#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZC3H4	23211	hgsc.bcm.edu	37	19	47575929	47575931	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:47575929_47575931delCTT	ENST00000253048.5	-	12	1517_1519	c.1480_1482delAAG	c.(1480-1482)aagdel	p.K494del	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	494							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		CCTCCACCTCCTTCTCATCCTCG	0.631																																					p.494_495del		Atlas-Indel	.											.	ZC3H4	96	.	0			c.1481_1483del						PASS	.																																			SO:0001651	inframe_deletion	23211	exon12			.	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1480_1482delAAG	19.37:g.47575929_47575931delCTT	ENSP00000253048:p.Lys494del	70.0	0.0	0		65.0	13.0	0.2	NM_015168	Q9Y420	In_Frame_Del	DEL	ENST00000253048.5	37	CCDS42582.1																																																																																			.	.	none		0.631	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
ALDH5A1	7915	hgsc.bcm.edu	37	6	24522996	24523012	+	Splice_Site	DEL	CTTGTGTTTGCTCAAAC	CTTGTGTTTGCTCAAAC	-	rs551402692		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	CTTGTGTTTGCTCAAAC	CTTGTGTTTGCTCAAAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:24522996_24523012delCTTGTGTTTGCTCAAAC	ENST00000357578.3	+	7	1161_1177	c.1016_1032delCTTGTGTTTGCTCAAAC	c.(1015-1032)acttgtgtttgctcaaac>a	p.TCVCSN339fs	ALDH5A1_ENST00000491546.1_Splice_Site_p.TCVCSN311fs|ALDH5A1_ENST00000348925.2_Splice_Site_p.TCVCSN352fs|ALDH5A1_ENST00000546278.1_Splice_Site_p.TCVCSN251fs	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	339					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	CCTGTCCAGACTTGTGTTTGCTCAAACCAATTCTTGG	0.493																																					p.352_357del		Pindel,Atlas-Indel	.											.	ALDH5A1	42	.	0			c.1054_1070del						PASS	.																																			SO:0001630	splice_region_variant	7915	exon8			.	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1015-1CTTGTGTTTGCTCAAAC>-	6.37:g.24522996_24523012delCTTGTGTTTGCTCAAAC		179.0	0.0	.		108.0	30.0	0.278	NM_170740	B2RD26|G5E949|Q546H9|Q8N3W6	Frame_Shift_Del	DEL	ENST00000357578.3	37	CCDS4555.1																																																																																			.	.	none		0.493	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		Frame_Shift_Del
PSMB2	5690	hgsc.bcm.edu	37	1	36101985	36101986	+	Frame_Shift_Del	DEL	AC	AC	-	rs139138858		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:36101985_36101986delAC	ENST00000373237.3	-	2	550_551	c.139_140delGT	c.(139-141)gttfs	p.V47fs		NM_002794.4	NP_002785.1	P49721	PSB2_HUMAN	proteasome (prosome, macropain) subunit, beta type, 2	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|large_intestine(2)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)|Carfilzomib(DB08889)	AGCCTCTCCAACACACAGGAGT	0.381																																					p.47_47del		Pindel,Atlas-Indel	.											.	PSMB2	9	.	0			c.140_141del						PASS	.																																			SO:0001589	frameshift_variant	5690	exon2			.	D26599	CCDS394.1, CCDS72755.1	1p34.2	2008-02-05			ENSG00000126067	ENSG00000126067		"""Proteasome (prosome, macropain) subunits"""	9539	protein-coding gene	gene with protein product		602175				7918633	Standard	NM_002794		Approved	HC7-I	uc001bzf.2	P49721	OTTHUMG00000004169	ENST00000373237.3:c.139_140delGT	1.37:g.36101989_36101990delAC	ENSP00000362334:p.Val47fs	247.0	0.0	.		181.0	54.0	0.298	NM_002794	D3DPS0|P31145|Q9BWZ9	Frame_Shift_Del	DEL	ENST00000373237.3	37	CCDS394.1																																																																																			.	.	none		0.381	PSMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012016.1	NM_002794	
C7orf55-LUC7L2	100996928	hgsc.bcm.edu	37	7	139102385	139102385	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:139102385delG	ENST00000354926.4	+	9	1265	c.911delG	c.(910-912)aggfs	p.R304fs	C7orf55-LUC7L2_ENST00000541170.3_Frame_Shift_Del_p.R301fs|LUC7L2_ENST00000541515.3_Frame_Shift_Del_p.R370fs|C7orf55-LUC7L2_ENST00000482860.1_3'UTR|C7orf55-LUC7L2_ENST00000263545.6_Frame_Shift_Del_p.R303fs	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		CATCGCCACAGGTCCCGCTCC	0.562																																					p.R370fs		Pindel,Atlas-Indel	.											.	.	.	.	0			c.1108delA						PASS	.						56.0	67.0	63.0					7																	139102385		2127	4228	6355	SO:0001589	frameshift_variant	100996928	exon10			.		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.911delG	7.37:g.139102385delG	ENSP00000347005:p.Arg304fs	81.0	0.0	.		59.0	32.0	0.542	NM_001244584		Frame_Shift_Del	DEL	ENST00000354926.4	37	CCDS43656.1																																																																																			.	.	none		0.562	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
TENC1	23371	hgsc.bcm.edu	37	12	53454755	53454756	+	Frame_Shift_Ins	INS	-	-	C	rs376940195|rs372006021		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:53454755_53454756insC	ENST00000314250.6	+	20	3355_3356	c.3065_3066insC	c.(3064-3069)ggccccfs	p.GP1022fs	TENC1_ENST00000379902.3_Frame_Shift_Ins_p.GP898fs|TENC1_ENST00000451358.1_Frame_Shift_Ins_p.GP1012fs|TENC1_ENST00000546602.1_Frame_Shift_Ins_p.GP925fs|TENC1_ENST00000552570.1_Frame_Shift_Ins_p.GP1022fs|TENC1_ENST00000314276.3_Frame_Shift_Ins_p.GP1032fs|TENC1_ENST00000549700.1_Frame_Shift_Ins_p.GP957fs	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	1022	Pro-rich.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						GGCCCTCGAGGCCCCCCCGACA	0.688																																					p.G1032fs		Pindel,Atlas-Indel	.											.	TENC1	148	.	0			c.3095_3096insC						PASS	.																																			SO:0001589	frameshift_variant	23371	exon20			.	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.3072dupC	12.37:g.53454762_53454762dupC	ENSP00000319684:p.Gly1022fs	53.0	0.0	.		76.0	18.0	0.237	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Frame_Shift_Ins	INS	ENST00000314250.6	37	CCDS8843.1																																																																																			.	.	none		0.688	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
CCDC108	255101	hgsc.bcm.edu	37	2	219883882	219883883	+	Frame_Shift_Ins	INS	-	-	G	rs568903495|rs189561241	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:219883882_219883883insG	ENST00000341552.5	-	21	3575_3576	c.3492_3493insC	c.(3490-3495)cccgtcfs	p.V1165fs	CCDC108_ENST00000453220.1_Frame_Shift_Ins_p.V1165fs|CCDC108_ENST00000441968.1_Frame_Shift_Ins_p.V1165fs	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1165						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGGTGAGGACGGGGGGGATCT	0.614																																					p.V1165fs		Pindel,Atlas-Indel	.											.	CCDC108	208	.	0			c.3493_3494insC						PASS	.			4,4248		0,4,2122						-2.8	0.0			53	5,8229		0,5,4112	no	frameshift	CCDC108	NM_194302.2		0,9,6234	A1A1,A1R,RR		0.0607,0.0941,0.0721				9,12477				SO:0001589	frameshift_variant	255101	exon21			.	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.3493dupC	2.37:g.219883889_219883889dupG	ENSP00000340776:p.Val1165fs	91.0	0.0	.		94.0	30.0	0.319	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Frame_Shift_Ins	INS	ENST00000341552.5	37	CCDS2430.2																																																																																			.	.	none		0.614	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
EZR	7430	hgsc.bcm.edu	37	6	159188112	159188113	+	Splice_Site	DEL	TG	TG	-			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:159188112_159188113delTG	ENST00000367075.3	-	14	1765		c.e14-2		EZR_ENST00000392177.4_Splice_Site|MIR3918_ENST00000581555.1_RNA|EZR_ENST00000337147.7_Splice_Site	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin						actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GCTCAGCGTCTGTAACATTAAG	0.579			T	ROS1	NSCLC																																.		Pindel,Atlas-Indel	.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	44	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	7430	.			.	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1597-2CA>-	6.37:g.159188112_159188113delTG		191.0	0.0	.		111.0	52.0	0.468	.	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Splice_Site	DEL	ENST00000367075.3	37	CCDS5258.1																																																																																			.	.	none		0.579	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	Intron
MBD3L1	85509	hgsc.bcm.edu	37	19	8953842	8953845	+	Frame_Shift_Del	DEL	CAGT	CAGT	-			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	CAGT	CAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:8953842_8953845delCAGT	ENST00000595891.1	+	3	719_722	c.488_491delCAGT	c.(487-492)acagtcfs	p.TV163fs	MBD3L1_ENST00000305625.2_Frame_Shift_Del_p.TV163fs			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						AAAGTGAAGACAGTCAGAGAGAGA	0.471																																					p.163_164del		Pindel,Atlas-Indel	.											.	MBD3L1	24	.	0			c.487_490del						PASS	.																																			SO:0001589	frameshift_variant	85509	exon1			.	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.488_491delCAGT	19.37:g.8953842_8953845delCAGT	ENSP00000471575:p.Thr163fs	58.0	0.0	.		70.0	16.0	0.229	NM_145208	B5BUM6|Q2M291	Frame_Shift_Del	DEL	ENST00000595891.1	37	CCDS12209.1																																																																																			.	.	none		0.471	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459973.1	NM_145208	
HIST1H2BJ	8970	hgsc.bcm.edu	37	6	27100189	27100219	+	Frame_Shift_Del	DEL	TCGGACACGGCGTGCTTGGCCAACTCCCCAG	TCGGACACGGCGTGCTTGGCCAACTCCCCAG	-	rs2272811|rs145874703	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	TCGGACACGGCGTGCTTGGCCAACTCCCCAG	TCGGACACGGCGTGCTTGGCCAACTCCCCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:27100189_27100219delTCGGACACGGCGTGCTTGGCCAACTCCCCAG	ENST00000607124.1	-	1	310_340	c.311_341delCTGGGGAGTTGGCCAAGCACGCCGTGTCCGA	c.(310-342)cctggggagttggccaagcacgccgtgtccgagfs	p.PGELAKHAVSE104fs	HIST1H2BJ_ENST00000541790.1_Frame_Shift_Del_p.PGELAKHAVSE104fs|HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000339812.2_Frame_Shift_Del_p.PGELAKHAVSE104fs			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	104					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E114K(1)		breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						CTTAGTACCCTCGGACACGGCGTGCTTGGCCAACTCCCCAGGCAGCAGCAG	0.584																																					p.104_114del		Pindel	.											HIST1H2BJ,NS,malignant_melanoma,-2,3	HIST1H2BJ	21	3	1	Substitution - Missense(1)	breast(1)	c.312_342del						PASS	.																																			SO:0001589	frameshift_variant	8970	exon1			.	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.311_341delCTGGGGAGTTGGCCAAGCACGCCGTGTCCGA	6.37:g.27100189_27100219delTCGGACACGGCGTGCTTGGCCAACTCCCCAG	ENSP00000476136:p.Pro104fs	99.0	0.0	.		72.0	13.0	0.181	NM_021058	B2R4J4|O60816	Frame_Shift_Del	DEL	ENST00000607124.1	37	CCDS4618.1																																																																																			.	.	none		0.584	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040138.2	NM_021058	
XRCC5	7520	hgsc.bcm.edu	37	2	216983663	216983769	+	Splice_Site	DEL	AGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	AGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	-	rs55885859|rs201183966|rs560904622|rs181615100|rs375440774|rs575986003		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	AGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	AGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:216983663_216983769delAGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	ENST00000392133.3	+	7	829_833	c.368_372delAGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA	c.(367-372)aagatc>a	p.KI123fs	XRCC5_ENST00000392132.2_Splice_Site_p.KI123fs			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	123					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TATTAACTCTAGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGAAAGAAGTTTG	0.322								Non-homologous end-joining																													p.123_124del		Pindel	.											.	XRCC5	64	.	0			c.369_371del						PASS	.																																			SO:0001630	splice_region_variant	7520	exon5			.	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.369-1AGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA>-	2.37:g.216983663_216983769delAGATCCATTTCTAAGCTTCTCTCCTCAGTGACCAAGTGTATTTGAATTTGTAGAAAAATAATTCAGGAGAATGATTTCTTAATATGATAACTCTCTCTTTTAGAGGA		178.0	0.0	.		136.0	37.0	0.272	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	In_Frame_Del	DEL	ENST00000392133.3	37	CCDS2402.1																																																																																			.	.	none		0.322	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	Frame_Shift_Del
TFDP3	51270	hgsc.bcm.edu	37	X	132351082	132351082	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:132351082G>A	ENST00000310125.4	-	1	1294	c.1206C>T	c.(1204-1206)gaC>gaT	p.D402D		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	402	Asp/Glu-rich (acidic; NCB domain).				cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					AGTCATCCTCGTCATTCTCAC	0.468																																					p.D402D		Atlas-SNP	.											.	TFDP3	92	.	0			c.C1206T						PASS	.						86.0	85.0	85.0					X																	132351082		2198	4290	6488	SO:0001819	synonymous_variant	51270	exon1			ATCCTCGTCATTC	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.1206C>T	X.37:g.132351082G>A		115.0	0.0	0		52.0	41.0	0.788462	NM_016521	Q6DK49|Q9NZ54	Silent	SNP	ENST00000310125.4	37	CCDS14636.2																																																																																			.	.	none		0.468	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521	
SCNN1G	6340	hgsc.bcm.edu	37	16	23200702	23200702	+	Missense_Mutation	SNP	G	G	A	rs147276737	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr16:23200702G>A	ENST00000300061.2	+	3	471	c.328G>A	c.(328-330)Gtt>Att	p.V110I		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	110					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	GTACAGCACCGTTCGCCACCT	0.607													G|||	3	0.000599042	0.0	0.0	5008	,	,		17010	0.0		0.0	False		,,,				2504	0.0031				p.V110I		Atlas-SNP	.											.	SCNN1G	82	.	0			c.G328A						PASS	.	G	ILE/VAL	1,4393	2.1+/-5.4	0,1,2196	65.0	68.0	67.0		328	6.0	0.1	16	dbSNP_134	67	0,8600		0,0,4300	yes	missense	SCNN1G	NM_001039.3	29	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	benign	110/650	23200702	1,12993	2197	4300	6497	SO:0001583	missense	6340	exon3			AGCACCGTTCGCC	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.328G>A	16.37:g.23200702G>A	ENSP00000300061:p.Val110Ile	27.0	0.0	0		25.0	13.0	0.52	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	37	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	G	2.346	-0.349973	0.05173	2.28E-4	0.0	ENSG00000166828	ENST00000300061	T	0.63096	-0.02	6.04	6.04	0.98038	.	0.247869	0.34603	N	0.003824	T	0.39009	0.1062	N	0.11927	0.2	0.27873	N	0.939975	B	0.24882	0.113	B	0.15484	0.013	T	0.20472	-1.0274	10	0.11485	T	0.65	-2.2978	10.7521	0.46216	0.0889:0.0:0.9111:0.0	.	110	P51170	SCNNG_HUMAN	I	110	ENSP00000300061:V110I	ENSP00000300061:V110I	V	+	1	0	SCNN1G	23108203	0.998000	0.40836	0.088000	0.20740	0.251000	0.25915	3.219000	0.51200	2.873000	0.98535	0.561000	0.74099	GTT	G|1.000;A|0.000	0.000	weak		0.607	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
MUC4	4585	hgsc.bcm.edu	37	3	195518119	195518119	+	Missense_Mutation	SNP	A	A	T	rs201789760		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:195518119A>T	ENST00000463781.3	-	2	791	c.332T>A	c.(331-333)aTg>aAg	p.M111K	MUC4_ENST00000475231.1_Missense_Mutation_p.M111K|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	111					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGCTGTCTCCATCACATTGTG	0.463																																					p.M111K		Atlas-SNP	.											.	MUC4	1505	.	0			c.T332A						PASS	.						173.0	151.0	158.0					3																	195518119		2001	4135	6136	SO:0001583	missense	4585	exon2			GTCTCCATCACAT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.332T>A	3.37:g.195518119A>T	ENSP00000417498:p.Met111Lys	166.0	0.0	0		1321.0	97.0	0.0734292	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.439	-0.114540	0.06881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.32023	1.47;1.47	3.35	-0.681	0.11342	.	2.861300	0.01499	N	0.017426	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B	0.27997	0.197	B	0.27500	0.08	T	0.14035	-1.0487	10	0.05959	T	0.93	0.0033	3.9454	0.09346	0.3204:0.1801:0.4995:0.0	.	111	E7ESK3	.	K	111;111;85	ENSP00000417498:M111K;ENSP00000420243:M111K	ENSP00000376209:M85K	M	-	2	0	MUC4	197002514	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.773000	0.01786	-0.150000	0.11195	-1.819000	0.00600	ATG	.	.	weak		0.463	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SEMA6D	80031	hgsc.bcm.edu	37	15	48062799	48062799	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr15:48062799G>C	ENST00000316364.5	+	19	2478	c.2039G>C	c.(2038-2040)gGt>gCt	p.G680A	SEMA6D_ENST00000354744.4_Missense_Mutation_p.G624A|SEMA6D_ENST00000389433.2_Missense_Mutation_p.G661A|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000358066.4_Missense_Mutation_p.G618A|SEMA6D_ENST00000389432.2_Missense_Mutation_p.G637A|SEMA6D_ENST00000536845.2_Missense_Mutation_p.G680A|SEMA6D_ENST00000537942.1_Missense_Mutation_p.G618A|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000389428.3_Missense_Mutation_p.G605A|SEMA6D_ENST00000558014.1_Missense_Mutation_p.G618A	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	680					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTCATTGCAGGTGTGGCAGTA	0.483																																					p.G680A		Atlas-SNP	.											SEMA6D_ENST00000558014,NS,adenocarcinoma,0,2	SEMA6D	322	2	0			c.G2039C						PASS	.						140.0	134.0	136.0					15																	48062799		2198	4297	6495	SO:0001583	missense	80031	exon19			TTGCAGGTGTGGC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2039G>C	15.37:g.48062799G>C	ENSP00000324857:p.Gly680Ala	258.0	1.0	0.00387597		173.0	141.0	0.815029	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021097	0.75275	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.84220	0.5424	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	0.993;0.993;1.0;0.993	P;P;D;P	0.91635	0.822;0.822;0.999;0.822	D	0.83718	0.0191	10	0.62326	D	0.03	.	20.5141	0.99211	0.0:0.0:1.0:0.0	.	605;624;680;618	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	A	618;680;680;661;637;624;618;605	ENSP00000442040:G618A;ENSP00000446152:G680A;ENSP00000324857:G680A;ENSP00000374084:G661A;ENSP00000374083:G637A;ENSP00000346786:G624A;ENSP00000350770:G618A;ENSP00000374079:G605A	ENSP00000324857:G680A	G	+	2	0	SEMA6D	45850091	1.000000	0.71417	0.947000	0.38551	0.934000	0.57294	7.515000	0.81761	2.850000	0.98022	0.655000	0.94253	GGT	.	.	none		0.483	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
C6orf211	79624	hgsc.bcm.edu	37	6	151789707	151789707	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:151789707T>A	ENST00000367294.3	+	5	1047	c.788T>A	c.(787-789)tTa>tAa	p.L263*	C6orf211_ENST00000545879.1_Nonsense_Mutation_p.L144*	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	263										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GTTACAGATTTAATATTAGCC	0.348																																					p.L263X		Atlas-SNP	.											.	C6orf211	30	.	0			c.T788A						PASS	.						134.0	139.0	137.0					6																	151789707		2203	4300	6503	SO:0001587	stop_gained	79624	exon5			CAGATTTAATATT	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.788T>A	6.37:g.151789707T>A	ENSP00000356263:p.Leu263*	353.0	0.0	0		194.0	154.0	0.793814	NM_024573	Q96FC6|Q9UFY5	Nonsense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	T	37	6.256437	0.97417	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	.	.	.	6.02	6.02	0.97574	.	0.264665	0.33075	N	0.005317	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	.	.	.	X	263;144	.	ENSP00000356263:L263X	L	+	2	0	C6orf211	151831400	1.000000	0.71417	0.593000	0.28771	0.819000	0.46315	7.963000	0.87922	2.299000	0.77371	0.528000	0.53228	TTA	.	.	none		0.348	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
BRCA1	672	hgsc.bcm.edu	37	17	41234477	41234477	+	Missense_Mutation	SNP	C	C	T	rs80357790		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:41234477C>T	ENST00000357654.3	-	12	4419	c.4301G>A	c.(4300-4302)aGt>aAt	p.S1434N	BRCA1_ENST00000309486.4_Missense_Mutation_p.S1138N|BRCA1_ENST00000352993.3_Missense_Mutation_p.S292N|BRCA1_ENST00000354071.3_Missense_Mutation_p.S1434N|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.S1434N|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.S1387N|BRCA1_ENST00000351666.3_Missense_Mutation_p.S251N|BRCA1_ENST00000468300.1_Missense_Mutation_p.S331N|BRCA1_ENST00000346315.3_Missense_Mutation_p.S1434N|BRCA1_ENST00000491747.2_Missense_Mutation_p.S331N	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1434					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGAAGAGTCACTTATGATGGA	0.438			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.S1434N		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	BRCA1,colon,carcinoma,+1,1	BRCA1	304	1	0			c.G4301A	GRCh37	CI992787	BRCA1	I	rs80357790	PASS	.						231.0	200.0	211.0					17																	41234477		2203	4300	6503	SO:0001583	missense	672	exon12	Familial Cancer Database		GAGTCACTTATGA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4301G>A	17.37:g.41234477C>T	ENSP00000350283:p.Ser1434Asn	135.0	0.0	0		113.0	67.0	0.59292	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	37	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.24|13.24	2.177284|2.177284	0.38413|0.38413	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825|ENST00000461574	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.56444|.	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46|.	5.36|5.36	-0.256|-0.256	0.12984|0.12984	.|.	1.181740|.	0.06245|.	N|.	0.691021|.	T|T	0.15046|0.15046	0.0363|0.0363	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.25007|.	0.023;0.026;0.007;0.116;0.007;0.003;0.007;0.005|.	B;B;B;B;B;B;B;B|.	0.26310|.	0.006;0.022;0.003;0.068;0.006;0.006;0.006;0.014|.	T|T	0.27297|0.27297	-1.0078|-1.0078	10|5	0.87932|.	D|.	0|.	0.1751|0.1751	4.5419|4.5419	0.12061|0.12061	0.0744:0.3923:0.3021:0.2313|0.0744:0.3923:0.3021:0.2313	.|.	330;284;330;331;331;1434;1434;1434|.	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;BRCA1_HUMAN;.|.	N|M	1434;1434;1434;292;1434;251;1138;331;284;1434;1387;330;330;205;284;206|199	ENSP00000350283:S1434N;ENSP00000326002:S1434N;ENSP00000312236:S292N;ENSP00000246907:S1434N;ENSP00000338007:S251N;ENSP00000310938:S1138N;ENSP00000417148:S331N;ENSP00000377294:S284N;ENSP00000418960:S1434N;ENSP00000418775:S1387N;ENSP00000420412:S330N;ENSP00000419481:S205N;ENSP00000418819:S284N;ENSP00000418212:S206N|.	ENSP00000310938:S1138N|.	S|V	-|-	2|1	0|0	BRCA1|BRCA1	38488003|38488003	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.169000|0.169000	0.22640|0.22640	-0.157000|-0.157000	0.10085|0.10085	-0.122000|-0.122000	0.11766|0.11766	-0.133000|-0.133000	0.14855|0.14855	AGT|GTG	.	.	none		0.438	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
EXOC7	23265	hgsc.bcm.edu	37	17	74093984	74093984	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:74093984T>A	ENST00000335146.7	-	5	586	c.533A>T	c.(532-534)gAt>gTt	p.D178V	EXOC7_ENST00000332065.5_Missense_Mutation_p.D178V|EXOC7_ENST00000589210.1_Missense_Mutation_p.D178V|EXOC7_ENST00000607838.1_Missense_Mutation_p.D178V|EXOC7_ENST00000467929.2_Missense_Mutation_p.D137V|EXOC7_ENST00000411744.2_Missense_Mutation_p.D178V|EXOC7_ENST00000405575.4_Missense_Mutation_p.D178V			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	178					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			CTCCAGATCATCGTCACCACT	0.622																																					p.D178V		Atlas-SNP	.											.	EXOC7	47	.	0			c.A533T						PASS	.						118.0	99.0	105.0					17																	74093984		2203	4300	6503	SO:0001583	missense	23265	exon5			AGATCATCGTCAC	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.533A>T	17.37:g.74093984T>A	ENSP00000334100:p.Asp178Val	77.0	0.0	0		120.0	45.0	0.375	NM_001145298	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739769	0.69304	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744;ENST00000405068;ENST00000420116	.	.	.	4.99	4.99	0.66335	Cullin repeat-like-containing domain (1);	0.157795	0.56097	D	0.000037	T	0.50956	0.1646	L	0.34521	1.04	0.80722	D	1	B;B;B;B;P;B;P;B	0.48089	0.04;0.001;0.007;0.244;0.675;0.043;0.905;0.073	B;B;B;B;B;B;P;B	0.50270	0.233;0.007;0.037;0.224;0.228;0.117;0.636;0.18	T	0.49123	-0.8972	9	0.38643	T	0.18	-16.317	13.4177	0.60979	0.0:0.0:0.0:1.0	.	178;178;137;137;178;178;178;178	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5-4;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;.;EXOC7_HUMAN;.;.	V	178;98;178;178;178;137;178;178;63	.	ENSP00000333806:D178V	D	-	2	0	EXOC7	71605579	1.000000	0.71417	0.266000	0.24541	0.420000	0.31355	5.760000	0.68793	2.101000	0.63845	0.460000	0.39030	GAT	.	.	none		0.622	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
COL21A1	81578	hgsc.bcm.edu	37	6	55939040	55939040	+	Missense_Mutation	SNP	G	G	T	rs368711091	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:55939040G>T	ENST00000244728.5	-	20	2352	c.1955C>A	c.(1954-1956)cCg>cAg	p.P652Q	COL21A1_ENST00000535941.1_Missense_Mutation_p.P652Q|COL21A1_ENST00000370819.1_Missense_Mutation_p.P649Q|COL21A1_ENST00000370808.2_Missense_Mutation_p.P52Q|COL21A1_ENST00000467045.1_5'UTR	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	652					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTTAGATCCCGGTGTTCCAGG	0.328																																					p.P652Q		Atlas-SNP	.											.	COL21A1	201	.	0			c.C1955A						PASS	.						87.0	86.0	86.0					6																	55939040		1810	4063	5873	SO:0001583	missense	81578	exon20			GATCCCGGTGTTC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1955C>A	6.37:g.55939040G>T	ENSP00000244728:p.Pro652Gln	123.0	0.0	0		204.0	69.0	0.338235	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585584	0.28268	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.98684	-5.07;-4.1;-5.07;-5.07	4.56	3.66	0.41972	.	0.246146	0.28161	N	0.016380	D	0.97673	0.9237	M	0.66506	2.035	0.26532	N	0.974238	B;B;D	0.69078	0.102;0.062;0.997	B;B;P	0.59703	0.031;0.014;0.862	D	0.94533	0.7738	10	0.42905	T	0.14	.	9.9388	0.41567	0.0:0.0:0.7963:0.2037	.	52;652;652	Q96P44-2;B7ZLK3;Q96P44	.;.;COLA1_HUMAN	Q	652;649;652;649;52	ENSP00000244728:P652Q;ENSP00000359855:P649Q;ENSP00000444384:P652Q;ENSP00000359844:P52Q	ENSP00000244728:P652Q	P	-	2	0	COL21A1	56046999	0.999000	0.42202	0.516000	0.27786	0.808000	0.45660	2.261000	0.43276	0.962000	0.38057	0.655000	0.94253	CCG	.	.	alt		0.328	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
SPATA17	128153	hgsc.bcm.edu	37	1	217915347	217915347	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:217915347A>T	ENST00000366933.4	+	6	481	c.426A>T	c.(424-426)aaA>aaT	p.K142N		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	142						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		CAGAAATGAAAGAAAGAGAAG	0.393																																					p.K142N		Atlas-SNP	.											.	SPATA17	59	.	0			c.A426T						PASS	.						122.0	113.0	116.0					1																	217915347		2203	4300	6503	SO:0001583	missense	128153	exon6			AATGAAAGAAAGA	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.426A>T	1.37:g.217915347A>T	ENSP00000355900:p.Lys142Asn	44.0	0.0	0		37.0	34.0	0.918919	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.308373	0.40895	.	.	ENSG00000162814	ENST00000366933	T	0.47869	0.83	5.84	2.25	0.28309	.	0.498628	0.23552	N	0.046960	T	0.34308	0.0893	L	0.41027	1.25	0.30875	N	0.732086	B	0.14438	0.01	B	0.14578	0.011	T	0.26052	-1.0114	10	0.40728	T	0.16	-9.0478	6.8947	0.24249	0.6022:0.0:0.3978:0.0	.	142	Q96L03	SPT17_HUMAN	N	142	ENSP00000355900:K142N	ENSP00000355900:K142N	K	+	3	2	SPATA17	215981970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.766000	0.26560	0.483000	0.27608	0.533000	0.62120	AAA	.	.	none		0.393	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
SMCR8	140775	hgsc.bcm.edu	37	17	18220580	18220580	+	Missense_Mutation	SNP	C	C	T	rs113043428		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:18220580C>T	ENST00000406438.3	+	1	1957	c.1477C>T	c.(1477-1479)Ctc>Ttc	p.L493F	TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	493						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CCAGGCAAGCCTCACAGTACC	0.517																																					p.L493F		Atlas-SNP	.											.	SMCR8	62	.	0			c.C1477T						PASS	.						58.0	61.0	60.0					17																	18220580		2203	4300	6503	SO:0001583	missense	140775	exon1			GCAAGCCTCACAG	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1477C>T	17.37:g.18220580C>T	ENSP00000385025:p.Leu493Phe	53.0	0.0	0		29.0	24.0	0.827586	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	C	15.01	2.705015	0.48412	.	.	ENSG00000176994	ENST00000406438	T	0.26223	1.75	5.73	4.68	0.58851	.	0.165285	0.39020	N	0.001492	T	0.30978	0.0782	L	0.32530	0.975	0.34570	D	0.713376	D	0.71674	0.998	P	0.61940	0.896	T	0.32824	-0.9892	10	0.44086	T	0.13	-37.0014	6.4655	0.21980	0.0:0.7155:0.0:0.2845	.	493	Q8TEV9	SMCR8_HUMAN	F	493	ENSP00000385025:L493F	ENSP00000385025:L493F	L	+	1	0	SMCR8	18161305	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.932000	0.40143	2.700000	0.92200	0.655000	0.94253	CTC	C|0.500;T|0.500	0.500	weak		0.517	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
CXorf22	170063	hgsc.bcm.edu	37	X	35970007	35970007	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:35970007A>T	ENST00000297866.5	+	6	1039	c.973A>T	c.(973-975)Atc>Ttc	p.I325F		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	325										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TACTATCATTATCTCCTGTCT	0.284																																					p.I325F		Atlas-SNP	.											.	CXorf22	272	.	0			c.A973T						PASS	.						56.0	54.0	55.0					X																	35970007		2194	4246	6440	SO:0001583	missense	170063	exon6			ATCATTATCTCCT	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.973A>T	X.37:g.35970007A>T	ENSP00000297866:p.Ile325Phe	876.0	0.0	0		782.0	311.0	0.397698	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066679	0.55539	.	.	ENSG00000165164	ENST00000297866	T	0.60040	0.22	5.76	4.57	0.56435	.	0.189713	0.46758	N	0.000266	T	0.67050	0.2852	M	0.74258	2.255	0.32724	N	0.509944	D	0.64830	0.994	D	0.65010	0.931	T	0.68853	-0.5299	10	0.02654	T	1	-22.2371	10.4909	0.44750	0.8525:0.0:0.0:0.1475	.	325	Q6ZTR5	CX022_HUMAN	F	325	ENSP00000297866:I325F	ENSP00000297866:I325F	I	+	1	0	CXorf22	35879928	1.000000	0.71417	0.915000	0.36163	0.503000	0.33858	3.555000	0.53727	0.766000	0.33244	0.417000	0.27973	ATC	.	.	none		0.284	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810612	65810612	+	Missense_Mutation	SNP	G	G	T	rs35285455	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:65810612G>T	ENST00000312006.4	-	3	943	c.662C>A	c.(661-663)gCc>gAc	p.A221D	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.A221D	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	221			A -> D (in dbSNP:rs35285455).		monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						CAGGTAGGCGGCGTCGTCGCG	0.657													G|||	66	0.0131789	0.0242	0.0101	5008	,	,		9967	0.0		0.0189	False		,,,				2504	0.0082				p.A221D		Atlas-SNP	.											GAL3ST3,rectum,carcinoma,0,3	GAL3ST3	40	3	0			c.C662A						PASS	.	G	ASP/ALA	81,4313		1,79,2117	31.0	37.0	35.0		662	2.6	1.0	11	dbSNP_126	35	157,8411		1,155,4128	yes	missense	GAL3ST3	NM_033036.2	126	2,234,6245	TT,TG,GG		1.8324,1.8434,1.8361	benign	221/432	65810612	238,12724	2197	4284	6481	SO:0001583	missense	89792	exon3			TAGGCGGCGTCGT	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.662C>A	11.37:g.65810612G>T	ENSP00000308591:p.Ala221Asp	87.0	0.0	0		67.0	19.0	0.283582	NM_033036	Q14D05	Missense_Mutation	SNP	ENST00000312006.4	37	CCDS8128.1	21	0.009615384615384616	6	0.012195121951219513	2	0.0055248618784530384	0	0.0	13	0.017150395778364115	G	7.938	0.742112	0.15642	0.018434	0.018324	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.14391	2.51;2.51	4.51	2.57	0.30868	.	0.445001	0.22406	N	0.060466	T	0.02012	0.0063	N	0.02158	-0.66	0.32668	N	0.517241	B	0.02656	0.0	B	0.01281	0.0	T	0.32375	-0.9909	10	0.14656	T	0.56	-4.5024	9.826	0.40912	0.0:0.0:0.6262:0.3738	rs35285455	221	Q96A11	G3ST3_HUMAN	D	221	ENSP00000308591:A221D;ENSP00000434829:A221D	ENSP00000308591:A221D	A	-	2	0	GAL3ST3	65567188	0.040000	0.19996	0.968000	0.41197	0.996000	0.88848	0.659000	0.24994	0.417000	0.25871	0.561000	0.74099	GCC	G|0.983;T|0.017	0.017	strong		0.657	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
CARD11	84433	hgsc.bcm.edu	37	7	2983971	2983971	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:2983971G>A	ENST00000396946.4	-	5	962	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	187					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TAGCTGTCCCGCTCTTCCTTC	0.557			Mis		DLBCL																																p.R187W		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	CARD11,NS,carcinoma,0,1	CARD11	339	1	0			c.C559T						scavenged	.						248.0	154.0	186.0					7																	2983971		2203	4300	6503	SO:0001583	missense	84433	exon5			TGTCCCGCTCTTC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.559C>T	7.37:g.2983971G>A	ENSP00000380150:p.Arg187Trp	190.0	1.0	0.00526316		260.0	106.0	0.407692	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710363	0.48517	.	.	ENSG00000198286	ENST00000396946	T	0.36157	1.27	4.46	2.25	0.28309	.	0.000000	0.85682	D	0.000000	T	0.19765	0.0475	N	0.20881	0.62	0.52099	D	0.999945	B	0.27971	0.196	B	0.17722	0.019	T	0.05632	-1.0873	10	0.37606	T	0.19	-27.5118	7.2254	0.26012	0.0992:0.0:0.6097:0.2911	.	187	Q9BXL7	CAR11_HUMAN	W	187	ENSP00000380150:R187W	ENSP00000380150:R187W	R	-	1	2	CARD11	2950497	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	2.135000	0.42112	1.000000	0.39049	0.561000	0.74099	CGG	.	.	none		0.557	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
QARS	5859	hgsc.bcm.edu	37	3	49136098	49136098	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:49136098C>A	ENST00000306125.6	-	20	2228	c.1891G>T	c.(1891-1893)Gct>Tct	p.A631S	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Missense_Mutation_p.A620S			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	631					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	TGGCCCCAAGCCAGGCGCTTA	0.582																																					p.A631S		Atlas-SNP	.											.	QARS	55	.	0			c.G1891T						PASS	.						17.0	19.0	18.0					3																	49136098		2202	4299	6501	SO:0001583	missense	5859	exon20			CCCAAGCCAGGCG	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1891G>T	3.37:g.49136098C>A	ENSP00000307567:p.Ala631Ser	53.0	0.0	0		58.0	14.0	0.241379	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992316	0.35131	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.25250	1.81;1.81	5.74	3.95	0.45737	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.052310	0.85682	D	0.000000	T	0.21227	0.0511	L	0.46567	1.45	0.80722	D	1	B;B	0.27997	0.197;0.197	B;B	0.26614	0.071;0.071	T	0.04537	-1.0944	10	0.38643	T	0.18	-7.9256	8.9136	0.35568	0.0:0.7747:0.0:0.2253	.	620;631	B4DWJ2;P47897	.;SYQ_HUMAN	S	151;631;620	ENSP00000307567:A631S;ENSP00000390015:A620S	ENSP00000307567:A631S	A	-	1	0	QARS	49111102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.822000	0.48073	1.429000	0.47314	0.561000	0.74099	GCT	.	.	none		0.582	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
OR10A4	283297	hgsc.bcm.edu	37	11	6898788	6898788	+	Missense_Mutation	SNP	C	C	T	rs146085036	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:6898788C>T	ENST00000379829.2	+	1	933	c.910C>T	c.(910-912)Cgg>Tgg	p.R304W		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	304					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGCACTGAAGCGGCTTATCCA	0.448													C|||	2	0.000399361	0.0	0.0	5008	,	,		19920	0.002		0.0	False		,,,				2504	0.0				p.R304W		Atlas-SNP	.											.	OR10A4	65	.	0			c.C910T						PASS	.		TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	82.0	82.0	82.0		910	2.0	0.1	11	dbSNP_134	82	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR10A4	NM_207186.2	101	0,2,6495	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	304/316	6898788	2,12992	2201	4296	6497	SO:0001583	missense	283297	exon1			CTGAAGCGGCTTA	AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.910C>T	11.37:g.6898788C>T	ENSP00000369157:p.Arg304Trp	75.0	0.0	0		44.0	26.0	0.590909	NM_207186	B2RNP5|B9EH36|Q96R20	Missense_Mutation	SNP	ENST00000379829.2	37	CCDS7774.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	11.99	1.802297	0.31869	2.27E-4	1.16E-4	ENSG00000170782	ENST00000379829	T	0.41758	0.99	3.99	2.01	0.26516	.	0.000000	0.40385	N	0.001120	T	0.39172	0.1068	M	0.65975	2.015	0.20563	N	0.999889	B	0.18968	0.032	B	0.20184	0.028	T	0.42599	-0.9442	10	0.87932	D	0	.	8.8618	0.35263	0.4398:0.5602:0.0:0.0	.	304	Q9H209	O10A4_HUMAN	W	304	ENSP00000369157:R304W	ENSP00000369157:R304W	R	+	1	2	OR10A4	6855364	0.001000	0.12720	0.064000	0.19789	0.163000	0.22366	1.026000	0.30103	0.580000	0.29522	0.651000	0.88453	CGG	C|1.000;T|0.000	0.000	strong		0.448	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186	
CHD3	1107	hgsc.bcm.edu	37	17	7798425	7798425	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:7798425T>C	ENST00000330494.7	+	9	1610	c.1460T>C	c.(1459-1461)cTg>cCg	p.L487P	CHD3_ENST00000358181.4_Missense_Mutation_p.L487P|CHD3_ENST00000380358.4_Missense_Mutation_p.L546P	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	487					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				AACCCTCCCCTGCCTGACATT	0.557																																					p.L546P		Atlas-SNP	.											.	CHD3	169	.	0			c.T1637C						PASS	.						257.0	184.0	209.0					17																	7798425		2203	4300	6503	SO:0001583	missense	1107	exon9			CTCCCCTGCCTGA	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1460T>C	17.37:g.7798425T>C	ENSP00000332628:p.Leu487Pro	80.0	0.0	0		51.0	37.0	0.72549	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077973	0.36662	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	T;T;T	0.55930	0.49;0.49;0.49	5.01	5.01	0.66863	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Chromo domain-like (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.32231	N	0.006382	T	0.80844	0.4701	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.87113	0.2186	10	0.87932	D	0	-13.9037	14.5551	0.68094	0.0:0.0:0.0:1.0	.	487;487;546	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	P	546;487;487	ENSP00000369716:L546P;ENSP00000350907:L487P;ENSP00000332628:L487P	ENSP00000332628:L487P	L	+	2	0	CHD3	7739150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.110000	0.64415	0.459000	0.35465	CTG	.	.	none		0.557	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
NUMBL	9253	hgsc.bcm.edu	37	19	41173904	41173904	+	Silent	SNP	T	T	C	rs79658769		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:41173904T>C	ENST00000252891.4	-	10	1466	c.1299A>G	c.(1297-1299)caA>caG	p.Q433Q	NUMBL_ENST00000540131.1_Silent_p.Q392Q|NUMBL_ENST00000598779.1_Silent_p.Q392Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	433	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgttgctgttgctgctgct	0.662																																					p.Q433Q		Atlas-SNP	.											NUMBL,colon,carcinoma,0,2	NUMBL	49	2	0			c.A1299G						scavenged	.						8.0	8.0	8.0					19																	41173904		2119	4125	6244	SO:0001819	synonymous_variant	9253	exon10			TTGCTGTTGCTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1299A>G	19.37:g.41173904T>C		28.0	1.0	0.0357143		23.0	8.0	0.347826	NM_004756	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			C|1.000;|0.000	1.000	weak		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
KMT2D	8085	hgsc.bcm.edu	37	12	49427324	49427324	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:49427324G>A	ENST00000301067.7	-	39	11163	c.11164C>T	c.(11164-11166)Cag>Tag	p.Q3722*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3722	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGCTGCAGCTGCAGCTGCCTT	0.592																																					p.Q3722X		Atlas-SNP	.											.	MLL2	1173	.	0			c.C11164T						PASS	.						23.0	28.0	27.0					12																	49427324		2182	4289	6471	SO:0001587	stop_gained	8085	exon39			GCAGCTGCAGCTG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11164C>T	12.37:g.49427324G>A	ENSP00000301067:p.Gln3722*	42.0	0.0	0		38.0	25.0	0.657895	NM_003482	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	51	18.529697	0.99906	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.11	5.11	0.69529	.	0.000000	0.33180	N	0.005192	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6784	0.88236	0.0:0.0:1.0:0.0	.	.	.	.	X	3722	.	ENSP00000301067:Q3722X	Q	-	1	0	MLL2	47713591	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.317000	0.96327	2.547000	0.85894	0.462000	0.41574	CAG	.	.	none		0.592	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CD8B	926	hgsc.bcm.edu	37	2	87085358	87085358	+	Silent	SNP	G	G	A	rs139740563		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:87085358G>A	ENST00000390655.6	-	2	283	c.225C>T	c.(223-225)tcC>tcT	p.S75S	CD8B_ENST00000393761.2_Silent_p.S75S|CD8B_ENST00000331469.2_Silent_p.S75S|CD8B_ENST00000431506.2_Intron|CD8B_ENST00000349455.3_Silent_p.S75S|CD8B_ENST00000393759.2_Silent_p.S75S	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	75	Ig-like V-type.				immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						TCCCTTTTGCGGAATCCCAGA	0.547																																					p.S75S		Atlas-SNP	.											.	CD8B	37	.	0			c.C225T						PASS	.						111.0	100.0	103.0					2																	87085358		2203	4300	6503	SO:0001819	synonymous_variant	926	exon2			TTTTGCGGAATCC		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.225C>T	2.37:g.87085358G>A		248.0	0.0	0		331.0	69.0	0.208459	NM_004931	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			G|0.999;A|0.001	0.001	weak		0.547	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
HARBI1	283254	hgsc.bcm.edu	37	11	46637180	46637180	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:46637180A>G	ENST00000326737.3	-	2	855	c.608T>C	c.(607-609)cTg>cCg	p.L203P	ATG13_ENST00000451945.1_5'Flank|ATG13_ENST00000434074.1_5'Flank|ATG13_ENST00000529655.1_5'Flank|ATG13_ENST00000530500.1_5'Flank|ATG13_ENST00000526508.1_5'Flank|ATG13_ENST00000312040.4_5'Flank|ATG13_ENST00000524625.1_5'Flank|ATG13_ENST00000528494.1_5'Flank|ATG13_ENST00000359513.4_5'Flank	NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	203						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						AGACTGCTGCAGCACAGCACA	0.493																																					p.L203P		Atlas-SNP	.											.	HARBI1	19	.	0			c.T608C						PASS	.						115.0	118.0	117.0					11																	46637180		2201	4299	6500	SO:0001583	missense	283254	exon2			TGCTGCAGCACAG	AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.608T>C	11.37:g.46637180A>G	ENSP00000317743:p.Leu203Pro	142.0	0.0	0		125.0	75.0	0.6	NM_173811	D3DQP9	Missense_Mutation	SNP	ENST00000326737.3	37	CCDS7920.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158679	0.78226	.	.	ENSG00000180423	ENST00000326737	.	.	.	5.23	5.23	0.72850	.	0.141737	0.48767	D	0.000171	D	0.83663	0.5303	M	0.89601	3.045	0.80722	D	1	D	0.58970	0.984	D	0.64237	0.923	D	0.87380	0.2356	9	0.72032	D	0.01	-12.4836	15.1287	0.72503	1.0:0.0:0.0:0.0	.	203	Q96MB7	HARB1_HUMAN	P	203	.	ENSP00000317743:L203P	L	-	2	0	HARBI1	46593756	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	8.918000	0.92759	1.967000	0.57214	0.533000	0.62120	CTG	.	.	none		0.493	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390291.1	NM_173811	
NEFH	4744	hgsc.bcm.edu	37	22	29884844	29884844	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr22:29884844C>T	ENST00000310624.6	+	4	1248	c.1215C>T	c.(1213-1215)ctC>ctT	p.L405L		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	405	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GCAGAAAACTCCTGGAAGGTG	0.463																																					p.L405L		Atlas-SNP	.											.	NEFH	178	.	0			c.C1215T						PASS	.						71.0	74.0	73.0					22																	29884844		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			AAAACTCCTGGAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1215C>T	22.37:g.29884844C>T		75.0	0.0	0		57.0	22.0	0.385965	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.	.	none		0.463	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
OR14I1	401994	hgsc.bcm.edu	37	1	248845140	248845140	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:248845140C>T	ENST00000342623.3	-	1	489	c.466G>A	c.(466-468)Gtc>Atc	p.V156I		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						CCAGTGTGGACGGCTGCGTAG	0.547																																					p.V156I		Atlas-SNP	.											.	OR14I1	64	.	0			c.G466A						PASS	.						91.0	81.0	84.0					1																	248845140		2203	4300	6503	SO:0001583	missense	401994	exon1			TGTGGACGGCTGC		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.466G>A	1.37:g.248845140C>T	ENSP00000339726:p.Val156Ile	107.0	0.0	0		138.0	27.0	0.195652	NM_001004734		Missense_Mutation	SNP	ENST00000342623.3	37	CCDS31125.1	.	.	.	.	.	.	.	.	.	.	.	11.09	1.535424	0.27475	.	.	ENSG00000189181	ENST00000342623	T	0.37058	1.22	3.48	-2.84	0.05751	GPCR, rhodopsin-like superfamily (1);	0.376195	0.19197	N	0.120265	T	0.16085	0.0387	N	0.25201	0.72	0.09310	N	1	B	0.23937	0.094	B	0.22880	0.042	T	0.08229	-1.0732	10	0.32370	T	0.25	.	1.6843	0.02838	0.3234:0.2438:0.3194:0.1135	.	156	A6ND48	O14I1_HUMAN	I	156	ENSP00000339726:V156I	ENSP00000339726:V156I	V	-	1	0	OR14I1	246911763	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-3.169000	0.00574	-0.144000	0.11314	0.536000	0.68110	GTC	.	.	none		0.547	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734	
UBALD2	283991	hgsc.bcm.edu	37	17	74262008	74262008	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:74262008C>T	ENST00000327490.6	+	2	445	c.141C>T	c.(139-141)ttC>ttT	p.F47F	UBALD2_ENST00000589240.1_5'UTR	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	47																	GCACGTTCTTCCAAGAAACCA	0.701																																					p.F47F		Atlas-SNP	.											.	.	.	.	0			c.C141T						PASS	.						31.0	28.0	29.0					17																	74262008		2199	4297	6496	SO:0001819	synonymous_variant	283991	exon2			GTTCTTCCAAGAA		CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.141C>T	17.37:g.74262008C>T		62.0	0.0	0		57.0	10.0	0.175439	NM_182565		Silent	SNP	ENST00000327490.6	37	CCDS11742.1																																																																																			.	.	none		0.701	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255920.1	NM_182565	
RAPH1	65059	hgsc.bcm.edu	37	2	204305402	204305402	+	Silent	SNP	C	C	T	rs144494517	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:204305402C>T	ENST00000319170.5	-	14	2810	c.2511G>A	c.(2509-2511)ccG>ccA	p.P837P	RAPH1_ENST00000374493.3_Silent_p.P889P|ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	837					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTAATGTTGGCGGGGGTACTG	0.582													C|||	4	0.000798722	0.0015	0.0014	5008	,	,		8603	0.0		0.001	False		,,,				2504	0.0				p.P837P		Atlas-SNP	.											.	RAPH1	118	.	0			c.G2511A						PASS	.	C		1,4403		0,1,2201	44.0	52.0	50.0		2511	-5.8	0.0	2	dbSNP_134	50	1,8599		0,1,4299	no	coding-synonymous	RAPH1	NM_213589.1		0,2,6500	TT,TC,CC		0.0116,0.0227,0.0154		837/1251	204305402	2,13002	2202	4300	6502	SO:0001819	synonymous_variant	65059	exon14			TGTTGGCGGGGGT	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.2511G>A	2.37:g.204305402C>T		40.0	0.0	0		78.0	15.0	0.192308	NM_213589	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1																																																																																			C|0.999;T|0.001	0.001	strong		0.582	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
ZNF536	9745	hgsc.bcm.edu	37	19	30934652	30934652	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:30934652C>T	ENST00000355537.3	+	2	330	c.183C>T	c.(181-183)ccC>ccT	p.P61P		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	61					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.P61P(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGAAGCCCCCCGCATCCCTGG	0.672																																					p.P61P		Atlas-SNP	.											.	ZNF536	424	.	1	Substitution - coding silent(1)	lung(1)	c.C183T						PASS	.						40.0	44.0	42.0					19																	30934652		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon2			GCCCCCCGCATCC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.183C>T	19.37:g.30934652C>T		33.0	0.0	0		45.0	11.0	0.244444	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																			.	.	none		0.672	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
CPS1	1373	hgsc.bcm.edu	37	2	211481148	211481148	+	Splice_Site	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:211481148C>A	ENST00000233072.5	+	21	2766	c.2570C>A	c.(2569-2571)gCc>gAc	p.A857D	CPS1_ENST00000451903.2_Splice_Site_p.A406D|CPS1_ENST00000430249.2_Splice_Site_p.A863D	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	857					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCTTGGCAGGCCATTGATGAC	0.353																																					p.A863D		Atlas-SNP	.											.	CPS1	485	.	0			c.C2588A						PASS	.						151.0	148.0	149.0					2																	211481148		2203	4300	6503	SO:0001630	splice_region_variant	1373	exon22			GGCAGGCCATTGA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2569-1C>A	2.37:g.211481148C>A		65.0	0.0	0		57.0	21.0	0.368421	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653451	0.67472	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.99070	-5.39;-5.39;-5.39	5.41	5.41	0.78517	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.096332	0.64402	D	0.000001	D	0.99518	0.9828	H	0.97315	3.98	0.49051	D	0.999744	D;D	0.71674	0.998;0.998	D;D	0.66351	0.943;0.943	D	0.98128	1.0429	10	0.87932	D	0	-0.0201	15.0894	0.72180	0.0:0.8586:0.1414:0.0	.	867;857	Q59HF8;P31327	.;CPSM_HUMAN	D	863;865;857;406	ENSP00000402608:A863D;ENSP00000233072:A857D;ENSP00000406136:A406D	ENSP00000233072:A857D	A	+	2	0	CPS1	211189393	1.000000	0.71417	0.981000	0.43875	0.626000	0.37791	7.198000	0.77823	2.686000	0.91538	0.655000	0.94253	GCC	.	.	none		0.353	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		Missense_Mutation
FST	10468	hgsc.bcm.edu	37	5	52778714	52778714	+	Silent	SNP	G	G	C	rs201482393	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:52778714G>C	ENST00000256759.3	+	2	473	c.90G>C	c.(88-90)ggG>ggC	p.G30G	FST_ENST00000396947.3_Silent_p.G30G	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	30	TB.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				TCACAGCTGGGAACTGCTGGC	0.652											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G30G		Atlas-SNP	.											.	FST	42	.	0			c.G90C						PASS	.						39.0	37.0	38.0					5																	52778714		2203	4300	6503	SO:0001819	synonymous_variant	10468	exon2			AGCTGGGAACTGC	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.90G>C	5.37:g.52778714G>C		150.0	0.0	0	987	127.0	34.0	0.267717	NM_013409	B5BU94|Q9BTH0	Silent	SNP	ENST00000256759.3	37	CCDS3959.1																																																																																			G|1.000;T|0.000	.	alt		0.652	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409	
DACH2	117154	hgsc.bcm.edu	37	X	85950135	85950135	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:85950135G>T	ENST00000373125.4	+	5	884	c.884G>T	c.(883-885)gGt>gTt	p.G295V	DACH2_ENST00000373131.1_Missense_Mutation_p.G282V|DACH2_ENST00000510272.1_Missense_Mutation_p.G76V|DACH2_ENST00000508860.1_Missense_Mutation_p.G128V	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	295					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GGCATTGGGGGTGCTCCAACC	0.498																																					p.G295V		Atlas-SNP	.											.	DACH2	263	.	0			c.G884T						PASS	.						64.0	47.0	53.0					X																	85950135		2203	4300	6503	SO:0001583	missense	117154	exon5			TTGGGGGTGCTCC	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.884G>T	X.37:g.85950135G>T	ENSP00000362217:p.Gly295Val	332.0	0.0	0		678.0	152.0	0.224189	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	g	0.282	-0.985447	0.02180	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.81996	-1.56;-1.56	4.99	3.16	0.36331	.	0.450888	0.22302	N	0.061844	T	0.64560	0.2609	N	0.11427	0.14	0.44780	D	0.997788	B;B;B	0.30236	0.085;0.274;0.091	B;B;B	0.27887	0.022;0.084;0.007	T	0.53739	-0.8396	10	0.27082	T	0.32	.	8.6822	0.34216	0.0813:0.0:0.767:0.1516	.	161;282;295	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	V	295;282;295;128;76;128	ENSP00000362223:G282V;ENSP00000362217:G295V	ENSP00000345134:G295V	G	+	2	0	DACH2	85836791	1.000000	0.71417	0.012000	0.15200	0.005000	0.04900	3.040000	0.49799	0.320000	0.23234	0.509000	0.49947	GGT	.	.	none		0.498	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
TRIM77	390231	hgsc.bcm.edu	37	11	89444662	89444662	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:89444662G>A	ENST00000398290.3	+	2	496	c.496G>A	c.(496-498)Gga>Aga	p.G166R		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	166						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										CAACATAATCGGAACATGGGA	0.363																																					p.G166R		Atlas-SNP	.											.	.	.	.	0			c.G496A						PASS	.						118.0	104.0	108.0					11																	89444662		692	1591	2283	SO:0001583	missense	390231	exon2			ATAATCGGAACAT		CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.496G>A	11.37:g.89444662G>A	ENSP00000474003:p.Gly166Arg	353.0	1.0	0.00283286		353.0	104.0	0.294618	NM_001146162		Missense_Mutation	SNP	ENST00000398290.3	37																																																																																				.	.	none		0.363	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146162	
SLC16A10	117247	hgsc.bcm.edu	37	6	111543327	111543327	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:111543327G>A	ENST00000368851.5	+	6	1612	c.1437G>A	c.(1435-1437)gaG>gaA	p.E479E	SLC16A10_ENST00000368850.3_Silent_p.E165E	NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	479					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	AGCAAAGAGAGATCAGTAAAA	0.433																																					p.E479E		Atlas-SNP	.											SLC16A10,NS,carcinoma,+2,1	SLC16A10	33	1	0			c.G1437A						PASS	.						127.0	127.0	127.0					6																	111543327		2203	4300	6503	SO:0001819	synonymous_variant	117247	exon6			AAGAGAGATCAGT	AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.1437G>A	6.37:g.111543327G>A		196.0	1.0	0.00510204		152.0	118.0	0.776316	NM_018593	B3KWY0|Q6ZMG0|Q8WVI5	Silent	SNP	ENST00000368851.5	37	CCDS5089.1																																																																																			.	.	none		0.433	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041822.2		
RIPK4	54101	hgsc.bcm.edu	37	21	43161043	43161043	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr21:43161043G>A	ENST00000352483.2	-	9	2518	c.2454C>T	c.(2452-2454)ggC>ggT	p.G818G	RIPK4_ENST00000544709.1_Silent_p.G707G|RIPK4_ENST00000542057.1_Silent_p.G707G|RIPK4_ENST00000332512.3_Silent_p.G770G|AP001615.9_ENST00000423276.1_RNA			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	818					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GGCCATGGCCGCCCTGGAACT	0.697																																					p.G770G		Atlas-SNP	.											.	RIPK4	151	.	0			c.C2310T						PASS	.						31.0	31.0	31.0					21																	43161043		2200	4294	6494	SO:0001819	synonymous_variant	54101	exon8			ATGGCCGCCCTGG	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2454C>T	21.37:g.43161043G>A		48.0	0.0	0		105.0	57.0	0.542857	NM_020639	Q96KH0	Silent	SNP	ENST00000352483.2	37																																																																																				.	.	none		0.697	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
MACROD1	28992	hgsc.bcm.edu	37	11	63884662	63884662	+	Intron	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:63884662C>T	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.T308M	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						AACCTGACCACGCTGCCCCGC	0.617																																					p.T308M		Atlas-SNP	.											.	FLRT1	46	.	0			c.C923T						PASS	.						56.0	48.0	51.0					11																	63884662		2201	4297	6498	SO:0001627	intron_variant	23769	exon2			TGACCACGCTGCC	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34048G>A	11.37:g.63884662C>T		85.0	0.0	0		65.0	34.0	0.523077	NM_013280	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	37	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848171	0.32699	.	.	ENSG00000126500	ENST00000246841	T	0.59906	0.23	5.07	3.14	0.36123	.	0.133754	0.49305	D	0.000152	T	0.60805	0.2297	L	0.57536	1.79	0.50039	D	0.99984	D	0.61697	0.99	P	0.56042	0.79	T	0.55425	-0.8143	10	0.20519	T	0.43	-19.8004	8.6572	0.34071	0.1515:0.767:0.0:0.0815	.	280	Q9NZU1	FLRT1_HUMAN	M	308	ENSP00000246841:T308M	ENSP00000246841:T308M	T	+	2	0	FLRT1	63641238	0.849000	0.29639	0.841000	0.33234	0.916000	0.54674	1.646000	0.37249	0.492000	0.27815	0.484000	0.47621	ACG	.	.	none		0.617	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
ZNF440	126070	hgsc.bcm.edu	37	19	11941439	11941439	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:11941439G>T	ENST00000304060.5	+	3	302	c.138G>T	c.(136-138)agG>agT	p.R46S		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	46	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TAGGAAAAAGGTGGAAAGACC	0.363																																					p.R46S		Atlas-SNP	.											.	ZNF440	56	.	0			c.G138T						PASS	.						85.0	85.0	85.0					19																	11941439		2203	4300	6503	SO:0001583	missense	126070	exon3			AAAAAGGTGGAAA	AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.138G>T	19.37:g.11941439G>T	ENSP00000305373:p.Arg46Ser	434.0	1.0	0.00230415		452.0	207.0	0.457965	NM_152357	Q8N1R9	Missense_Mutation	SNP	ENST00000304060.5	37	CCDS42503.1	.	.	.	.	.	.	.	.	.	.	t	0.012	-1.686073	0.00738	.	.	ENSG00000171295	ENST00000304060;ENST00000427505;ENST00000414255	T;T;T	0.00776	5.71;5.71;5.71	1.15	-2.29	0.06805	Krueppel-associated box (3);	.	.	.	.	T	0.00384	0.0012	N	0.03268	-0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42882	-0.9425	9	0.16896	T	0.51	.	0.5479	0.00657	0.1891:0.1734:0.3025:0.335	.	46	Q8IYI8	ZN440_HUMAN	S	46;49;48	ENSP00000305373:R46S;ENSP00000393489:R49S;ENSP00000411974:R48S	ENSP00000305373:R46S	R	+	3	2	ZNF440	11802439	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-2.503000	0.00965	-2.524000	0.00495	-2.989000	0.00078	AGG	.	.	none		0.363	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357	
NHS	4810	hgsc.bcm.edu	37	X	17750129	17750129	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:17750129G>A	ENST00000380060.3	+	8	4776	c.4438G>A	c.(4438-4440)Ggt>Agt	p.G1480S	NHS_ENST00000398097.3_Missense_Mutation_p.G1324S	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1501	Poly-Ser.				cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GAGGTCTCCTGGTCTCATATA	0.493																																					p.G1480S		Atlas-SNP	.											.	NHS	302	.	0			c.G4438A						PASS	.						155.0	136.0	142.0					X																	17750129		2203	4300	6503	SO:0001583	missense	4810	exon8			TCTCCTGGTCTCA		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4438G>A	X.37:g.17750129G>A	ENSP00000369400:p.Gly1480Ser	134.0	0.0	0		127.0	35.0	0.275591	NM_198270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793800	0.90453	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.61392	0.11;0.13	5.79	5.79	0.91817	.	0.102979	0.64402	D	0.000003	T	0.73651	0.3614	M	0.68952	2.095	0.58432	D	0.999999	D;D;D;D	0.69078	0.976;0.976;0.976;0.997	P;P;P;D	0.74348	0.698;0.698;0.698;0.983	T	0.68191	-0.5474	10	0.19147	T	0.46	-19.5354	18.9979	0.92821	0.0:0.0:1.0:0.0	.	1501;1322;1324;1480	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	S	1480;1324;1322	ENSP00000369400:G1480S;ENSP00000381170:G1324S	ENSP00000369397:G1322S	G	+	1	0	NHS	17660050	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.404000	0.79996	2.435000	0.82474	0.600000	0.82982	GGT	.	.	none		0.493	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
BCL11B	64919	hgsc.bcm.edu	37	14	99641823	99641823	+	Silent	SNP	C	C	T	rs375880436		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr14:99641823C>T	ENST00000357195.3	-	4	1359	c.1350G>A	c.(1348-1350)acG>acA	p.T450T	BCL11B_ENST00000345514.2_Silent_p.T379T|BCL11B_ENST00000443726.2_Silent_p.T256T	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	450					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GCTTCTCGCCCGTGTGACTGC	0.647			T	TLX3	T-ALL																																p.T450T		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.G1350A						PASS	.	C	,	1,4403	2.1+/-5.4	0,1,2201	29.0	29.0	29.0		1137,1350	0.4	1.0	14		29	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	BCL11B	NM_022898.1,NM_138576.2	,	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	,	379/824,450/895	99641823	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	64919	exon4			CTCGCCCGTGTGA	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1350G>A	14.37:g.99641823C>T		91.0	0.0	0		58.0	38.0	0.655172	NM_138576	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.	.	weak		0.647	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
DIS3L2	129563	hgsc.bcm.edu	37	2	233001289	233001289	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:233001289C>T	ENST00000360410.4	+	9	1145	c.869C>T	c.(868-870)cCt>cTt	p.P290L	DIS3L2_ENST00000273009.6_Silent_p.P270P|DIS3L2_ENST00000325385.7_Silent_p.P270P|DIS3L2_ENST00000409307.1_Silent_p.P270P					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		TGTTTTCTCCCTCAGACCACC	0.483																																					p.P270P		Atlas-SNP	.											.	DIS3L2	77	.	0			c.C810T						PASS	.						196.0	181.0	186.0					2																	233001289		1890	4127	6017	SO:0001583	missense	129563	exon8			TTCTCCCTCAGAC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000360410.4:c.869C>T	2.37:g.233001289C>T	ENSP00000353584:p.Pro290Leu	139.0	0.0	0		160.0	61.0	0.38125	NM_152383		Silent	SNP	ENST00000360410.4	37		.	.	.	.	.	.	.	.	.	.	C	18.38	3.611078	0.66558	.	.	ENSG00000144535	ENST00000360410	T	0.41758	0.99	6.07	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.50394	0.1613	.	.	.	0.36177	D	0.849142	.	.	.	.	.	.	T	0.58346	-0.7652	7	0.87932	D	0	-18.9098	8.845	0.35164	0.0:0.5387:0.0:0.4613	.	.	.	.	L	290	ENSP00000353584:P290L	ENSP00000353584:P290L	P	+	2	0	DIS3L2	232709533	0.559000	0.26562	0.999000	0.59377	0.998000	0.95712	-0.207000	0.09384	0.234000	0.21139	0.585000	0.79938	CCT	.	.	none		0.483	DIS3L2-202	KNOWN	basic	protein_coding	protein_coding		NM_152383	
CD320	51293	hgsc.bcm.edu	37	19	8369939	8369939	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:8369939C>G	ENST00000301458.5	-	2	308	c.244G>C	c.(244-246)Gat>Cat	p.D82H	CD320_ENST00000537716.2_Intron|CD320_ENST00000596246.1_5'Flank	NM_016579.3	NP_057663.1	Q9NPF0	CD320_HUMAN	CD320 molecule	82	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cobalamin metabolic process (GO:0009235)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)	6						TCGCTGCCATCGCTGCAGTCC	0.687																																					p.D82H		Atlas-SNP	.											.	CD320	20	.	0			c.G244C						PASS	.						50.0	48.0	49.0					19																	8369939		2203	4300	6503	SO:0001583	missense	51293	exon2			TGCCATCGCTGCA	AF161254	CCDS12198.1, CCDS54210.1	19p13.3-p13.2	2008-02-05	2006-03-28			ENSG00000167775		"""CD molecules"""	16692	protein-coding gene	gene with protein product	"""8D6 antigen"""	606475	"""CD320 antigen"""			10727470	Standard	NM_016579		Approved	8D6, 8D6A	uc002mjj.2	Q9NPF0		ENST00000301458.5:c.244G>C	19.37:g.8369939C>G	ENSP00000301458:p.Asp82His	15.0	0.0	0		26.0	9.0	0.346154	NM_016579	B2RDS5|D6W668|F5H6D3|Q53HF7	Missense_Mutation	SNP	ENST00000301458.5	37	CCDS12198.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860981	0.51482	.	.	ENSG00000167775	ENST00000301458	D	0.97620	-4.46	4.87	4.87	0.63330	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.136815	0.33591	N	0.004757	D	0.98741	0.9577	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99184	1.0868	10	0.87932	D	0	-17.2415	14.2342	0.65913	0.0:1.0:0.0:0.0	.	82	Q9NPF0	CD320_HUMAN	H	82	ENSP00000301458:D82H	ENSP00000301458:D82H	D	-	1	0	CD320	8275939	0.938000	0.31826	0.648000	0.29521	0.001000	0.01503	2.947000	0.49058	2.644000	0.89710	0.655000	0.94253	GAT	.	.	none		0.687	CD320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461366.1	NM_016579	
IL6	3569	hgsc.bcm.edu	37	7	22767218	22767218	+	Missense_Mutation	SNP	T	T	C	rs201822486		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:22767218T>C	ENST00000404625.1	+	3	634	c.175T>C	c.(175-177)Tac>Cac	p.Y59H	AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000407492.1_Intron|IL6_ENST00000420258.2_Missense_Mutation_p.Y113H|IL6_ENST00000406575.1_Missense_Mutation_p.Y59H|IL6_ENST00000258743.5_Missense_Mutation_p.Y59H|IL6_ENST00000401630.3_Missense_Mutation_p.Y36H|IL6_ENST00000401651.1_Intron			P05231	IL6_HUMAN	interleukin 6	59					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	ACAAATTCGGTACATCCTCGA	0.582																																					p.Y59H	Esophageal Squamous(47;342 1214 13936 33513)	Atlas-SNP	.											.	IL6	30	.	0			c.T175C						PASS	.						105.0	100.0	102.0					7																	22767218		2203	4300	6503	SO:0001583	missense	3569	exon2			ATTCGGTACATCC	M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.175T>C	7.37:g.22767218T>C	ENSP00000385675:p.Tyr59His	53.0	0.0	0		132.0	80.0	0.606061	NM_000600	Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	ENST00000404625.1	37	CCDS5375.1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.232174	0.39498	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000401630;ENST00000406575	T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26	5.73	-5.7	0.02421	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.669760	0.02407	N	0.081299	T	0.11110	0.0271	N	0.16903	0.455	0.09310	N	1	B;B;B	0.27882	0.192;0.152;0.039	B;B;B	0.36719	0.231;0.133;0.037	T	0.28235	-1.0050	10	0.25751	T	0.34	-1.1849	5.1132	0.14821	0.2499:0.4044:0.0:0.3457	.	113;59;59	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	H	59;59;59;113;36;59	ENSP00000385675:Y59H;ENSP00000405150:Y59H;ENSP00000258743:Y59H;ENSP00000405994:Y113H;ENSP00000384928:Y36H;ENSP00000385227:Y59H	ENSP00000258743:Y59H	Y	+	1	0	IL6	22733743	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.787000	0.04618	-0.714000	0.04975	-0.375000	0.07067	TAC	.	.	weak		0.582	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600	
PARP12	64761	hgsc.bcm.edu	37	7	139734083	139734083	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:139734083C>T	ENST00000263549.3	-	8	2246	c.1373G>A	c.(1372-1374)cGc>cAc	p.R458H	PARP12_ENST00000470515.1_5'UTR	NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	458	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					TTTGGGTCTGCGGCAAACCTT	0.443																																					p.R458H		Atlas-SNP	.											.	PARP12	59	.	0			c.G1373A						PASS	.						86.0	79.0	81.0					7																	139734083		2203	4300	6503	SO:0001583	missense	64761	exon8			GGTCTGCGGCAAA	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1373G>A	7.37:g.139734083C>T	ENSP00000263549:p.Arg458His	116.0	0.0	0		100.0	36.0	0.36	NM_022750	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	C	32	5.110229	0.94292	.	.	ENSG00000059378	ENST00000263549;ENST00000489809	T;T	0.72725	-0.25;-0.68	5.84	5.84	0.93424	WWE domain (1);	0.000000	0.85682	D	0.000000	D	0.86752	0.6008	M	0.87180	2.865	0.53688	D	0.999975	D	0.89917	1.0	D	0.87578	0.998	D	0.88096	0.2816	10	0.72032	D	0.01	.	18.3385	0.90297	0.0:1.0:0.0:0.0	.	458	Q9H0J9	PAR12_HUMAN	H	458;96	ENSP00000263549:R458H;ENSP00000417606:R96H	ENSP00000263549:R458H	R	-	2	0	PARP12	139380552	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.991000	0.70602	2.767000	0.95098	0.555000	0.69702	CGC	.	.	none		0.443	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
MAGT1	84061	hgsc.bcm.edu	37	X	77112935	77112935	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:77112935C>T	ENST00000358075.6	-	4	632	c.546G>A	c.(544-546)cgG>cgA	p.R182R		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	150					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						ATGTATCACCCCGTTTGGGTT	0.423																																					p.R182R		Atlas-SNP	.											.	MAGT1	51	.	0			c.G546A						PASS	.						148.0	137.0	141.0					X																	77112935		2203	4296	6499	SO:0001819	synonymous_variant	84061	exon4			ATCACCCCGTTTG		CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.546G>A	X.37:g.77112935C>T		182.0	0.0	0		146.0	16.0	0.109589	NM_032121	B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Silent	SNP	ENST00000358075.6	37	CCDS14436.2																																																																																			.	.	none		0.423	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121	
MAP1B	4131	hgsc.bcm.edu	37	5	71495764	71495764	+	Silent	SNP	G	G	A	rs368060624		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:71495764G>A	ENST00000296755.7	+	5	6880	c.6582G>A	c.(6580-6582)acG>acA	p.T2194T		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2194					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAACTGTCACGTACAAACACA	0.587																																					p.T2194T	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.G6582A						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	142.0	128.0	133.0		6582	-11.9	0.1	5		133	0,8600		0,0,4300	no	coding-synonymous	MAP1B	NM_005909.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		2194/2469	71495764	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4131	exon5			TGTCACGTACAAA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6582G>A	5.37:g.71495764G>A		53.0	0.0	0		56.0	23.0	0.410714	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																			.	.	weak		0.587	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
SMG5	23381	hgsc.bcm.edu	37	1	156221239	156221239	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:156221239T>C	ENST00000361813.5	-	20	2927	c.2783A>G	c.(2782-2784)aAg>aGg	p.K928R	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	928	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CTCAAAGCTCTTTCCCACCTC	0.557																																					p.K928R		Atlas-SNP	.											.	SMG5	98	.	0			c.A2783G						PASS	.						200.0	193.0	195.0					1																	156221239		2203	4300	6503	SO:0001583	missense	23381	exon20			AAGCTCTTTCCCA	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2783A>G	1.37:g.156221239T>C	ENSP00000355261:p.Lys928Arg	118.0	0.0	0		128.0	24.0	0.1875	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886395	0.33348	.	.	ENSG00000198952	ENST00000361813	T	0.29142	1.58	4.56	4.56	0.56223	Nucleotide binding protein, PINc (1);	0.065325	0.64402	D	0.000017	T	0.05364	0.0142	N	0.04508	-0.205	0.80722	D	1	B	0.21381	0.055	B	0.19391	0.025	T	0.19582	-1.0301	10	0.08381	T	0.77	-14.5089	13.2101	0.59819	0.0:0.0:0.0:1.0	.	928	Q9UPR3	SMG5_HUMAN	R	928	ENSP00000355261:K928R	ENSP00000355261:K928R	K	-	2	0	SMG5	154487863	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	2.513000	0.45494	2.062000	0.61559	0.459000	0.35465	AAG	.	.	none		0.557	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
KCNJ8	3764	hgsc.bcm.edu	37	12	21918851	21918851	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:21918851T>G	ENST00000240662.2	-	3	1426	c.1081A>C	c.(1081-1083)Aaa>Caa	p.K361Q	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	361					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	ATGGAAGGTTTCTCATCCAGC	0.458																																					p.K361Q		Atlas-SNP	.											.	KCNJ8	59	.	0			c.A1081C						PASS	.						145.0	145.0	145.0					12																	21918851		2203	4300	6503	SO:0001583	missense	3764	exon3			AAGGTTTCTCATC	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.1081A>C	12.37:g.21918851T>G	ENSP00000240662:p.Lys361Gln	275.0	0.0	0		164.0	9.0	0.054878	NM_004982	O00657	Missense_Mutation	SNP	ENST00000240662.2	37	CCDS8692.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.913406	0.72983	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.94138	-3.36	5.43	5.43	0.79202	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.94275	0.8161	L	0.48986	1.54	0.54753	D	0.99998	D	0.55800	0.973	P	0.58266	0.836	D	0.92996	0.6419	10	0.29301	T	0.29	.	15.6454	0.77046	0.0:0.0:0.0:1.0	.	361	Q15842	IRK8_HUMAN	Q	361	ENSP00000240662:K361Q	ENSP00000240662:K361Q	K	-	1	0	KCNJ8	21810118	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.010000	0.70753	2.279000	0.76181	0.533000	0.62120	AAA	.	.	none		0.458	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
RGS14	10636	hgsc.bcm.edu	37	5	176795190	176795190	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:176795190C>T	ENST00000408923.3	+	8	960	c.772C>T	c.(772-774)Cga>Tga	p.R258*		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	258					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCTTGCGCCGAGAGTCTCA	0.632																																					p.R258X	NSCLC(47;353 1896 28036)	Atlas-SNP	.											.	RGS14	34	.	0			c.C772T						PASS	.						56.0	61.0	60.0					5																	176795190		2014	4168	6182	SO:0001587	stop_gained	10636	exon8			TTGCGCCGAGAGT	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.772C>T	5.37:g.176795190C>T	ENSP00000386229:p.Arg258*	33.0	0.0	0		65.0	10.0	0.153846	NM_006480	O43565|Q506M1|Q6ZWA4|Q8TD62	Nonsense_Mutation	SNP	ENST00000408923.3	37	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607138	0.87157	.	.	ENSG00000169220	ENST00000408923	.	.	.	4.14	1.12	0.20585	.	0.072462	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.6275	13.4062	0.60915	0.5852:0.4148:0.0:0.0	.	.	.	.	X	258	.	ENSP00000386229:R258X	R	+	1	2	RGS14	176727796	0.164000	0.22935	0.937000	0.37676	0.925000	0.55904	-0.314000	0.08092	0.010000	0.14839	0.491000	0.48974	CGA	.	.	none		0.632	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43846488	43846488	+	Missense_Mutation	SNP	C	C	T	rs375621283		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:43846488C>T	ENST00000389420.3	-	13	1770	c.1771G>A	c.(1771-1773)Gga>Aga	p.G591R	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.G591R	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	591	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G591R(2)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TAATTTCCTCCGTTTCTTGGC	0.393																																					p.G591R		Atlas-SNP	.											ADAMTS20_ENST00000389420,NS,malignant_melanoma,0,4	ADAMTS20	635	4	2	Substitution - Missense(2)	skin(2)	c.G1771A						PASS	.	C	ARG/GLY	0,4406		0,0,2203	60.0	52.0	55.0		1771	4.7	1.0	12		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADAMTS20	NM_025003.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	591/1911	43846488	1,13005	2203	4300	6503	SO:0001583	missense	80070	exon13			TTCCTCCGTTTCT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1771G>A	12.37:g.43846488C>T	ENSP00000374071:p.Gly591Arg	76.0	0.0	0		86.0	41.0	0.476744	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692176	0.88735	0.0	1.16E-4	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.09163	3.01;3.01	4.7	4.7	0.59300	.	0.000000	0.49916	D	0.000124	T	0.47655	0.1457	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65516	-0.6149	10	0.87932	D	0	.	18.5382	0.91018	0.0:1.0:0.0:0.0	.	591	P59510	ATS20_HUMAN	R	591	ENSP00000374071:G591R;ENSP00000448341:G591R	ENSP00000374068:G591R	G	-	1	0	ADAMTS20	42132755	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.536000	0.85505	0.563000	0.77884	GGA	.	.	weak		0.393	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
PIK3CG	5294	hgsc.bcm.edu	37	7	106523531	106523531	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:106523531A>G	ENST00000359195.3	+	8	2993	c.2683A>G	c.(2683-2685)Aca>Gca	p.T895A	PIK3CG_ENST00000496166.1_Missense_Mutation_p.T895A|PIK3CG_ENST00000440650.2_Missense_Mutation_p.T895A	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	895	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TCAGCAAAGCACAGTGGGCAA	0.463																																					p.T895A		Atlas-SNP	.											.	PIK3CG	279	.	0			c.A2683G						PASS	.						159.0	155.0	156.0					7																	106523531		2203	4300	6503	SO:0001583	missense	5294	exon8			CAAAGCACAGTGG		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.2683A>G	7.37:g.106523531A>G	ENSP00000352121:p.Thr895Ala	80.0	0.0	0		70.0	30.0	0.428571	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348050	0.24426	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000473541;ENST00000359195	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.1	5.1	0.69264	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.097763	0.64402	D	0.000001	T	0.68430	0.3000	N	0.25890	0.77	0.54753	D	0.999984	B	0.11235	0.004	B	0.20384	0.029	T	0.62793	-0.6779	10	0.07325	T	0.83	-20.0097	15.0634	0.71973	1.0:0.0:0.0:0.0	.	895	P48736	PK3CG_HUMAN	A	895;895;168;895	ENSP00000392258:T895A;ENSP00000419260:T895A;ENSP00000417623:T168A;ENSP00000352121:T895A	ENSP00000352121:T895A	T	+	1	0	PIK3CG	106310767	1.000000	0.71417	0.995000	0.50966	0.872000	0.50106	6.652000	0.74377	2.131000	0.65755	0.459000	0.35465	ACA	.	.	none		0.463	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
MGAM	8972	hgsc.bcm.edu	37	7	141805676	141805676	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:141805676G>T	ENST00000549489.2	+	48	5654	c.5559G>T	c.(5557-5559)tgG>tgT	p.W1853C	MGAM_ENST00000475668.2_Missense_Mutation_p.W2749C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1853					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CATTGACGTGGATAAGCACTC	0.348																																					p.W1853C		Atlas-SNP	.											.	MGAM	767	.	0			c.G5559T						PASS	.						122.0	115.0	117.0					7																	141805676		1854	4099	5953	SO:0001583	missense	8972	exon48			GACGTGGATAAGC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5559G>T	7.37:g.141805676G>T	ENSP00000447378:p.Trp1853Cys	161.0	0.0	0		122.0	44.0	0.360656	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133003	0.56828	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.90133	-2.62	5.43	4.56	0.56223	.	.	.	.	.	D	0.94420	0.8205	M	0.84683	2.71	0.45150	D	0.998161	D	0.67145	0.996	D	0.63033	0.91	D	0.94592	0.7788	9	0.87932	D	0	.	10.0176	0.42024	0.0904:0.0:0.9096:0.0	.	1853	O43451	MGA_HUMAN	C	1853;2750	ENSP00000447378:W1853C	ENSP00000373973:W1853C	W	+	3	0	MGAM	141452145	0.998000	0.40836	0.736000	0.30914	0.028000	0.11728	4.135000	0.57997	1.535000	0.49220	0.655000	0.94253	TGG	.	.	none		0.348	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
MUC16	94025	hgsc.bcm.edu	37	19	9033694	9033694	+	Silent	SNP	G	G	A	rs200620444	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:9033694G>A	ENST00000397910.4	-	9	36446	c.36243C>T	c.(36241-36243)acC>acT	p.T12081T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12083	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTGGTGATGGTGAAGTTGA	0.557																																					p.T12081T		Atlas-SNP	.											.	MUC16	4315	.	0			c.C36243T						PASS	.						136.0	133.0	134.0					19																	9033694		2107	4236	6343	SO:0001819	synonymous_variant	94025	exon9			GGTGATGGTGAAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36243C>T	19.37:g.9033694G>A		103.0	0.0	0		99.0	43.0	0.434343	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			G|0.757;A|0.243	0.243	strong		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
UBR4	23352	hgsc.bcm.edu	37	1	19403339	19403339	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:19403339G>A	ENST00000375254.3	-	105	15409	c.15382C>T	c.(15382-15384)Cgc>Tgc	p.R5128C	UBR4_ENST00000375226.2_Missense_Mutation_p.R5104C|UBR4_ENST00000429347.2_Missense_Mutation_p.R651C|UBR4_ENST00000375224.1_Missense_Mutation_p.R835C|UBR4_ENST00000375217.2_Missense_Mutation_p.R5121C|UBR4_ENST00000375267.2_Missense_Mutation_p.R5149C|UBR4_ENST00000375225.3_Missense_Mutation_p.R203C|RP5-1126H10.2_ENST00000606379.1_RNA|UBR4_ENST00000543981.1_Missense_Mutation_p.R792C	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	5128					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TCGTTGTGGCGGATGTACTCA	0.537																																					p.R5128C		Atlas-SNP	.											.	UBR4	415	.	0			c.C15382T						PASS	.						190.0	163.0	172.0					1																	19403339		2203	4300	6503	SO:0001583	missense	23352	exon105			TGTGGCGGATGTA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15382C>T	1.37:g.19403339G>A	ENSP00000364403:p.Arg5128Cys	132.0	0.0	0		97.0	22.0	0.226804	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598627	0.87055	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000375225;ENST00000375224;ENST00000429347;ENST00000543981	T;T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	M	0.85542	2.76	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.993;0.993;0.995;0.988	T	0.66448	-0.5921	10	0.87932	D	0	.	18.8623	0.92278	0.0:0.0:1.0:0.0	.	792;651;5128;5104	B4DYV5;B4DPF6;Q5T4S7;Q5T4S7-3	.;.;UBR4_HUMAN;.	C	5128;5149;5121;5104;203;835;651;792	ENSP00000364403:R5128C;ENSP00000364416:R5149C;ENSP00000364365:R5121C;ENSP00000364374:R5104C;ENSP00000364373:R203C;ENSP00000364372:R835C;ENSP00000394173:R651C;ENSP00000444070:R792C	ENSP00000364365:R5121C	R	-	1	0	UBR4	19275926	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.323000	0.65858	2.793000	0.96121	0.655000	0.94253	CGC	.	.	none		0.537	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
MARCO	8685	hgsc.bcm.edu	37	2	119739789	119739789	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:119739789C>A	ENST00000327097.4	+	11	1094	c.959C>A	c.(958-960)gCc>gAc	p.A320D	MARCO_ENST00000541757.1_Missense_Mutation_p.A242D	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	320	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CACCCAGGTGCCAAGGGTGAG	0.622																																					p.A320D	GBM(8;18 374 7467 11269 32796)	Atlas-SNP	.											MARCO,pharynx,carcinoma,-1,1	MARCO	120	1	0			c.C959A						PASS	.						67.0	72.0	70.0					2																	119739789		2203	4300	6503	SO:0001583	missense	8685	exon11			CAGGTGCCAAGGG	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.959C>A	2.37:g.119739789C>A	ENSP00000318916:p.Ala320Asp	86.0	0.0	0		71.0	17.0	0.239437	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	9.182	1.023855	0.19433	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.83837	-1.77;-1.77	4.66	3.78	0.43462	.	0.966899	0.08556	N	0.928317	T	0.74321	0.3701	N	0.17278	0.47	0.33498	D	0.589607	P	0.52316	0.952	P	0.46585	0.521	T	0.70908	-0.4744	9	.	.	.	.	8.2489	0.31706	0.0:0.893:0.0:0.107	.	320	Q9UEW3	MARCO_HUMAN	D	320;320;242	ENSP00000318916:A320D;ENSP00000441769:A242D	.	A	+	2	0	MARCO	119456259	0.592000	0.26832	0.971000	0.41717	0.539000	0.34962	1.088000	0.30877	1.188000	0.43014	0.462000	0.41574	GCC	.	.	none		0.622	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
XRCC5	7520	hgsc.bcm.edu	37	2	216983862	216983862	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:216983862G>C	ENST00000392133.3	+	7	926	c.465G>C	c.(463-465)aaG>aaC	p.K155N	XRCC5_ENST00000392132.2_Missense_Mutation_p.K155N			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	155	Leucine-zipper.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		ATAGCTTGAAGAAATGTGACA	0.368								Non-homologous end-joining																													p.K155N		Atlas-SNP	.											.	XRCC5	64	.	0			c.G465C						PASS	.						72.0	74.0	73.0					2																	216983862		2203	4300	6503	SO:0001583	missense	7520	exon5			CTTGAAGAAATGT	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.465G>C	2.37:g.216983862G>C	ENSP00000375978:p.Lys155Asn	243.0	1.0	0.00411523		222.0	99.0	0.445946	NM_021141	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	37	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763741	0.69878	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.34859	1.34;1.34	5.38	5.38	0.77491	Ku70/Ku80, N-terminal alpha/beta (1);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	M	0.64997	1.995	0.58432	D	0.999992	D	0.71674	0.998	D	0.64506	0.926	T	0.34650	-0.9820	10	0.23302	T	0.38	.	11.6821	0.51463	0.0793:0.0:0.9207:0.0	.	155	P13010	XRCC5_HUMAN	N	155	ENSP00000375978:K155N;ENSP00000375977:K155N	ENSP00000375977:K155N	K	+	3	2	XRCC5	216692107	1.000000	0.71417	0.998000	0.56505	0.847000	0.48162	2.124000	0.42006	2.793000	0.96121	0.655000	0.94253	AAG	.	.	none		0.368	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256675.3	NM_021141	
PIM1	5292	hgsc.bcm.edu	37	6	37139092	37139092	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:37139092C>T	ENST00000373509.5	+	4	805	c.432C>T	c.(430-432)gcC>gcT	p.A144A		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	235	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Y -> H (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGGAGCTGGCCCGCAGCTTCT	0.612			T	BCL6	NHL																																p.A235A		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C705T						PASS	.						54.0	65.0	61.0					6																	37139092		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			GCTGGCCCGCAGC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.432C>T	6.37:g.37139092C>T		93.0	0.0	0		129.0	27.0	0.209302	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.612	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
SEMA3C	10512	hgsc.bcm.edu	37	7	80374533	80374533	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:80374533C>A	ENST00000265361.3	-	18	2494	c.1933G>T	c.(1933-1935)Gct>Tct	p.A645S	SEMA3C_ENST00000544525.1_Missense_Mutation_p.A663S|SEMA3C_ENST00000419255.2_Missense_Mutation_p.A645S	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	645	Ig-like C2-type.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTTTCTGTAGCAATGCAGTGA	0.433																																					p.A645S		Atlas-SNP	.											.	SEMA3C	106	.	0			c.G1933T						PASS	.						78.0	75.0	76.0					7																	80374533		2203	4300	6503	SO:0001583	missense	10512	exon18			CTGTAGCAATGCA	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1933G>T	7.37:g.80374533C>A	ENSP00000265361:p.Ala645Ser	145.0	0.0	0		140.0	60.0	0.428571	NM_006379	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951421	0.53186	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	T;T;T	0.76578	-1.03;-1.03;-1.03	5.56	5.56	0.83823	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.096714	0.64402	D	0.000001	T	0.74412	0.3713	L	0.39692	1.235	0.80722	D	1	B;P	0.39782	0.3;0.688	B;B	0.42625	0.106;0.393	T	0.69789	-0.5050	10	0.18710	T	0.47	.	19.5309	0.95228	0.0:1.0:0.0:0.0	.	663;645	F5H1Z7;Q99985	.;SEM3C_HUMAN	S	645;645;663	ENSP00000265361:A645S;ENSP00000411193:A645S;ENSP00000445649:A663S	ENSP00000265361:A645S	A	-	1	0	SEMA3C	80212469	1.000000	0.71417	0.998000	0.56505	0.863000	0.49368	5.641000	0.67881	2.636000	0.89361	0.650000	0.86243	GCT	.	.	none		0.433	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
MED22	6837	hgsc.bcm.edu	37	9	136213400	136213400	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr9:136213400C>T	ENST00000491289.1	-	2	699	c.118G>A	c.(118-120)Gcc>Acc	p.A40T	MED22_ENST00000344469.5_Missense_Mutation_p.A40T|RPL7A_ENST00000323345.6_5'Flank|MED22_ENST00000476080.1_Missense_Mutation_p.A40T|MED22_ENST00000471524.1_Intron|MED22_ENST00000371999.1_Missense_Mutation_p.A40T|SNORD24_ENST00000383884.1_RNA|MED22_ENST00000343730.5_Missense_Mutation_p.A40T|RPL7A_ENST00000315731.4_5'Flank			Q15528	MED22_HUMAN	mediator complex subunit 22	40						cytoplasm (GO:0005737)|mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|large_intestine(1)|ovary(1)|urinary_tract(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		CCCACCTTGGCGGTCTTGATG	0.592																																					p.A40T		Atlas-SNP	.											.	MED22	13	.	0			c.G118A						PASS	.						140.0	123.0	129.0					9																	136213400		2203	4300	6503	SO:0001583	missense	6837	exon2			CCTTGGCGGTCTT		CCDS6963.1, CCDS6964.1	9q34.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000148297	ENSG00000148297			11477	protein-coding gene	gene with protein product		185641	"""surfeit 5"""	SURF5		8499913, 15175163	Standard	NM_133640		Approved	Med24	uc004cdc.3	Q15528	OTTHUMG00000020869	ENST00000491289.1:c.118G>A	9.37:g.136213400C>T	ENSP00000420393:p.Ala40Thr	93.0	0.0	0		155.0	92.0	0.593548	NM_181491	B3KW83|B3KWX4|O76072|Q5T8U0	Missense_Mutation	SNP	ENST00000491289.1	37	CCDS6963.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.832980	0.91036	.	.	ENSG00000148297	ENST00000491289;ENST00000486395;ENST00000343730;ENST00000344469;ENST00000476080;ENST00000371999;ENST00000446777;ENST00000494177;ENST00000457204	.	.	.	5.01	3.17	0.36434	.	0.050283	0.85682	D	0.000000	T	0.62986	0.2473	M	0.70842	2.15	0.80722	D	1	P;D	0.57571	0.923;0.98	P;P	0.50490	0.563;0.642	T	0.65150	-0.6238	9	0.72032	D	0.01	-21.2717	10.5851	0.45278	0.0:0.8424:0.0:0.1576	.	40;40	Q15528-2;Q15528	.;MED22_HUMAN	T	40	.	ENSP00000342343:A40T	A	-	1	0	MED22	135203221	1.000000	0.71417	0.928000	0.36995	0.948000	0.59901	5.942000	0.70203	0.519000	0.28406	0.491000	0.48974	GCC	.	.	none		0.592	MED22-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054898.2	NM_133640	
C6orf211	79624	hgsc.bcm.edu	37	6	151789728	151789728	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:151789728T>A	ENST00000367294.3	+	5	1068	c.809T>A	c.(808-810)tTg>tAg	p.L270*	C6orf211_ENST00000545879.1_Nonsense_Mutation_p.L151*	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	270										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GACTTCTTGTTGTCCTCTGAA	0.328																																					p.L270X		Atlas-SNP	.											.	C6orf211	30	.	0			c.T809A						PASS	.						131.0	137.0	135.0					6																	151789728		2203	4300	6503	SO:0001587	stop_gained	79624	exon5			TCTTGTTGTCCTC	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.809T>A	6.37:g.151789728T>A	ENSP00000356263:p.Leu270*	335.0	0.0	0		179.0	136.0	0.759777	NM_024573	Q96FC6|Q9UFY5	Nonsense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	T	38	6.806416	0.97853	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	.	.	.	6.02	6.02	0.97574	.	0.324258	0.29791	N	0.011196	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	.	.	.	X	270;151	.	ENSP00000356263:L270X	L	+	2	0	C6orf211	151831421	1.000000	0.71417	0.774000	0.31636	0.994000	0.84299	6.221000	0.72243	2.299000	0.77371	0.528000	0.53228	TTG	.	.	none		0.328	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54635973	54635973	+	Silent	SNP	T	T	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:54635973T>G	ENST00000230640.5	+	6	905	c.651T>G	c.(649-651)acT>acG	p.T217T	SKIV2L2_ENST00000545714.1_Silent_p.T116T	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	217	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GTGATGTTACTATTAATCCTA	0.348																																					p.T217T	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.T651G						PASS	.						173.0	171.0	172.0					5																	54635973		2203	4300	6503	SO:0001819	synonymous_variant	23517	exon6			TGTTACTATTAAT	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.651T>G	5.37:g.54635973T>G		209.0	1.0	0.00478469		202.0	99.0	0.490099	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	37	CCDS3967.1																																																																																			.	.	none		0.348	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
TRIM23	373	hgsc.bcm.edu	37	5	64905170	64905170	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:64905170C>T	ENST00000231524.9	-	6	1315	c.944G>A	c.(943-945)cGt>cAt	p.R315H	TRIM23_ENST00000381018.3_Missense_Mutation_p.R315H|TRIM23_ENST00000274327.7_Missense_Mutation_p.R315H|TRIM23_ENST00000508808.1_5'UTR	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	315					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CAATTTTTCACGAACATGAGC	0.418																																					p.R315H		Atlas-SNP	.											.	TRIM23	73	.	0			c.G944A						PASS	.						121.0	111.0	114.0					5																	64905170		2203	4300	6503	SO:0001583	missense	373	exon6			TTTTCACGAACAT	L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.944G>A	5.37:g.64905170C>T	ENSP00000231524:p.Arg315His	291.0	0.0	0		265.0	82.0	0.309434	NM_033228	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	ENST00000231524.9	37	CCDS3987.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101218	0.94245	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.75367	-0.84;-0.84;-0.93	5.39	5.39	0.77823	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85270	0.5658	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	D	0.85178	0.1002	10	0.54805	T	0.06	.	19.5154	0.95162	0.0:1.0:0.0:0.0	.	315;315;315	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	H	315	ENSP00000231524:R315H;ENSP00000370406:R315H;ENSP00000274327:R315H	ENSP00000231524:R315H	R	-	2	0	TRIM23	64940926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.685000	0.91497	0.655000	0.94253	CGT	.	.	none		0.418	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215058.2	NM_001656	
TENM4	26011	hgsc.bcm.edu	37	11	78369308	78369308	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:78369308G>A	ENST00000278550.7	-	34	8567	c.8105C>T	c.(8104-8106)gCg>gTg	p.A2702V		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2702					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GCGGGCCCACGCTTGGCGCAC	0.672																																					p.A2702V		Atlas-SNP	.											ODZ4_ENST00000278550,colon,carcinoma,+1,2	.	.	2	0			c.C8105T						PASS	.						39.0	45.0	43.0					11																	78369308		2029	4182	6211	SO:0001583	missense	26011	exon34			GCCCACGCTTGGC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.8105C>T	11.37:g.78369308G>A	ENSP00000278550:p.Ala2702Val	61.0	0.0	0		71.0	28.0	0.394366	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589110	0.86851	.	.	ENSG00000149256	ENST00000278550	D	0.92911	-3.13	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.95924	0.8673	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.94982	0.8126	9	.	.	.	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	2702	Q6N022	TEN4_HUMAN	V	2702	ENSP00000278550:A2702V	.	A	-	2	0	ODZ4	78046956	1.000000	0.71417	0.972000	0.41901	0.607000	0.37147	9.601000	0.98297	2.884000	0.98904	0.655000	0.94253	GCG	.	.	none		0.672	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
IFT140	9742	hgsc.bcm.edu	37	16	1652418	1652418	+	Missense_Mutation	SNP	C	C	T	rs146128830	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr16:1652418C>T	ENST00000426508.2	-	4	685	c.322G>A	c.(322-324)Gtg>Atg	p.V108M	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	108					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CAACGGAGCACGGTGATGTCG	0.582													C|||	14	0.00279553	0.0023	0.0029	5008	,	,		17970	0.0		0.007	False		,,,				2504	0.002				p.V108M		Atlas-SNP	.											IFT140,NS,carcinoma,0,1	IFT140	128	1	0			c.G322A						PASS	.	C	MET/VAL	12,4386	19.1+/-41.9	0,12,2187	110.0	80.0	90.0		322	-1.2	0.0	16	dbSNP_134	90	81,8519	47.6+/-106.9	0,81,4219	yes	missense	IFT140	NM_014714.3	21	0,93,6406	TT,TC,CC		0.9419,0.2729,0.7155	possibly-damaging	108/1463	1652418	93,12905	2199	4300	6499	SO:0001583	missense	9742	exon4			GGAGCACGGTGAT	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.322G>A	16.37:g.1652418C>T	ENSP00000406012:p.Val108Met	120.0	0.0	0		94.0	38.0	0.404255	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	8	0.003663003663003663	0	0.0	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	C	11.51	1.660137	0.29515	0.002729	0.009419	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T;T	0.60299	0.7;0.2	4.83	-1.19	0.09585	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.456706	0.22233	N	0.062786	T	0.56790	0.2009	M	0.78801	2.425	0.24640	N	0.993577	D	0.59357	0.985	P	0.56042	0.79	T	0.58126	-0.7691	10	0.32370	T	0.25	.	9.8005	0.40761	0.0:0.4051:0.0:0.5949	.	108	Q96RY7	IF140_HUMAN	M	108	ENSP00000380562:V108M;ENSP00000406012:V108M	ENSP00000380562:V108M	V	-	1	0	IFT140	1592419	0.004000	0.15560	0.008000	0.14137	0.004000	0.04260	-0.032000	0.12266	-0.555000	0.06142	0.561000	0.74099	GTG	C|0.993;T|0.007	0.007	strong		0.582	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
CCDC40	55036	hgsc.bcm.edu	37	17	78032381	78032381	+	Silent	SNP	C	C	T	rs375199947		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:78032381C>T	ENST00000397545.4	+	8	1275	c.1248C>T	c.(1246-1248)cgC>cgT	p.R416R	CCDC40_ENST00000269318.5_Silent_p.R416R|CCDC40_ENST00000374877.3_Silent_p.R416R|CCDC40_ENST00000374876.4_Silent_p.R416R	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	416					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ACGACATCCGCGTGATGACAC	0.532													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21045	0.0		0.0	False		,,,				2504	0.0				p.R416R		Atlas-SNP	.											.	CCDC40	198	.	0			c.C1248T						PASS	.	C		1,4213		0,1,2106	67.0	71.0	70.0		1248	-7.1	0.0	17		70	4,8450		0,4,4223	no	coding-synonymous	CCDC40	NM_017950.3		0,5,6329	TT,TC,CC		0.0473,0.0237,0.0395		416/1143	78032381	5,12663	2107	4227	6334	SO:0001819	synonymous_variant	55036	exon8			CATCCGCGTGATG	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1248C>T	17.37:g.78032381C>T		74.0	0.0	0		84.0	48.0	0.571429	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	ENST00000397545.4	37	CCDS42395.1																																																																																			.	.	weak		0.532	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
DIDO1	11083	hgsc.bcm.edu	37	20	61526223	61526223	+	Missense_Mutation	SNP	G	G	T	rs139525718		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr20:61526223G>T	ENST00000266070.4	-	10	2700	c.2375C>A	c.(2374-2376)aCg>aAg	p.T792K	DIDO1_ENST00000395340.1_Missense_Mutation_p.T792K|DIDO1_ENST00000395335.2_Missense_Mutation_p.T792K|DIDO1_ENST00000395343.1_Missense_Mutation_p.T792K	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	792					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CCTGGGGGCCGTCTTCTTGCT	0.498																																					p.T792K	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.C2375A						PASS	.						75.0	83.0	80.0					20																	61526223		2203	4300	6503	SO:0001583	missense	11083	exon10			GGGGCCGTCTTCT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2375C>A	20.37:g.61526223G>T	ENSP00000266070:p.Thr792Lys	105.0	0.0	0		83.0	47.0	0.566265	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.594885	0.46318	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.14640	2.91;2.91;2.49;2.49	5.5	2.33	0.28932	.	0.567818	0.14596	N	0.309931	T	0.08714	0.0216	L	0.44542	1.39	0.09310	N	0.999998	B;P	0.34724	0.302;0.465	B;B	0.23150	0.04;0.044	T	0.28964	-1.0027	10	0.34782	T	0.22	-2.3923	4.5074	0.11894	0.3162:0.0:0.5279:0.1559	.	792;792	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	K	792	ENSP00000266070:T792K;ENSP00000378752:T792K;ENSP00000378749:T792K;ENSP00000378744:T792K	ENSP00000266070:T792K	T	-	2	0	DIDO1	60996668	0.001000	0.12720	0.000000	0.03702	0.582000	0.36321	1.120000	0.31271	0.212000	0.20703	0.462000	0.41574	ACG	G|0.999;A|0.001	.	alt		0.498	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
TMEM74	157753	hgsc.bcm.edu	37	8	109796609	109796609	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr8:109796609G>A	ENST00000297459.3	-	2	897	c.719C>T	c.(718-720)aCg>aTg	p.T240M	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	240					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.T240M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GCCCCCCAGCGTGAGGAGGCA	0.587																																					p.T240M		Atlas-SNP	.											TMEM74,NS,carcinoma,0,6	TMEM74	70	6	1	Substitution - Missense(1)	prostate(1)	c.C719T						PASS	.						64.0	62.0	63.0					8																	109796609		2203	4300	6503	SO:0001583	missense	157753	exon2			CCCAGCGTGAGGA	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.719C>T	8.37:g.109796609G>A	ENSP00000297459:p.Thr240Met	108.0	0.0	0		58.0	17.0	0.293103	NM_153015		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318149	0.81469	.	.	ENSG00000164841	ENST00000297459	T	0.19394	2.15	5.42	5.42	0.78866	.	0.102142	0.64402	D	0.000003	T	0.48040	0.1478	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.42447	-0.9451	10	0.87932	D	0	-17.0071	19.416	0.94700	0.0:0.0:1.0:0.0	.	240	Q96NL1	TMM74_HUMAN	M	240	ENSP00000297459:T240M	ENSP00000297459:T240M	T	-	2	0	TMEM74	109865785	1.000000	0.71417	0.973000	0.42090	0.826000	0.46750	9.657000	0.98554	2.821000	0.97095	0.650000	0.86243	ACG	.	.	none		0.587	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
IDH3A	3419	hgsc.bcm.edu	37	15	78453926	78453926	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr15:78453926C>T	ENST00000299518.2	+	5	376	c.293C>T	c.(292-294)cCt>cTt	p.P98L	IDH3A_ENST00000441490.2_5'UTR|IDH3A_ENST00000561366.1_5'Flank|IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558554.1_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	98					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						ATAACAGGCCCTTTGAAGACC	0.468																																					p.P98L		Atlas-SNP	.											.	IDH3A	24	.	0			c.C293T						PASS	.						94.0	86.0	89.0					15																	78453926		2196	4293	6489	SO:0001583	missense	3419	exon5			CAGGCCCTTTGAA		CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.293C>T	15.37:g.78453926C>T	ENSP00000299518:p.Pro98Leu	63.0	0.0	0		45.0	15.0	0.333333	NM_005530	D3DW83|Q9H3X0	Missense_Mutation	SNP	ENST00000299518.2	37	CCDS10297.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253008	0.80135	.	.	ENSG00000166411	ENST00000299518	T	0.71222	-0.55	6.02	6.02	0.97574	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91725	0.5392	10	0.87932	D	0	-13.8159	19.5254	0.95203	0.0:1.0:0.0:0.0	.	98	P50213	IDH3A_HUMAN	L	98	ENSP00000299518:P98L	ENSP00000299518:P98L	P	+	2	0	IDH3A	76240981	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.608000	0.82898	2.857000	0.98124	0.650000	0.86243	CCT	.	.	none		0.468	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289799.4	NM_005530	
CDH26	60437	hgsc.bcm.edu	37	20	58558068	58558068	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr20:58558068G>T	ENST00000244047.5	+	5	795	c.484G>T	c.(484-486)Gca>Tca	p.A162S	CDH26_ENST00000348616.4_Missense_Mutation_p.A162S			Q8IXH8	CAD26_HUMAN	cadherin 26	162	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GAATGATCATGCACCCCAGTT	0.463																																					p.A162S		Atlas-SNP	.											.	CDH26	229	.	0			c.G484T						PASS	.						156.0	161.0	160.0					20																	58558068		2203	4300	6503	SO:0001583	missense	60437	exon5			GATCATGCACCCC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.484G>T	20.37:g.58558068G>T	ENSP00000244047:p.Ala162Ser	114.0	0.0	0		104.0	23.0	0.221154	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	G	17.28	3.350695	0.61183	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.61742	0.08;0.08	4.91	3.97	0.46021	.	0.356242	0.29948	N	0.010794	T	0.71771	0.3379	M	0.73962	2.25	0.40699	D	0.982466	D	0.69078	0.997	D	0.73708	0.981	T	0.71623	-0.4537	10	0.38643	T	0.18	.	10.4423	0.44472	0.0927:0.0:0.9073:0.0	.	162	Q8IXH8-4	.	S	162	ENSP00000244047:A162S;ENSP00000339390:A162S	ENSP00000244047:A162S	A	+	1	0	CDH26	57991463	0.502000	0.26107	0.006000	0.13384	0.964000	0.63967	1.962000	0.40442	1.057000	0.40506	0.591000	0.81541	GCA	.	.	none		0.463	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
DGAT2L6	347516	hgsc.bcm.edu	37	X	69424307	69424307	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:69424307G>A	ENST00000333026.3	+	6	900	c.800G>A	c.(799-801)cGg>cAg	p.R267Q		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	267					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						TTCCATGGCCGGGGCTTCACT	0.502																																					p.R267Q		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.G800A						PASS	.						74.0	68.0	70.0					X																	69424307		2203	4300	6503	SO:0001583	missense	347516	exon6			ATGGCCGGGGCTT	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.800G>A	X.37:g.69424307G>A	ENSP00000328036:p.Arg267Gln	163.0	0.0	0		208.0	45.0	0.216346	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	37	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.402595	0.25291	.	.	ENSG00000184210	ENST00000333026	T	0.24723	1.84	4.98	1.19	0.21007	.	0.300803	0.27567	N	0.018792	T	0.36220	0.0959	M	0.88241	2.94	0.26196	N	0.979515	P	0.47191	0.891	P	0.45343	0.477	T	0.29761	-1.0001	10	0.49607	T	0.09	-17.6492	8.4724	0.32993	0.3533:0.0:0.6467:0.0	.	267	Q6ZPD8	DG2L6_HUMAN	Q	267	ENSP00000328036:R267Q	ENSP00000328036:R267Q	R	+	2	0	DGAT2L6	69341032	0.982000	0.34865	0.170000	0.22879	0.003000	0.03518	3.486000	0.53215	0.167000	0.19631	-0.208000	0.12717	CGG	.	.	none		0.502	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
MAGEC2	51438	hgsc.bcm.edu	37	X	141291747	141291747	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:141291747G>A	ENST00000247452.3	-	3	374	c.27C>T	c.(25-27)ttC>ttT	p.F9F		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	9					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					CAACGTTGCGGAATGGAACGC	0.537										HNSCC(46;0.14)																											p.F9F		Atlas-SNP	.											.	MAGEC2	102	.	0			c.C27T						PASS	.						117.0	106.0	110.0					X																	141291747		2203	4300	6503	SO:0001819	synonymous_variant	51438	exon3			GTTGCGGAATGGA	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.27C>T	X.37:g.141291747G>A		102.0	0.0	0		54.0	43.0	0.796296	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Silent	SNP	ENST00000247452.3	37	CCDS14678.1																																																																																			.	.	none		0.537	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
PBRM1	55193	hgsc.bcm.edu	37	3	52712591	52712591	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:52712591T>C	ENST00000296302.7	-	2	162	c.161A>G	c.(160-162)tAt>tGt	p.Y54C	PBRM1_ENST00000356770.4_Missense_Mutation_p.Y54C|PBRM1_ENST00000337303.4_Missense_Mutation_p.Y54C|PBRM1_ENST00000409767.1_Missense_Mutation_p.Y54C|PBRM1_ENST00000409114.3_Missense_Mutation_p.Y54C|PBRM1_ENST00000409057.1_Missense_Mutation_p.Y54C|PBRM1_ENST00000394830.3_Missense_Mutation_p.Y54C|PBRM1_ENST00000410007.1_Missense_Mutation_p.Y54C			Q86U86	PB1_HUMAN	polybromo 1	54					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GATGGTATTATAGAGTTCATG	0.408			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.Y54C		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.A161G						PASS	.						122.0	110.0	114.0					3																	52712591		2203	4300	6503	SO:0001583	missense	55193	exon3			GTATTATAGAGTT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.161A>G	3.37:g.52712591T>C	ENSP00000296302:p.Tyr54Cys	91.0	0.0	0		91.0	54.0	0.593407	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	19.44	3.827120	0.71143	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000431678;ENST00000420148;ENST00000449505;ENST00000450271	T;T;T;T;T;T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.2	5.2	0.72013	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.53351	0.1791	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.992;0.999;0.992;0.969;0.99;0.997;0.974;1.0	T	0.63620	-0.6596	10	0.87932	D	0	.	15.0658	0.71992	0.0:0.0:0.0:1.0	.	54;54;54;54;54;54;54;54	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	C	54	ENSP00000349213:Y54C;ENSP00000378307:Y54C;ENSP00000296302:Y54C;ENSP00000338302:Y54C;ENSP00000386593:Y54C;ENSP00000386529:Y54C;ENSP00000386643:Y54C;ENSP00000386601:Y54C;ENSP00000387775:Y54C;ENSP00000409939:Y54C;ENSP00000389390:Y54C;ENSP00000412401:Y54C;ENSP00000416851:Y54C	ENSP00000296302:Y54C	Y	-	2	0	PBRM1	52687631	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.598000	0.54038	1.968000	0.57251	0.377000	0.23210	TAT	.	.	none		0.408	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
SLC41A1	254428	hgsc.bcm.edu	37	1	205768918	205768918	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:205768918C>T	ENST00000367137.3	-	4	1535	c.521G>A	c.(520-522)cGg>cAg	p.R174Q	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	174					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			AGTGATCATCCGCCAGAGCTC	0.572																																					p.R174Q		Atlas-SNP	.											.	SLC41A1	46	.	0			c.G521A						PASS	.						129.0	98.0	109.0					1																	205768918		2203	4300	6503	SO:0001583	missense	254428	exon4			ATCATCCGCCAGA	AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.521G>A	1.37:g.205768918C>T	ENSP00000356105:p.Arg174Gln	122.0	0.0	0		167.0	38.0	0.227545	NM_173854	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	ENST00000367137.3	37	CCDS30988.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539952	0.85917	.	.	ENSG00000133065	ENST00000367137	T	0.32753	1.44	5.99	4.9	0.64082	MgtE magnesium transporter, integral membrane (1);	0.213578	0.46145	D	0.000304	T	0.16769	0.0403	N	0.25286	0.73	0.34459	D	0.70156	B	0.33940	0.433	B	0.29862	0.108	T	0.14559	-1.0468	10	0.30854	T	0.27	-13.7793	6.4586	0.21944	0.0:0.6766:0.1902:0.1332	.	174	Q8IVJ1	S41A1_HUMAN	Q	174	ENSP00000356105:R174Q	ENSP00000356105:R174Q	R	-	2	0	SLC41A1	204035541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.886000	0.39688	2.843000	0.97960	0.655000	0.94253	CGG	.	.	none		0.572	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087731.1		
LAIR2	3904	hgsc.bcm.edu	37	19	55014155	55014155	+	Silent	SNP	T	T	C	rs143266047		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:55014155T>C	ENST00000301202.2	+	1	143	c.21T>C	c.(19-21)gcT>gcC	p.A7A	LAIR2_ENST00000351841.2_Silent_p.A7A	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	7						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		ACCTCACTGCTCTCCTGGGCC	0.627													T|||	1	0.000199681	0.0	0.0	5008	,	,		16035	0.0		0.0	False		,,,				2504	0.001				p.A7A		Atlas-SNP	.											LAIR2,brain,primitive_neuroectodermal_tumour-medulloblastoma,+1,1	LAIR2	30	1	0			c.T21C						scavenged	.	T	,	0,4406		0,0,2203	86.0	77.0	80.0		21,21	-0.2	0.0	19	dbSNP_134	80	3,8597	3.7+/-12.6	0,3,4297	no	coding-synonymous,coding-synonymous	LAIR2	NM_002288.4,NM_021270.3	,	0,3,6500	CC,CT,TT		0.0349,0.0,0.0231	,	7/153,7/136	55014155	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	3904	exon1			CACTGCTCTCCTG	AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.21T>C	19.37:g.55014155T>C		101.0	2.0	0.019802		108.0	8.0	0.0740741	NM_002288	Q6PEZ4	Silent	SNP	ENST00000301202.2	37	CCDS12897.1																																																																																			T|1.000;C|0.000	0.000	weak		0.627	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140801.1		
OR2L5	81466	hgsc.bcm.edu	37	1	248185497	248185497	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:248185497A>G	ENST00000355281.1	+	1	248	c.248A>G	c.(247-249)gAt>gGt	p.D83G	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										ATGGCTTCTGATTTTCTGTAT	0.443																																					p.D83G		Atlas-SNP	.											.	.	.	.	0			c.A248G						PASS	.																																			SO:0001583	missense	81466	exon1			CTTCTGATTTTCT		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.248A>G	1.37:g.248185497A>G	ENSP00000347428:p.Asp83Gly	246.0	0.0	0		243.0	42.0	0.17284	NM_001258284	Q6IF04	Missense_Mutation	SNP	ENST00000355281.1	37	CCDS58068.1	.	.	.	.	.	.	.	.	.	.	.	5.482	0.273928	0.10403	.	.	ENSG00000197454	ENST00000355281	T	0.00417	7.5	2.37	1.13	0.20643	.	0.955940	0.08428	N	0.947360	T	0.00300	0.0009	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37244	-0.9714	7	0.35671	T	0.21	.	5.2772	0.15657	0.7085:0.0:0.2914:0.0	.	.	.	.	G	83	ENSP00000347428:D83G	ENSP00000347428:D83G	D	+	2	0	OR2L5	246252120	0.000000	0.05858	0.007000	0.13788	0.710000	0.40934	0.020000	0.13466	0.933000	0.37291	0.352000	0.21897	GAT	.	.	none		0.443	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096851.1		
CWC25	54883	hgsc.bcm.edu	37	17	36971290	36971290	+	Silent	SNP	G	G	A	rs202146970		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:36971290G>A	ENST00000225428.5	-	3	549	c.252C>T	c.(250-252)gaC>gaT	p.D84D	CWC25_ENST00000536127.1_Silent_p.D21D	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	84										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						GCAGGTACTCGTCACGGTTCA	0.463																																					p.D84D		Atlas-SNP	.											.	CWC25	24	.	0			c.C252T						PASS	.						134.0	135.0	135.0					17																	36971290		1907	4114	6021	SO:0001819	synonymous_variant	54883	exon3			GTACTCGTCACGG	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.252C>T	17.37:g.36971290G>A		72.0	0.0	0		112.0	93.0	0.830357	NM_017748	A0JLM3|Q68DK5	Silent	SNP	ENST00000225428.5	37	CCDS45663.1																																																																																			G|0.998;A|0.002	0.002	weak		0.463	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748	
PHOX2B	8929	hgsc.bcm.edu	37	4	41748171	41748171	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr4:41748171G>A	ENST00000226382.2	-	3	957	c.598C>T	c.(598-600)Ccc>Tcc	p.P200S	RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	200					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						TTGGGATTGGGACCTGGGCCC	0.731			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.P200S		Atlas-SNP	.	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	PHOX2B	53	.	0			c.C598T						PASS	.						44.0	43.0	43.0					4																	41748171		2203	4300	6503	SO:0001583	missense	8929	exon3	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	GATTGGGACCTGG	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.598C>T	4.37:g.41748171G>A	ENSP00000226382:p.Pro200Ser	47.0	0.0	0		46.0	25.0	0.543478	NM_003924	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	G	7.728	0.698662	0.15106	.	.	ENSG00000109132	ENST00000226382	D	0.90563	-2.69	4.69	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.79423	0.4443	N	0.19112	0.55	0.42186	D	0.991702	B	0.26935	0.164	B	0.19946	0.027	T	0.71768	-0.4493	10	0.30078	T	0.28	.	4.8021	0.13301	0.0832:0.1498:0.6123:0.1547	.	200	Q99453	PHX2B_HUMAN	S	200	ENSP00000226382:P200S	ENSP00000226382:P200S	P	-	1	0	PHOX2B	41442928	1.000000	0.71417	0.114000	0.21550	0.004000	0.04260	6.516000	0.73755	1.173000	0.42796	-0.165000	0.13383	CCC	.	.	none		0.731	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
ABCB5	340273	hgsc.bcm.edu	37	7	20768004	20768004	+	Missense_Mutation	SNP	T	T	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:20768004T>A	ENST00000404938.2	+	23	3445	c.2793T>A	c.(2791-2793)ttT>ttA	p.F931L	ABCB5_ENST00000258738.6_Missense_Mutation_p.F486L	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	931	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TTATATATTTTGCCTATGCGG	0.418																																					p.F931L		Atlas-SNP	.											.	ABCB5	357	.	0			c.T2793A						PASS	.						131.0	134.0	133.0					7																	20768004		2203	4300	6503	SO:0001583	missense	340273	exon23			ATATTTTGCCTAT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2793T>A	7.37:g.20768004T>A	ENSP00000384881:p.Phe931Leu	175.0	0.0	0		181.0	67.0	0.370166	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.824361	0.71143	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.88664	-2.41;-2.41	3.91	-1.39	0.08997	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.102767	0.39544	N	0.001337	D	0.89153	0.6634	L	0.54965	1.715	0.41601	D	0.988854	B;D;P	0.65815	0.303;0.995;0.871	B;D;P	0.69654	0.282;0.965;0.714	D	0.84074	0.0381	10	0.39692	T	0.17	.	4.9214	0.13871	0.0:0.3962:0.176:0.4278	.	931;109;486	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	L	931;486	ENSP00000384881:F931L;ENSP00000258738:F486L	ENSP00000258738:F486L	F	+	3	2	ABCB5	20734529	0.992000	0.36948	0.995000	0.50966	0.967000	0.64934	0.073000	0.14640	-0.238000	0.09724	0.533000	0.62120	TTT	.	.	none		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
SPIN3	169981	hgsc.bcm.edu	37	X	57021350	57021350	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:57021350C>A	ENST00000374919.3	-	2	353	c.31G>T	c.(31-33)Ggg>Tgg	p.G11W		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	11					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						GACCGCTGCCCTGCAGCTGCC	0.557																																					p.G11W		Atlas-SNP	.											.	SPIN3	33	.	0			c.G31T						PASS	.						37.0	37.0	37.0					X																	57021350		2059	4167	6226	SO:0001583	missense	169981	exon2			GCTGCCCTGCAGC	AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.31G>T	X.37:g.57021350C>A	ENSP00000364054:p.Gly11Trp	91.0	0.0	0		127.0	27.0	0.212598	NM_001010862	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	ENST00000374919.3	37	CCDS43963.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315986	0.60524	.	.	ENSG00000204271	ENST00000374919;ENST00000374915	T	0.46063	0.88	2.32	2.32	0.28847	.	.	.	.	.	T	0.44329	0.1288	L	0.46157	1.445	0.24883	N	0.992217	D	0.61697	0.99	P	0.50659	0.647	T	0.29549	-1.0008	9	0.87932	D	0	-1.0721	9.9797	0.41806	0.0:1.0:0.0:0.0	.	11	Q5JUX0	SPIN3_HUMAN	W	11	ENSP00000364054:G11W	ENSP00000364050:G11W	G	-	1	0	SPIN3	57038075	0.171000	0.23029	0.509000	0.27700	0.071000	0.16799	1.058000	0.30504	1.449000	0.47699	0.513000	0.50165	GGG	.	.	none		0.557	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1	XM_093024	
IRF8	3394	hgsc.bcm.edu	37	16	85942659	85942659	+	Missense_Mutation	SNP	A	A	G	rs397514711		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr16:85942659A>G	ENST00000268638.5	+	3	660	c.238A>G	c.(238-240)Acg>Gcg	p.T80A	IRF8_ENST00000563180.1_Missense_Mutation_p.T80A	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	80			T -> A (in IMD32A; impairs transcriptional activity by disrupting the interaction between IRF8 and DNA). {ECO:0000269|PubMed:21524210}.		cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				CACTTGGAAGACGAGGTTACG	0.458																																					p.T80A		Atlas-SNP	.											IRF8,NS,neuroblastoma,-1,1	IRF8	65	1	0			c.A238G						scavenged	.						74.0	76.0	75.0					16																	85942659		2198	4300	6498	SO:0001583	missense	3394	exon3			TGGAAGACGAGGT	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.238A>G	16.37:g.85942659A>G	ENSP00000268638:p.Thr80Ala	88.0	1.0	0.0113636		101.0	64.0	0.633663	NM_002163	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763543	0.69878	.	.	ENSG00000140968	ENST00000268638	D	0.97688	-4.49	4.88	4.88	0.63580	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.046894	0.85682	D	0.000000	D	0.97791	0.9275	L	0.45470	1.425	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.91635	0.999;0.996	D	0.97383	0.9984	10	0.30854	T	0.27	-15.9347	14.7789	0.69751	1.0:0.0:0.0:0.0	.	80;80	B2R8V7;Q02556	.;IRF8_HUMAN	A	80	ENSP00000268638:T80A	ENSP00000268638:T80A	T	+	1	0	IRF8	84500160	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.780000	0.91799	1.973000	0.57446	0.397000	0.26171	ACG	.	.	none		0.458	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
SMYD1	150572	hgsc.bcm.edu	37	2	88402591	88402591	+	Silent	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:88402591G>T	ENST00000419482.2	+	7	988	c.903G>T	c.(901-903)gtG>gtT	p.V301V	SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000444564.2_Silent_p.V288V	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	301					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CTCAGGAAGTGGTGAAGGAGA	0.428																																					p.V301V		Atlas-SNP	.											.	SMYD1	95	.	0			c.G903T						PASS	.						94.0	91.0	92.0					2																	88402591		2203	4300	6503	SO:0001819	synonymous_variant	150572	exon7			GGAAGTGGTGAAG	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.903G>T	2.37:g.88402591G>T		70.0	0.0	0		91.0	16.0	0.175824	NM_198274	A0AV30|A6NE13	Silent	SNP	ENST00000419482.2	37	CCDS33240.1																																																																																			.	.	none		0.428	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
CHD5	26038	hgsc.bcm.edu	37	1	6208973	6208973	+	De_novo_Start_OutOfFrame	SNP	A	A	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:6208973A>C	ENST00000378021.1	-	0	1423				CHD5_ENST00000262450.3_Missense_Mutation_p.C442G			O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5						tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGGTTGAGGCAATGCAGGTGG	0.697																																					p.C442G		Atlas-SNP	.											.	CHD5	267	.	0			c.T1324G						PASS	.						49.0	52.0	51.0					1																	6208973		2201	4300	6501			26038	exon9			TGAGGCAATGCAG	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000378021.1:c.-2106T>G	1.37:g.6208973A>C		99.0	0.0	0		95.0	58.0	0.610526	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000378021.1	37		.	.	.	.	.	.	.	.	.	.	A	18.99	3.738941	0.69304	.	.	ENSG00000116254	ENST00000262450	D	0.99252	-5.63	3.56	3.56	0.40772	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Chromo domain-like (1);	0.000000	0.85682	U	0.000000	D	0.99687	0.9882	H	0.99609	4.655	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.97244	0.9893	10	0.72032	D	0.01	-21.1597	12.1231	0.53903	1.0:0.0:0.0:0.0	.	442	Q8TDI0	CHD5_HUMAN	G	442	ENSP00000262450:C442G	ENSP00000262450:C442G	C	-	1	0	CHD5	6131560	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	9.157000	0.94714	1.410000	0.46936	0.260000	0.18958	TGC	.	.	none		0.697	CHD5-201	KNOWN	basic	protein_coding	protein_coding		NM_015557	
LRRC38	126755	hgsc.bcm.edu	37	1	13802549	13802549	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:13802549C>T	ENST00000376085.3	-	2	1104	c.650G>A	c.(649-651)tGc>tAc	p.C217Y		NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	217	LRRCT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GGGCAGGGAGCACTGGATTTC	0.537																																					p.C217Y		Atlas-SNP	.											.	LRRC38	12	.	0			c.G650A						PASS	.																																			SO:0001583	missense	126755	exon2			AGGGAGCACTGGA	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.650G>A	1.37:g.13802549C>T	ENSP00000365253:p.Cys217Tyr	70.0	0.0	0		58.0	11.0	0.189655	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	37	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254380	0.80135	.	.	ENSG00000162494	ENST00000376085	T	0.02837	4.14	5.25	5.25	0.73442	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26340	0.0643	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.40961	-0.9535	10	0.87932	D	0	.	17.4263	0.87527	0.0:1.0:0.0:0.0	.	217	Q5VT99	LRC38_HUMAN	Y	217	ENSP00000365253:C217Y	ENSP00000365253:C217Y	C	-	2	0	LRRC38	13675136	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.416000	0.80143	2.446000	0.82766	0.561000	0.74099	TGC	.	.	none		0.537	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
ANO5	203859	hgsc.bcm.edu	37	11	22249091	22249091	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr11:22249091G>T	ENST00000324559.8	+	7	924	c.607G>T	c.(607-609)Gat>Tat	p.D203Y		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	203					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CCTCATCGAAGATCAGGCAAC	0.458																																					p.D203Y		Atlas-SNP	.											.	ANO5	162	.	0			c.G607T						PASS	.						98.0	96.0	97.0					11																	22249091		2203	4300	6503	SO:0001583	missense	203859	exon7			ATCGAAGATCAGG	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.607G>T	11.37:g.22249091G>T	ENSP00000315371:p.Asp203Tyr	119.0	0.0	0		86.0	50.0	0.581395	NM_213599		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651987	0.67472	.	.	ENSG00000171714	ENST00000324559	T	0.65916	-0.18	5.69	4.78	0.61160	.	0.174317	0.64402	D	0.000009	D	0.82388	0.5026	M	0.92317	3.295	0.58432	D	0.999994	D	0.71674	0.998	D	0.64506	0.926	D	0.87157	0.2212	10	0.87932	D	0	.	14.8589	0.70362	0.0693:0.0:0.9307:0.0	.	203	Q75V66	ANO5_HUMAN	Y	203	ENSP00000315371:D203Y	ENSP00000315371:D203Y	D	+	1	0	ANO5	22205667	1.000000	0.71417	0.390000	0.26220	0.843000	0.47879	3.119000	0.50422	1.409000	0.46915	0.650000	0.86243	GAT	.	.	none		0.458	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
GLUD2	2747	hgsc.bcm.edu	37	X	120182459	120182459	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:120182459G>A	ENST00000328078.1	+	1	998	c.921G>A	c.(919-921)caG>caA	p.Q307Q		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	307					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TTGTTGTTCAGGGATTTGGTA	0.393																																					p.Q307Q		Atlas-SNP	.											.	GLUD2	89	.	0			c.G921A						PASS	.						226.0	206.0	213.0					X																	120182459		2203	4300	6503	SO:0001819	synonymous_variant	2747	exon1			TGTTCAGGGATTT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.921G>A	X.37:g.120182459G>A		472.0	0.0	0		409.0	235.0	0.574572	NM_012084	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1																																																																																			.	.	none		0.393	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
PCDH17	27253	hgsc.bcm.edu	37	13	58208450	58208450	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr13:58208450C>T	ENST00000377918.3	+	1	1796	c.1770C>T	c.(1768-1770)aaC>aaT	p.N590N		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	590	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CGCTGCAGAACGACACCGCGG	0.672																																					p.N590N	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											.	PCDH17	304	.	0			c.C1770T						PASS	.						33.0	32.0	32.0					13																	58208450		2203	4300	6503	SO:0001819	synonymous_variant	27253	exon1			GCAGAACGACACC	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1770C>T	13.37:g.58208450C>T		42.0	0.0	0		25.0	10.0	0.4	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																			.	.	none		0.672	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
RAPH1	65059	hgsc.bcm.edu	37	2	204304543	204304543	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:204304543G>A	ENST00000319170.5	-	14	3669	c.3370C>T	c.(3370-3372)Cga>Tga	p.R1124*	RAPH1_ENST00000374493.3_Nonsense_Mutation_p.R1176*|ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1124					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CGTTTGGGTCGTGTGGGTGGA	0.512																																					p.R1124X		Atlas-SNP	.											.	RAPH1	118	.	0			c.C3370T						PASS	.						119.0	106.0	110.0					2																	204304543		2203	4300	6503	SO:0001587	stop_gained	65059	exon14			TGGGTCGTGTGGG	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3370C>T	2.37:g.204304543G>A	ENSP00000316543:p.Arg1124*	220.0	0.0	0		273.0	116.0	0.424908	NM_213589	Q96Q37|Q9C0I2	Nonsense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	37	6.353621	0.97498	.	.	ENSG00000173166	ENST00000319170;ENST00000374493	.	.	.	4.94	4.02	0.46733	.	0.000000	0.31721	U	0.007163	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2851	12.5109	0.56005	0.0:0.0:0.7007:0.2993	.	.	.	.	X	1124;1176	.	ENSP00000316543:R1124X	R	-	1	2	RAPH1	204012788	0.997000	0.39634	0.971000	0.41717	0.666000	0.39218	2.781000	0.47750	2.288000	0.76882	0.563000	0.77884	CGA	.	.	none		0.512	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
MGP	4256	hgsc.bcm.edu	37	12	15035143	15035143	+	Missense_Mutation	SNP	C	C	T	rs375828646		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:15035143C>T	ENST00000539261.1	-	4	376	c.242G>A	c.(241-243)cGc>cAc	p.R81H	C12orf60_ENST00000527783.1_Intron|MGP_ENST00000228938.5_Missense_Mutation_p.R106H	NM_000900.3	NP_000891.2	P08493	MGP_HUMAN	matrix Gla protein	81	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|ossification (GO:0001503)|regulation of bone mineralization (GO:0030500)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|structural constituent of bone (GO:0008147)			large_intestine(1)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	7						CATGGCGTAGCGTTCGCAAAG	0.463																																					p.R106H		Atlas-SNP	.											MGP,colon,carcinoma,-1,3	MGP	16	3	0			c.G317A						PASS	.						156.0	148.0	151.0					12																	15035143		2203	4300	6503	SO:0001583	missense	4256	exon5			GCGTAGCGTTCGC	M58549	CCDS8669.1, CCDS53752.1	12p12.3	2006-12-15			ENSG00000111341	ENSG00000111341			7060	protein-coding gene	gene with protein product		154870				2394711	Standard	NM_000900		Approved		uc021qvr.1	P08493	OTTHUMG00000168740	ENST00000539261.1:c.242G>A	12.37:g.15035143C>T	ENSP00000445907:p.Arg81His	194.0	0.0	0		137.0	11.0	0.080292	NM_001190839	A0M8W5|B2R519|J3KMX7|Q2TU41|Q567P9|Q6ICN5	Missense_Mutation	SNP	ENST00000539261.1	37	CCDS8669.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662123	0.67700	.	.	ENSG00000111341	ENST00000539261;ENST00000228938	D;D	0.99220	-5.58;-5.58	5.13	4.24	0.50183	Gamma-carboxyglutamic acid-rich (GLA) domain (5);	0.299010	0.32218	N	0.006413	D	0.98538	0.9512	L	0.61036	1.89	0.34062	D	0.657446	D	0.64830	0.994	P	0.55667	0.781	D	0.99940	1.1398	10	0.15066	T	0.55	-1.3297	9.507	0.39053	0.0:0.9048:0.0:0.0952	.	81	P08493	MGP_HUMAN	H	81;106	ENSP00000445907:R81H;ENSP00000228938:R106H	ENSP00000228938:R106H	R	-	2	0	MGP	14926410	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	0.727000	0.25999	1.532000	0.49169	0.655000	0.94253	CGC	.	.	alt		0.463	MGP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400864.1	NM_000900	
PCSK5	5125	hgsc.bcm.edu	37	9	78796464	78796464	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr9:78796464C>G	ENST00000545128.1	+	16	2692	c.2154C>G	c.(2152-2154)aaC>aaG	p.N718K	PCSK5_ENST00000376752.4_Missense_Mutation_p.N718K	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	718	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						AAGAAACCAACAGCTGTGTTA	0.453																																					p.N718K		Atlas-SNP	.											.	PCSK5	329	.	0			c.C2154G						PASS	.						131.0	113.0	119.0					9																	78796464		2203	4300	6503	SO:0001583	missense	5125	exon16			AACCAACAGCTGT		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2154C>G	9.37:g.78796464C>G	ENSP00000446280:p.Asn718Lys	93.0	0.0	0		127.0	34.0	0.267717	NM_006200	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193932	0.38707	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376752;ENST00000424854	T;D;T	0.85484	-0.14;-1.99;-0.09	6.06	3.92	0.45320	.	0.166330	0.64402	D	0.000004	T	0.79969	0.4538	L	0.54908	1.71	0.37334	D	0.910111	B	0.21147	0.052	B	0.21917	0.037	T	0.78453	-0.2198	10	0.46703	T	0.11	-19.0967	7.7085	0.28663	0.0:0.6627:0.1411:0.1962	.	718	Q92824-2	.	K	718;421;718;391	ENSP00000446280:N718K;ENSP00000365943:N718K;ENSP00000411654:N391K	ENSP00000365943:N718K	N	+	3	2	PCSK5	77986284	1.000000	0.71417	0.992000	0.48379	0.966000	0.64601	0.911000	0.28584	1.581000	0.49865	0.655000	0.94253	AAC	.	.	none		0.453	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PEX19	5824	hgsc.bcm.edu	37	1	160252238	160252238	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:160252238C>T	ENST00000368072.5	-	4	422	c.401G>A	c.(400-402)aGt>aAt	p.S134N	PEX19_ENST00000440949.3_Missense_Mutation_p.S44N|DCAF8_ENST00000608310.1_Intron|PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000556710.1_Intron	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	134					chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCTAATCCACTTAGTGTTTC	0.458																																					p.S134N		Atlas-SNP	.											.	PEX19	34	.	0			c.G401A						PASS	.						129.0	121.0	124.0					1																	160252238		2203	4300	6503	SO:0001583	missense	5824	exon4			AATCCACTTAGTG	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.401G>A	1.37:g.160252238C>T	ENSP00000357051:p.Ser134Asn	255.0	0.0	0		287.0	57.0	0.198606	NM_002857	D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	ENST00000368072.5	37	CCDS1201.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712935	0.48517	.	.	ENSG00000258465;ENSG00000162735;ENSG00000162735;ENSG00000162735;ENSG00000162735	ENST00000485079;ENST00000368072;ENST00000429425;ENST00000440949;ENST00000392220	.	.	.	5.5	5.5	0.81552	.	0.261768	0.45361	D	0.000379	T	0.25901	0.0631	N	0.16743	0.435	0.37882	D	0.930421	B	0.02656	0.0	B	0.11329	0.006	T	0.07849	-1.0751	9	0.26408	T	0.33	-7.953	13.885	0.63704	0.0:0.8471:0.1528:0.0	.	134	P40855	PEX19_HUMAN	N	4;134;114;44;114	.	ENSP00000357051:S134N	S	-	2	0	RP11-574F21.3;PEX19	158518862	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.956000	0.49129	2.584000	0.87258	0.563000	0.77884	AGT	.	.	none		0.458	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080642.2	NM_002857	
FAM208B	54906	hgsc.bcm.edu	37	10	5790878	5790878	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr10:5790878C>G	ENST00000328090.5	+	15	6119	c.5494C>G	c.(5494-5496)Cta>Gta	p.L1832V		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1832																	AGATTCTGATCTAGACCTGCT	0.478																																					p.L1832V		Atlas-SNP	.											.	.	.	.	0			c.C5494G						PASS	.						67.0	66.0	66.0					10																	5790878		1873	4124	5997	SO:0001583	missense	54906	exon15			TCTGATCTAGACC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.5494C>G	10.37:g.5790878C>G	ENSP00000328426:p.Leu1832Val	116.0	0.0	0		87.0	73.0	0.83908	NM_017782	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	9.110	1.006421	0.19199	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04234	3.67	5.71	-3.08	0.05347	.	1.613740	0.03359	N	0.197302	T	0.03871	0.0109	N	0.22421	0.69	0.09310	N	1	B	0.22604	0.072	B	0.18871	0.023	T	0.45366	-0.9266	10	0.07813	T	0.8	.	11.99	0.53169	0.2271:0.2164:0.5565:0.0	.	1832	Q5VWN6	F208B_HUMAN	V	1832;1027	ENSP00000328426:L1832V	ENSP00000328426:L1832V	L	+	1	2	C10orf18	5830884	0.359000	0.24955	0.000000	0.03702	0.089000	0.18198	0.425000	0.21346	-0.953000	0.03645	0.563000	0.77884	CTA	.	.	none		0.478	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
ZNF608	57507	hgsc.bcm.edu	37	5	124080282	124080282	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:124080282C>T	ENST00000306315.5	-	1	836	c.401G>A	c.(400-402)gGc>gAc	p.G134D	ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	134							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CTGCCTCTTGCCAGTGCTGCT	0.527																																					p.G134D		Atlas-SNP	.											.	ZNF608	117	.	0			c.G401A						PASS	.						71.0	70.0	71.0					5																	124080282		2203	4300	6503	SO:0001583	missense	57507	exon1			CTCTTGCCAGTGC	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.401G>A	5.37:g.124080282C>T	ENSP00000307746:p.Gly134Asp	124.0	1.0	0.00806452		131.0	112.0	0.854962	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152626	0.57259	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.55052	0.54	5.33	4.46	0.54185	.	0.287027	0.30446	N	0.009608	T	0.44244	0.1284	L	0.48642	1.525	0.80722	D	1	B	0.16802	0.019	B	0.19946	0.027	T	0.34825	-0.9813	10	0.37606	T	0.19	-16.5901	9.4407	0.38666	0.0:0.7796:0.1439:0.0765	.	134	Q9ULD9	ZN608_HUMAN	D	134	ENSP00000307746:G134D	ENSP00000307746:G134D	G	-	2	0	ZNF608	124108181	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.891000	0.48617	1.381000	0.46364	0.655000	0.94253	GGC	.	.	none		0.527	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
NGEF	25791	hgsc.bcm.edu	37	2	233759514	233759514	+	Missense_Mutation	SNP	G	G	A	rs183477550	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:233759514G>A	ENST00000264051.3	-	6	1219	c.941C>T	c.(940-942)gCg>gTg	p.A314V	NGEF_ENST00000539537.1_Missense_Mutation_p.A37V|NGEF_ENST00000409079.1_Missense_Mutation_p.A222V|NGEF_ENST00000373552.4_Missense_Mutation_p.A222V	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	314	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GAGGATGTGCGCCTCGGACGG	0.612													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17319	0.001		0.0	False		,,,				2504	0.0				p.A314V		Atlas-SNP	.											.	NGEF	198	.	0			c.C941T						PASS	.						110.0	94.0	100.0					2																	233759514		2203	4299	6502	SO:0001583	missense	25791	exon6			ATGTGCGCCTCGG	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.941C>T	2.37:g.233759514G>A	ENSP00000264051:p.Ala314Val	81.0	0.0	0		115.0	12.0	0.104348	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	CCDS2500.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.58	2.279274	0.40294	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537;ENST00000416114;ENST00000458735;ENST00000409079	T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08	5.22	5.22	0.72569	Dbl homology (DH) domain (5);	0.479329	0.23496	N	0.047544	T	0.27524	0.0676	N	0.03608	-0.345	0.29453	N	0.858306	B;B;P	0.34800	0.045;0.044;0.469	B;B;B	0.19148	0.013;0.021;0.024	T	0.14364	-1.0475	10	0.18276	T	0.48	-26.6423	12.1758	0.54184	0.078:0.0:0.922:0.0	.	222;222;314	E9PC42;B4DMB8;Q8N5V2	.;.;NGEF_HUMAN	V	314;222;204;37;37;37;222	ENSP00000264051:A314V;ENSP00000362653:A222V;ENSP00000439035:A37V;ENSP00000401063:A37V;ENSP00000412614:A37V;ENSP00000387033:A222V	ENSP00000264051:A314V	A	-	2	0	NGEF	233467758	0.424000	0.25490	0.940000	0.37924	0.791000	0.44710	2.309000	0.43699	2.440000	0.82611	0.655000	0.94253	GCG	G|1.000;A|0.000	0.000	strong		0.612	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
SMPD2	6610	hgsc.bcm.edu	37	6	109764547	109764547	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:109764547C>T	ENST00000258052.3	+	9	1166	c.807C>T	c.(805-807)ctC>ctT	p.L269L	PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	269					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		GCACCCCCCTCTCTGATCATG	0.542																																					p.L269L		Atlas-SNP	.											.	SMPD2	25	.	0			c.C807T						PASS	.						77.0	81.0	80.0					6																	109764547		2203	4300	6503	SO:0001819	synonymous_variant	6610	exon9			CCCCCTCTCTGAT	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.807C>T	6.37:g.109764547C>T		154.0	0.0	0		94.0	69.0	0.734043	NM_003080	Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	CCDS5075.1	.	.	.	.	.	.	.	.	.	.	C	3.719	-0.057929	0.07317	.	.	ENSG00000135587	ENST00000458487	.	.	.	5.95	0.892	0.19230	.	.	.	.	.	T	0.25568	0.0622	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.17440	-1.0369	4	.	.	.	-6.5899	1.8071	0.03083	0.1417:0.4848:0.1377:0.2358	.	.	.	.	F	166	.	.	S	+	2	0	SMPD2	109871240	0.987000	0.35691	0.922000	0.36590	0.668000	0.39293	0.475000	0.22164	0.089000	0.17243	-0.136000	0.14681	TCT	.	.	none		0.542	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
MEGF8	1954	hgsc.bcm.edu	37	19	42859915	42859915	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:42859915C>T	ENST00000251268.6	+	24	4150	c.4150C>T	c.(4150-4152)Ctc>Ttc	p.L1384F	MEGF8_ENST00000334370.4_Missense_Mutation_p.L1317F	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1384	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CACAGGGCTGCTCGTGCTGCA	0.637																																					p.L1384F		Atlas-SNP	.											.	MEGF8	358	.	0			c.C4150T						PASS	.						18.0	13.0	15.0					19																	42859915		2201	4300	6501	SO:0001583	missense	1954	exon24			GGGCTGCTCGTGC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4150C>T	19.37:g.42859915C>T	ENSP00000251268:p.Leu1384Phe	97.0	0.0	0		66.0	53.0	0.80303	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	C	13.61	2.288997	0.40494	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.35789	1.29;1.29	4.74	4.74	0.60224	CUB (1);	0.172164	0.38897	N	0.001533	T	0.43523	0.1251	N	0.19112	0.55	0.80722	D	1	D;D	0.67145	0.995;0.996	P;D	0.63793	0.858;0.918	T	0.43605	-0.9381	10	0.52906	T	0.07	-20.7852	16.6455	0.85176	0.0:1.0:0.0:0.0	.	1384;1317	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	F	1317;1384	ENSP00000334219:L1317F;ENSP00000251268:L1384F	ENSP00000251268:L1384F	L	+	1	0	MEGF8	47551755	1.000000	0.71417	0.995000	0.50966	0.142000	0.21351	3.448000	0.52943	2.481000	0.83766	0.655000	0.94253	CTC	.	.	none		0.637	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
TJP1	7082	hgsc.bcm.edu	37	15	30011279	30011279	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr15:30011279C>G	ENST00000346128.6	-	21	3541	c.3067G>C	c.(3067-3069)Gcc>Ccc	p.A1023P	TJP1_ENST00000545208.2_Missense_Mutation_p.A943P|TJP1_ENST00000400011.2_Missense_Mutation_p.A947P|TJP1_ENST00000356107.6_Missense_Mutation_p.A1023P	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1023					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TGACTAACGGCTGGCTGTTTC	0.458																																					p.A1023P	Melanoma(77;681 1843 6309 6570)	Atlas-SNP	.											TJP1,NS,NS,+2,1	TJP1	140	1	0			c.G3067C						PASS	.						194.0	196.0	195.0					15																	30011279		1987	4164	6151	SO:0001583	missense	7082	exon21			TAACGGCTGGCTG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3067G>C	15.37:g.30011279C>G	ENSP00000281537:p.Ala1023Pro	198.0	0.0	0		137.0	111.0	0.810219	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	9.190	1.025747	0.19512	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.07216	3.21;3.34	5.93	-0.696	0.11287	.	0.381382	0.27429	N	0.019405	T	0.06280	0.0162	L	0.45581	1.43	0.18873	N	0.999988	B;B;B;B	0.12013	0.005;0.001;0.002;0.0	B;B;B;B	0.09377	0.004;0.002;0.002;0.003	T	0.26950	-1.0088	10	0.40728	T	0.16	.	4.3747	0.11265	0.1004:0.5365:0.1958:0.1673	.	1016;943;1023;947	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	P	1023;947;1023;943;943	ENSP00000281537:A1023P;ENSP00000382890:A947P	ENSP00000281537:A1023P	A	-	1	0	TJP1	27798571	0.070000	0.21116	0.219000	0.23793	0.897000	0.52465	-0.263000	0.08670	0.126000	0.18424	0.563000	0.77884	GCC	.	.	none		0.458	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
SIX4	51804	hgsc.bcm.edu	37	14	61186927	61186927	+	Missense_Mutation	SNP	T	T	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr14:61186927T>C	ENST00000216513.4	-	2	1159	c.1100A>G	c.(1099-1101)aAt>aGt	p.N367S		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	367					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		AATAAAAGAATTTCCATTAAG	0.388																																					p.N367S		Atlas-SNP	.											.	SIX4	69	.	0			c.A1100G						PASS	.						83.0	80.0	81.0					14																	61186927		2203	4300	6503	SO:0001583	missense	51804	exon2			AAAGAATTTCCAT	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1100A>G	14.37:g.61186927T>C	ENSP00000216513:p.Asn367Ser	154.0	0.0	0		142.0	40.0	0.28169	NM_017420	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	37	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	T	2.699	-0.271504	0.05716	.	.	ENSG00000100625	ENST00000216513;ENST00000554079;ENST00000556952	D;T	0.89746	-2.56;1.13	5.62	4.49	0.54785	.	0.333671	0.31624	N	0.007327	T	0.66587	0.2804	N	0.02916	-0.46	0.28150	N	0.929414	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.57429	-0.7813	10	0.06625	T	0.88	.	3.2835	0.06924	0.0:0.2058:0.2126:0.5816	.	359;367	G3V2N2;Q9UIU6	.;SIX4_HUMAN	S	367;40;359	ENSP00000216513:N367S;ENSP00000451537:N40S	ENSP00000216513:N367S	N	-	2	0	SIX4	60256680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.575000	0.46025	2.150000	0.67090	0.533000	0.62120	AAT	.	.	none		0.388	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
SLC2A14	144195	hgsc.bcm.edu	37	12	7970447	7970447	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:7970447A>C	ENST00000543909.1	-	15	2083	c.1324T>G	c.(1324-1326)Ttg>Gtg	p.L442V	SLC2A14_ENST00000542505.1_Missense_Mutation_p.L83V|SLC2A14_ENST00000396589.2_Missense_Mutation_p.L442V|SLC2A14_ENST00000535295.1_Missense_Mutation_p.L333V|SLC2A14_ENST00000542546.1_Missense_Mutation_p.L333V|SLC2A14_ENST00000340749.5_Missense_Mutation_p.L419V|SLC2A14_ENST00000431042.2_Missense_Mutation_p.L419V|SLC2A14_ENST00000539924.1_Missense_Mutation_p.L457V			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	442					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		GGGAAGAGCAATCCGACTAGG	0.483																																					p.L442V		Atlas-SNP	.											.	SLC2A14	78	.	0			c.T1324G						PASS	.						50.0	51.0	51.0					12																	7970447		2203	4300	6503	SO:0001583	missense	144195	exon11			AGAGCAATCCGAC	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1324T>G	12.37:g.7970447A>C	ENSP00000440480:p.Leu442Val	158.0	1.0	0.00632911		96.0	80.0	0.833333	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.325096	0.41197	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000542505;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	3.31	-2.39	0.06602	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.356645	0.29260	N	0.012680	T	0.73892	0.3645	M	0.76938	2.355	0.32386	N	0.553901	P;P;P;P	0.49358	0.923;0.866;0.545;0.549	P;P;B;B	0.52672	0.706;0.619;0.248;0.34	T	0.72090	-0.4395	10	0.66056	D	0.02	.	1.8486	0.03164	0.1194:0.1529:0.244:0.4836	.	457;333;419;442	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	V	419;442;419;83;442;333;333;457	ENSP00000340450:L419V;ENSP00000440480:L442V;ENSP00000407287:L419V;ENSP00000438484:L83V;ENSP00000379834:L442V;ENSP00000440492:L333V;ENSP00000443903:L333V;ENSP00000445929:L457V	ENSP00000340450:L419V	L	-	1	2	SLC2A14	7861714	0.023000	0.18921	0.519000	0.27824	0.790000	0.44656	0.099000	0.15210	-0.335000	0.08451	0.164000	0.16699	TTG	.	.	none		0.483	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
CHD5	26038	hgsc.bcm.edu	37	1	6208928	6208928	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:6208928A>T	ENST00000262450.3	-	9	1468	c.1369T>A	c.(1369-1371)Tgc>Agc	p.C457S	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAGCGCGGGCAGAGCCATTCA	0.721																																					p.C457S		Atlas-SNP	.											.	CHD5	267	.	0			c.T1369A						PASS	.						49.0	55.0	53.0					1																	6208928		2202	4300	6502	SO:0001583	missense	26038	exon9			GCGGGCAGAGCCA	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1369T>A	1.37:g.6208928A>T	ENSP00000262450:p.Cys457Ser	100.0	0.0	0		77.0	51.0	0.662338	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.693706	0.88735	.	.	ENSG00000116254	ENST00000262450	D	0.99252	-5.63	3.56	3.56	0.40772	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Chromo domain-like (1);	0.000000	0.85682	U	0.000000	D	0.99521	0.9829	H	0.98682	4.3	0.80722	D	1	D	0.63046	0.992	P	0.57244	0.816	D	0.98206	1.0470	10	0.87932	D	0	-21.3112	12.1231	0.53903	1.0:0.0:0.0:0.0	.	457	Q8TDI0	CHD5_HUMAN	S	457	ENSP00000262450:C457S	ENSP00000262450:C457S	C	-	1	0	CHD5	6131515	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.355000	0.79434	1.410000	0.46936	0.260000	0.18958	TGC	.	.	none		0.721	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
ZFHX4	79776	hgsc.bcm.edu	37	8	77618778	77618778	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr8:77618778G>T	ENST00000521891.2	+	2	2903	c.2455G>T	c.(2455-2457)Gag>Tag	p.E819*	ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.E819*|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.E819*|ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.E819*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	819					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGCGGAAGCAGAGCTTTATCA	0.507										HNSCC(33;0.089)																											p.E819X		Atlas-SNP	.											.	ZFHX4	878	.	0			c.G2455T						PASS	.						20.0	20.0	20.0					8																	77618778		2019	4178	6197	SO:0001587	stop_gained	79776	exon2			GAAGCAGAGCTTT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2455G>T	8.37:g.77618778G>T	ENSP00000430497:p.Glu819*	92.0	0.0	0		71.0	36.0	0.507042	NM_024721	G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	38	6.790914	0.97841	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	4.91	4.91	0.64330	.	0.000000	0.43579	U	0.000548	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.6385	0.91386	0.0:0.0:1.0:0.0	.	.	.	.	X	819	.	ENSP00000050961:E819X	E	+	1	0	ZFHX4	77781333	1.000000	0.71417	0.976000	0.42696	0.921000	0.55340	9.559000	0.98135	2.699000	0.92147	0.585000	0.79938	GAG	.	.	none		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
HS3ST1	9957	hgsc.bcm.edu	37	4	11401388	11401388	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr4:11401388G>A	ENST00000002596.5	-	2	1416	c.242C>T	c.(241-243)gCg>gTg	p.A81V		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	81					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CTCCGCGGCCGCCACGTCGGG	0.657																																					p.A81V		Atlas-SNP	.											.	HS3ST1	41	.	0			c.C242T						PASS	.						61.0	52.0	55.0					4																	11401388		2203	4300	6503	SO:0001583	missense	9957	exon2			GCGGCCGCCACGT	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.242C>T	4.37:g.11401388G>A	ENSP00000002596:p.Ala81Val	68.0	0.0	0		64.0	28.0	0.4375	NM_005114	B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	37	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096989	0.56075	.	.	ENSG00000002587	ENST00000002596;ENST00000514690;ENST00000510712	T;T;T	0.55234	0.53;0.53;0.53	5.81	5.81	0.92471	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	N	0.20610	0.595	0.80722	D	1	P	0.52692	0.955	P	0.44394	0.448	T	0.18840	-1.0324	10	0.13853	T	0.58	.	19.0707	0.93134	0.0:0.0:1.0:0.0	.	81	O14792	HS3S1_HUMAN	V	81	ENSP00000002596:A81V;ENSP00000425673:A81V;ENSP00000422629:A81V	ENSP00000002596:A81V	A	-	2	0	HS3ST1	11010486	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	8.006000	0.88564	2.746000	0.94184	0.655000	0.94253	GCG	.	.	none		0.657	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114	
RUNX1T1	862	hgsc.bcm.edu	37	8	93026977	93026977	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr8:93026977C>T	ENST00000523629.1	-	4	752	c.298G>A	c.(298-300)Ggg>Agg	p.G100R	RUNX1T1_ENST00000396218.1_Missense_Mutation_p.G73R|RUNX1T1_ENST00000522163.1_5'Flank|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.G63R|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.G100R|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.G111R|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.G73R|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.G63R|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.G63R|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.G63R	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	100					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GAGGAAGGCCCATTGCTGAAG	0.532																																					p.G159R		Atlas-SNP	.											.	RUNX1T1	516	.	0			c.G475A						PASS	.						58.0	60.0	59.0					8																	93026977		2203	4300	6503	SO:0001583	missense	862	exon4			AAGGCCCATTGCT	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.298G>A	8.37:g.93026977C>T	ENSP00000428543:p.Gly100Arg	79.0	0.0	0		52.0	22.0	0.423077	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	34	5.322905	0.95708	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054;ENST00000519847;ENST00000517792;ENST00000522467;ENST00000517919;ENST00000521733;ENST00000520556;ENST00000521319;ENST00000520583;ENST00000523168;ENST00000518823	T;T;T;T;T;T;T;T;T;T;T	0.48836	1.36;1.37;1.36;1.38;1.38;1.38;1.36;1.37;0.82;0.8;1.42	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.68137	0.2968	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.994;1.0;0.986;1.0;0.994	T	0.65071	-0.6257	10	0.52906	T	0.07	-18.8339	20.6013	0.99457	0.0:1.0:0.0:0.0	.	111;111;73;100;73	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	R	100;73;100;63;63;63;111;73;63;100;63;100;63;100;100;73;63;63;100;100;73	ENSP00000428543:G100R;ENSP00000379520:G73R;ENSP00000265814:G100R;ENSP00000353504:G63R;ENSP00000390137:G63R;ENSP00000428742:G63R;ENSP00000402257:G111R;ENSP00000430728:G73R;ENSP00000429728:G63R;ENSP00000431094:G100R;ENSP00000427763:G63R	ENSP00000265814:G100R	G	-	1	0	RUNX1T1	93096153	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.783000	0.85696	2.878000	0.98634	0.650000	0.86243	GGG	.	.	none		0.532	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
ANKFY1	51479	hgsc.bcm.edu	37	17	4071128	4071128	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:4071128G>A	ENST00000341657.4	-	25	3490	c.3455C>T	c.(3454-3456)cCt>cTt	p.P1152L	CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000574367.1_Missense_Mutation_p.P1153L|ANKFY1_ENST00000570535.1_Missense_Mutation_p.P1194L	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	1152					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						AACCCGCACAGGCTTGTTCAG	0.502																																					p.P1194L		Atlas-SNP	.											.	ANKFY1	81	.	0			c.C3581T						PASS	.						62.0	67.0	65.0					17																	4071128		1883	4107	5990	SO:0001583	missense	51479	exon25			CGCACAGGCTTGT	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.3455C>T	17.37:g.4071128G>A	ENSP00000343362:p.Pro1152Leu	50.0	0.0	0		37.0	27.0	0.72973	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		.	.	.	.	.	.	.	.	.	.	G	27.0	4.788564	0.90367	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	4.88	4.88	0.63580	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.83737	0.5319	M	0.85542	2.76	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.86167	0.1597	9	0.72032	D	0.01	-14.4331	17.5598	0.87902	0.0:0.0:1.0:0.0	.	1094;1152;1153;1194	F5H754;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;ANFY1_HUMAN;.;.	L	1153;1094	.	ENSP00000343362:P1153L	P	-	2	0	ANKFY1	4017877	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.567000	0.98161	2.697000	0.92050	0.563000	0.77884	CCT	.	.	none		0.502	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
DRG2	1819	hgsc.bcm.edu	37	17	18003008	18003008	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:18003008G>A	ENST00000225729.3	+	5	576	c.438G>A	c.(436-438)atG>atA	p.M146I	DRG2_ENST00000395726.4_Missense_Mutation_p.M146I|DRG2_ENST00000583355.1_Intron	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	146	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					TCATCATGATGCTGGATGCCA	0.617																																					p.M146I		Atlas-SNP	.											.	DRG2	27	.	0			c.G438A						PASS	.						56.0	41.0	46.0					17																	18003008		2203	4300	6503	SO:0001583	missense	1819	exon5			CATGATGCTGGAT	X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.438G>A	17.37:g.18003008G>A	ENSP00000225729:p.Met146Ile	146.0	0.0	0		67.0	52.0	0.776119	NM_001388	B2R8G5|Q53Y50|Q9BWB2	Missense_Mutation	SNP	ENST00000225729.3	37	CCDS11191.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708499	0.68615	.	.	ENSG00000108591	ENST00000395726;ENST00000225729	T;T	0.15834	2.39;2.39	5.6	5.6	0.85130	Small GTP-binding protein domain (1);GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.15262	0.0368	N	0.13098	0.295	0.80722	D	1	B;B	0.16802	0.019;0.019	B;B	0.28709	0.093;0.056	T	0.10132	-1.0643	10	0.52906	T	0.07	-40.0835	19.5973	0.95546	0.0:0.0:1.0:0.0	.	146;146	A8MZF9;P55039	.;DRG2_HUMAN	I	146	ENSP00000379076:M146I;ENSP00000225729:M146I	ENSP00000225729:M146I	M	+	3	0	DRG2	17943733	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.744000	0.98853	2.640000	0.89533	0.467000	0.42956	ATG	.	.	none		0.617	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		48.0	0.0	0		72.0	11.0	0.152778	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
DDX60	55601	hgsc.bcm.edu	37	4	169212958	169212958	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr4:169212958C>G	ENST00000393743.3	-	8	1273	c.982G>C	c.(982-984)Gct>Cct	p.A328P		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	328					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CTAGCACAAGCTCTTTGAGAA	0.388																																					p.A328P		Atlas-SNP	.											.	DDX60	304	.	0			c.G982C						PASS	.						97.0	97.0	97.0					4																	169212958		2203	4300	6503	SO:0001583	missense	55601	exon8			CACAAGCTCTTTG	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.982G>C	4.37:g.169212958C>G	ENSP00000377344:p.Ala328Pro	75.0	0.0	0		91.0	40.0	0.43956	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969121	0.53614	.	.	ENSG00000137628	ENST00000393743	T	0.23348	1.91	4.79	4.79	0.61399	.	0.000000	0.64402	D	0.000012	T	0.51210	0.1661	M	0.75264	2.295	0.39673	D	0.970785	D	0.89917	1.0	D	0.79108	0.992	T	0.56220	-0.8015	10	0.59425	D	0.04	.	15.7864	0.78306	0.0:1.0:0.0:0.0	.	328	Q8IY21	DDX60_HUMAN	P	328	ENSP00000377344:A328P	ENSP00000377344:A328P	A	-	1	0	DDX60	169449533	1.000000	0.71417	0.997000	0.53966	0.192000	0.23643	3.850000	0.55918	2.510000	0.84645	0.563000	0.77884	GCT	.	.	none		0.388	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
KIAA1468	57614	hgsc.bcm.edu	37	18	59936160	59936160	+	Silent	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr18:59936160A>T	ENST00000398130.2	+	20	2971	c.2739A>T	c.(2737-2739)ggA>ggT	p.G913G	KIAA1468_ENST00000256858.6_Silent_p.G913G	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	913										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				ATGCAACAGGAGTCCTTACGT	0.318																																					p.G913G		Atlas-SNP	.											.	KIAA1468	93	.	0			c.A2739T						PASS	.						48.0	49.0	48.0					18																	59936160		2203	4298	6501	SO:0001819	synonymous_variant	57614	exon20			AACAGGAGTCCTT	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2739A>T	18.37:g.59936160A>T		521.0	0.0	0		285.0	216.0	0.757895	NM_020854		Silent	SNP	ENST00000398130.2	37	CCDS11979.2																																																																																			.	.	none		0.318	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
GLS	2744	hgsc.bcm.edu	37	2	191746033	191746033	+	Missense_Mutation	SNP	T	T	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr2:191746033T>G	ENST00000320717.3	+	1	481	c.223T>G	c.(223-225)Tct>Gct	p.S75A	AC005540.3_ENST00000413911.1_RNA|GLS_ENST00000338435.4_Missense_Mutation_p.S75A	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	75					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	ccTGTCCAGCTCTCCTTCGGA	0.806																																					p.S75A		Atlas-SNP	.											.	GLS	47	.	0			c.T223G						PASS	.						2.0	3.0	3.0					2																	191746033		1153	2110	3263	SO:0001583	missense	2744	exon1			TCCAGCTCTCCTT	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.223T>G	2.37:g.191746033T>G	ENSP00000317379:p.Ser75Ala	23.0	0.0	0		26.0	15.0	0.576923	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	37	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.549476	0.45383	.	.	ENSG00000115419	ENST00000320717;ENST00000338435	T;T	0.46451	0.98;0.87	3.58	3.58	0.41010	.	0.391203	0.18719	U	0.133071	T	0.26955	0.0660	N	0.24115	0.695	0.80722	D	1	B;B;P	0.35872	0.013;0.023;0.525	B;B;B	0.35353	0.006;0.07;0.201	T	0.05886	-1.0858	10	0.36615	T	0.2	-7.0459	8.6962	0.34298	0.0:0.0:0.0:1.0	.	75;75;75	O94925;O94925-3;O94925-2	GLSK_HUMAN;.;.	A	75	ENSP00000317379:S75A;ENSP00000340689:S75A	ENSP00000317379:S75A	S	+	1	0	GLS	191454278	0.983000	0.35010	0.645000	0.29479	0.495000	0.33615	2.600000	0.46240	1.623000	0.50342	0.402000	0.26972	TCT	.	.	none		0.806	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
CCP110	9738	hgsc.bcm.edu	37	16	19554242	19554242	+	Missense_Mutation	SNP	G	G	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr16:19554242G>C	ENST00000381396.5	+	8	2657	c.2410G>C	c.(2410-2412)Gca>Cca	p.A804P	CCP110_ENST00000396212.2_Missense_Mutation_p.A804P|CCP110_ENST00000396208.2_Missense_Mutation_p.A804P	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	804	Calmodulin-binding.				cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						CAAAATAACTGCAGTGGCAAA	0.333																																					p.A804P		Atlas-SNP	.											.	CCP110	57	.	0			c.G2410C						PASS	.						96.0	97.0	97.0					16																	19554242		2197	4300	6497	SO:0001583	missense	9738	exon8			ATAACTGCAGTGG	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2410G>C	16.37:g.19554242G>C	ENSP00000370803:p.Ala804Pro	163.0	0.0	0		183.0	10.0	0.0546448	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534605	0.85812	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.46819	0.87;0.86;0.87	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.72684	0.3491	M	0.81497	2.545	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75614	-0.3257	10	0.87932	D	0	-0.8444	19.7559	0.96291	0.0:0.0:1.0:0.0	.	804;804	O43303;O43303-2	CP110_HUMAN;.	P	804	ENSP00000379515:A804P;ENSP00000370803:A804P;ENSP00000379511:A804P	ENSP00000370803:A804P	A	+	1	0	CCP110	19461743	1.000000	0.71417	0.970000	0.41538	0.899000	0.52679	7.591000	0.82666	2.656000	0.90262	0.655000	0.94253	GCA	.	.	none		0.333	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
CLGN	1047	hgsc.bcm.edu	37	4	141313740	141313740	+	Splice_Site	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr4:141313740C>T	ENST00000325617.5	-	12	1931	c.1491G>A	c.(1489-1491)aaG>aaA	p.K497K	CLGN_ENST00000414773.1_Splice_Site_p.K497K|CLGN_ENST00000537281.1_Splice_Site_p.K497K	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	497					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					TTTTCTTTACCTTTACTTTTC	0.343																																					p.K497K		Atlas-SNP	.											.	CLGN	76	.	0			c.G1491A						PASS	.						60.0	58.0	59.0					4																	141313740		2203	4300	6503	SO:0001630	splice_region_variant	1047	exon13			CTTTACCTTTACT	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.1491+1G>A	4.37:g.141313740C>T		202.0	0.0	0		170.0	26.0	0.152941	NM_001130675	B3KS90|B4DXV8|D3DNY8	Silent	SNP	ENST00000325617.5	37	CCDS3751.1																																																																																			.	.	none		0.343	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2	NM_004362	Silent
HOXB5	3215	hgsc.bcm.edu	37	17	46669811	46669811	+	Silent	SNP	G	G	A	rs201570571		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:46669811G>A	ENST00000239151.5	-	2	848	c.570C>T	c.(568-570)acC>acT	p.T190T	HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB3_ENST00000476342.1_5'Flank|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB3_ENST00000460160.1_5'Flank|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB3_ENST00000498678.1_5'Flank|HOXB3_ENST00000472863.1_5'Flank	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	190					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell differentiation (GO:0045446)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			large_intestine(1)|lung(2)	3						CGTCCGGCCCGGTCATATCTG	0.642																																					p.T190T		Atlas-SNP	.											.	HOXB5	20	.	0			c.C570T						PASS	.						37.0	38.0	37.0					17																	46669811		2203	4300	6503	SO:0001819	synonymous_variant	3215	exon2			CGGCCCGGTCATA		CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075		"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A		1973146, 1358459	Standard	NM_002147		Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.570C>T	17.37:g.46669811G>A		81.0	0.0	0		60.0	29.0	0.483333	NM_002147	B2RC69|P09069|Q17RP4	Silent	SNP	ENST00000239151.5	37	CCDS11530.1																																																																																			G|1.000;C|0.000	.	alt		0.642	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358148.2		
MUC17	140453	hgsc.bcm.edu	37	7	100695189	100695189	+	Missense_Mutation	SNP	C	C	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:100695189C>A	ENST00000306151.4	+	9	13113	c.13049C>A	c.(13048-13050)tCc>tAc	p.S4350Y		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4350					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCAGTGTCTCCAAGAACTGT	0.572																																					p.S4350Y		Atlas-SNP	.											.	MUC17	804	.	0			c.C13049A						PASS	.						188.0	167.0	174.0					7																	100695189		2203	4300	6503	SO:0001583	missense	140453	exon9			GTGTCTCCAAGAA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13049C>A	7.37:g.100695189C>A	ENSP00000302716:p.Ser4350Tyr	85.0	0.0	0		84.0	35.0	0.416667	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	5.810	0.333824	0.11013	.	.	ENSG00000169876	ENST00000306151	T	0.52057	0.68	4.26	3.34	0.38264	.	.	.	.	.	T	0.52158	0.1717	L	0.28556	0.865	0.09310	N	1	D	0.63046	0.992	D	0.64506	0.926	T	0.36261	-0.9755	9	0.66056	D	0.02	.	9.2479	0.37539	0.2158:0.7842:0.0:0.0	.	4350	Q685J3	MUC17_HUMAN	Y	4350	ENSP00000302716:S4350Y	ENSP00000302716:S4350Y	S	+	2	0	MUC17	100481909	0.058000	0.20735	0.004000	0.12327	0.003000	0.03518	3.104000	0.50306	1.079000	0.41038	0.561000	0.74099	TCC	.	.	none		0.572	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
TRIM55	84675	hgsc.bcm.edu	37	8	67067878	67067878	+	Intron	SNP	G	G	A	rs373183172		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr8:67067878G>A	ENST00000315962.4	+	9	1897				TRIM55_ENST00000276573.7_Silent_p.A515A|TRIM55_ENST00000353317.5_Intron|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55						signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TCTGCCTAGCGCTTTTGGCTT	0.318																																					p.A515A		Atlas-SNP	.											.	TRIM55	91	.	0			c.G1545A						PASS	.	G	,,,	0,4404		0,0,2202	164.0	155.0	158.0		1545,,,	1.8	1.0	8		158	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron,intron,intron	TRIM55	NM_033058.2,NM_184085.1,NM_184086.1,NM_184087.1	,,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,,	515/541,,,	67067878	1,13003	2202	4300	6502	SO:0001627	intron_variant	84675	exon10			CCTAGCGCTTTTG	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1524+1309G>A	8.37:g.67067878G>A		266.0	0.0	0		237.0	44.0	0.185654	NM_033058	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Silent	SNP	ENST00000315962.4	37	CCDS6184.1																																																																																			.	.	weak		0.318	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
PDE4DIP	9659	hgsc.bcm.edu	37	1	145075675	145075675	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:145075675G>A	ENST00000530740.1	-	1	226	c.188C>T	c.(187-189)gCg>gTg	p.A63V	PDE4DIP_ENST00000369345.4_Missense_Mutation_p.A63V|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.A63V|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.A63V			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCCTCGGCCGCTGCTGCCCA	0.716			T	PDGFRB	MPD																																p.A63V		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.C188T						PASS	.						38.0	48.0	45.0					1																	145075675		2192	4281	6473	SO:0001583	missense	9659	exon1			TCGGCCGCTGCTG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.188C>T	1.37:g.145075675G>A	ENSP00000435654:p.Ala63Val	167.0	0.0	0		270.0	27.0	0.1	NM_022359	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	37		.	.	.	.	.	.	.	.	.	.	G	9.842	1.191237	0.21954	.	.	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.15487	3.79;3.76;2.42	3.6	2.68	0.31781	.	.	.	.	.	T	0.04679	0.0127	N	0.24115	0.695	0.09310	N	1	D;P	0.65815	0.995;0.926	B;B	0.43155	0.41;0.117	T	0.23084	-1.0198	9	0.87932	D	0	.	6.8328	0.23919	0.1306:0.0:0.8694:0.0	.	63;63	Q5TB27;E9PJ64	.;.	V	63	ENSP00000435654:A63V;ENSP00000358366:A63V;ENSP00000358354:A63V	ENSP00000358351:A63V	A	-	2	0	PDE4DIP	143787032	0.056000	0.20664	0.012000	0.15200	0.095000	0.18619	0.881000	0.28173	0.849000	0.35215	0.561000	0.74099	GCG	.	.	none		0.716	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359	
COL5A3	50509	hgsc.bcm.edu	37	19	10103700	10103700	+	Splice_Site	SNP	G	G	A	rs147814824		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:10103700G>A	ENST00000264828.3	-	20	1878	c.1793C>T	c.(1792-1794)cCg>cTg	p.P598L	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	598	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GATACTCACCGGCTCCCCAGC	0.632																																					p.P598L		Atlas-SNP	.											.	COL5A3	243	.	0			c.C1793T						PASS	.	G	LEU/PRO	1,4405		0,1,2202	21.0	23.0	22.0		1793	4.2	1.0	19	dbSNP_134	22	1,8599		0,1,4299	yes	missense-near-splice	COL5A3	NM_015719.3	98	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	598/1746	10103700	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	50509	exon20			CTCACCGGCTCCC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1794+1C>T	19.37:g.10103700G>A		78.0	0.0	0		68.0	23.0	0.338235	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160144	0.38119	2.27E-4	1.16E-4	ENSG00000080573	ENST00000264828	D	0.93488	-3.23	4.2	4.2	0.49525	.	0.075522	0.53938	D	0.000050	D	0.92080	0.7490	N	0.21240	0.645	0.51767	D	0.99993	D	0.76494	0.999	P	0.61800	0.894	D	0.91127	0.4934	10	0.38643	T	0.18	.	11.9061	0.52713	0.0:0.0:1.0:0.0	.	598	P25940	CO5A3_HUMAN	L	598	ENSP00000264828:P598L	ENSP00000264828:P598L	P	-	2	0	COL5A3	9964700	0.997000	0.39634	0.999000	0.59377	0.982000	0.71751	2.523000	0.45580	2.176000	0.68965	0.561000	0.74099	CCG	G|1.000;A|0.000	0.000	weak		0.632	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	Missense_Mutation
RTN2	6253	hgsc.bcm.edu	37	19	45991939	45991939	+	Missense_Mutation	SNP	G	G	T	rs190900651		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:45991939G>T	ENST00000245923.4	-	8	1641	c.1406C>A	c.(1405-1407)aCc>aAc	p.T469N	PPM1N_ENST00000401705.1_5'Flank|RTN2_ENST00000430715.2_Missense_Mutation_p.T129N|RTN2_ENST00000590526.1_Missense_Mutation_p.T195N|RTN2_ENST00000344680.4_Missense_Mutation_p.T396N	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	469	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		ACCCACGAAGGTCAAGATGTA	0.567													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18946	0.0		0.0	False		,,,				2504	0.0				p.T469N		Atlas-SNP	.											.	RTN2	45	.	0			c.C1406A						PASS	.						41.0	40.0	41.0					19																	45991939		2203	4300	6503	SO:0001583	missense	6253	exon8			ACGAAGGTCAAGA	AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1406C>A	19.37:g.45991939G>T	ENSP00000245923:p.Thr469Asn	33.0	0.0	0		46.0	7.0	0.152174	NM_005619	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	ENST00000245923.4	37	CCDS12665.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	26.3	4.722770	0.89298	.	.	ENSG00000125744	ENST00000344680;ENST00000245923;ENST00000430715	T;T;T	0.48201	0.82;0.82;0.82	5.58	5.58	0.84498	.	0.106863	0.64402	D	0.000006	T	0.67739	0.2925	M	0.72479	2.2	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.87578	0.973;0.998	T	0.69161	-0.5218	10	0.59425	D	0.04	-25.1144	15.1396	0.72601	0.0:0.0:1.0:0.0	.	396;469	O75298-2;O75298	.;RTN2_HUMAN	N	396;469;129	ENSP00000345127:T396N;ENSP00000245923:T469N;ENSP00000398178:T129N	ENSP00000245923:T469N	T	-	2	0	RTN2	50683779	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.591000	0.90824	2.649000	0.89929	0.650000	0.86243	ACC	G|1.000;T|0.000	0.000	strong		0.567	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619	
FRMPD1	22844	hgsc.bcm.edu	37	9	37746410	37746410	+	Missense_Mutation	SNP	C	C	T	rs199593687		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr9:37746410C>T	ENST00000539465.1	+	16	4974	c.4381C>T	c.(4381-4383)Cgc>Tgc	p.R1461C	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.R1461C			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1461						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AAGCCGGAGCCGCCTCTGCAT	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16762	0.0		0.0	False		,,,				2504	0.0				p.R1461C		Atlas-SNP	.											.	FRMPD1	237	.	0			c.C4381T						PASS	.						20.0	23.0	22.0					9																	37746410		2202	4299	6501	SO:0001583	missense	22844	exon16			CGGAGCCGCCTCT	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4381C>T	9.37:g.37746410C>T	ENSP00000444411:p.Arg1461Cys	32.0	0.0	0		22.0	14.0	0.636364	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	17.19	3.325729	0.60743	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07444	3.19;3.19	5.67	3.13	0.36017	.	0.672742	0.15711	N	0.248395	T	0.06371	0.0164	L	0.29908	0.895	0.80722	D	1	B	0.16603	0.018	B	0.08055	0.003	T	0.21895	-1.0232	10	0.46703	T	0.11	-8.2395	7.7661	0.28980	0.23:0.6848:0.0:0.0852	.	1461	Q5SYB0	FRPD1_HUMAN	C	1461	ENSP00000366995:R1461C;ENSP00000444411:R1461C	ENSP00000366995:R1461C	R	+	1	0	FRMPD1	37736410	0.387000	0.25188	1.000000	0.80357	0.998000	0.95712	0.559000	0.23485	2.672000	0.90937	0.655000	0.94253	CGC	C|1.000;T|0.000	0.000	strong		0.572	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
B2M	567	hgsc.bcm.edu	37	15	45003745	45003745	+	Start_Codon_SNP	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr15:45003745A>T	ENST00000558401.1	+	1	71	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Start_Codon_SNP_p.M1L|B2M_ENST00000544417.1_Start_Codon_SNP_p.M1L	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	1					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.M1L(3)|p.M1V(2)|p.?(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCGGGCCGAGATGTCTCGCTC	0.612																																					p.M1L		Atlas-SNP	.											B2M,caecum,carcinoma,-2,17	B2M	99	17	6	Substitution - Missense(5)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(2)|lung(1)|large_intestine(1)	c.A1T						PASS	.						126.0	92.0	104.0					15																	45003745		2198	4298	6496	SO:0001582	initiator_codon_variant	567	exon1			GCCGAGATGTCTC	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.1A>T	15.37:g.45003745A>T	ENSP00000452780:p.Met1Leu	76.0	0.0	0		66.0	55.0	0.833333	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242783	0.79912	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01165	5.24	5.35	5.35	0.76521	.	.	.	.	.	T	0.01765	0.0056	.	.	.	0.80722	D	1	P;P;P	0.47302	0.835;0.893;0.745	B;B;B	0.41271	0.352;0.294;0.192	T	0.62821	-0.6773	8	0.87932	D	0	.	11.9	0.52678	1.0:0.0:0.0:0.0	.	1;1;1	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	L	1	ENSP00000437604:M1L	ENSP00000340858:M1L	M	+	1	0	B2M	42791037	0.891000	0.30450	0.406000	0.26421	0.024000	0.10985	1.849000	0.39318	2.371000	0.80710	0.533000	0.62120	ATG	.	.	none		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	Missense_Mutation
SLC27A1	376497	hgsc.bcm.edu	37	19	17615344	17615344	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr19:17615344G>A	ENST00000252595.7	+	12	1961	c.1864G>A	c.(1864-1866)Gac>Aac	p.D622N	SLC27A1_ENST00000598424.1_Missense_Mutation_p.D443N|CTD-3131K8.2_ENST00000596643.1_lincRNA|SLC27A1_ENST00000598848.1_3'UTR|SLC27A1_ENST00000442725.1_Missense_Mutation_p.D622N	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	622					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CTTCTTCCTGGACCTGAAGCA	0.597																																					p.D622N		Atlas-SNP	.											.	SLC27A1	97	.	0			c.G1864A						PASS	.						84.0	71.0	75.0					19																	17615344		2203	4300	6503	SO:0001583	missense	376497	exon12			TTCCTGGACCTGA	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.1864G>A	19.37:g.17615344G>A	ENSP00000252595:p.Asp622Asn	62.0	0.0	0		67.0	15.0	0.223881	NM_198580	A6NIH2|B7Z662	Missense_Mutation	SNP	ENST00000252595.7	37	CCDS32953.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097728	0.37048	.	.	ENSG00000130304	ENST00000442725;ENST00000252595	T;T	0.48201	0.82;0.82	4.13	4.13	0.48395	.	0.056406	0.64402	D	0.000001	T	0.31575	0.0801	N	0.17594	0.5	0.38800	D	0.955185	B;B	0.28667	0.008;0.219	B;B	0.27380	0.016;0.079	T	0.19712	-1.0297	10	0.30078	T	0.28	-8.2526	13.8877	0.63719	0.0:0.0:1.0:0.0	.	443;622	B7Z662;Q6PCB7	.;S27A1_HUMAN	N	622	ENSP00000413424:D622N;ENSP00000252595:D622N	ENSP00000252595:D622N	D	+	1	0	SLC27A1	17476344	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	5.864000	0.69575	1.831000	0.53308	0.561000	0.74099	GAC	.	.	none		0.597	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580	
VWDE	221806	hgsc.bcm.edu	37	7	12420309	12420309	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:12420309G>T	ENST00000275358.3	-	5	780	c.592C>A	c.(592-594)Ctg>Atg	p.L198M		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	198						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						AACTCCACCAGAACCTCTGGC	0.478																																					p.L198M		Atlas-SNP	.											.	VWDE	123	.	0			c.C592A						PASS	.						57.0	54.0	55.0					7																	12420309		692	1591	2283	SO:0001583	missense	221806	exon5			CCACCAGAACCTC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.592C>A	7.37:g.12420309G>T	ENSP00000275358:p.Leu198Met	66.0	0.0	0		81.0	39.0	0.481481	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	G	3.949	-0.012699	0.07727	.	.	ENSG00000146530	ENST00000275358	D	0.81996	-1.56	4.98	-0.645	0.11475	.	.	.	.	.	T	0.62380	0.2423	N	0.22421	0.69	0.09310	N	1	P	0.38863	0.65	B	0.29353	0.101	T	0.55636	-0.8110	9	0.51188	T	0.08	.	1.6938	0.02857	0.2436:0.3634:0.2408:0.1522	.	198	Q8N2E2	VWDE_HUMAN	M	198	ENSP00000275358:L198M	ENSP00000275358:L198M	L	-	1	2	VWDE	12386834	0.001000	0.12720	0.026000	0.17262	0.044000	0.14063	0.131000	0.15870	-0.047000	0.13423	-0.995000	0.02519	CTG	.	.	none		0.478	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
TRNT1	51095	hgsc.bcm.edu	37	3	3182323	3182323	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:3182323A>C	ENST00000251607.6	+	4	574	c.472A>C	c.(472-474)Atg>Ctg	p.M158L	TRNT1_ENST00000280591.6_Missense_Mutation_p.M158L	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	158					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		TATAAATTCTATGTTTTTAGG	0.368																																					p.M158L		Atlas-SNP	.											.	TRNT1	34	.	0			c.A472C						PASS	.						75.0	77.0	76.0					3																	3182323		2203	4300	6503	SO:0001583	missense	51095	exon4			AATTCTATGTTTT	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.472A>C	3.37:g.3182323A>C	ENSP00000251607:p.Met158Leu	158.0	0.0	0		149.0	32.0	0.214765	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	ENST00000251607.6	37	CCDS2561.2	.	.	.	.	.	.	.	.	.	.	A	18.65	3.670644	0.67814	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.31247	1.53;1.5	5.71	5.71	0.89125	Poly A polymerase, head domain (1);	0.000000	0.85682	D	0.000000	T	0.20455	0.0492	N	0.17248	0.465	0.80722	D	1	B;B	0.18461	0.007;0.028	B;B	0.28385	0.028;0.089	T	0.05419	-1.0886	10	0.06099	T	0.92	0.0631	15.9869	0.80160	1.0:0.0:0.0:0.0	.	158;158	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	L	158	ENSP00000251607:M158L;ENSP00000280591:M158L	ENSP00000251607:M158L	M	+	1	0	TRNT1	3157323	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.125000	0.94402	2.171000	0.68590	0.533000	0.62120	ATG	.	.	none		0.368	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
CELA1	1990	hgsc.bcm.edu	37	12	51736400	51736400	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:51736400G>A	ENST00000293636.1	-	4	325	c.285C>T	c.(283-285)atC>atT	p.I95I		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	95	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						GATGCACCACGATCTTCTGCA	0.582																																					p.I95I		Atlas-SNP	.											CELA1,NS,carcinoma,0,1	CELA1	39	1	0			c.C285T						PASS	.						197.0	146.0	163.0					12																	51736400		2203	4300	6503	SO:0001819	synonymous_variant	1990	exon4			CACCACGATCTTC		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.285C>T	12.37:g.51736400G>A		93.0	0.0	0		96.0	16.0	0.166667	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Silent	SNP	ENST00000293636.1	37	CCDS8812.1																																																																																			.	.	none		0.582	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
ZADH2	284273	hgsc.bcm.edu	37	18	72914061	72914061	+	Silent	SNP	G	G	A	rs370732101		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr18:72914061G>A	ENST00000322342.3	-	2	733	c.444C>T	c.(442-444)ccC>ccT	p.P148P	ZADH2_ENST00000537114.2_Silent_p.P25P	NM_175907.4	NP_787103.1	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain containing 2	148						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.P148P(1)		endometrium(3)|large_intestine(3)|lung(8)|skin(1)	15		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		TAAGATACTCGGGTTTCACTG	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19496	0.0		0.0	False		,,,				2504	0.0				p.P148P		Atlas-SNP	.											.	ZADH2	25	.	1	Substitution - coding silent(1)	lung(1)	c.C444T						PASS	.	G		0,4406		0,0,2203	242.0	251.0	248.0		444	-10.9	0.3	18		248	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZADH2	NM_175907.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		148/378	72914061	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	284273	exon2			ATACTCGGGTTTC	BC033780	CCDS12008.1	18q22.3	2008-05-29	2008-05-29		ENSG00000180011	ENSG00000180011			28697	protein-coding gene	gene with protein product						12477932	Standard	NM_175907		Approved	MGC45594	uc002llx.3	Q8N4Q0	OTTHUMG00000132858	ENST00000322342.3:c.444C>T	18.37:g.72914061G>A		104.0	0.0	0		50.0	16.0	0.32	NM_175907	A8KA15|B4DZ91	Silent	SNP	ENST00000322342.3	37	CCDS12008.1																																																																																			.	.	weak		0.527	ZADH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256332.1	NM_175907	
TSNARE1	203062	hgsc.bcm.edu	37	8	143356150	143356150	+	Missense_Mutation	SNP	G	G	A	rs546251254		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr8:143356150G>A	ENST00000307180.3	-	12	1555	c.1438C>T	c.(1438-1440)Cgg>Tgg	p.R480W	TSNARE1_ENST00000520166.1_Missense_Mutation_p.R480W|TSNARE1_ENST00000519651.1_Missense_Mutation_p.R261W|TSNARE1_ENST00000524325.1_Missense_Mutation_p.R479W	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	480					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACTTGGTGCCGGCTGGCTCCA	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16768	0.0		0.001	False		,,,				2504	0.0				p.R480W		Atlas-SNP	.											.	TSNARE1	59	.	0			c.C1438T						PASS	.						11.0	15.0	14.0					8																	143356150		2174	4272	6446	SO:0001583	missense	203062	exon12			GGTGCCGGCTGGC			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1438C>T	8.37:g.143356150G>A	ENSP00000303437:p.Arg480Trp	223.0	0.0	0		152.0	25.0	0.164474	NM_145003	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.188182	0.38609	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.35236	2.61;2.61;2.61;1.32	2.4	2.4	0.29515	Target SNARE coiled-coil domain (1);	.	.	.	.	T	0.61375	0.2342	M	0.86502	2.82	0.27569	N	0.949932	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.68483	0.958;0.925;0.958;0.958	T	0.53982	-0.8361	9	0.87932	D	0	.	10.9101	0.47103	0.0:0.0:1.0:0.0	.	479;261;480;481	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	W	479;480;480;261	ENSP00000428763:R479W;ENSP00000303437:R480W;ENSP00000427770:R480W;ENSP00000429679:R261W	ENSP00000303437:R480W	R	-	1	2	TSNARE1	143354057	0.862000	0.29867	1.000000	0.80357	0.213000	0.24496	0.786000	0.26844	1.272000	0.44329	0.462000	0.41574	CGG	.	.	none		0.652	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
IL6	3569	hgsc.bcm.edu	37	7	22767230	22767230	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:22767230G>A	ENST00000404625.1	+	3	646	c.187G>A	c.(187-189)Ggc>Agc	p.G63S	AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000407492.1_Intron|IL6_ENST00000420258.2_Missense_Mutation_p.G117S|IL6_ENST00000406575.1_Missense_Mutation_p.G63S|IL6_ENST00000258743.5_Missense_Mutation_p.G63S|IL6_ENST00000401630.3_Missense_Mutation_p.G40S|IL6_ENST00000401651.1_Intron			P05231	IL6_HUMAN	interleukin 6	63					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)	p.G63S(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	CATCCTCGACGGCATCTCAGC	0.592																																					p.G63S	Esophageal Squamous(47;342 1214 13936 33513)	Atlas-SNP	.											IL6,colon,carcinoma,0,1	IL6	30	1	1	Substitution - Missense(1)	large_intestine(1)	c.G187A						PASS	.						93.0	88.0	90.0					7																	22767230		2203	4300	6503	SO:0001583	missense	3569	exon2			CTCGACGGCATCT	M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.187G>A	7.37:g.22767230G>A	ENSP00000385675:p.Gly63Ser	52.0	0.0	0		125.0	35.0	0.28	NM_000600	Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	ENST00000404625.1	37	CCDS5375.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624986	0.66901	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000401630;ENST00000406575	T;T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37;2.37	5.73	-7.63	0.01290	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.051350	0.07276	N	0.869904	T	0.11623	0.0283	N	0.14661	0.345	0.09310	N	1	D;D;P	0.58970	0.983;0.984;0.933	P;P;B	0.52758	0.708;0.645;0.43	T	0.16689	-1.0394	10	0.22706	T	0.39	-0.2201	7.1005	0.25333	0.4851:0.2042:0.3107:0.0	.	117;63;63	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	S	63;63;63;117;40;63	ENSP00000385675:G63S;ENSP00000405150:G63S;ENSP00000258743:G63S;ENSP00000405994:G117S;ENSP00000384928:G40S;ENSP00000385227:G63S	ENSP00000258743:G63S	G	+	1	0	IL6	22733755	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.387000	0.07361	-1.013000	0.03383	-0.300000	0.09419	GGC	.	.	none		0.592	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155928159	155928159	+	Silent	SNP	T	T	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:155928159T>G	ENST00000361247.4	-	12	1596	c.1497A>C	c.(1495-1497)gtA>gtC	p.V499V	ARHGEF2_ENST00000368316.1_Silent_p.V471V|ARHGEF2_ENST00000462460.2_Silent_p.V544V|ARHGEF2_ENST00000313667.4_Silent_p.V498V|ARHGEF2_ENST00000313695.7_Silent_p.V471V|ARHGEF2_ENST00000368315.4_Silent_p.V500V|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	499	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GAAACACCAGTACATCTGTCA	0.488																																					p.V499V	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											.	ARHGEF2	81	.	0			c.A1497C						PASS	.						126.0	101.0	110.0					1																	155928159		2203	4300	6503	SO:0001819	synonymous_variant	9181	exon12			CACCAGTACATCT	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1497A>C	1.37:g.155928159T>G		89.0	0.0	0		106.0	25.0	0.235849	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	ENST00000361247.4	37	CCDS53376.1																																																																																			.	.	none		0.488	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
MYL6B	140465	hgsc.bcm.edu	37	12	56548600	56548600	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:56548600G>A	ENST00000553066.1	+	3	600	c.178G>A	c.(178-180)Gag>Aag	p.E60K	RP11-603J24.14_ENST00000548731.1_RNA|MYL6B_ENST00000550443.1_Missense_Mutation_p.E60K|MYL6B_ENST00000550152.1_3'UTR|MYL6B_ENST00000552568.1_Missense_Mutation_p.E60K|MYL6B_ENST00000207437.5_Missense_Mutation_p.E60K			P14649	MYL6B_HUMAN	myosin, light chain 6B, alkali, smooth muscle and non-muscle	60					metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)	calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(4)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			TCCACAGATCGAGTTTAACAA	0.532																																					p.E60K		Atlas-SNP	.											.	MYL6B	12	.	0			c.G178A						PASS	.						196.0	194.0	195.0					12																	56548600		2203	4300	6503	SO:0001583	missense	140465	exon3			CAGATCGAGTTTA	M31211	CCDS8905.1	12q13.2	2013-01-10	2006-09-29			ENSG00000196465		"""Myosins / Light chain"", ""EF-hand domain containing"""	29823	protein-coding gene	gene with protein product	"""myosin light chain 1 slow a"""	609930	"""myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle"""			2602161, 2304459	Standard	NM_002475		Approved	MLC1SA	uc001sjs.3	P14649		ENST00000553066.1:c.178G>A	12.37:g.56548600G>A	ENSP00000450385:p.Glu60Lys	114.0	0.0	0		151.0	61.0	0.403974	NM_001199629		Missense_Mutation	SNP	ENST00000553066.1	37	CCDS8905.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549050	0.45383	.	.	ENSG00000196465	ENST00000553066;ENST00000550443;ENST00000207437;ENST00000552568	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	4.08	3.16	0.36331	.	0.372052	0.29059	N	0.013270	T	0.78451	0.4285	L	0.49126	1.545	0.43907	D	0.996548	P;B	0.38922	0.651;0.256	B;B	0.31245	0.126;0.024	T	0.79067	-0.1955	10	0.72032	D	0.01	-19.8264	11.6215	0.51121	0.0:0.182:0.818:0.0	.	60;60	B4E368;P14649	.;MYL6B_HUMAN	K	60	ENSP00000450385:E60K;ENSP00000446643:E60K;ENSP00000207437:E60K;ENSP00000446965:E60K	ENSP00000207437:E60K	E	+	1	0	MYL6B	54834867	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.257000	0.72480	1.016000	0.39470	0.491000	0.48974	GAG	.	.	none		0.532	MYL6B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407920.2	NM_002475	
KIAA1107	23285	hgsc.bcm.edu	37	1	92647539	92647539	+	Missense_Mutation	SNP	G	G	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:92647539G>T	ENST00000370378.4	+	8	3083	c.2985G>T	c.(2983-2985)aaG>aaT	p.K995N	KIAA1107_ENST00000409154.4_Missense_Mutation_p.K1050N	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	1050										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						CAACTAAAAAGTTTAAAAGGT	0.368																																					p.K995N		Atlas-SNP	.											.	KIAA1107	60	.	0			c.G2985T						PASS	.						53.0	47.0	49.0					1																	92647539		692	1591	2283	SO:0001583	missense	23285	exon8			TAAAAAGTTTAAA	AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.2985G>T	1.37:g.92647539G>T	ENSP00000359404:p.Lys995Asn	176.0	0.0	0		174.0	88.0	0.505747	NM_015237	O14767|Q8N3X7	Missense_Mutation	SNP	ENST00000370378.4	37	CCDS44172.1	.	.	.	.	.	.	.	.	.	.	G	0.704	-0.789763	0.02884	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	T;T	0.04275	3.66;3.66	5.79	-6.19	0.02078	.	0.527792	0.19795	N	0.105893	T	0.00241	0.0007	N	0.00707	-1.245	0.29199	N	0.875338	B	0.02656	0.0	B	0.04013	0.001	T	0.32719	-0.9896	10	0.02654	T	1	.	0.7628	0.01010	0.3921:0.2227:0.1168:0.2684	.	995	E9PEZ5	.	N	1050;995	ENSP00000386957:K1050N;ENSP00000359404:K995N	ENSP00000359404:K995N	K	+	3	2	KIAA1107	92420127	0.034000	0.19679	0.191000	0.23289	0.967000	0.64934	-0.408000	0.07169	-0.691000	0.05135	-0.140000	0.14226	AAG	.	.	none		0.368	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028375.3	XM_034086	
RREB1	6239	hgsc.bcm.edu	37	6	7230225	7230225	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:7230225C>T	ENST00000349384.6	+	10	2207	c.1893C>T	c.(1891-1893)ggC>ggT	p.G631G	RREB1_ENST00000379938.2_Silent_p.G631G|RREB1_ENST00000379933.3_Silent_p.G631G|RREB1_ENST00000334984.6_Silent_p.G631G	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	631					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CAGCGCCCGGCGGCAAGAAGA	0.637																																					p.G631G		Atlas-SNP	.											.	RREB1	242	.	0			c.C1893T						PASS	.						21.0	23.0	22.0					6																	7230225		2202	4297	6499	SO:0001819	synonymous_variant	6239	exon10			GCCCGGCGGCAAG	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1893C>T	6.37:g.7230225C>T		63.0	0.0	0		68.0	41.0	0.602941	NM_001003700	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	ENST00000349384.6	37	CCDS34336.1																																																																																			.	.	none		0.637	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
MUC4	4585	hgsc.bcm.edu	37	3	195518110	195518110	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:195518110G>A	ENST00000463781.3	-	2	800	c.341C>T	c.(340-342)gCt>gTt	p.A114V	MUC4_ENST00000475231.1_Missense_Mutation_p.A114V|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	119					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATCTGGAGGAGCTGTCTCCAT	0.468																																					p.A114V		Atlas-SNP	.											MUC4_ENST00000463781,caecum,adenoma,0,1	MUC4	1505	1	0			c.C341T						PASS	.						169.0	145.0	153.0					3																	195518110		1992	4142	6134	SO:0001583	missense	4585	exon2			GGAGGAGCTGTCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.341C>T	3.37:g.195518110G>A	ENSP00000417498:p.Ala114Val	143.0	0.0	0		1197.0	86.0	0.0718463	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.679	0.493843	0.12702	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.32272	1.46;1.47	3.46	1.61	0.23674	.	4.057260	0.00950	N	0.002944	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B	0.34015	0.435	B	0.29353	0.101	T	0.16041	-1.0416	10	0.35671	T	0.21	-0.1442	5.2629	0.15584	0.277:0.0:0.723:0.0	.	114	E7ESK3	.	V	114;114;88	ENSP00000417498:A114V;ENSP00000420243:A114V	ENSP00000376209:A88V	A	-	2	0	MUC4	197002505	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.806000	0.00758	0.455000	0.26910	-0.302000	0.09304	GCT	.	.	none		0.468	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
AASS	10157	hgsc.bcm.edu	37	7	121738881	121738881	+	Missense_Mutation	SNP	C	C	G	rs549330560		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr7:121738881C>G	ENST00000393376.1	-	13	1541	c.1446G>C	c.(1444-1446)aaG>aaC	p.K482N	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.K482N			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	482	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						GAACCAAAACCTTTCTCCTGG	0.313																																					p.K482N		Atlas-SNP	.											.	AASS	123	.	0			c.G1446C						PASS	.						62.0	67.0	66.0					7																	121738881		2203	4299	6502	SO:0001583	missense	10157	exon14			CAAAACCTTTCTC	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.1446G>C	7.37:g.121738881C>G	ENSP00000377040:p.Lys482Asn	158.0	0.0	0		137.0	49.0	0.357664	NM_005763	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884697	0.51908	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.96	4.9	0.64082	NAD(P)-binding domain (1);	0.189513	0.56097	D	0.000031	T	0.38639	0.1048	N	0.08118	0	0.45477	D	0.998446	B	0.06786	0.001	B	0.12837	0.008	T	0.20174	-1.0283	9	0.41790	T	0.15	-16.3813	14.9791	0.71299	0.0:0.9183:0.0:0.0817	.	482	Q9UDR5	AASS_HUMAN	N	482	.	ENSP00000351834:K482N	K	-	3	2	AASS	121526117	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	0.796000	0.26986	2.823000	0.97156	0.650000	0.86243	AAG	.	.	none		0.313	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
TMEM240	339453	hgsc.bcm.edu	37	1	1470884	1470884	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:1470884C>T	ENST00000378733.4	-	4	387	c.377G>A	c.(376-378)gGc>gAc	p.G126D	TMEM240_ENST00000425828.1_Missense_Mutation_p.G126D	NM_001114748.1	NP_001108220.1	Q5SV17	TM240_HUMAN	transmembrane protein 240	126						integral component of membrane (GO:0016021)											GGTCCACGAGCCATCTGCGGG	0.756																																					p.G126D		Atlas-SNP	.											.	TMEM240	8	.	0			c.G377A						PASS	.						11.0	12.0	12.0					1																	1470884		690	1590	2280	SO:0001583	missense	339453	exon4			CACGAGCCATCTG		CCDS44040.1	1p36.33	2011-11-25	2011-11-25	2011-11-25	ENSG00000205090	ENSG00000205090			25186	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 70"""	C1orf70			Standard	NM_001114748		Approved		uc009vkf.3	Q5SV17	OTTHUMG00000042193	ENST00000378733.4:c.377G>A	1.37:g.1470884C>T	ENSP00000368007:p.Gly126Asp	60.0	0.0	0		79.0	52.0	0.658228	NM_001114748	B9EJG7	Missense_Mutation	SNP	ENST00000378733.4	37	CCDS44040.1	.	.	.	.	.	.	.	.	.	.	N	5.089	0.202033	0.09652	.	.	ENSG00000205090	ENST00000378733;ENST00000425828	.	.	.	2.83	2.83	0.33086	.	.	.	.	.	T	0.18299	0.0439	N	0.08118	0	0.28304	N	0.92299	B	0.27997	0.197	B	0.31614	0.133	T	0.10154	-1.0642	8	0.42905	T	0.14	.	4.6176	0.12433	0.0:0.7387:0.0:0.2613	.	126	Q5SV17	CA070_HUMAN	D	126	.	ENSP00000368007:G126D	G	-	2	0	C1orf70	1460747	0.997000	0.39634	1.000000	0.80357	0.983000	0.72400	1.226000	0.32563	1.899000	0.54978	0.448000	0.29417	GGC	.	.	none		0.756	TMEM240-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100391.2	NM_001114748	
RNF217	154214	hgsc.bcm.edu	37	6	125397811	125397811	+	Silent	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:125397811C>T	ENST00000521654.2	+	4	1290	c.1290C>T	c.(1288-1290)atC>atT	p.I430I	RNF217_ENST00000368414.2_5'UTR|RNF217_ENST00000359704.2_Silent_p.I138I|RNF217_ENST00000275184.6_Silent_p.I74I|RNF217_ENST00000560949.1_Silent_p.I195I			Q8TC41	RN217_HUMAN	ring finger protein 217	430					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		AGATCCACATCCAGCGAACTG	0.408																																					p.I138I		Atlas-SNP	.											.	RNF217	64	.	0			c.C414T						PASS	.						115.0	100.0	105.0					6																	125397811		2203	4300	6503	SO:0001819	synonymous_variant	154214	exon6			CCACATCCAGCGA	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1290C>T	6.37:g.125397811C>T		136.0	0.0	0		69.0	21.0	0.304348	NM_152553	H7C5V4|Q5TCA4|Q9BX48	Silent	SNP	ENST00000521654.2	37																																																																																				.	.	none		0.408	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3	NM_152553	
MSL2	55167	hgsc.bcm.edu	37	3	135871364	135871364	+	Missense_Mutation	SNP	A	A	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr3:135871364A>G	ENST00000309993.2	-	2	1091	c.359T>C	c.(358-360)aTa>aCa	p.I120T	MSL2_ENST00000434835.2_Missense_Mutation_p.I46T	NM_018133.3	NP_060603.2	Q9HCI7	MSL2_HUMAN	male-specific lethal 2 homolog (Drosophila)	120					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	18						AACTGCTTCTATTATATCCCG	0.378																																					p.I120T		Atlas-SNP	.											.	MSL2	63	.	0			c.T359C						PASS	.						168.0	157.0	161.0					3																	135871364		2203	4300	6503	SO:0001583	missense	55167	exon2			GCTTCTATTATAT	AK001408	CCDS33861.1, CCDS46922.1	3q22.2	2008-10-29	2008-10-29	2008-10-29	ENSG00000174579	ENSG00000174579		"""RING-type (C3HC4) zinc fingers"""	25544	protein-coding gene	gene with protein product	"""male-specific lethal-2 homolog (Drosophila)"""	614802	"""ring finger protein 184"", ""male-specific lethal 2-like 1 (Drosophila)"""	RNF184, MSL2L1		16227571, 16543150	Standard	NM_018133		Approved	FLJ10546, KIAA1585, msl-2	uc003eqx.1	Q9HCI7	OTTHUMG00000159793	ENST00000309993.2:c.359T>C	3.37:g.135871364A>G	ENSP00000311827:p.Ile120Thr	209.0	0.0	0		148.0	62.0	0.418919	NM_018133	B4DYL4|G5E9I1|Q0D2P1|Q8NDB4|Q9NVS4	Missense_Mutation	SNP	ENST00000309993.2	37	CCDS33861.1	.	.	.	.	.	.	.	.	.	.	A	3.117	-0.181422	0.06340	.	.	ENSG00000174579	ENST00000309993;ENST00000434835;ENST00000481989;ENST00000491050;ENST00000473093	.	.	.	6.17	5.01	0.66863	.	0.114979	0.64402	D	0.000013	T	0.37679	0.1012	N	0.24115	0.695	0.35088	D	0.764059	B	0.10296	0.003	B	0.09377	0.004	T	0.40701	-0.9549	9	0.29301	T	0.29	-11.1528	11.7296	0.51728	0.9316:0.0:0.0683:0.0	.	120	Q9HCI7	MSL2_HUMAN	T	120;46;46;46;46	.	ENSP00000311827:I120T	I	-	2	0	MSL2	137354054	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.691000	0.61738	1.146000	0.42352	0.533000	0.62120	ATA	.	.	none		0.378	MSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357347.1	NM_018133	
AKAP4	8852	hgsc.bcm.edu	37	X	49961619	49961619	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chrX:49961619C>T	ENST00000376056.2	-	4	322	c.172G>A	c.(172-174)Ggc>Agc	p.G58S	AKAP4_ENST00000358526.2_Missense_Mutation_p.G67S|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.G58S|AKAP4_ENST00000376064.3_Missense_Mutation_p.G58S					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TTTAAGTTGCCTTCTGAGCTG	0.433																																					p.G67S		Atlas-SNP	.											.	AKAP4	131	.	0			c.G199A						PASS	.						174.0	144.0	154.0					X																	49961619		2203	4300	6503	SO:0001583	missense	8852	exon4			AGTTGCCTTCTGA	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.172G>A	X.37:g.49961619C>T	ENSP00000365224:p.Gly58Ser	221.0	0.0	0		283.0	108.0	0.381625	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	C	3.029	-0.200104	0.06219	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865;ENST00000437370	T;T;T;T;T	0.32272	2.7;1.46;2.7;2.7;1.46	4.35	2.5	0.30297	.	0.504572	0.16825	N	0.198005	T	0.25082	0.0609	L	0.57536	1.79	0.09310	N	1	B;B	0.17038	0.02;0.011	B;B	0.15052	0.006;0.012	T	0.23797	-1.0178	9	.	.	.	-0.9557	4.6452	0.12568	0.2165:0.6629:0.0:0.1206	.	67;58	Q5JQC9;A6ND82	AKAP4_HUMAN;.	S	58;58;67;58;58;58	ENSP00000365224:G58S;ENSP00000365226:G58S;ENSP00000351327:G67S;ENSP00000365232:G58S;ENSP00000412279:G58S	.	G	-	1	0	AKAP4	49848359	0.002000	0.14202	0.001000	0.08648	0.020000	0.10135	0.471000	0.22100	0.234000	0.21139	0.513000	0.50165	GGC	.	.	none		0.433	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
DENND5B	160518	hgsc.bcm.edu	37	12	31555505	31555505	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr12:31555505A>T	ENST00000389082.5	-	15	3140	c.2876T>A	c.(2875-2877)aTc>aAc	p.I959N	DENND5B_ENST00000536562.1_Missense_Mutation_p.I994N|DENND5B_ENST00000306833.6_Missense_Mutation_p.I994N	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	959	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGATACACAGATCCAAGGGTT	0.403																																					p.I959N		Atlas-SNP	.											.	DENND5B	114	.	0			c.T2876A						PASS	.						168.0	165.0	166.0					12																	31555505		1882	4122	6004	SO:0001583	missense	160518	exon15			ACACAGATCCAAG	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2876T>A	12.37:g.31555505A>T	ENSP00000373734:p.Ile959Asn	246.0	0.0	0		265.0	125.0	0.471698	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193138	0.78902	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.69561	-0.41;-0.41;-0.41	4.2	4.2	0.49525	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	0.162227	0.43747	D	0.000534	D	0.83608	0.5291	M	0.90082	3.085	0.58432	D	0.999999	D;D	0.69078	0.997;0.996	D;D	0.72075	0.976;0.959	D	0.87352	0.2338	10	0.87932	D	0	-21.976	13.4458	0.61140	1.0:0.0:0.0:0.0	.	959;994	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	N	959;994;994	ENSP00000373734:I959N;ENSP00000306482:I994N;ENSP00000444889:I994N	ENSP00000306482:I994N	I	-	2	0	DENND5B	31446772	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.831000	0.92068	1.766000	0.52107	0.533000	0.62120	ATC	.	.	none		0.403	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
SASH1	23328	hgsc.bcm.edu	37	6	148865065	148865065	+	Missense_Mutation	SNP	G	G	A	rs144633784	byFrequency	TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:148865065G>A	ENST00000367467.3	+	18	2934	c.2459G>A	c.(2458-2460)cGg>cAg	p.R820Q		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	820					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TCCATCTGCCGGAGCTGTGAG	0.592													G|||	11	0.00219649	0.0	0.0	5008	,	,		8739	0.0		0.004	False		,,,				2504	0.0072				p.R820Q		Atlas-SNP	.											SASH1,mouth,carcinoma,+1,1	SASH1	123	1	0			c.G2459A						PASS	.	G	GLN/ARG	0,4406		0,0,2203	106.0	120.0	116.0		2459	5.3	1.0	6	dbSNP_134	116	17,8583	11.9+/-42.8	0,17,4283	yes	missense	SASH1	NM_015278.3	43	0,17,6486	AA,AG,GG		0.1977,0.0,0.1307	probably-damaging	820/1248	148865065	17,12989	2203	4300	6503	SO:0001583	missense	23328	exon18			TCTGCCGGAGCTG	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2459G>A	6.37:g.148865065G>A	ENSP00000356437:p.Arg820Gln	89.0	0.0	0		60.0	43.0	0.716667	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	G	34	5.322345	0.95708	0.0	0.001977	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	T	0.42900	0.96	5.26	5.26	0.73747	.	0.053272	0.85682	D	0.000000	T	0.55784	0.1942	M	0.62723	1.935	0.49299	D	0.999772	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.59484	-0.7446	10	0.72032	D	0.01	-20.5504	17.0537	0.86527	0.0:0.0:1.0:0.0	.	801;820	Q6P4R9;O94885	.;SASH1_HUMAN	Q	820;581;230	ENSP00000356437:R820Q	ENSP00000356437:R820Q	R	+	2	0	SASH1	148906758	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.494000	0.66905	2.454000	0.82982	0.650000	0.86243	CGG	G|0.998;A|0.002	0.002	strong		0.592	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
TP53	7157	hgsc.bcm.edu	37	17	7577586	7577586	+	Missense_Mutation	SNP	A	A	G	rs587781589		TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr17:7577586A>G	ENST00000269305.4	-	7	884	c.695T>C	c.(694-696)aTc>aCc	p.I232T	TP53_ENST00000413465.2_Missense_Mutation_p.I232T|TP53_ENST00000455263.2_Missense_Mutation_p.I232T|TP53_ENST00000359597.4_Missense_Mutation_p.I232T|TP53_ENST00000420246.2_Missense_Mutation_p.I232T|TP53_ENST00000445888.2_Missense_Mutation_p.I232T|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	232	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I232T(8)|p.I232N(6)|p.?(5)|p.I232_H233insG(3)|p.I232S(2)|p.T230fs*6(2)|p.C229_H233delCTTIH(2)|p.I232_Y236delIHYNY(1)|p.T230_Y234delTTIHY(1)|p.C229_I232del(1)|p.I139T(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.I139_H140insG(1)|p.I232fs*5(1)|p.S227_I232delSDCTTI(1)|p.I232fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGTAGTGGATGGTGGTACA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I232T	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,67	TP53	33396	67	46	Substitution - Missense(17)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(5)|Insertion - In frame(4)|Insertion - Frameshift(1)	biliary_tract(5)|haematopoietic_and_lymphoid_tissue(5)|upper_aerodigestive_tract(4)|endometrium(4)|breast(4)|NS(4)|bone(4)|lung(3)|oesophagus(3)|liver(3)|stomach(2)|central_nervous_system(2)|ovary(2)|thymus(1)	c.T695C						PASS	.						113.0	90.0	98.0					17																	7577586		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TAGTGGATGGTGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.695T>C	17.37:g.7577586A>G	ENSP00000269305:p.Ile232Thr	76.0	0.0	0		40.0	34.0	0.85	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370793	0.82573	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99807	-6.85;-6.85;-6.85;-6.85;-6.85;-6.85;-6.85;-6.85	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.174276	0.51477	D	0.000096	D	0.99697	0.9885	M	0.85630	2.765	0.53005	D	0.99996	B;B;B;B;B;B	0.32781	0.327;0.032;0.106;0.12;0.21;0.384	P;B;B;P;P;B	0.53401	0.601;0.065;0.193;0.725;0.614;0.153	D	0.96603	0.9446	10	0.72032	D	0.01	-25.5076	12.3101	0.54924	1.0:0.0:0.0:0.0	.	232;232;139;232;232;232	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	T	232;232;232;232;232;232;221;139;100;139	ENSP00000410739:I232T;ENSP00000352610:I232T;ENSP00000269305:I232T;ENSP00000398846:I232T;ENSP00000391127:I232T;ENSP00000391478:I232T;ENSP00000425104:I100T;ENSP00000423862:I139T	ENSP00000269305:I232T	I	-	2	0	TP53	7518311	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.061000	0.93913	2.074000	0.62210	0.379000	0.24179	ATC	.	.	none		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
BTG2	7832	hgsc.bcm.edu	37	1	203274870	203274870	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr1:203274870C>G	ENST00000290551.4	+	1	207	c.136C>G	c.(136-138)Ctc>Gtc	p.L46V	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	46					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CCAGGAGGCACTCACAGGTGA	0.706																																					p.L46V		Atlas-SNP	.											.	BTG2	16	.	0			c.C136G						PASS	.						11.0	13.0	12.0					1																	203274870		2008	3922	5930	SO:0001583	missense	7832	exon1			GAGGCACTCACAG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.136C>G	1.37:g.203274870C>G	ENSP00000290551:p.Leu46Val	56.0	0.0	0		80.0	50.0	0.625	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996025	0.54147	.	.	ENSG00000159388	ENST00000290551	T	0.38077	1.16	4.4	3.48	0.39840	Anti-proliferative protein (3);	0.000000	0.51477	D	0.000083	T	0.59514	0.2199	M	0.91818	3.245	0.39613	D	0.969913	D	0.55800	0.973	P	0.61275	0.886	T	0.64841	-0.6312	10	0.87932	D	0	-5.3352	6.4668	0.21985	0.1795:0.7256:0.0:0.0949	.	46	P78543	BTG2_HUMAN	V	46	ENSP00000290551:L46V	ENSP00000290551:L46V	L	+	1	0	BTG2	201541493	0.941000	0.31946	0.225000	0.23894	0.595000	0.36748	0.961000	0.29267	1.064000	0.40671	0.471000	0.43371	CTC	.	.	none		0.706	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
MYO18B	84700	hgsc.bcm.edu	37	22	26291160	26291160	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr22:26291160G>A	ENST00000407587.2	+	28	4753	c.4584G>A	c.(4582-4584)atG>atA	p.M1528I	CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.M1527I|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.M1527I|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1527	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTGCTCAGATGGAGAACGAGT	0.542																																					p.M1527I		Atlas-SNP	.											.	MYO18B	322	.	0			c.G4581A						PASS	.						40.0	44.0	43.0					22																	26291160		2180	4283	6463	SO:0001583	missense	84700	exon28			TCAGATGGAGAAC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4584G>A	22.37:g.26291160G>A	ENSP00000386096:p.Met1528Ile	50.0	0.0	0		32.0	11.0	0.34375	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	G	15.44	2.833067	0.50951	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86297	-2.1;-2.1;-1.12	5.26	1.83	0.25207	.	0.303395	0.30704	N	0.009056	T	0.79868	0.4520	L	0.51422	1.61	0.30516	N	0.76893	B;B;P;P	0.35774	0.274;0.384;0.458;0.519	B;B;B;B	0.38264	0.112;0.138;0.194;0.269	T	0.73382	-0.4000	10	0.36615	T	0.2	.	2.7126	0.05179	0.173:0.1451:0.5328:0.1491	.	1040;1527;1528;1527	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	I	1527;1527;1528	ENSP00000441229:M1527I;ENSP00000334563:M1527I;ENSP00000386096:M1528I	ENSP00000334563:M1527I	M	+	3	0	MYO18B	24621160	0.998000	0.40836	1.000000	0.80357	0.947000	0.59692	0.315000	0.19451	1.221000	0.43506	0.563000	0.77884	ATG	.	.	none		0.542	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PIM1	5292	hgsc.bcm.edu	37	6	37138571	37138571	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:37138571G>A	ENST00000373509.5	+	2	478	c.105G>A	c.(103-105)gaG>gaA	p.E35E		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	126					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGCCCCTGGAGTCGCAGTACC	0.711			T	BCL6	NHL																																p.E126E		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.G378A						PASS	.						21.0	31.0	28.0					6																	37138571		2163	4266	6429	SO:0001819	synonymous_variant	5292	exon2			CCTGGAGTCGCAG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.105G>A	6.37:g.37138571G>A		51.0	0.0	0		75.0	19.0	0.253333	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.711	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
DST	667	hgsc.bcm.edu	37	6	56505292	56505292	+	Silent	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr6:56505292G>A	ENST00000361203.3	-	14	1513	c.1506C>T	c.(1504-1506)atC>atT	p.I502I	DST_ENST00000370754.5_Silent_p.I680I|DST_ENST00000370765.6_Silent_p.I176I|DST_ENST00000312431.6_Silent_p.I502I|DST_ENST00000370788.2_Silent_p.I502I|DST_ENST00000518935.1_Silent_p.I176I|DST_ENST00000244364.6_Silent_p.I176I|DST_ENST00000446842.2_Silent_p.I176I|DST_ENST00000421834.2_Silent_p.I502I|DST_ENST00000370769.4_Silent_p.I502I			Q03001	DYST_HUMAN	dystonin	502					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACTTTGAGTGATTCCTGATA	0.438																																					p.I176I		Atlas-SNP	.											DST_ENST00000370769,NS,carcinoma,0,5	DST	1427	5	0			c.C528T						scavenged	.						122.0	122.0	122.0					6																	56505292		2203	4300	6503	SO:0001819	synonymous_variant	667	exon4			TTGAGTGATTCCT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1506C>T	6.37:g.56505292G>A		331.0	1.0	0.00302115		527.0	145.0	0.275142	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.	.	none		0.438	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
MAST4	375449	hgsc.bcm.edu	37	5	66350237	66350237	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9TY-01A-11D-A38X-10	TCGA-GS-A9TY-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	efd48c02-60c4-4db1-9c40-8ffcac8b4991	9dba8651-a374-4e47-862f-f91f46c7bd4d	g.chr5:66350237G>A	ENST00000403625.2	+	5	975	c.680G>A	c.(679-681)cGa>cAa	p.R227Q	MAST4_ENST00000403666.1_Missense_Mutation_p.R38Q|MAST4_ENST00000490016.2_Missense_Mutation_p.R38Q|MAST4_ENST00000261569.7_Missense_Mutation_p.R33Q|MAST4_ENST00000405643.1_Missense_Mutation_p.R45Q|MAST4_ENST00000404260.3_Missense_Mutation_p.R227Q	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	227						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.R227Q(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GATAGTTGCCGAACAAGCAAC	0.423																																					p.R227Q		Atlas-SNP	.											MAST4_ENST00000404260,rectum,carcinoma,0,1	MAST4	218	1	1	Substitution - Missense(1)	large_intestine(1)	c.G680A						PASS	.						72.0	68.0	69.0					5																	66350237		1883	4100	5983	SO:0001583	missense	375449	exon5			GTTGCCGAACAAG	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.680G>A	5.37:g.66350237G>A	ENSP00000385727:p.Arg227Gln	194.0	1.0	0.00515464		140.0	117.0	0.835714	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288148	0.95517	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000432426;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T	0.74106	-0.32;-0.32;1.26;-0.79;-0.81;-0.65	5.77	5.77	0.91146	.	0.225364	0.25089	U	0.033232	D	0.86012	0.5831	M	0.69358	2.11	0.32854	D	0.507104	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.991	D;D;D;D;P	0.78314	0.941;0.987;0.973;0.991;0.716	D	0.88093	0.2814	10	0.72032	D	0.01	-4.4909	19.9894	0.97361	0.0:0.0:1.0:0.0	.	45;227;33;38;38	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	Q	227;227;38;38;45;18;45;33;33;33	ENSP00000385048:R227Q;ENSP00000385727:R227Q;ENSP00000421739:R38Q;ENSP00000384313:R38Q;ENSP00000384099:R45Q;ENSP00000261569:R33Q	ENSP00000261569:R33Q	R	+	2	0	MAST4	66385993	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.398000	0.90195	2.726000	0.93360	0.561000	0.74099	CGA	.	.	none		0.423	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
