#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KTN1	3895	hgsc.bcm.edu	37	14	56079010	56079010	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr14:56079010C>T	ENST00000395314.3	+	2	312	c.244C>T	c.(244-246)Cga>Tga	p.R82*	KTN1_ENST00000395308.1_Nonsense_Mutation_p.R82*|KTN1_ENST00000395311.1_Nonsense_Mutation_p.R82*|KTN1_ENST00000413890.2_Nonsense_Mutation_p.R82*|KTN1_ENST00000438792.2_Nonsense_Mutation_p.R82*|KTN1_ENST00000416613.1_Nonsense_Mutation_p.R82*|KTN1_ENST00000395309.3_Nonsense_Mutation_p.R82*	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	82					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GAGTGTACCTCGAGACTTTAA	0.363			T	RET	papillary thryoid																																p.R82X		Atlas-SNP	.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	147	.	0			c.C244T						PASS	.						74.0	78.0	77.0					14																	56079010		2203	4300	6503	SO:0001587	stop_gained	3895	exon2			GTACCTCGAGACT		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.244C>T	14.37:g.56079010C>T	ENSP00000378725:p.Arg82*	188.0	0.0	0		145.0	19.0	0.131034	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Nonsense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	C	35	5.445114	0.96187	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	.	.	.	5.63	4.75	0.60458	.	0.296616	0.24176	N	0.040855	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.098	14.4179	0.67163	0.0:0.9292:0.0:0.0708	.	.	.	.	X	82	.	ENSP00000378719:R82X	R	+	1	2	KTN1	55148763	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	2.425000	0.44723	1.379000	0.46325	0.591000	0.81541	CGA	.	.	none		0.363	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
PKN2	5586	hgsc.bcm.edu	37	1	89271287	89271287	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr1:89271287C>G	ENST00000370521.3	+	11	1968	c.1609C>G	c.(1609-1611)Caa>Gaa	p.Q537E	PKN2_ENST00000316005.7_Missense_Mutation_p.Q537E|PKN2_ENST00000370513.5_Missense_Mutation_p.Q489E|PKN2_ENST00000544045.1_Missense_Mutation_p.Q211E|PKN2_ENST00000370505.3_Missense_Mutation_p.Q380E	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	537					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		CTTCAGCCCTCAAGCTCCTGT	0.443																																					p.Q537E		Atlas-SNP	.											.	PKN2	109	.	0			c.C1609G						PASS	.						67.0	66.0	67.0					1																	89271287		1960	4158	6118	SO:0001583	missense	5586	exon11			AGCCCTCAAGCTC	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.1609C>G	1.37:g.89271287C>G	ENSP00000359552:p.Gln537Glu	148.0	0.0	0		122.0	8.0	0.0655738	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	C	4.487	0.090208	0.08632	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	6.02	6.02	0.97574	.	0.000000	0.43260	U	0.000595	T	0.15219	0.0367	L	0.38175	1.15	0.48632	D	0.999685	B;B;B;B	0.20368	0.002;0.001;0.044;0.025	B;B;B;B	0.18561	0.002;0.002;0.022;0.02	T	0.19160	-1.0314	10	0.02654	T	1	.	20.5269	0.99230	0.0:1.0:0.0:0.0	.	521;489;537;537	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	E	537;537;380;489;211	ENSP00000359552:Q537E;ENSP00000317851:Q537E;ENSP00000359536:Q380E;ENSP00000359544:Q489E;ENSP00000439643:Q211E	ENSP00000317851:Q537E	Q	+	1	0	PKN2	89043875	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.144000	0.77357	2.859000	0.98148	0.591000	0.81541	CAA	.	.	none		0.443	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
CDH3	1001	hgsc.bcm.edu	37	16	68712537	68712537	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr16:68712537G>A	ENST00000264012.4	+	5	1068	c.524G>A	c.(523-525)cGg>cAg	p.R175Q	CDH3_ENST00000429102.2_Missense_Mutation_p.R175Q|CDH3_ENST00000581171.1_Missense_Mutation_p.R120Q	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	175	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CCACTGGACCGGGAGGAGATT	0.572																																					p.R175Q		Atlas-SNP	.											.	CDH3	68	.	2	Unknown(2)	breast(2)	c.G524A						PASS	.						89.0	92.0	91.0					16																	68712537		2198	4300	6498	SO:0001583	missense	1001	exon5			TGGACCGGGAGGA	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.524G>A	16.37:g.68712537G>A	ENSP00000264012:p.Arg175Gln	56.0	0.0	0		35.0	6.0	0.171429	NM_001793	B2R6F4|Q05DI6	Missense_Mutation	SNP	ENST00000264012.4	37	CCDS10868.1	.	.	.	.	.	.	.	.	.	.	G	35	5.512360	0.96402	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.59364	0.27;0.27	5.64	5.64	0.86602	Cadherin (5);Cadherin-like (1);	0.000000	0.38837	N	0.001542	D	0.84424	0.5469	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88804	0.3287	10	0.87932	D	0	.	17.243	0.87019	0.0:0.0:1.0:0.0	.	175	P22223	CADH3_HUMAN	Q	175;175;120	ENSP00000398485:R175Q;ENSP00000264012:R175Q	ENSP00000264012:R175Q	R	+	2	0	CDH3	67270038	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.625000	0.98406	2.937000	0.99478	0.650000	0.86243	CGG	.	.	none		0.572	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
MAP1B	4131	hgsc.bcm.edu	37	5	71495880	71495880	+	Missense_Mutation	SNP	A	A	C			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr5:71495880A>C	ENST00000296755.7	+	5	6996	c.6698A>C	c.(6697-6699)aAa>aCa	p.K2233T		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2233					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AACCTGGGCAAAGCTCTAAAG	0.522																																					p.K2233T	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.A6698C						PASS	.						101.0	102.0	101.0					5																	71495880		2203	4300	6503	SO:0001583	missense	4131	exon5			TGGGCAAAGCTCT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6698A>C	5.37:g.71495880A>C	ENSP00000296755:p.Lys2233Thr	61.0	0.0	0		50.0	5.0	0.1	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089024	0.55968	.	.	ENSG00000131711	ENST00000296755	T	0.03920	3.76	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000001	T	0.15696	0.0378	L	0.52364	1.645	0.51767	D	0.999934	D;D	0.61697	0.99;0.979	D;P	0.63957	0.92;0.702	T	0.00303	-1.1833	10	0.48119	T	0.1	-23.3459	16.1303	0.81428	1.0:0.0:0.0:0.0	.	2107;2233	A2BDK6;P46821	.;MAP1B_HUMAN	T	2233	ENSP00000296755:K2233T	ENSP00000296755:K2233T	K	+	2	0	MAP1B	71531636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.846000	0.92159	2.218000	0.71995	0.533000	0.62120	AAA	.	.	none		0.522	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
TRPM3	80036	hgsc.bcm.edu	37	9	73225579	73225579	+	Silent	SNP	G	G	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr9:73225579G>T	ENST00000377111.2	-	18	2820	c.2577C>A	c.(2575-2577)ggC>ggA	p.G859G	TRPM3_ENST00000377105.1_Silent_p.G718G|TRPM3_ENST00000377106.1_Silent_p.G731G|TRPM3_ENST00000358082.3_Silent_p.G721G|TRPM3_ENST00000396280.5_Silent_p.G708G|TRPM3_ENST00000377110.3_Silent_p.G859G|TRPM3_ENST00000357533.2_Silent_p.G863G|TRPM3_ENST00000396285.1_Silent_p.G706G|TRPM3_ENST00000408909.2_Silent_p.G718G|TRPM3_ENST00000423814.3_Silent_p.G886G|TRPM3_ENST00000360823.2_Silent_p.G721G|TRPM3_ENST00000396292.4_Silent_p.G731G	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	884					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGATTTTTCTGCCGAGGGGGA	0.478																																					p.G859G		Atlas-SNP	.											TRPM3_ENST00000423814,NS,carcinoma,-2,3	TRPM3	700	3	0			c.C2577A						PASS	.						212.0	190.0	197.0					9																	73225579		2203	4300	6503	SO:0001819	synonymous_variant	80036	exon18			TTTTCTGCCGAGG	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2577C>A	9.37:g.73225579G>T		112.0	0.0	0		99.0	9.0	0.0909091	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	G	9.856	1.195023	0.22037	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.17	4.21	0.49690	.	.	.	.	.	T	0.53706	0.1813	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51942	-0.8641	4	.	.	.	-26.6526	5.2178	0.15352	0.1719:0.0:0.5664:0.2617	.	.	.	.	K	708	.	.	Q	-	1	0	TRPM3	72415399	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.191000	0.32138	1.631000	0.50456	0.655000	0.94253	CAG	.	.	none		0.478	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33581343	33581343	+	Missense_Mutation	SNP	G	G	A	rs369439478		TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr11:33581343G>A	ENST00000321505.4	+	6	3193	c.3013G>A	c.(3013-3015)Gtg>Atg	p.V1005M	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.V1011M|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.V1011M			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1005						integral component of membrane (GO:0016021)											GGTGTACGTCGTGGGCAATCA	0.582																																					p.V1005M		Atlas-SNP	.											.	.	.	.	0			c.G3013A						PASS	.	G	MET/VAL	0,4294		0,0,2147	102.0	102.0	102.0		3013	4.5	1.0	11		102	1,8491		0,1,4245	no	missense	C11orf41	NM_012194.2	21	0,1,6392	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	1005/1850	33581343	1,12785	2147	4246	6393	SO:0001583	missense	25758	exon6			TACGTCGTGGGCA	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.3013G>A	11.37:g.33581343G>A	ENSP00000315295:p.Val1005Met	73.0	0.0	0		53.0	9.0	0.169811	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291386	0.80914	0.0	1.18E-4	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.	.	.	5.42	4.49	0.54785	.	0.119417	0.56097	D	0.000022	T	0.73590	0.3606	M	0.80847	2.515	0.29328	N	0.866907	D;D	0.89917	1.0;0.999	D;P	0.78314	0.991;0.814	T	0.73984	-0.3810	9	0.87932	D	0	-9.1816	15.7714	0.78173	0.0:0.0:0.8626:0.1374	.	1011;1011	E9PAT2;Q6ZVL6-2	.;.	M	1005;1011;1011;844	.	ENSP00000265654:V1011M	V	+	1	0	C11orf41	33537919	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.357000	0.73051	1.389000	0.46526	0.573000	0.79308	GTG	.	.	weak		0.582	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33588659	33588659	+	IGR	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr20:33588659G>A	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Missense_Mutation_p.R1798Q			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CAGGAGAGGCGGGAGGCTGAG	0.612																																					p.R1798Q		Atlas-SNP	.											MYH7B,NS,carcinoma,+1,1	MYH7B	145	1	0			c.G5393A						PASS	.						45.0	64.0	58.0					20																	33588659		2134	4257	6391	SO:0001628	intergenic_variant	57644	exon40			AGAGGCGGGAGGC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33588659G>A		40.0	0.0	0		42.0	6.0	0.142857	NM_020884	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692707	0.68271	.	.	ENSG00000078814	ENST00000262873	T	0.78246	-1.16	4.65	4.65	0.58169	Myosin tail (1);	0.000000	0.34580	N	0.003843	D	0.88779	0.6529	M	0.85859	2.78	0.49389	D	0.999786	D	0.76494	0.999	D	0.80764	0.994	D	0.88397	0.3012	10	0.35671	T	0.21	.	17.7847	0.88534	0.0:0.0:1.0:0.0	.	1756	A7E2Y1	MYH7B_HUMAN	Q	1798	ENSP00000262873:R1798Q	ENSP00000262873:R1798Q	R	+	2	0	MYH7B	33052320	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.797000	0.85911	2.433000	0.82419	0.558000	0.71614	CGG	.	.	none		0.612	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
GRIN2A	2903	hgsc.bcm.edu	37	16	9916205	9916205	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr16:9916205C>T	ENST00000396573.2	-	11	2393	c.2084G>A	c.(2083-2085)cGg>cAg	p.R695Q	GRIN2A_ENST00000396575.2_Missense_Mutation_p.R695Q|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R695Q|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R695Q|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R695Q|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R538Q	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	695					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATAGTTATTCCGAATGTTTCT	0.458																																					p.R695Q		Atlas-SNP	.											.	GRIN2A	366	.	0			c.G2084A						PASS	.						167.0	142.0	150.0					16																	9916205		2197	4300	6497	SO:0001583	missense	2903	exon11			TTATTCCGAATGT		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2084G>A	16.37:g.9916205C>T	ENSP00000379818:p.Arg695Gln	177.0	0.0	0		127.0	7.0	0.0551181	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	36	5.757827	0.96898	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	5.65	5.65	0.86999	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	L	0.52266	1.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.921;0.953;0.992	T	0.34950	-0.9808	9	.	.	.	.	18.7287	0.91726	0.0:1.0:0.0:0.0	.	538;695;695	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	Q	695;695;538;695;695	ENSP00000379818:R695Q;ENSP00000385872:R695Q;ENSP00000441572:R538Q;ENSP00000332549:R695Q;ENSP00000379820:R695Q	.	R	-	2	0	GRIN2A	9823706	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.943000	0.70211	2.655000	0.90218	0.655000	0.94253	CGG	.	.	none		0.458	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
CAMTA1	23261	hgsc.bcm.edu	37	1	7796527	7796527	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr1:7796527C>G	ENST00000303635.7	+	13	3397	c.3190C>G	c.(3190-3192)Cgc>Ggc	p.R1064G	CAMTA1_ENST00000439411.2_Missense_Mutation_p.R1064G	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1064					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AAAGACTTTCCGCGGAATGAC	0.597			T	WWTR1	epitheliod hemangioendothelioma																																p.R1064G		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.C3190G						PASS	.						136.0	122.0	127.0					1																	7796527		2203	4300	6503	SO:0001583	missense	23261	exon13			ACTTTCCGCGGAA	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3190C>G	1.37:g.7796527C>G	ENSP00000306522:p.Arg1064Gly	96.0	0.0	0		92.0	9.0	0.0978261	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.617775	0.66787	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.42900	0.96;0.96	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.41824	1.3	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.999;0.995;0.998;0.991	T	0.52741	-0.8535	10	0.48119	T	0.1	-10.5237	14.4254	0.67212	0.1473:0.8526:0.0:0.0	.	1064;151;20;1064	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	G	1064;1064;151;20	ENSP00000306522:R1064G;ENSP00000402561:R1064G	ENSP00000306522:R1064G	R	+	1	0	CAMTA1	7719114	1.000000	0.71417	0.998000	0.56505	0.704000	0.40688	4.842000	0.62831	2.624000	0.88883	0.655000	0.94253	CGC	.	.	none		0.597	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
RAB40A	142684	hgsc.bcm.edu	37	X	102755451	102755451	+	Silent	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chrX:102755451G>A	ENST00000372633.1	-	1	2352	c.234C>T	c.(232-234)acC>acT	p.T78T	LL0XNC01-250H12.3_ENST00000445990.1_RNA|RAB40A_ENST00000304236.1_Silent_p.T78T			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	78					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						AGCGGAATATGGTACAAAATC	0.542																																					p.T78T		Atlas-SNP	.											.	RAB40A	30	.	0			c.C234T						PASS	.						67.0	60.0	62.0					X																	102755451		2202	4279	6481	SO:0001819	synonymous_variant	142684	exon3			GAATATGGTACAA	AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.234C>T	X.37:g.102755451G>A		461.0	0.0	0		350.0	25.0	0.0714286	NM_080879	O00407|Q17RQ5|Q6DK06|Q8TF06	Silent	SNP	ENST00000372633.1	37	CCDS35357.1																																																																																			.	.	none		0.542	RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057714.1		
UBE2R2	54926	hgsc.bcm.edu	37	9	33900200	33900200	+	Missense_Mutation	SNP	A	A	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr9:33900200A>T	ENST00000263228.3	+	3	484	c.293A>T	c.(292-294)cAt>cTt	p.H98L		NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2	98					protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TCGATTCTTCATCCGCCTGTA	0.403																																					p.H98L		Atlas-SNP	.											UBE2R2,NS,carcinoma,+1,1	UBE2R2	19	1	0			c.A293T						PASS	.						154.0	146.0	149.0					9																	33900200		2203	4300	6503	SO:0001583	missense	54926	exon3			TTCTTCATCCGCC	AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797	ENST00000263228.3:c.293A>T	9.37:g.33900200A>T	ENSP00000263228:p.His98Leu	141.0	0.0	0		153.0	11.0	0.0718954	NM_017811	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	37	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	A	32	5.129742	0.94473	.	.	ENSG00000107341	ENST00000263228	T	0.37915	1.17	5.73	5.73	0.89815	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.71048	-0.4705	10	0.87932	D	0	-12.1031	15.6837	0.77393	1.0:0.0:0.0:0.0	.	98	Q712K3	UB2R2_HUMAN	L	98	ENSP00000263228:H98L	ENSP00000263228:H98L	H	+	2	0	UBE2R2	33890200	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.770000	0.91746	2.182000	0.69389	0.528000	0.53228	CAT	.	.	none		0.403	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1	NM_017811	
GAL3ST4	79690	hgsc.bcm.edu	37	7	99757593	99757593	+	Silent	SNP	G	G	C			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr7:99757593G>C	ENST00000360039.4	-	4	1811	c.1419C>G	c.(1417-1419)acC>acG	p.T473T	C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000498638.1_5'Flank|GAL3ST4_ENST00000426974.2_Silent_p.T411T|C7orf43_ENST00000316937.3_5'Flank|C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000411994.1_3'UTR|GAL3ST4_ENST00000413800.1_Silent_p.T473T|GAL3ST4_ENST00000423751.1_3'UTR	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	473					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAGTGAGACGGTAGGGGGGA	0.537																																					p.T473T		Atlas-SNP	.											.	GAL3ST4	59	.	0			c.C1419G						PASS	.						94.0	81.0	85.0					7																	99757593		2203	4300	6503	SO:0001819	synonymous_variant	79690	exon4			TGAGACGGTAGGG	AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1419C>G	7.37:g.99757593G>C		76.0	0.0	0		63.0	6.0	0.0952381	NM_024637	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Silent	SNP	ENST00000360039.4	37	CCDS5688.1																																																																																			.	.	none		0.537	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637	
DLGAP3	58512	hgsc.bcm.edu	37	1	35370945	35370945	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr1:35370945G>A	ENST00000373347.1	-	3	308	c.40C>T	c.(40-42)Cca>Tca	p.P14S	DLGAP3_ENST00000495979.1_5'UTR|DLGAP3_ENST00000235180.4_Missense_Mutation_p.P14S			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	14					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				AAGCGGGCTGGGCGGGGATGG	0.642																																					p.P14S		Atlas-SNP	.											.	DLGAP3	107	.	0			c.C40T						PASS	.						4.0	4.0	4.0					1																	35370945		2095	4128	6223	SO:0001583	missense	58512	exon1			GGGCTGGGCGGGG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.40C>T	1.37:g.35370945G>A	ENSP00000362444:p.Pro14Ser	88.0	0.0	0		63.0	8.0	0.126984	NM_001080418	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	ENST00000373347.1	37	CCDS30670.1	.	.	.	.	.	.	.	.	.	.	g	7.354	0.623400	0.14193	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.25579	1.79;1.79	4.49	3.57	0.40892	.	0.177561	0.37483	N	0.002071	T	0.16342	0.0393	L	0.27053	0.805	0.33953	D	0.644702	B	0.26081	0.141	B	0.20955	0.032	T	0.17379	-1.0371	10	0.28530	T	0.3	-3.2976	10.9404	0.47270	0.0919:0.0:0.9081:0.0	.	14	O95886	DLGP3_HUMAN	S	14	ENSP00000362444:P14S;ENSP00000235180:P14S	ENSP00000235180:P14S	P	-	1	0	DLGAP3	35143532	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.279000	0.51670	2.054000	0.61138	0.457000	0.33378	CCA	.	.	none		0.642	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
MYH10	4628	hgsc.bcm.edu	37	17	8455392	8455392	+	Silent	SNP	C	C	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr17:8455392C>T	ENST00000269243.4	-	8	999	c.861G>A	c.(859-861)ttG>ttA	p.L287L	MYH10_ENST00000379980.4_Silent_p.L303L|MYH10_ENST00000396239.1_Silent_p.L287L|MYH10_ENST00000360416.3_Silent_p.L297L	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	287	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CTCCAGATAACAACTGGTAAA	0.313																																					p.L297L		Atlas-SNP	.											.	MYH10	148	.	0			c.G891A						PASS	.						46.0	48.0	47.0					17																	8455392		2203	4300	6503	SO:0001819	synonymous_variant	4628	exon9			AGATAACAACTGG	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.861G>A	17.37:g.8455392C>T		168.0	0.0	0		161.0	15.0	0.0931677	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																			.	.	none		0.313	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
PMFBP1	83449	hgsc.bcm.edu	37	16	72198813	72198813	+	Silent	SNP	C	C	T	rs550862432	byFrequency	TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr16:72198813C>T	ENST00000237353.10	-	3	276	c.15G>A	c.(13-15)gcG>gcA	p.A5A	PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000543746.1_5'UTR|PMFBP1_ENST00000537465.1_Silent_p.A5A	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	5						cytoplasm (GO:0005737)		p.A5A(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				CTCTCTCCCCCGCCTAGGCAG	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		20548	0.0		0.0	False		,,,				2504	0.002				p.A5A		Atlas-SNP	.											PMFBP1,NS,carcinoma,-1,2	PMFBP1	101	2	1	Substitution - coding silent(1)	endometrium(1)	c.G15A						PASS	.						51.0	48.0	49.0					16																	72198813		2198	4300	6498	SO:0001819	synonymous_variant	83449	exon3			CTCCCCCGCCTAG	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.15G>A	16.37:g.72198813C>T		45.0	0.0	0		33.0	6.0	0.181818	NM_031293	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	ENST00000237353.10	37	CCDS32483.1																																																																																			.	.	none		0.443	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
NEK1	4750	hgsc.bcm.edu	37	4	170509869	170509869	+	Missense_Mutation	SNP	C	C	T			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr4:170509869C>T	ENST00000439128.2	-	7	1122	c.482G>A	c.(481-483)cGa>cAa	p.R161Q	NEK1_ENST00000510533.1_Missense_Mutation_p.R161Q|NEK1_ENST00000512193.1_Missense_Mutation_p.R161Q|NEK1_ENST00000511633.1_Missense_Mutation_p.R161Q|NEK1_ENST00000507142.1_Missense_Mutation_p.R161Q	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TATGCAAGTTCGAGCCAGCTC	0.343																																					p.R161Q		Atlas-SNP	.											.	NEK1	203	.	0			c.G482A						PASS	.						43.0	42.0	42.0					4																	170509869		1718	3745	5463	SO:0001583	missense	4750	exon8			CAAGTTCGAGCCA	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.482G>A	4.37:g.170509869C>T	ENSP00000408020:p.Arg161Gln	275.0	0.0	0		176.0	23.0	0.130682	NM_001199399	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	C	36	5.684701	0.96784	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000023	T	0.66636	0.2809	N	0.11255	0.115	0.80722	D	1	D;D;D;D;D;D	0.89917	0.97;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.91635	0.637;0.998;0.999;0.999;0.999;0.999	T	0.70594	-0.4829	10	0.48119	T	0.1	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	161;161;161;161;161;161	Q96PY6-5;Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;.;NEK1_HUMAN	Q	161	ENSP00000408020:R161Q;ENSP00000423332:R161Q;ENSP00000427653:R161Q;ENSP00000424757:R161Q;ENSP00000424938:R161Q	ENSP00000408020:R161Q	R	-	2	0	NEK1	170746444	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.492000	0.81482	2.857000	0.98124	0.650000	0.86243	CGA	.	.	none		0.343	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3		
TRIM22	10346	hgsc.bcm.edu	37	11	5730437	5730437	+	Silent	SNP	G	G	A	rs140700337	byFrequency	TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr11:5730437G>A	ENST00000379965.3	+	8	1333	c.1056G>A	c.(1054-1056)tcG>tcA	p.S352S	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	352	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		ATTTCTCTTCGGGGAAATATT	0.413													G|||	19	0.00379393	0.0136	0.0014	5008	,	,		19088	0.0		0.0	False		,,,				2504	0.0				p.S352S	GBM(104;491 2336 5222)	Atlas-SNP	.											.	TRIM22	66	.	0			c.G1056A						PASS	.	G	,	17,3647		0,17,1815	131.0	123.0	126.0		1044,1056	2.5	0.6	11	dbSNP_134	126	0,8182		0,0,4091	no	coding-synonymous,coding-synonymous	TRIM22	NM_001199573.1,NM_006074.4	,	0,17,5906	AA,AG,GG		0.0,0.464,0.1435	,	348/495,352/499	5730437	17,11829	1832	4091	5923	SO:0001819	synonymous_variant	10346	exon8			CTCTTCGGGGAAA	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.1056G>A	11.37:g.5730437G>A		132.0	0.0	0		116.0	11.0	0.0948276	NM_006074	Q05CQ0|Q15521	Silent	SNP	ENST00000379965.3	37	CCDS41612.1																																																																																			G|0.993;A|0.007	0.007	strong		0.413	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074	
CNGB1	1258	hgsc.bcm.edu	37	16	57918303	57918303	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr16:57918303G>A	ENST00000251102.8	-	33	3581	c.3521C>T	c.(3520-3522)aCg>aTg	p.T1174M	CNGB1_ENST00000564448.1_Missense_Mutation_p.T1168M	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	1174					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CTTTGGGTGCGTGTGCTGGTC	0.701																																					p.T1174M	Colon(156;1293 1853 16336 28962 38659)	Atlas-SNP	.											.	CNGB1	105	.	0			c.C3521T						PASS	.						21.0	23.0	23.0					16																	57918303		1970	4139	6109	SO:0001583	missense	1258	exon33			GGGTGCGTGTGCT	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.3521C>T	16.37:g.57918303G>A	ENSP00000251102:p.Thr1174Met	72.0	0.0	0		64.0	16.0	0.25	NM_001297	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.798004	0.31777	.	.	ENSG00000070729	ENST00000251102	D	0.96716	-4.1	4.33	-1.25	0.09405	.	1.568360	0.04324	N	0.351159	D	0.88444	0.6438	N	0.08118	0	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.09377	0.004;0.002	T	0.79167	-0.1915	10	0.45353	T	0.12	.	0.7321	0.00959	0.292:0.1654:0.3729:0.1697	.	546;1174	Q14028-2;Q14028	.;CNGB1_HUMAN	M	1174	ENSP00000251102:T1174M	ENSP00000251102:T1174M	T	-	2	0	CNGB1	56475804	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.110000	0.15437	-0.050000	0.13356	-0.982000	0.02568	ACG	.	.	none		0.701	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57081004	57081004	+	Silent	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr11:57081004G>A	ENST00000532437.1	-	4	1469	c.1158C>T	c.(1156-1158)acC>acT	p.T386T	TNKS1BP1_ENST00000358252.3_Silent_p.T386T|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	386	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GCCGGGGTGAGGTGGCAGGGG	0.701																																					p.T386T		Atlas-SNP	.											.	TNKS1BP1	148	.	0			c.C1158T						PASS	.						14.0	16.0	15.0					11																	57081004		2187	4268	6455	SO:0001819	synonymous_variant	85456	exon5			GGGTGAGGTGGCA	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1158C>T	11.37:g.57081004G>A		35.0	0.0	0		50.0	13.0	0.26	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	CCDS7951.1																																																																																			.	.	none		0.701	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
MESP2	145873	hgsc.bcm.edu	37	15	90320149	90320149	+	Silent	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr15:90320149G>A	ENST00000341735.3	+	1	561	c.561G>A	c.(559-561)ggG>ggA	p.G187G	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	187	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaggggcaggggcaag	0.781																																					p.G187G		Atlas-SNP	.											.	MESP2	20	.	0			c.G561A						PASS	.						2.0	3.0	3.0					15																	90320149		1334	3199	4533	SO:0001819	synonymous_variant	145873	exon1			GCAGGGGCAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.561G>A	15.37:g.90320149G>A		23.0	0.0	0		22.0	8.0	0.363636	NM_001039958	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																			.	.	none		0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
HHLA3	11147	hgsc.bcm.edu	37	1	70832174	70832174	+	Missense_Mutation	SNP	C	C	G	rs143161214		TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr1:70832174C>G	ENST00000359875.5	+	2	445	c.305C>G	c.(304-306)tCt>tGt	p.S102C	HHLA3_ENST00000361764.4_Missense_Mutation_p.F68L|HHLA3_ENST00000370940.5_Missense_Mutation_p.L70V|HHLA3_ENST00000531950.1_Missense_Mutation_p.S102C|HHLA3_ENST00000432224.1_Missense_Mutation_p.L103V	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3	102										large_intestine(3)|lung(1)	4						agagagcattcttggatctct	0.368																																					p.S102C		Atlas-SNP	.											.	HHLA3	11	.	0			c.C305G						PASS	.						13.0	15.0	14.0					1																	70832174		2182	4265	6447	SO:0001583	missense	11147	exon2			AGCATTCTTGGAT	AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.305C>G	1.37:g.70832174C>G	ENSP00000352938:p.Ser102Cys	152.0	0.0	0		140.0	8.0	0.0571429	NM_001036645	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	Missense_Mutation	SNP	ENST00000359875.5	37	CCDS30753.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	3.184|3.184|3.184	-0.167279|-0.167279|-0.167279	0.06461|0.06461|0.06461	.|.|.	.|.|.	ENSG00000197568|ENSG00000197568|ENSG00000197568	ENST00000361764|ENST00000370940;ENST00000432224|ENST00000359875;ENST00000531950	.|.|.	.|.|.	.|.|.	0.137|0.137|0.137	0.137|0.137|0.137	0.14787|0.14787|0.14787	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	0.37019|0.37019|0.37019	0.0988|0.0988|0.0988	.|.|.	.|.|.	.|.|.	0.09310|0.09310|0.09310	N|N|N	1|1|1	B|P|P	0.28667|0.37398|0.49696	0.219|0.593|0.927	B|P|P	0.39217|0.48114|0.58660	0.294|0.567|0.843	T|T|T	0.14559|0.14559|0.14559	-1.0468|-1.0468|-1.0468	6|6|6	0.02654|0.87932|0.87932	T|D|D	1|0|0	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	68|70|102	Q9XRX5-3|Q9XRX5-2|Q9XRX5	.|.|HHLA3_HUMAN	L|V|C	68|70;103|102	.|.|.	ENSP00000354815:F68L|ENSP00000359978:L70V|ENSP00000352938:S102C	F|L|S	+|+|+	3|1|2	2|0|0	HHLA3|HHLA3|HHLA3	70604762|70604762|70604762	0.005000|0.005000|0.005000	0.15991|0.15991|0.15991	0.015000|0.015000|0.015000	0.15790|0.15790|0.15790	0.016000|0.016000|0.016000	0.09150|0.09150|0.09150	-0.771000|-0.771000|-0.771000	0.04699|0.04699|0.04699	0.291000|0.291000|0.291000	0.22468|0.22468|0.22468	0.297000|0.297000|0.297000	0.19635|0.19635|0.19635	TTC|CTT|TCT	C|1.000;A|0.000	.	alt		0.368	HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025911.2	NM_007071	
MED12	9968	hgsc.bcm.edu	37	X	70352367	70352367	+	Missense_Mutation	SNP	G	G	A			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chrX:70352367G>A	ENST00000374080.3	+	31	4426	c.4394G>A	c.(4393-4395)cGt>cAt	p.R1465H	MED12_ENST00000374102.1_Missense_Mutation_p.R1465H|MED12_ENST00000333646.6_Missense_Mutation_p.R1465H			Q93074	MED12_HUMAN	mediator complex subunit 12	1465					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CGCAAAGAACGTGATCGACAA	0.522			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.R1465H		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.G4394A						PASS	.						50.0	46.0	47.0					X																	70352367		1904	4122	6026	SO:0001583	missense	9968	exon31			AAGAACGTGATCG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4394G>A	X.37:g.70352367G>A	ENSP00000363193:p.Arg1465His	94.0	0.0	0		106.0	11.0	0.103774	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673341	0.88445	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	D;D;D;D;T	0.84873	-1.91;-1.91;-1.91;-1.91;1.26	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.91287	0.7253	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.74348	0.983;0.968;0.977;0.961	D	0.92570	0.6065	10	0.72032	D	0.01	-10.5615	16.1804	0.81895	0.0:0.0:1.0:0.0	.	1465;1312;1465;1465	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	H	1465;1465;1465;1465;1433;210	ENSP00000333125:R1465H;ENSP00000363215:R1465H;ENSP00000363193:R1465H;ENSP00000414203:R1433H;ENSP00000408388:R210H	ENSP00000333125:R1465H	R	+	2	0	MED12	70269092	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	8.933000	0.92911	2.071000	0.62044	0.523000	0.50628	CGT	.	.	none		0.522	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
RPL37	6167	hgsc.bcm.edu	37	5	40832665	40832665	+	Missense_Mutation	SNP	G	G	A	rs368304251		TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr5:40832665G>A	ENST00000274242.5	-	4	384	c.235C>T	c.(235-237)Cgt>Tgt	p.R79C	SNORD72_ENST00000390994.1_RNA|RPL37_ENST00000504562.1_5'UTR|RPL37_ENST00000509877.1_Silent_p.S50S	NM_000997.4	NP_000988.1	P61927	RL37_HUMAN	ribosomal protein L37	79					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			lung(3)|ovary(1)	4		Breast(839;0.238)				GTTCCTTCACGGAATCCATGC	0.383																																					p.R79C	Colon(188;1411 2035 4978 19588 31462)	Atlas-SNP	.											RPL37,NS,carcinoma,0,1	RPL37	7	1	0			c.C235T						PASS	.	G	CYS/ARG	0,4406		0,0,2203	180.0	184.0	183.0		235	3.9	1.0	5		183	1,8599	1.2+/-3.3	0,1,4299	no	missense	RPL37	NM_000997.4	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	79/98	40832665	1,13005	2203	4300	6503	SO:0001583	missense	6167	exon4			CTTCACGGAATCC	L11567	CCDS3934.1	5p13.1	2013-09-23			ENSG00000145592	ENSG00000145592		"""L ribosomal proteins"""	10347	protein-coding gene	gene with protein product	"""60S ribosomal protein L37a"""	604181				7545944, 9582194	Standard	NM_000997		Approved	L37	uc003jme.1	P61927	OTTHUMG00000094774	ENST00000274242.5:c.235C>T	5.37:g.40832665G>A	ENSP00000274242:p.Arg79Cys	193.0	0.0	0		145.0	8.0	0.0551724	NM_000997	B2R4H2|P02403|Q6IBB4|Q99883	Missense_Mutation	SNP	ENST00000274242.5	37	CCDS3934.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919716	0.52653	0.0	1.16E-4	ENSG00000145592	ENST00000274242	T	0.53423	0.62	4.81	3.94	0.45596	.	0.000000	0.85682	U	0.000000	T	0.39253	0.1071	.	.	.	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.20672	-1.0268	9	0.46703	T	0.11	.	12.9052	0.58147	0.0788:0.0:0.9212:0.0	.	79	P61927	RL37_HUMAN	C	79	ENSP00000274242:R79C	ENSP00000274242:R79C	R	-	1	0	RPL37	40868422	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.595000	0.82710	1.023000	0.39654	0.563000	0.77884	CGT	.	.	weak		0.383	RPL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000211583.2	NM_000997	
TRPM3	80036	hgsc.bcm.edu	37	9	73225580	73225580	+	Missense_Mutation	SNP	C	C	G			TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr9:73225580C>G	ENST00000377111.2	-	18	2819	c.2576G>C	c.(2575-2577)gGc>gCc	p.G859A	TRPM3_ENST00000377105.1_Missense_Mutation_p.G718A|TRPM3_ENST00000377106.1_Missense_Mutation_p.G731A|TRPM3_ENST00000358082.3_Missense_Mutation_p.G721A|TRPM3_ENST00000396280.5_Missense_Mutation_p.G708A|TRPM3_ENST00000377110.3_Missense_Mutation_p.G859A|TRPM3_ENST00000357533.2_Missense_Mutation_p.G863A|TRPM3_ENST00000396285.1_Missense_Mutation_p.G706A|TRPM3_ENST00000408909.2_Missense_Mutation_p.G718A|TRPM3_ENST00000423814.3_Missense_Mutation_p.G886A|TRPM3_ENST00000360823.2_Missense_Mutation_p.G721A|TRPM3_ENST00000396292.4_Missense_Mutation_p.G731A	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	884					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GATTTTTCTGCCGAGGGGGAT	0.473																																					p.G859A		Atlas-SNP	.											TRPM3_ENST00000423814,NS,carcinoma,-1,3	TRPM3	700	3	0			c.G2576C						PASS	.						211.0	190.0	197.0					9																	73225580		2203	4300	6503	SO:0001583	missense	80036	exon18			TTTCTGCCGAGGG	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2576G>C	9.37:g.73225580C>G	ENSP00000366315:p.Gly859Ala	114.0	0.0	0		100.0	9.0	0.09	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	C	16.76	3.211406	0.58343	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	D;D;D;D;D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.88310	0.6402	M	0.69823	2.125	0.80722	D	1	B;B;D;B;B;D;B;B	0.64830	0.049;0.021;0.994;0.066;0.066;0.981;0.336;0.354	B;B;D;B;B;P;B;B	0.64687	0.061;0.022;0.928;0.046;0.016;0.742;0.17;0.138	T	0.82682	-0.0336	10	0.15499	T	0.54	-26.6526	20.8794	0.99867	0.0:1.0:0.0:0.0	.	859;859;849;863;721;718;831;706	Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.;.	A	859;859;731;721;718;863;718;706;731;721;886	ENSP00000366315:G859A;ENSP00000366314:G859A;ENSP00000366310:G731A;ENSP00000354066:G721A;ENSP00000366309:G718A;ENSP00000350140:G863A;ENSP00000386127:G718A;ENSP00000379581:G706A;ENSP00000379587:G731A;ENSP00000350791:G721A;ENSP00000389542:G886A	ENSP00000350140:G863A	G	-	2	0	TRPM3	72415400	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGC	.	.	none		0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
OTOGL	283310	hgsc.bcm.edu	37	12	80714313	80714313	+	Missense_Mutation	SNP	G	G	A	rs369089877		TCGA-GS-A9U4-01A-11D-A38X-10	TCGA-GS-A9U4-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4b7512d6-8e65-47d9-98ca-1fe4bd7c455f	22fb535e-5b36-4add-ba3f-997cb70efcff	g.chr12:80714313G>A	ENST00000547103.1	+	33	3893	c.3887G>A	c.(3886-3888)cGg>cAg	p.R1296Q	OTOGL_ENST00000458043.2_Missense_Mutation_p.R1296Q			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1296					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GCCTTTCATCGGAGAGCAACA	0.433																																					p.R1296Q		Atlas-SNP	.											OTOGL_ENST00000458043,NS,carcinoma,+1,1	OTOGL	235	1	0			c.G3887A						PASS	.	G	GLN/ARG	1,3779		0,1,1889	80.0	76.0	78.0		3887	-4.1	0.3	12		78	0,8246		0,0,4123	no	missense	OTOGL	NM_173591.3	43	0,1,6012	AA,AG,GG		0.0,0.0265,0.0083		1296/2345	80714313	1,12025	1890	4123	6013	SO:0001583	missense	283310	exon33			TTCATCGGAGAGC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3887G>A	12.37:g.80714313G>A	ENSP00000447211:p.Arg1296Gln	127.0	0.0	0		93.0	9.0	0.0967742	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	G	5.435	0.265401	0.10294	2.65E-4	0.0	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15718	2.4;2.4	5.53	-4.09	0.03951	.	.	.	.	.	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.42396	-0.9454	7	0.07175	T	0.84	.	6.9939	0.24772	0.5056:0.0:0.3838:0.1106	.	.	.	.	Q	1296	ENSP00000447211:R1296Q;ENSP00000400895:R1296Q	ENSP00000400895:R1296Q	R	+	2	0	OTOGL	79238444	0.029000	0.19370	0.264000	0.24511	0.877000	0.50540	0.314000	0.19432	-0.957000	0.03627	-0.755000	0.03482	CGG	.	.	weak		0.433	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
