	.	.	ENSG00000021826	ENST00000536125	.	.	.	5.17	3.93	0.45458	.	.	.	.	.	T	0.66703	0.2816	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70539	-0.4844	5	0.87932	D	0	-26.7793	11.0084	0.47649	0.0:0.0:0.2859:0.7141	.	.	.	.	P	513	.	ENSP00000445539:L513P	L	+	2	0	CPS1	211172520	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.051000	0.30417	2.084000	0.62774	0.374000	0.22700	CTC	.	.	none		0.428	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
PRAMEF4	400735	hgsc.bcm.edu	37	1	12943023	12943023	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr1:12943023G>A	ENST00000235349.5	-	2	263	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	65					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGGGAGGCGGCGGAAGGGC	0.602																																					p.R65C		Atlas-SNP	.											.	PRAMEF4	62	.	0			c.C193T						PASS	.						39.0	45.0	43.0					1																	12943023		2186	4267	6453	SO:0001583	missense	400735	exon2			GGAGGCGGCGGAA		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.193C>T	1.37:g.12943023G>A	ENSP00000235349:p.Arg65Cys	203.0	0.0	0		195.0	49.0	0.251282	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	g	3.809	-0.040112	0.07497	.	.	ENSG00000243073	ENST00000235349	T	0.05258	3.47	1.48	-0.647	0.11468	.	1.582610	0.03465	N	0.212854	T	0.03220	0.0094	N	0.05330	-0.07	0.09310	N	1	B	0.17038	0.02	B	0.13407	0.009	T	0.40664	-0.9551	10	0.14656	T	0.56	.	3.9166	0.09225	0.5068:0.0:0.4932:0.0	.	65	O60810	PRAM4_HUMAN	C	65	ENSP00000235349:R65C	ENSP00000235349:R65C	R	-	1	0	PRAMEF4	12865610	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.260000	0.02858	-0.198000	0.10333	-0.498000	0.04607	CGC	.	.	none		0.602	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PKMYT1	9088	hgsc.bcm.edu	37	16	3026927	3026927	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr16:3026927A>T	ENST00000262300.8	-	3	624	c.116T>A	c.(115-117)tTc>tAc	p.F39Y	PKMYT1_ENST00000573944.1_Missense_Mutation_p.F30Y|PKMYT1_ENST00000431515.2_Missense_Mutation_p.F39Y|PKMYT1_ENST00000574730.1_Intron|PKMYT1_ENST00000440027.2_Missense_Mutation_p.F39Y|PKMYT1_ENST00000574385.1_Missense_Mutation_p.F30Y	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	39	Pro-rich.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CTTGAGGGAGAATCCAGGTTC	0.692																																					p.F39Y		Atlas-SNP	.											.	PKMYT1	23	.	0			c.T116A						PASS	.						11.0	15.0	14.0					16																	3026927		2106	4183	6289	SO:0001583	missense	9088	exon3			AGGGAGAATCCAG	AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.116T>A	16.37:g.3026927A>T	ENSP00000262300:p.Phe39Tyr	92.0	0.0	0		69.0	22.0	0.318841	NM_182687	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000262300.8	37	CCDS10486.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472280	0.84533	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.61274	0.12;0.2;0.25;0.29	5.68	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	M	0.63843	1.955	0.38873	D	0.956743	D;D;D	0.76494	0.999;0.996;0.998	D;P;D	0.63488	0.913;0.824;0.915	T	0.72906	-0.4150	10	0.72032	D	0.01	-19.7116	10.9777	0.47475	0.843:0.157:0.0:0.0	.	30;39;39	A6NHV6;Q99640;F8W164	.;PMYT1_HUMAN;.	Y	39;39;39;39;30	ENSP00000392855:F39Y;ENSP00000262300:F39Y;ENSP00000397739:F39Y;ENSP00000371675:F30Y	ENSP00000262300:F39Y	F	-	2	0	PKMYT1	2966928	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.755000	0.68750	0.938000	0.37419	0.533000	0.62120	TTC	.	.	none		0.692	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250963.2	NM_004203	
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M		Atlas-SNP	.											RHPN2,face,carcinoma,0,2	RHPN2	107	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A						scavenged	.						84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met	23.0	1.0	0.0434783		24.0	3.0	0.125	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG	.	.	none		0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
GCM2	9247	hgsc.bcm.edu	37	6	10875031	10875031	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr6:10875031C>T	ENST00000379491.4	-	5	865	c.718G>A	c.(718-720)Gtt>Att	p.V240I	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	240					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				GCTTTGTAAACATCAGACTTT	0.463																																					p.V240I		Atlas-SNP	.											.	GCM2	81	.	0			c.G718A						PASS	.						135.0	127.0	130.0					6																	10875031		2203	4300	6503	SO:0001583	missense	9247	exon5			TGTAAACATCAGA	AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.718G>A	6.37:g.10875031C>T	ENSP00000368805:p.Val240Ile	126.0	0.0	0		91.0	31.0	0.340659	NM_004752	D3GDV6|Q5THN5	Missense_Mutation	SNP	ENST00000379491.4	37	CCDS4517.1	.	.	.	.	.	.	.	.	.	.	C	9.809	1.182644	0.21870	.	.	ENSG00000124827	ENST00000379491	T	0.67865	-0.29	5.8	2.96	0.34315	.	0.437579	0.28125	N	0.016504	T	0.31949	0.0813	N	0.22421	0.69	0.80722	D	1	B	0.17038	0.02	B	0.14023	0.01	T	0.15150	-1.0447	10	0.37606	T	0.19	-1.735	9.5725	0.39436	0.1966:0.5631:0.2402:0.0	.	240	O75603	GCM2_HUMAN	I	240	ENSP00000368805:V240I	ENSP00000368805:V240I	V	-	1	0	GCM2	10983017	0.770000	0.28543	0.896000	0.35187	0.796000	0.44982	0.359000	0.20233	0.807000	0.34208	-0.824000	0.03097	GTT	.	.	none		0.463	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039844.1		
THRA	7067	hgsc.bcm.edu	37	17	38244519	38244519	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:38244519C>T	ENST00000264637.4	+	8	1328	c.748C>T	c.(748-750)Ctc>Ttc	p.L250F	THRA_ENST00000450525.2_Missense_Mutation_p.L250F|THRA_ENST00000394121.4_Missense_Mutation_p.L250F|THRA_ENST00000584985.1_Missense_Mutation_p.L250F|THRA_ENST00000546243.1_Missense_Mutation_p.L250F	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	250	Ligand-binding.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCAGATCATCCTCCTGAAGGG	0.627																																					p.L250F		Atlas-SNP	.											.	THRA	88	.	0			c.C748T						PASS	.						77.0	64.0	68.0					17																	38244519		2203	4300	6503	SO:0001583	missense	7067	exon8			ATCATCCTCCTGA	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.748C>T	17.37:g.38244519C>T	ENSP00000264637:p.Leu250Phe	63.0	0.0	0		47.0	12.0	0.255319	NM_001190918	A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	37	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	c	21.8	4.208826	0.79240	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93	4.97	3.78	0.43462	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.99137	0.9702	H	0.94886	3.595	0.51767	D	0.999938	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.995	D	0.98698	1.0699	10	0.87932	D	0	.	13.2085	0.59811	0.0:0.9048:0.0:0.0952	.	250;250;250	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	F	250	ENSP00000377679:L250F;ENSP00000264637:L250F;ENSP00000395641:L250F;ENSP00000443972:L250F	ENSP00000264637:L250F	L	+	1	0	THRA	35498045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.833000	0.62766	2.304000	0.77564	0.486000	0.48141	CTC	.	.	none		0.627	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2		
SLC17A4	10050	hgsc.bcm.edu	37	6	25771240	25771240	+	Splice_Site	SNP	G	G	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr6:25771240G>C	ENST00000377905.4	+	6	825	c.706G>C	c.(706-708)Gga>Cga	p.G236R	SLC17A4_ENST00000439485.2_Intron|SLC17A4_ENST00000397076.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	236					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTATATCTTTGGTGAGTGTGC	0.403																																					p.G236R		Atlas-SNP	.											.	SLC17A4	79	.	0			c.G706C						PASS	.						235.0	222.0	226.0					6																	25771240		2203	4300	6503	SO:0001630	splice_region_variant	10050	exon6			ATCTTTGGTGAGT	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.706+1G>C	6.37:g.25771240G>C		246.0	0.0	0		209.0	53.0	0.253589	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686492	0.88639	.	.	ENSG00000146039	ENST00000377905	T	0.63096	-0.02	5.56	5.56	0.83823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.50627	D	0.000113	D	0.84777	0.5547	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89223	0.3572	10	0.87932	D	0	.	15.3921	0.74755	0.0:0.0:1.0:0.0	.	236	Q9Y2C5	S17A4_HUMAN	R	236	ENSP00000367137:G236R	ENSP00000367137:G236R	G	+	1	0	SLC17A4	25879219	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.752000	0.74898	2.791000	0.96007	0.563000	0.77884	GGA	.	.	none		0.403	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		Missense_Mutation
AGTR1	185	hgsc.bcm.edu	37	3	148459567	148459567	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:148459567T>G	ENST00000497524.1	+	2	1136	c.745T>G	c.(745-747)Ttt>Gtt	p.F249V	AGTR1_ENST00000542281.1_Missense_Mutation_p.F249V|AGTR1_ENST00000461609.1_Missense_Mutation_p.F249V|AGTR1_ENST00000418473.2_Missense_Mutation_p.F249V|AGTR1_ENST00000475347.1_Missense_Mutation_p.F249V|AGTR1_ENST00000474935.1_Missense_Mutation_p.F249V|AGTR1_ENST00000402260.1_Missense_Mutation_p.F249V|AGTR1_ENST00000349243.3_Missense_Mutation_p.F249V|AGTR1_ENST00000404754.2_Missense_Mutation_p.F249V	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	249					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TGTGCTTTTCTTTTTCTTTTC	0.343																																					p.F284V		Atlas-SNP	.											.	AGTR1	63	.	0			c.T850G						PASS	.						55.0	59.0	58.0					3																	148459567		2203	4300	6503	SO:0001583	missense	185	exon4			CTTTTCTTTTTCT	M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.745T>G	3.37:g.148459567T>G	ENSP00000419422:p.Phe249Val	92.0	0.0	0		129.0	28.0	0.217054	NM_031850	Q13725|Q8TBK4	Missense_Mutation	SNP	ENST00000497524.1	37	CCDS3137.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.128394	0.77549	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82151	-0.0599	10	0.87932	D	0	-19.2182	15.6059	0.76672	0.0:0.0:0.0:1.0	.	249	P30556	AGTR1_HUMAN	V	249	ENSP00000419422:F249V;ENSP00000273430:F249V;ENSP00000443186:F249V;ENSP00000398832:F249V;ENSP00000385612:F249V;ENSP00000419783:F249V;ENSP00000418084:F249V;ENSP00000418851:F249V;ENSP00000385641:F249V	ENSP00000273430:F249V	F	+	1	0	AGTR1	149942257	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.081000	0.62600	0.533000	0.62120	TTT	.	.	none		0.343	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355807.1		
ZC3H12A	80149	hgsc.bcm.edu	37	1	37947259	37947259	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr1:37947259G>A	ENST00000373087.6	+	4	757	c.641G>A	c.(640-642)cGa>cAa	p.R214Q		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ACACCATCACGACGCGTGGGT	0.587																																					p.R214Q		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.G641A						PASS	.						254.0	225.0	235.0					1																	37947259		2203	4300	6503	SO:0001583	missense	80149	exon4			CATCACGACGCGT		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.641G>A	1.37:g.37947259G>A	ENSP00000362179:p.Arg214Gln	95.0	0.0	0		74.0	12.0	0.162162	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	G	35	5.518547	0.96416	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.44482	0.92	5.65	5.65	0.86999	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70637	-0.4817	10	0.56958	D	0.05	-36.0527	19.7405	0.96228	0.0:0.0:1.0:0.0	.	214	Q5D1E8	ZC12A_HUMAN	Q	214	ENSP00000362179:R214Q	ENSP00000362174:R214Q	R	+	2	0	ZC3H12A	37719846	1.000000	0.71417	0.478000	0.27316	0.805000	0.45488	9.807000	0.99171	2.655000	0.90218	0.655000	0.94253	CGA	.	.	none		0.587	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
ISYNA1	51477	hgsc.bcm.edu	37	19	18546466	18546466	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:18546466C>T	ENST00000338128.8	-	9	1378	c.1161G>A	c.(1159-1161)ccG>ccA	p.P387P	ISYNA1_ENST00000545187.1_Silent_p.P237P|ISYNA1_ENST00000578963.1_Silent_p.P259P|ISYNA1_ENST00000457269.4_Silent_p.P333P|ISYNA1_ENST00000317018.6_Silent_p.P185P	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	387					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						CACCCACGTACGGCACATACT	0.672																																					p.P387P		Atlas-SNP	.											.	ISYNA1	31	.	0			c.G1161A						PASS	.						60.0	46.0	51.0					19																	18546466		2201	4300	6501	SO:0001819	synonymous_variant	51477	exon9			CACGTACGGCACA		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1161G>A	19.37:g.18546466C>T		63.0	0.0	0		60.0	17.0	0.283333	NM_016368	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Silent	SNP	ENST00000338128.8	37	CCDS12379.1																																																																																			.	.	none		0.672	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	
ZBBX	79740	hgsc.bcm.edu	37	3	167033615	167033615	+	Silent	SNP	A	A	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:167033615A>G	ENST00000392766.2	-	15	1537	c.1197T>C	c.(1195-1197)acT>acC	p.T399T	ZBBX_ENST00000307529.5_Silent_p.T399T|ZBBX_ENST00000392764.1_Silent_p.T370T|ZBBX_ENST00000392767.2_Silent_p.T399T|ZBBX_ENST00000455345.2_Silent_p.T399T|ZBBX_ENST00000469220.1_5'Flank	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	399						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CCTCTTCATAAGTCttattaa	0.269																																					p.T399T		Atlas-SNP	.											.	ZBBX	299	.	0			c.T1197C						PASS	.						39.0	37.0	37.0					3																	167033615		1783	4053	5836	SO:0001819	synonymous_variant	79740	exon15			TTCATAAGTCTTA	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1197T>C	3.37:g.167033615A>G		524.0	0.0	0		570.0	104.0	0.182456	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	ENST00000392766.2	37	CCDS3199.2																																																																																			.	.	none		0.269	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
DSC2	1824	hgsc.bcm.edu	37	18	28662381	28662381	+	Silent	SNP	T	T	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr18:28662381T>G	ENST00000280904.6	-	9	1529	c.1086A>C	c.(1084-1086)acA>acC	p.T362T	DSC2_ENST00000251081.6_Silent_p.T362T	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	362	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CTTCCACTGATGTCACATACT	0.318																																					p.T362T		Atlas-SNP	.											DSC2_ENST00000251081,NS,carcinoma,0,2	DSC2	168	2	0			c.A1086C						PASS	.						69.0	66.0	67.0					18																	28662381		2200	4299	6499	SO:0001819	synonymous_variant	1824	exon9			CACTGATGTCACA	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1086A>C	18.37:g.28662381T>G		140.0	0.0	0		221.0	27.0	0.122172	NM_024422		Silent	SNP	ENST00000280904.6	37	CCDS11892.1																																																																																			.	.	none		0.318	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
DYSF	8291	hgsc.bcm.edu	37	2	71778761	71778761	+	Missense_Mutation	SNP	C	C	T	rs377735262		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:71778761C>T	ENST00000258104.3	+	19	1940	c.1663C>T	c.(1663-1665)Cgg>Tgg	p.R555W	DYSF_ENST00000409744.1_Missense_Mutation_p.R542W|DYSF_ENST00000409366.1_Missense_Mutation_p.R556W|DYSF_ENST00000409762.1_Missense_Mutation_p.R572W|DYSF_ENST00000394120.2_Missense_Mutation_p.R556W|DYSF_ENST00000410020.3_Missense_Mutation_p.R573W|DYSF_ENST00000409651.1_Missense_Mutation_p.R587W|DYSF_ENST00000410041.1_Missense_Mutation_p.R573W|DYSF_ENST00000409582.3_Missense_Mutation_p.R572W|DYSF_ENST00000429174.2_Missense_Mutation_p.R555W|DYSF_ENST00000413539.2_Missense_Mutation_p.R586W	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	555			R -> W (in isolated hyperCKemia, LGMD2B and MMD1). {ECO:0000269|PubMed:16010686, ECO:0000269|PubMed:18853459}.		plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TTATCGTGGCCGGCTTCTGCT	0.637																																					p.R587W		Atlas-SNP	.											.	DYSF	536	.	0			c.C1759T	GRCh37	CM053205	DYSF	M		PASS	.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	52.0	45.0	47.0		1666,1621,1621,1663,1756,1714,1714,1759,1666,1624,1717,1624,1717,1663	4.6	1.0	2		47	1,8593		0,1,4296	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	101,101,101,101,101,101,101,101,101,101,101,101,101,101	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	556/2082,541/2067,541/2088,555/2102,586/2112,572/2098,572/2119,587/2113,556/2103,542/2089,573/2099,542/2068,573/2120,555/2081	71778761	1,12999	2203	4297	6500	SO:0001583	missense	8291	exon20			CGTGGCCGGCTTC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1663C>T	2.37:g.71778761C>T	ENSP00000258104:p.Arg555Trp	50.0	0.0	0		53.0	16.0	0.301887	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228105	0.79576	0.0	1.16E-4	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.94232	-3.11;-3.38;-3.38;-3.06;-3.05;-3.11;-3.04;-3.32;-3.05;-3.38;-3.37	5.47	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.97002	0.9021	M	0.89534	3.04	0.58432	D	0.999996	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D	0.97395	0.9992	10	0.87932	D	0	-33.0299	12.9746	0.58531	0.1684:0.8316:0.0:0.0	.	587;573;556;542;573;542;572;541;586;572;555;541;556;555	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	W	586;572;572;555;555;587;556;542;556;573;573	ENSP00000407046:R586W;ENSP00000387137:R572W;ENSP00000386547:R572W;ENSP00000398305:R555W;ENSP00000258104:R555W;ENSP00000386683:R587W;ENSP00000377678:R556W;ENSP00000386285:R542W;ENSP00000386512:R556W;ENSP00000386881:R573W;ENSP00000386617:R573W	ENSP00000258104:R555W	R	+	1	2	DYSF	71632269	0.995000	0.38212	0.999000	0.59377	0.937000	0.57800	1.029000	0.30140	1.234000	0.43709	0.655000	0.94253	CGG	.	.	weak		0.637	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
DHRS12	79758	hgsc.bcm.edu	37	13	52346027	52346027	+	Silent	SNP	C	C	T	rs151116008		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr13:52346027C>T	ENST00000444610.2	-	8	649	c.636G>A	c.(634-636)acG>acA	p.T212T	DHRS12_ENST00000490949.1_5'UTR|DHRS12_ENST00000280056.2_Silent_p.T163T|DHRS12_ENST00000218981.1_Silent_p.T163T	NM_001270424.1	NP_001257353.1	A0PJE2	DHR12_HUMAN	dehydrogenase/reductase (SDR family) member 12	212							oxidoreductase activity (GO:0016491)			cervix(1)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	7		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		CCCACCGCTCCGTCAGAACCA	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18842	0.001		0.0	False		,,,				2504	0.0				p.T212T		Atlas-SNP	.											.	DHRS12	28	.	0			c.G636A						PASS	.	C	,	1,4405	2.1+/-5.4	0,1,2202	70.0	74.0	73.0		489,489	-6.4	0.0	13	dbSNP_134	73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	DHRS12	NM_001031719.1,NM_024705.1	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	163/272,163/243	52346027	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79758	exon8			CCGCTCCGTCAGA	AK023701	CCDS9430.1, CCDS31976.1, CCDS58292.1	13q14.3	2013-10-11			ENSG00000102796	ENSG00000102796		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	25832	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 40C, member 1"""					19027726	Standard	NM_001031719		Approved	FLJ13639, SDR40C1	uc001vfq.4	A0PJE2	OTTHUMG00000016952	ENST00000444610.2:c.636G>A	13.37:g.52346027C>T		110.0	0.0	0		113.0	26.0	0.230089	NM_001270424	Q96GB2|Q9H8H1	Silent	SNP	ENST00000444610.2	37	CCDS58292.1																																																																																			C|1.000;T|0.000	0.000	strong		0.607	DHRS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045036.3	NM_024705	
CASC1	55259	hgsc.bcm.edu	37	12	25297343	25297343	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr12:25297343C>A	ENST00000320267.9	-	8	1021	c.940G>T	c.(940-942)Gaa>Taa	p.E314*	CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000395987.3_Nonsense_Mutation_p.E320*|CASC1_ENST00000545133.1_Nonsense_Mutation_p.E255*|CASC1_ENST00000354189.5_Nonsense_Mutation_p.E378*|CASC1_ENST00000537577.1_Nonsense_Mutation_p.E202*|CASC1_ENST00000395990.2_Nonsense_Mutation_p.E274*	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	314										breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			ACTTTTATTTCTTCCTCCTGA	0.348																																					p.E378X		Atlas-SNP	.											.	CASC1	146	.	0			c.G1132T						PASS	.						210.0	211.0	210.0					12																	25297343		2203	4300	6503	SO:0001587	stop_gained	55259	exon9			TTATTTCTTCCTC	AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.940G>T	12.37:g.25297343C>A	ENSP00000313141:p.Glu314*	577.0	0.0	0		556.0	130.0	0.233813	NM_001082972	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Nonsense_Mutation	SNP	ENST00000320267.9	37	CCDS41762.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.347205	0.82022	.	.	ENSG00000118307	ENST00000354189;ENST00000395987;ENST00000320267;ENST00000395990;ENST00000537577;ENST00000395992;ENST00000545133;ENST00000389246	.	.	.	4.25	2.36	0.29203	.	0.469935	0.22630	N	0.057588	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-1.813	9.6523	0.39906	0.0:0.8066:0.0:0.1934	.	.	.	.	X	378;320;314;274;202;320;255;124	.	ENSP00000313141:E314X	E	-	1	0	CASC1	25188610	0.029000	0.19370	0.095000	0.20976	0.248000	0.25809	0.256000	0.18351	0.091000	0.17302	-1.161000	0.01788	GAA	.	.	none		0.348	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316761.1	NM_018272	
ZNF814	730051	hgsc.bcm.edu	37	19	58385867	58385867	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:58385867T>A	ENST00000435989.2	-	3	1125	c.891A>T	c.(889-891)gaA>gaT	p.E297D	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	297					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTCTCCACATTCATGTTTTT	0.363																																					p.E297D		Atlas-SNP	.											ZNF814,NS,carcinoma,-2,1	ZNF814	93	1	0			c.A891T						scavenged	.						5.0	4.0	4.0					19																	58385867		510	1081	1591	SO:0001583	missense	730051	exon3			TCCACATTCATGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.891A>T	19.37:g.58385867T>A	ENSP00000410545:p.Glu297Asp	70.0	0.0	0		104.0	11.0	0.105769	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.15	1.554325	0.27739	.	.	ENSG00000204514	ENST00000435989	T	0.22134	1.97	1.93	-3.87	0.04218	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16214	0.0390	L	0.47078	1.49	0.09310	N	1	P	0.36048	0.534	B	0.39738	0.308	T	0.22208	-1.0223	9	0.40728	T	0.16	.	3.3223	0.07054	0.3234:0.181:0.0:0.4956	.	297	B7Z6K7	ZN814_HUMAN	D	297	ENSP00000410545:E297D	ENSP00000410545:E297D	E	-	3	2	ZNF814	63077679	0.000000	0.05858	0.000000	0.03702	0.378000	0.30076	-2.601000	0.00892	-0.795000	0.04462	0.102000	0.15555	GAA	.	.	none		0.363	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
DNAH9	1770	hgsc.bcm.edu	37	17	11666907	11666907	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:11666907C>T	ENST00000262442.4	+	36	7214	c.7146C>T	c.(7144-7146)ttC>ttT	p.F2382F	DNAH9_ENST00000454412.2_Silent_p.F2382F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2382					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTGGGCTTTCGGCGGAGCAA	0.468																																					p.F2382F		Atlas-SNP	.											.	DNAH9	695	.	0			c.C7146T						PASS	.						71.0	65.0	67.0					17																	11666907		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon36			GGCTTTCGGCGGA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7146C>T	17.37:g.11666907C>T		124.0	0.0	0		105.0	32.0	0.304762	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.	.	none		0.468	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SLC6A16	28968	hgsc.bcm.edu	37	19	49812603	49812603	+	Silent	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:49812603G>A	ENST00000335875.4	-	6	1183	c.942C>T	c.(940-942)ctC>ctT	p.L314L	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Silent_p.L314L	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	314					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CCCCTTCCAGGAGTAGAGTCC	0.507																																					p.L314L		Atlas-SNP	.											.	SLC6A16	62	.	0			c.C942T						PASS	.						71.0	72.0	71.0					19																	49812603		1926	4128	6054	SO:0001819	synonymous_variant	28968	exon6			TTCCAGGAGTAGA	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.942C>T	19.37:g.49812603G>A		73.0	0.0	0		140.0	10.0	0.0714286	NM_014037	Q8IYV4|Q9Y5I9	Silent	SNP	ENST00000335875.4	37	CCDS42590.1																																																																																			.	.	none		0.507	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		Atlas-SNP	.											.	ZNF814	93	.	0			c.G965A						PASS	.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	202.0	0.0	0		272.0	38.0	0.139706	NM_001144989	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500	0.500	weak		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
OR2A5	393046	hgsc.bcm.edu	37	7	143747902	143747902	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr7:143747902G>A	ENST00000408906.2	+	1	442	c.408G>A	c.(406-408)atG>atA	p.M136I		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M136I(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					CTGTCATCATGAGATGGGGAG	0.512																																					p.M136I		Atlas-SNP	.											OR2A5,NS,carcinoma,0,1	OR2A5	78	1	1	Substitution - Missense(1)	prostate(1)	c.G408A						PASS	.						187.0	193.0	191.0					7																	143747902		2128	4247	6375	SO:0001583	missense	393046	exon1			CATCATGAGATGG	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.408G>A	7.37:g.143747902G>A	ENSP00000386208:p.Met136Ile	168.0	0.0	0		204.0	49.0	0.240196	NM_012365	B9EGX2|O43885|O43888	Missense_Mutation	SNP	ENST00000408906.2	37	CCDS43668.1	.	.	.	.	.	.	.	.	.	.	G	9.840	1.190889	0.21954	.	.	ENSG00000221836	ENST00000408906	T	0.00551	6.65	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	U	0.001688	T	0.01156	0.0038	M	0.83223	2.63	0.29425	N	0.860251	B	0.20164	0.042	B	0.23852	0.049	T	0.07986	-1.0744	10	0.72032	D	0.01	.	16.3726	0.83370	0.0:0.0:1.0:0.0	.	136	Q96R48	OR2A5_HUMAN	I	136	ENSP00000386208:M136I	ENSP00000386208:M136I	M	+	3	0	OR2A5	143378835	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	4.248000	0.58760	2.728000	0.93425	0.557000	0.71058	ATG	.	.	none		0.512	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1		
FAM47E	100129583	hgsc.bcm.edu	37	4	77192845	77192845	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr4:77192845G>T	ENST00000424749.2	+	5	800	c.794G>T	c.(793-795)aGt>aTt	p.S265I	FAM47E_ENST00000515604.1_Missense_Mutation_p.S265I|FAM47E-STBD1_ENST00000539752.1_5'UTR|FAM47E_ENST00000339906.6_Missense_Mutation_p.S167I|FAM47E_ENST00000510197.1_Missense_Mutation_p.S167I	NM_001136570.2	NP_001130042.1	Q6ZV65	FA47E_HUMAN	family with sequence similarity 47, member E	265																	CTAAAGCGTAGTGTGGGGCTC	0.473																																					p.S265I		Atlas-SNP	.											.	.	.	.	0			c.G794T						PASS	.						120.0	102.0	107.0					4																	77192845		692	1591	2283	SO:0001583	missense	0	exon5			AGCGTAGTGTGGG	AC034139, AK124936, CR591456, CR627383	CCDS47081.1, CCDS58907.1	4q21.1	2013-04-23			ENSG00000189157	ENSG00000189157			34343	protein-coding gene	gene with protein product	"""similar to genethonin 1"""						Standard	NM_001136570		Approved	FLJ42946, LOC100129583	uc003hjx.3	Q6ZV65	OTTHUMG00000185390	ENST00000424749.2:c.794G>T	4.37:g.77192845G>T	ENSP00000409423:p.Ser265Ile	90.0	0.0	0		81.0	19.0	0.234568	NM_001242939	D6R8Y4	Missense_Mutation	SNP	ENST00000424749.2	37	CCDS47081.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807631	0.31961	.	.	ENSG00000189157	ENST00000510197;ENST00000339906;ENST00000515604;ENST00000509377;ENST00000424749;ENST00000514140	T;T;T;T	0.48201	0.82;0.82;1.42;1.42	4.38	2.61	0.31194	.	1.076150	0.07240	N	0.864079	T	0.52597	0.1744	M	0.62723	1.935	0.09310	N	0.999994	D;D;P;P;P	0.56035	0.967;0.974;0.799;0.799;0.911	P;P;B;B;P	0.49829	0.6;0.623;0.366;0.366;0.461	T	0.37934	-0.9684	10	0.62326	D	0.03	1.7403	6.1022	0.20053	0.1044:0.1912:0.7044:0.0	.	112;265;265;265;167	D6RCS4;Q6ZV65-1;Q6ZV65;C9JTC9;Q6ZV65-2	.;.;FA47E_HUMAN;.;.	I	167;167;265;112;265;73	ENSP00000422262:S167I;ENSP00000340401:S167I;ENSP00000422067:S265I;ENSP00000409423:S265I	ENSP00000340401:S167I	S	+	2	0	FAM47E	77411869	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.169000	0.16641	0.594000	0.29761	-0.176000	0.13171	AGT	.	.	none		0.473	FAM47E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362528.2	NM_001136570	
FAT4	79633	hgsc.bcm.edu	37	4	126336502	126336502	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr4:126336502C>T	ENST00000394329.3	+	5	6397	c.6384C>T	c.(6382-6384)gaC>gaT	p.D2128D	FAT4_ENST00000335110.5_Silent_p.D426D	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2128	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGGCTACAGACAAAGGTCAAC	0.413																																					p.D2128D		Atlas-SNP	.											FAT4_ENST00000394329,NS,carcinoma,+2,2	FAT4	1752	2	0			c.C6384T						PASS	.						84.0	83.0	84.0					4																	126336502		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon5			TACAGACAAAGGT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6384C>T	4.37:g.126336502C>T		100.0	0.0	0		85.0	23.0	0.270588	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.	.	none		0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
EIF2B4	8890	hgsc.bcm.edu	37	2	27587653	27587653	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:27587653A>T	ENST00000347454.4	-	12	1475	c.1304T>A	c.(1303-1305)cTg>cAg	p.L435Q	EIF2B4_ENST00000451130.2_Missense_Mutation_p.L455Q|EIF2B4_ENST00000493344.2_Missense_Mutation_p.L456Q|EIF2B4_ENST00000445933.2_Missense_Mutation_p.L434Q|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	435					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACAGCAAACCAGCACTGGTAC	0.522																																					p.L455Q		Atlas-SNP	.											.	EIF2B4	48	.	0			c.T1364A						PASS	.						106.0	94.0	98.0					2																	27587653		2203	4300	6503	SO:0001583	missense	8890	exon11			CAAACCAGCACTG	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.1304T>A	2.37:g.27587653A>T	ENSP00000233552:p.Leu435Gln	94.0	0.0	0		70.0	21.0	0.3	NM_172195	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	ENST00000347454.4	37	CCDS33164.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196658	0.79015	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.97145	0.9067	M	0.91510	3.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.87578	0.998;0.998;0.992;0.982	D	0.97934	1.0322	10	0.87932	D	0	-11.0063	13.5046	0.61477	1.0:0.0:0.0:0.0	.	432;434;435;455	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	Q	435;432;434;455;456	ENSP00000233552:L435Q;ENSP00000394397:L434Q;ENSP00000394869:L455Q;ENSP00000429323:L456Q	ENSP00000233552:L435Q	L	-	2	0	EIF2B4	27441157	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.081000	0.94049	2.058000	0.61347	0.533000	0.62120	CTG	.	.	none		0.522	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1		
SNX21	90203	hgsc.bcm.edu	37	20	44469595	44469595	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr20:44469595C>T	ENST00000491381.1	+	4	833	c.765C>T	c.(763-765)ctC>ctT	p.L255L	SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000372542.1_Silent_p.L246L|SNX21_ENST00000342644.5_Intron|SNX21_ENST00000462307.1_3'UTR			Q969T3	SNX21_HUMAN	sorting nexin family member 21	255					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				GTACTGGCCTCTATCGTGAGG	0.692																																					p.L255L		Atlas-SNP	.											.	SNX21	23	.	0			c.C765T						PASS	.						15.0	18.0	17.0					20																	44469595		2192	4258	6450	SO:0001819	synonymous_variant	90203	exon4			TGGCCTCTATCGT	AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.765C>T	20.37:g.44469595C>T		68.0	0.0	0		64.0	17.0	0.265625	NM_033421	Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	Silent	SNP	ENST00000491381.1	37	CCDS13377.1																																																																																			.	.	none		0.692	SNX21-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079534.1	NM_033421	
SERPINB3	6317	hgsc.bcm.edu	37	18	61323022	61323022	+	Missense_Mutation	SNP	C	C	T	rs111442409		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr18:61323022C>T	ENST00000283752.5	-	8	1185	c.1042G>A	c.(1042-1044)Gct>Act	p.A348T	SERPINB3_ENST00000332821.8_Missense_Mutation_p.A296T|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	348					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						CCTACTACAGCGGTGGCAGCT	0.498													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19839	0.0		0.0	False		,,,				2504	0.0				p.A348T		Atlas-SNP	.											.	SERPINB3	90	.	0			c.G1042A						PASS	.						110.0	116.0	114.0					18																	61323022		2203	4300	6503	SO:0001583	missense	6317	exon8			CTACAGCGGTGGC	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.1042G>A	18.37:g.61323022C>T	ENSP00000283752:p.Ala348Thr	193.0	0.0	0		404.0	48.0	0.118812	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	CCDS11987.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	12.32	1.901744	0.33535	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.83506	-1.73;-1.73	3.06	1.15	0.20763	Serpin domain (3);	0.530994	0.15710	N	0.248470	T	0.71813	0.3384	L	0.41710	1.295	0.09310	N	1	B;B	0.34264	0.446;0.002	B;B	0.29440	0.102;0.001	T	0.61407	-0.7069	10	0.52906	T	0.07	.	8.2078	0.31465	0.0:0.7806:0.0:0.2194	.	296;348	P29508-2;P29508	.;SPB3_HUMAN	T	348;296	ENSP00000283752:A348T;ENSP00000329498:A296T	ENSP00000283752:A348T	A	-	1	0	SERPINB3	59474002	0.000000	0.05858	0.003000	0.11579	0.025000	0.11179	-0.304000	0.08199	0.300000	0.22699	-0.384000	0.06662	GCT	C|0.999;T|0.001	0.001	strong		0.498	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
ENPP7	339221	hgsc.bcm.edu	37	17	77704925	77704925	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:77704925C>T	ENST00000328313.5	+	1	245	c.24C>T	c.(22-24)ctC>ctT	p.L8L		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CCGTCCTCCTCACTGTGGCTC	0.657																																					p.L8L		Atlas-SNP	.											.	ENPP7	63	.	0			c.C24T						PASS	.						15.0	16.0	16.0					17																	77704925		2173	4242	6415	SO:0001819	synonymous_variant	339221	exon1			CCTCCTCACTGTG	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.24C>T	17.37:g.77704925C>T		44.0	0.0	0		38.0	10.0	0.263158	NM_178543		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			.	.	none		0.657	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
SCN3A	6328	hgsc.bcm.edu	37	2	165948871	165948871	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:165948871A>C	ENST00000360093.3	-	27	5191	c.4700T>G	c.(4699-4701)gTt>gGt	p.V1567G	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.V1518G|SCN3A_ENST00000540861.1_Missense_Mutation_p.V50G|SCN3A_ENST00000283254.7_Missense_Mutation_p.V1567G|SCN3A_ENST00000465043.1_5'UTR	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1567					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTGAACAGAACAATGAACAC	0.468																																					p.V1567G		Atlas-SNP	.											.	SCN3A	544	.	0			c.T4700G						PASS	.						168.0	135.0	146.0					2																	165948871		2203	4300	6503	SO:0001583	missense	6328	exon27			AACAGAACAATGA	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4700T>G	2.37:g.165948871A>C	ENSP00000353206:p.Val1567Gly	160.0	0.0	0		125.0	27.0	0.216	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	A	15.82	2.945058	0.53079	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96	5.78	5.78	0.91487	.	0.231242	0.33401	N	0.004958	D	0.97204	0.9086	L	0.37750	1.13	0.80722	D	1	P;B;B	0.41188	0.741;0.001;0.001	P;B;B	0.47744	0.556;0.003;0.015	D	0.97804	1.0246	10	0.56958	D	0.05	.	16.4053	0.83662	1.0:0.0:0.0:0.0	.	1518;1518;1567	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	G	1567;1567;1518;50	ENSP00000353206:V1567G;ENSP00000283254:V1567G;ENSP00000386726:V1518G;ENSP00000439920:V50G	ENSP00000283254:V1567G	V	-	2	0	SCN3A	165657117	1.000000	0.71417	0.998000	0.56505	0.820000	0.46376	9.287000	0.95975	2.333000	0.79357	0.482000	0.46254	GTT	.	.	none		0.468	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
CCND3	896	hgsc.bcm.edu	37	6	41903710	41903710	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr6:41903710T>C	ENST00000372991.4	-	5	1045	c.847A>G	c.(847-849)Act>Gct	p.T283A	CCND3_ENST00000511686.1_5'UTR|CCND3_ENST00000372987.4_Missense_Mutation_p.T233A|CCND3_ENST00000372988.4_Missense_Mutation_p.T202A|CCND3_ENST00000414200.2_Missense_Mutation_p.T211A|CCND3_ENST00000415497.2_Missense_Mutation_p.T87A|CCND3_ENST00000510503.1_Missense_Mutation_p.H156R|CCND3_ENST00000511642.1_Missense_Mutation_p.T202A	NM_001760.3	NP_001751.1	P30281	CCND3_HUMAN	cyclin D3	283					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)	p.T283P(1)|p.T283A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(13)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	20	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCTGTAGGAGTGCTGGTCTGG	0.667			T	IGH@	MM																																p.T283A		Atlas-SNP	.		Dom	yes		6	6p21	896	cyclin D3		L	CCND3,NS,lymphoid_neoplasm,0,2	CCND3	40	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A847G						PASS	.						34.0	39.0	37.0					6																	41903710		2203	4300	6503	SO:0001583	missense	896	exon5			TAGGAGTGCTGGT		CCDS4863.1, CCDS47425.1, CCDS47426.1, CCDS47427.1, CCDS75452.1	6p21	2008-08-26			ENSG00000112576	ENSG00000112576			1585	protein-coding gene	gene with protein product		123834				1386335	Standard	NM_001136125		Approved		uc003orn.3	P30281	OTTHUMG00000014690	ENST00000372991.4:c.847A>G	6.37:g.41903710T>C	ENSP00000362082:p.Thr283Ala	82.0	0.0	0		69.0	15.0	0.217391	NM_001760	B2RD63|B3KQ22|E9PAS4|E9PB36|Q5T8J0|Q6FG62|Q96F49	Missense_Mutation	SNP	ENST00000372991.4	37	CCDS4863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	23.1|23.1	4.377335|4.377335	0.82682|0.82682	.|.	.|.	ENSG00000112576|ENSG00000112576	ENST00000510503|ENST00000372991;ENST00000511642;ENST00000372987;ENST00000372988;ENST00000415497;ENST00000414200	T|T;T;T;T;T;T	0.36878|0.54071	1.23|2.69;2.7;2.69;2.7;1.08;0.59	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.64402	.|D	.|0.000011	T|T	0.63224|0.63224	0.2493|0.2493	M|M	0.73962|0.73962	2.25|2.25	0.31265|0.31265	N|N	0.692446|0.692446	.|D;D;D	.|0.69078	.|0.982;0.993;0.997	.|D;D;D	.|0.75020	.|0.952;0.978;0.985	T|T	0.66830|0.66830	-0.5824|-0.5824	7|10	0.23891|0.56958	T|D	0.37|0.05	.|.	14.0609|14.0609	0.64800|0.64800	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|211;283;233	.|E9PAS4;P30281;Q5T8J1	.|.;CCND3_HUMAN;.	R|A	156|283;202;233;202;87;211	ENSP00000425986:H156R|ENSP00000362082:T283A;ENSP00000426212:T202A;ENSP00000362078:T233A;ENSP00000362079:T202A;ENSP00000401595:T87A;ENSP00000397545:T211A	ENSP00000425986:H156R|ENSP00000362078:T233A	H|T	-|-	2|1	0|0	CCND3|CCND3	42011688|42011688	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.295000|7.295000	0.78780|0.78780	2.155000|2.155000	0.67459|0.67459	0.482000|0.482000	0.46254|0.46254	CAC|ACT	.	.	none		0.667	CCND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040540.2	NM_001760	
COASY	80347	hgsc.bcm.edu	37	17	40716134	40716134	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:40716134G>A	ENST00000393818.2	+	2	1312	c.856G>A	c.(856-858)Gtg>Atg	p.V286M	RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000590958.1_Missense_Mutation_p.V315M|MLX_ENST00000246912.4_5'Flank|MLX_ENST00000435881.2_5'Flank|COASY_ENST00000420359.1_Missense_Mutation_p.V286M|COASY_ENST00000421097.2_Missense_Mutation_p.V286M|MLX_ENST00000346833.4_5'Flank|COASY_ENST00000449624.1_5'UTR	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	286	Phosphopantetheine adenylyltransferase.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GGAGTTCCTGGTGGTCAGCGA	0.602																																					p.V315M		Atlas-SNP	.											.	COASY	45	.	0			c.G943A						PASS	.						48.0	49.0	49.0					17																	40716134		2203	4300	6503	SO:0001583	missense	80347	exon4			TTCCTGGTGGTCA	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.856G>A	17.37:g.40716134G>A	ENSP00000377406:p.Val286Met	140.0	0.0	0		123.0	28.0	0.227642	NM_001042532	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	G	31	5.070898	0.93950	.	.	ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818	D;D	0.97575	-4.44;-4.44	5.23	5.23	0.72850	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.98814	0.9600	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	D	0.99289	1.0898	10	0.87932	D	0	-20.9887	16.6827	0.85297	0.0:0.0:1.0:0.0	.	315;286	Q13057-2;Q13057	.;COASY_HUMAN	M	315;286;286	ENSP00000413338:V286M;ENSP00000377406:V286M	ENSP00000377406:V286M	V	+	1	0	COASY	37969660	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.436000	0.97532	2.882000	0.98803	0.655000	0.94253	GTG	.	.	none		0.602	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	
ZIC1	7545	hgsc.bcm.edu	37	3	147128808	147128808	+	Silent	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:147128808C>T	ENST00000282928.4	+	1	1638	c.909C>T	c.(907-909)ccC>ccT	p.P303P		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	303					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						AGCCCTTTCCCTGCCCCTTCC	0.572																																					p.P303P		Atlas-SNP	.											.	ZIC1	141	.	0			c.C909T						PASS	.						83.0	87.0	86.0					3																	147128808		2203	4300	6503	SO:0001819	synonymous_variant	7545	exon1			CTTTCCCTGCCCC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.909C>T	3.37:g.147128808C>T		71.0	0.0	0		74.0	13.0	0.175676	NM_003412	Q2M3N1	Silent	SNP	ENST00000282928.4	37	CCDS3136.1																																																																																			.	.	none		0.572	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
SI	6476	hgsc.bcm.edu	37	3	164730788	164730788	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:164730788T>C	ENST00000264382.3	-	34	4104	c.4042A>G	c.(4042-4044)Acg>Gcg	p.T1348A		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1348	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TCATCTTCCGTTAGAGTTTTA	0.323										HNSCC(35;0.089)																											p.T1348A		Atlas-SNP	.											.	SI	500	.	0			c.A4042G						PASS	.						133.0	130.0	131.0					3																	164730788		2203	4300	6503	SO:0001583	missense	6476	exon34			CTTCCGTTAGAGT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4042A>G	3.37:g.164730788T>C	ENSP00000264382:p.Thr1348Ala	175.0	0.0	0		151.0	30.0	0.198675	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.753476	0.31046	.	.	ENSG00000090402	ENST00000264382	D	0.88354	-2.37	4.54	4.54	0.55810	Glycoside hydrolase, superfamily (1);	0.278355	0.36234	N	0.002713	D	0.87055	0.6082	L	0.57536	1.79	0.09310	N	1	B	0.34290	0.447	B	0.44044	0.439	T	0.76386	-0.2978	10	0.25106	T	0.35	.	5.3666	0.16117	0.1734:0.0:0.1805:0.646	.	1348	P14410	SUIS_HUMAN	A	1348	ENSP00000264382:T1348A	ENSP00000264382:T1348A	T	-	1	0	SI	166213482	0.377000	0.25106	0.755000	0.31263	0.660000	0.38997	-0.129000	0.10515	1.876000	0.54355	0.477000	0.44152	ACG	.	.	none		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
PRRC2B	84726	hgsc.bcm.edu	37	9	134357813	134357813	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr9:134357813G>A	ENST00000357304.4	+	20	5094	c.5039G>A	c.(5038-5040)cGg>cAg	p.R1680Q	PRRC2B_ENST00000405995.1_Missense_Mutation_p.R986Q|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.R986Q	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1680							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCCGAGTCTCGGGAGTCGTCT	0.602																																					p.R1680Q		Atlas-SNP	.											.	PRRC2B	266	.	0			c.G5039A						PASS	.						145.0	151.0	149.0					9																	134357813		1979	4166	6145	SO:0001583	missense	84726	exon20			AGTCTCGGGAGTC	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.5039G>A	9.37:g.134357813G>A	ENSP00000349856:p.Arg1680Gln	189.0	0.0	0		173.0	48.0	0.277457	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004885	0.74932	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550	T;T;T	0.02280	4.36;4.71;4.36	4.92	4.92	0.64577	.	0.000000	0.37577	U	0.002038	T	0.05686	0.0149	N	0.21142	0.635	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.956	T	0.62364	-0.6870	10	0.12103	T	0.63	-27.4773	17.105	0.86660	0.0:0.0:1.0:0.0	.	412;1680	Q5JSZ8;Q5JSZ5	.;PRC2B_HUMAN	Q	986;1680;986	ENSP00000384606:R986Q;ENSP00000349856:R1680Q;ENSP00000398853:R986Q	ENSP00000349856:R1680Q	R	+	2	0	PRRC2B	133347634	1.000000	0.71417	0.987000	0.45799	0.916000	0.54674	4.534000	0.60622	2.275000	0.75901	0.561000	0.74099	CGG	.	.	none		0.602	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DSG1	1828	hgsc.bcm.edu	37	18	28911696	28911696	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr18:28911696G>A	ENST00000257192.4	+	6	762	c.550G>A	c.(550-552)Gca>Aca	p.A184T		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TGCTACTGACGCAGATGAACC	0.333																																					p.A184T		Atlas-SNP	.											DSG1,colon,carcinoma,0,1	DSG1	176	1	0			c.G550A						PASS	.						74.0	68.0	70.0					18																	28911696		2203	4299	6502	SO:0001583	missense	1828	exon6			ACTGACGCAGATG	X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.550G>A	18.37:g.28911696G>A	ENSP00000257192:p.Ala184Thr	127.0	0.0	0		299.0	31.0	0.103679	NM_001942	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	.	.	.	.	.	.	.	.	.	.	G	33	5.283521	0.95489	.	.	ENSG00000134760	ENST00000257192	T	0.61859	0.07	5.88	5.88	0.94601	Cadherin (5);Cadherin-like (1);	0.000000	0.64402	D	0.000016	T	0.82029	0.4948	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84483	0.0606	10	0.72032	D	0.01	.	20.2187	0.98312	0.0:0.0:1.0:0.0	.	184	Q02413	DSG1_HUMAN	T	184	ENSP00000257192:A184T	ENSP00000257192:A184T	A	+	1	0	DSG1	27165694	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.063000	0.89482	2.780000	0.95670	0.655000	0.94253	GCA	.	.	none		0.333	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942	
MESP2	145873	hgsc.bcm.edu	37	15	90320149	90320149	+	Silent	SNP	G	G	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr15:90320149G>A	ENST00000341735.3	+	1	561	c.561G>A	c.(559-561)ggG>ggA	p.G187G	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	187	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaggggcaggggcaag	0.781																																					p.G187G		Atlas-SNP	.											.	MESP2	20	.	0			c.G561A						PASS	.						2.0	3.0	3.0					15																	90320149		1334	3199	4533	SO:0001819	synonymous_variant	145873	exon1			GCAGGGGCAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.561G>A	15.37:g.90320149G>A		28.0	0.0	0		20.0	9.0	0.45	NM_001039958	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																			.	.	none		0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
LRRN3	54674	hgsc.bcm.edu	37	7	110763849	110763849	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr7:110763849C>A	ENST00000422987.3	+	2	1852	c.1021C>A	c.(1021-1023)Ctg>Atg	p.L341M	IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000450877.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.L341M|LRRN3_ENST00000308478.5_Missense_Mutation_p.L341M|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	341					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ATCACTCATGCTGAACAGCAA	0.453																																					p.L341M		Atlas-SNP	.											.	LRRN3	132	.	0			c.C1021A						PASS	.						106.0	100.0	102.0					7																	110763849		2203	4300	6503	SO:0001583	missense	54674	exon2			CTCATGCTGAACA	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1021C>A	7.37:g.110763849C>A	ENSP00000412417:p.Leu341Met	134.0	0.0	0		149.0	56.0	0.375839	NM_018334	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	ENST00000422987.3	37	CCDS5754.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659574	0.47467	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.77229	-1.08;-1.08;-1.08	5.81	4.01	0.46588	.	0.000000	0.52532	D	0.000077	D	0.89480	0.6727	M	0.91717	3.235	0.48571	D	0.999679	D	0.89917	1.0	D	0.97110	1.0	D	0.90182	0.4243	10	0.59425	D	0.04	.	12.3926	0.55366	0.0:0.8648:0.0:0.1352	.	341	Q9H3W5	LRRN3_HUMAN	M	341	ENSP00000312001:L341M;ENSP00000397312:L341M;ENSP00000412417:L341M	ENSP00000312001:L341M	L	+	1	2	LRRN3	110551085	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	2.694000	0.47035	0.807000	0.34208	0.650000	0.86243	CTG	.	.	none		0.453	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
DCAF8	50717	hgsc.bcm.edu	37	1	160209665	160209665	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr1:160209665C>T	ENST00000368073.3	-	4	979	c.545G>A	c.(544-546)cGt>cAt	p.R182H	DCAF8_ENST00000608310.1_Missense_Mutation_p.R336H|DCAF8_ENST00000556710.1_Missense_Mutation_p.R336H|DCAF8_ENST00000475733.1_Missense_Mutation_p.R182H|DCAF8_ENST00000610139.1_Missense_Mutation_p.R182H|DCAF8_ENST00000368074.1_Missense_Mutation_p.R182H|DCAF8_ENST00000326837.2_Missense_Mutation_p.R182H			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	182				QR -> HG (in Ref. 1; AAA16607). {ECO:0000305}.	protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						CAGGCGGAAACGCTGCACAAA	0.622																																					p.R182H		Atlas-SNP	.											.	DCAF8	64	.	0			c.G545A						PASS	.						60.0	59.0	60.0					1																	160209665		2203	4300	6503	SO:0001583	missense	50717	exon4			CGGAAACGCTGCA	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.545G>A	1.37:g.160209665C>T	ENSP00000357052:p.Arg182His	192.0	0.0	0		140.0	29.0	0.207143	NM_015726	D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	ENST00000368073.3	37	CCDS1200.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896809	0.72639	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000447377;ENST00000556710	D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.04	5.04	0.67666	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	U	0.000001	D	0.82683	0.5090	L	0.39898	1.24	0.58432	D	0.999999	D;P;P	0.76494	0.999;0.934;0.742	D;B;B	0.78314	0.991;0.394;0.139	D	0.83516	0.0083	10	0.48119	T	0.1	-0.8097	17.1813	0.86856	0.0:1.0:0.0:0.0	.	336;182;182	G3V3G9;Q5TAQ9-2;Q5TAQ9	.;.;DCAF8_HUMAN	H	182;182;182;336;163;182;336	ENSP00000357052:R182H;ENSP00000318227:R182H;ENSP00000357053:R182H;ENSP00000451989:R336H;ENSP00000413688:R182H;ENSP00000451235:R336H	ENSP00000318227:R182H	R	-	2	0	RP11-574F21.3;DCAF8	158476289	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.125000	0.64715	2.333000	0.79357	0.655000	0.94253	CGT	.	.	none		0.622	DCAF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077402.2	NM_015726	
CCDC33	80125	hgsc.bcm.edu	37	15	74623324	74623324	+	Silent	SNP	G	G	A	rs370369621		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr15:74623324G>A	ENST00000398814.3	+	14	1979	c.1548G>A	c.(1546-1548)aaG>aaA	p.K516K	CCDC33_ENST00000558821.1_Silent_p.K109K|CCDC33_ENST00000268082.4_Silent_p.K109K|CCDC33_ENST00000321288.5_Silent_p.K719K	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	719										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TCTCACAGAAGAATGATCGAG	0.607																																					p.K516K		Atlas-SNP	.											.	CCDC33	160	.	0			c.G1548A						PASS	.						17.0	20.0	19.0					15																	74623324		1994	4164	6158	SO:0001819	synonymous_variant	80125	exon14			ACAGAAGAATGAT	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1548G>A	15.37:g.74623324G>A		49.0	0.0	0		47.0	12.0	0.255319	NM_025055	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Silent	SNP	ENST00000398814.3	37	CCDS42058.1																																																																																			.	.	alt		0.607	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791	
CWC25	54883	hgsc.bcm.edu	37	17	36959083	36959083	+	Missense_Mutation	SNP	G	G	A	rs199944848		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr17:36959083G>A	ENST00000225428.5	-	9	1330	c.1033C>T	c.(1033-1035)Cgg>Tgg	p.R345W	CWC25_ENST00000536127.1_Missense_Mutation_p.R282W|PIP4K2B_ENST00000269554.3_5'Flank	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	345										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						ATCTCTTGCCGTTTTCGCTCT	0.483																																					p.R345W		Atlas-SNP	.											.	CWC25	24	.	0			c.C1033T						PASS	.	G	TRP/ARG	0,3952		0,0,1976	195.0	192.0	193.0		1033	2.7	1.0	17		193	1,8315		0,1,4157	yes	missense	CWC25	NM_017748.3	101	0,1,6133	AA,AG,GG		0.012,0.0,0.0082	probably-damaging	345/426	36959083	1,12267	1976	4158	6134	SO:0001583	missense	54883	exon9			CTTGCCGTTTTCG	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.1033C>T	17.37:g.36959083G>A	ENSP00000225428:p.Arg345Trp	202.0	0.0	0		177.0	41.0	0.231638	NM_017748	A0JLM3|Q68DK5	Missense_Mutation	SNP	ENST00000225428.5	37	CCDS45663.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058239	0.76074	0.0	1.2E-4	ENSG00000108296	ENST00000225428;ENST00000536127	.	.	.	5.88	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.78456	2.415	0.80722	D	1	P;D	0.89917	0.954;1.0	B;D	0.87578	0.429;0.998	T	0.70208	-0.4935	9	0.62326	D	0.03	.	7.9671	0.30104	0.0717:0.0:0.5191:0.4092	rs35783447	282;345	B4DJK2;Q9NXE8	.;CWC25_HUMAN	W	345;282	.	ENSP00000225428:R345W	R	-	1	2	CWC25	34212609	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	1.881000	0.39638	0.365000	0.24400	0.655000	0.94253	CGG	.	.	weak		0.483	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748	
HMGB2	3148	hgsc.bcm.edu	37	4	174254780	174254780	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr4:174254780G>C	ENST00000296503.5	-	2	894	c.21C>G	c.(19-21)aaC>aaG	p.N7K	HMGB2_ENST00000438704.2_Missense_Mutation_p.N7K|HMGB2_ENST00000446922.2_Missense_Mutation_p.N7K			P26583	HMGB2_HUMAN	high mobility group box 2	7					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCCGCGGCTTGTTGGGGTCTC	0.632																																					p.N7K		Atlas-SNP	.											.	HMGB2	24	.	0			c.C21G						PASS	.						66.0	69.0	68.0					4																	174254780		2203	4300	6503	SO:0001583	missense	3148	exon1			CGGCTTGTTGGGG		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.21C>G	4.37:g.174254780G>C	ENSP00000296503:p.Asn7Lys	91.0	0.0	0		85.0	16.0	0.188235	NM_001130689	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	37	CCDS3816.1	.	.	.	.	.	.	.	.	.	.	G	0.105	-1.145864	0.01714	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	T;T;T;T	0.13778	2.56;2.56;2.56;2.56	5.45	3.72	0.42706	High mobility group, superfamily (1);	0.000000	0.64402	D	0.000001	T	0.09423	0.0232	L	0.37800	1.135	0.48236	D	0.999614	B	0.02656	0.0	B	0.06405	0.002	T	0.11591	-1.0581	10	0.07030	T	0.85	.	10.0298	0.42094	0.0722:0.0:0.7896:0.1382	.	7	P26583	HMGB2_HUMAN	K	7	ENSP00000296503:N7K;ENSP00000393448:N7K;ENSP00000404912:N7K;ENSP00000423001:N7K	ENSP00000296503:N7K	N	-	3	2	HMGB2	174491355	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	0.752000	0.26362	0.672000	0.31204	-0.309000	0.09137	AAC	.	.	none		0.632	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	NM_001130688	
PTX3	5806	hgsc.bcm.edu	37	3	157160548	157160548	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr3:157160548A>G	ENST00000295927.3	+	3	1071	c.926A>G	c.(925-927)cAg>cGg	p.Q309R	VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392833.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	309	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GGAATCCTGCAGATTGGCCAA	0.502																																					p.Q309R		Atlas-SNP	.											.	PTX3	27	.	0			c.A926G						PASS	.						123.0	119.0	121.0					3																	157160548		2203	4300	6503	SO:0001583	missense	5806	exon3			TCCTGCAGATTGG	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.926A>G	3.37:g.157160548A>G	ENSP00000295927:p.Gln309Arg	203.0	0.0	0		230.0	43.0	0.186957	NM_002852	B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688570	0.68271	.	.	ENSG00000163661	ENST00000295927	T	0.06294	3.32	5.97	3.59	0.41128	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.055526	0.85682	D	0.000000	T	0.19886	0.0478	M	0.70275	2.135	0.54753	D	0.999983	D	0.89917	1.0	D	0.79784	0.993	T	0.00158	-1.1975	10	0.62326	D	0.03	-23.4043	8.0147	0.30374	0.8124:0.0:0.0655:0.1221	.	309	P26022	PTX3_HUMAN	R	309	ENSP00000295927:Q309R	ENSP00000295927:Q309R	Q	+	2	0	PTX3	158643242	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	7.087000	0.76893	0.502000	0.28037	0.533000	0.62120	CAG	.	.	none		0.502	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230413	23230413	+	Silent	SNP	A	A	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr22:23230413A>G	ENST00000526893.1	+	1	454	c.180A>G	c.(178-180)cgA>cgG	p.R60R	hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.R60R|IGLL5_ENST00000532223.2_Silent_p.R60R	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	60						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GAAGCAGCCGATCCAGCCTGC	0.647																																					p.D25G		Atlas-SNP	.											.	IGLL5	26	.	0			c.A74G						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			CAGCCGATCCAGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.180A>G	22.37:g.23230413A>G		109.0	0.0	0		103.0	54.0	0.524272	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.647	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
SRCAP	10847	hgsc.bcm.edu	37	16	30747922	30747922	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr16:30747922C>T	ENST00000262518.4	+	33	7370	c.6985C>T	c.(6985-6987)Cga>Tga	p.R2329*	SRCAP_ENST00000344771.4_Nonsense_Mutation_p.R2171*|SRCAP_ENST00000395059.2_Nonsense_Mutation_p.R2267*	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2329	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGAGGTGAGCCGAGAGGAGCT	0.507																																					p.R2329X		Atlas-SNP	.											.	SRCAP	298	.	0			c.C6985T						PASS	.						40.0	42.0	41.0					16																	30747922		2197	4300	6497	SO:0001587	stop_gained	10847	exon33			GTGAGCCGAGAGG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6985C>T	16.37:g.30747922C>T	ENSP00000262518:p.Arg2329*	95.0	0.0	0		110.0	38.0	0.345455	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Nonsense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	46	12.453280	0.99669	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	.	.	.	4.99	4.02	0.46733	.	0.000000	0.38897	N	0.001525	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.2684	13.5265	0.61597	0.1574:0.8425:0.0:0.0	.	.	.	.	X	2329;2267;2171	.	ENSP00000262518:R2329X	R	+	1	2	SRCAP	30655423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.623000	0.46435	1.292000	0.44672	0.563000	0.77884	CGA	.	.	none		0.507	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
MS4A8	83661	hgsc.bcm.edu	37	11	60470906	60470906	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr11:60470906C>T	ENST00000300226.2	+	3	478	c.275C>T	c.(274-276)aCg>aTg	p.T92M		NM_031457.1	NP_113645.1	Q9BY19	M4A8_HUMAN	membrane-spanning 4-domains, subfamily A, member 8	92						integral component of membrane (GO:0016021)											ATCATGGCGACGGTTCTCGTA	0.552																																					p.T92M		Atlas-SNP	.											.	.	.	.	0			c.C275T						PASS	.						151.0	139.0	143.0					11																	60470906		2203	4300	6503	SO:0001583	missense	83661	exon3			TGGCGACGGTTCT	AF237905	CCDS7990.1	11q12	2013-03-01	2013-03-01	2013-03-01	ENSG00000166959	ENSG00000166959			13380	protein-coding gene	gene with protein product		606549	"""membrane-spanning 4-domains, subfamily A, member 8B"""	MS4A8B		11245982, 11401424	Standard	NM_031457		Approved	MS4A4, CD20L5	uc001npv.3	Q9BY19	OTTHUMG00000167686	ENST00000300226.2:c.275C>T	11.37:g.60470906C>T	ENSP00000300226:p.Thr92Met	219.0	0.0	0		190.0	45.0	0.236842	NM_031457	Q8TCA5	Missense_Mutation	SNP	ENST00000300226.2	37	CCDS7990.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.36|11.36	1.615604|1.615604	0.28801|0.28801	.|.	.|.	ENSG00000166959|ENSG00000166959	ENST00000525458|ENST00000300226;ENST00000529752	.|T;T	.|0.02301	.|4.35;4.35	3.62|3.62	2.6|2.6	0.31112|0.31112	.|.	.|0.472817	.|0.19530	.|N	.|0.112065	T|T	0.03739|0.03739	0.0106|0.0106	L|L	0.41573|0.41573	1.285|1.285	0.09310|0.09310	N|N	1|1	.|D;D	.|0.69078	.|0.964;0.997	.|P;P	.|0.53102	.|0.557;0.718	T|T	0.45818|0.45818	-0.9235|-0.9235	5|10	.|0.31617	.|T	.|0.26	-14.2382|-14.2382	7.6502|7.6502	0.28344|0.28344	0.2522:0.7478:0.0:0.0|0.2522:0.7478:0.0:0.0	.|.	.|92;92	.|E9PQE1;Q9BY19	.|.;M4A8B_HUMAN	W|M	74|92	.|ENSP00000300226:T92M;ENSP00000436857:T92M	.|ENSP00000300226:T92M	R|T	+|+	1|2	2|0	MS4A8B|MS4A8B	60227482|60227482	0.001000|0.001000	0.12720|0.12720	0.011000|0.011000	0.14972|0.14972	0.004000|0.004000	0.04260|0.04260	0.804000|0.804000	0.27098|0.27098	1.745000|1.745000	0.51790|0.51790	0.491000|0.491000	0.48974|0.48974	CGG|ACG	.	.	none		0.552	MS4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395605.1		
UNC13A	23025	hgsc.bcm.edu	37	19	17751347	17751347	+	Silent	SNP	G	G	A	rs371816774		TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr19:17751347G>A	ENST00000519716.2	-	22	2759	c.2760C>T	c.(2758-2760)tcC>tcT	p.S920S	UNC13A_ENST00000551649.1_Silent_p.S920S|UNC13A_ENST00000252773.7_Silent_p.S920S|UNC13A_ENST00000550896.1_Silent_p.S918S|UNC13A_ENST00000552293.1_Silent_p.S920S|UNC13A_ENST00000428389.2_Silent_p.S1008S	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	920					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CGAAGCGGTCGGAGGCAGACA	0.582																																					p.S920S		Atlas-SNP	.											.	UNC13A	299	.	0			c.C2760T						PASS	.	G		1,4327		0,1,2163	51.0	62.0	58.0		2760	-2.7	1.0	19		58	0,8492		0,0,4246	no	coding-synonymous	UNC13A	NM_001080421.2		0,1,6409	AA,AG,GG		0.0,0.0231,0.0078		920/1704	17751347	1,12819	2164	4246	6410	SO:0001819	synonymous_variant	23025	exon21			GCGGTCGGAGGCA	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2760C>T	19.37:g.17751347G>A		124.0	0.0	0		89.0	19.0	0.213483	NM_001080421	E5RHY9	Silent	SNP	ENST00000519716.2	37	CCDS46013.2																																																																																			.	.	weak		0.582	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
LRRTM4	80059	hgsc.bcm.edu	37	2	77746792	77746792	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TU-01A-11D-A382-10	TCGA-GS-A9TU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	a588279b-b306-445f-9584-61586da9887f	758b8554-5e4a-469e-92dd-c459fbcd4e0e	g.chr2:77746792A>G	ENST00000409093.1	-	3	539	c.203T>C	c.(202-204)tTa>tCa	p.L68S	LRRTM4_ENST00000409884.1_Missense_Mutation_p.L68S|LRRTM4_ENST00000409088.3_Missense_Mutation_p.L68S|LRRTM4_ENST00000409282.1_Missense_Mutation_p.L69S|LRRTM4_ENST00000409911.1_Missense_Mutation_p.L69S			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	68					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GTTGAACCTTAATGATAAGCC	0.418																																					p.L68S		Atlas-SNP	.											LRRTM4_ENST00000409093,colon,carcinoma,+1,2	LRRTM4	334	2	0			c.T203C						PASS	.						130.0	123.0	125.0					2																	77746792		1926	4136	6062	SO:0001583	missense	80059	exon3			AACCTTAATGATA	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.203T>C	2.37:g.77746792A>G	ENSP00000386357:p.Leu68Ser	229.0	0.0	0		232.0	57.0	0.24569	NM_024993	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.247695	0.59103	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	D	0.90741	0.7094	H	0.96604	3.85	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.93611	0.6939	10	0.87932	D	0	.	14.8238	0.70094	1.0:0.0:0.0:0.0	.	69;68;68	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	S	69;68;68;68;69	ENSP00000387228:L69S;ENSP00000387297:L68S;ENSP00000386357:L68S;ENSP00000386236:L68S;ENSP00000386286:L69S	ENSP00000386236:L68S	L	-	2	0	LRRTM4	77600300	0.996000	0.38824	0.920000	0.36463	0.998000	0.95712	9.339000	0.96797	2.189000	0.69895	0.533000	0.62120	TTA	.	.	none		0.418	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
