#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf71	118461	hgsc.bcm.edu	37	10	50534484	50534486	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:50534484_50534486delCTT	ENST00000374144.3	+	3	4182_4184	c.3894_3896delCTT	c.(3892-3897)accttc>acc	p.F1299del	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1299										endometrium(1)	1						AAATCAAGACCTTCTATGACCCA	0.64																																					p.1298_1299del		Pindel,Atlas-Indel	.											.	C10orf71	179	.	0			c.3893_3895del						PASS	.																																			SO:0001651	inframe_deletion	118461	exon3			.	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3894_3896delCTT	10.37:g.50534484_50534486delCTT	ENSP00000363259:p.Phe1299del	0.0	0.0	.		19.0	19.0	1.000	NM_001135196	A0AVL8	In_Frame_Del	DEL	ENST00000374144.3	37	CCDS44387.1																																																																																			.	.	none		0.640	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
STAT3	6774	hgsc.bcm.edu	37	17	40475061	40475063	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:40475061_40475063delCTT	ENST00000264657.5	-	20	2159_2161	c.1847_1849delAAG	c.(1846-1851)gaagga>gga	p.E616del	STAT3_ENST00000588969.1_In_Frame_Del_p.E616del|STAT3_ENST00000389272.3_In_Frame_Del_p.E518del|STAT3_ENST00000404395.3_In_Frame_Del_p.E616del|STAT3_ENST00000585517.1_In_Frame_Del_p.E616del	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	616	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GTGACGCCTCCTTCTTTGCTGCT	0.562									Hyperimmunoglobulin E Recurrent Infection Syndrome		OREG0024421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.616_617del		Pindel,Atlas-Indel	.											.	STAT3	268	.	0			c.1848_1850del						PASS	.																																			SO:0001651	inframe_deletion	6774	exon20	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	.	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1847_1849delAAG	17.37:g.40475064_40475066delCTT	ENSP00000264657:p.Glu616del	0.0	0.0	.	893	16.0	16.0	1.000	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	In_Frame_Del	DEL	ENST00000264657.5	37	CCDS32656.1																																																																																			.	.	none		0.562	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	In_Frame_Ins	INS	-	-	TGGCAGCAGCTGGGG	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:39305774_39305775insTGGCAGCAGCTGGGG	ENST00000343246.4	-	1	279_280	c.245_246insCCCCAGCTGCTGCCA	c.(244-246)cag>caCCCCAGCTGCTGCCAg	p.81_82insHPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82delinsHPSCCQ		Atlas-Indel	.											KRTAP4-5,NS,carcinoma,0,1	KRTAP4-5	34	1	1	Substitution - Missense(1)	lung(1)	c.246_247insCCCCAGCTGCTGCCA						PASS	.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246insCCCCAGCTGCTGCCA	17.37:g.39305774_39305775insTGGCAGCAGCTGGGG	ENSP00000340546:p.Cys81_Gln82insHisProSerCysCys	46.0	0.0	0		45.0	25.0	0.555556	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	37	CCDS32650.1																																																																																			.	.	none		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
DMKN	93099	hgsc.bcm.edu	37	19	36002421	36002422	+	In_Frame_Ins	INS	-	-	CTGCTGCTG	rs72334573	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:36002421_36002422insCTGCTGCTG	ENST00000339686.3	-	5	985_986	c.809_810insCAGCAGCAG	c.(808-810)ggt>ggCAGCAGCAGt	p.270_271insSSS	DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000418261.1_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000451297.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000440396.1_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000447113.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000424570.2_In_Frame_Ins_p.270_271insSSS|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000443640.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	270	Gly-rich.			Missing (in Ref. 3; ABN11273/ABN11274). {ECO:0000305}.		extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			tgctgctgccaccactgctgct	0.653																																					p.G270delinsGSSS		Atlas-Indel	.											DMKN,colon,carcinoma,0,1	DMKN	116	1	0			c.810_811insCAGCAGCAG						PASS	.																																			SO:0001652	inframe_insertion	93099	exon5			.	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.809_810insCAGCAGCAG	19.37:g.36002421_36002422insCTGCTGCTG	ENSP00000342012:p.Gly270_Gly271insSerSerSer	51.0	0.0	0		47.0	14.0	0.297872	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	In_Frame_Ins	INS	ENST00000339686.3	37	CCDS12463.1																																																																																			.	.	alt		0.653	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
B2M	567	hgsc.bcm.edu	37	15	45007714	45007714	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:45007714A>T	ENST00000558401.1	+	2	231	c.161A>T	c.(160-162)gAc>gTc	p.D54V	B2M_ENST00000544417.1_Missense_Mutation_p.D54V|B2M_ENST00000559220.1_Intron|B2M_ENST00000559916.1_Missense_Mutation_p.D54V	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	54	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CATCCATCCGACATTGAAGTT	0.413																																					p.D54V		Atlas-SNP	.											B2M,bladder,carcinoma,+1,1	B2M	99	1	0			c.A161T						scavenged	.						183.0	188.0	186.0					15																	45007714		2198	4298	6496	SO:0001583	missense	567	exon2			CATCCGACATTGA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.161A>T	15.37:g.45007714A>T	ENSP00000452780:p.Asp54Val	106.0	1.0	0.00943396		67.0	35.0	0.522388	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124893	0.77436	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.03212	4.01	6.03	6.03	0.97812	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.936939	0.09208	N	0.833609	T	0.08891	0.0220	N	0.20328	0.56	0.20307	N	0.999913	P;P;P	0.50369	0.821;0.781;0.934	P;P;P	0.58331	0.6;0.721;0.837	T	0.49234	-0.8961	10	0.87932	D	0	.	12.95	0.58394	1.0:0.0:0.0:0.0	.	54;54;54	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	V	54	ENSP00000437604:D54V	ENSP00000340858:D54V	D	+	2	0	B2M	42795006	0.302000	0.24454	0.009000	0.14445	0.002000	0.02628	5.095000	0.64529	2.308000	0.77769	0.533000	0.62120	GAC	.	.	none		0.413	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
PDHA2	5161	hgsc.bcm.edu	37	4	96761963	96761963	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:96761963A>G	ENST00000295266.4	+	1	725	c.662A>G	c.(661-663)gAg>gGg	p.E221G		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	221					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TTCATCTGTGAGAATAACCTA	0.453																																					p.E221G		Atlas-SNP	.											.	PDHA2	118	.	0			c.A662G						PASS	.						80.0	83.0	82.0					4																	96761963		2203	4300	6503	SO:0001583	missense	5161	exon1			TCTGTGAGAATAA		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.662A>G	4.37:g.96761963A>G	ENSP00000295266:p.Glu221Gly	69.0	0.0	0		47.0	19.0	0.404255	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	37	CCDS3644.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145730	0.77888	.	.	ENSG00000163114	ENST00000295266	D	0.96522	-4.04	4.7	4.7	0.59300	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98794	1.0737	10	0.87932	D	0	-26.8347	12.4398	0.55619	1.0:0.0:0.0:0.0	.	221	P29803	ODPAT_HUMAN	G	221	ENSP00000295266:E221G	ENSP00000295266:E221G	E	+	2	0	PDHA2	96980986	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.369000	0.90118	2.103000	0.63969	0.383000	0.25322	GAG	.	.	none		0.453	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
NTM	50863	hgsc.bcm.edu	37	11	132016345	132016345	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:132016345T>A	ENST00000374786.1	+	2	816	c.337T>A	c.(337-339)Tac>Aac	p.Y113N	NTM_ENST00000374791.3_Missense_Mutation_p.Y113N|NTM_ENST00000427481.2_Missense_Mutation_p.Y104N|NTM_ENST00000374784.1_Missense_Mutation_p.Y113N|NTM_ENST00000425719.2_Missense_Mutation_p.Y113N|NTM_ENST00000539799.1_Missense_Mutation_p.Y113N	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	113	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CGAGGGCCCTTACACCTGCTC	0.587																																					p.Y113N		Atlas-SNP	.											.	NTM	253	.	0			c.T337A						PASS	.						162.0	112.0	129.0					11																	132016345		2201	4297	6498	SO:0001583	missense	50863	exon2			GGCCCTTACACCT	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.337T>A	11.37:g.132016345T>A	ENSP00000363918:p.Tyr113Asn	110.0	0.0	0		116.0	41.0	0.353448	NM_001144059	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.301473	0.81136	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.58	5.58	0.84498	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.305913	0.36268	N	0.002692	D	0.90191	0.6934	H	0.96633	3.855	0.52501	D	0.999958	D;D;D;D;D;D	0.89917	1.0;0.997;1.0;0.997;0.999;1.0	D;D;D;D;D;D	0.85130	0.997;0.993;0.995;0.997;0.982;0.995	D	0.92723	0.6193	10	0.87932	D	0	-20.7387	12.0456	0.53477	0.1289:0.0:0.0:0.8711	.	113;104;113;113;113;113	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	N	113;113;104;104;113;113;113	ENSP00000363923:Y113N;ENSP00000437668:Y113N;ENSP00000448104:Y104N;ENSP00000416320:Y104N;ENSP00000363918:Y113N;ENSP00000396722:Y113N;ENSP00000363916:Y113N	ENSP00000363916:Y113N	Y	+	1	0	NTM	131521555	1.000000	0.71417	0.916000	0.36221	0.950000	0.60333	8.026000	0.88783	2.126000	0.65437	0.533000	0.62120	TAC	.	.	none		0.587	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
SBSPON	157869	hgsc.bcm.edu	37	8	73993379	73993379	+	Missense_Mutation	SNP	C	C	T	rs34728970		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:73993379C>T	ENST00000297354.6	-	2	488	c.284G>A	c.(283-285)cGt>cAt	p.R95H	RP11-956J14.1_ENST00000442274.1_RNA|SBSPON_ENST00000519697.1_5'UTR	NM_153225.3	NP_694957.3	Q8IVN8	SBSPO_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	95	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				immune response (GO:0006955)	proteinaceous extracellular matrix (GO:0005578)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)										CCTCCGCACACGGGTTGTAGG	0.652																																					p.R95H		Atlas-SNP	.											C8orf84,NS,carcinoma,-1,1	.	.	1	0			c.G284A						scavenged	.						65.0	72.0	70.0					8																	73993379		2021	4174	6195	SO:0001583	missense	157869	exon2			CGCACACGGGTTG		CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764			30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84		12107410	Standard	NM_153225		Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.284G>A	8.37:g.73993379C>T	ENSP00000297354:p.Arg95His	151.0	1.0	0.00662252		170.0	59.0	0.347059	NM_153225	A8KAA5|Q96J64	Missense_Mutation	SNP	ENST00000297354.6	37	CCDS43747.2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888198	0.91814	.	.	ENSG00000164764	ENST00000297354	T	0.21191	2.02	5.29	4.4	0.53042	.	0.118037	0.56097	D	0.000031	T	0.44117	0.1278	M	0.80982	2.52	0.80722	D	1	D	0.67145	0.996	P	0.58077	0.832	T	0.52026	-0.8630	10	0.66056	D	0.02	-5.0986	15.3079	0.74008	0.1412:0.8588:0.0:0.0	.	95	Q8IVN8	RPESP_HUMAN	H	95	ENSP00000297354:R95H	ENSP00000297354:R95H	R	-	2	0	C8orf84	74155933	1.000000	0.71417	0.971000	0.41717	0.926000	0.56050	5.388000	0.66249	1.204000	0.43247	0.591000	0.81541	CGT	.	.	none		0.652	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347584.2	NM_153225	
TSPAN31	6302	hgsc.bcm.edu	37	12	58140844	58140844	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:58140844A>C	ENST00000257910.3	+	5	762	c.488A>C	c.(487-489)aAg>aCg	p.K163T	TSPAN31_ENST00000547472.1_Missense_Mutation_p.K80T|TSPAN31_ENST00000547992.1_Missense_Mutation_p.K79T|TSPAN31_ENST00000553221.1_3'UTR|CDK4_ENST00000551888.1_5'Flank	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	163					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TGTGGAGAAAAGTTTCTTAAG	0.438																																					p.K163T		Atlas-SNP	.											.	TSPAN31	20	.	0			c.A488C						PASS	.						128.0	133.0	131.0					12																	58140844		2203	4300	6503	SO:0001583	missense	6302	exon5			GAGAAAAGTTTCT		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.488A>C	12.37:g.58140844A>C	ENSP00000257910:p.Lys163Thr	130.0	0.0	0		164.0	64.0	0.390244	NM_005981	O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296104	0.40594	.	.	ENSG00000135452	ENST00000257910;ENST00000547992;ENST00000547472;ENST00000548167	T;T	0.80566	-1.39;-1.39	5.03	2.65	0.31530	.	0.157358	0.53938	N	0.000054	T	0.72326	0.3446	M	0.73962	2.25	0.46028	D	0.99882	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.58244	-0.7670	10	0.13853	T	0.58	-5.5034	3.0344	0.06117	0.6323:0.1468:0.0797:0.1412	.	79;163	F8VS78;Q12999	.;TSN31_HUMAN	T	163;79;80;85	ENSP00000257910:K163T;ENSP00000449199:K80T	ENSP00000257910:K163T	K	+	2	0	TSPAN31	56427111	0.931000	0.31567	0.895000	0.35142	0.995000	0.86356	1.087000	0.30865	0.483000	0.27608	0.459000	0.35465	AAG	.	.	none		0.438	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		
DNAH17	8632	hgsc.bcm.edu	37	17	76567366	76567366	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr17:76567366G>A	ENST00000585328.1	-	5	951	c.827C>T	c.(826-828)aCt>aTt	p.T276I	DNAH17_ENST00000389840.5_Missense_Mutation_p.T276I	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	276	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CTCACCTTCAGTGACGTTGGT	0.517																																					p.T276I		Atlas-SNP	.											.	DNAH17	347	.	0			c.C827T						PASS	.						80.0	82.0	82.0					17																	76567366		2151	4244	6395	SO:0001583	missense	8632	exon5			CCTTCAGTGACGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.827C>T	17.37:g.76567366G>A	ENSP00000465516:p.Thr276Ile	127.0	0.0	0		157.0	64.0	0.407643	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	10.10	1.258295	0.23051	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.57107	0.42	4.31	2.14	0.27477	.	.	.	.	.	T	0.38746	0.1052	N	0.24115	0.695	0.23371	N	0.997811	.	.	.	.	.	.	T	0.21621	-1.0240	7	0.35671	T	0.21	.	6.7434	0.23449	0.0:0.3411:0.4984:0.1605	.	.	.	.	I	276	ENSP00000374490:T276I	ENSP00000300671:T276I	T	-	2	0	DNAH17	74078961	0.326000	0.24669	0.376000	0.26042	0.015000	0.08874	0.724000	0.25954	2.115000	0.64714	0.561000	0.74099	ACT	.	.	none		0.517	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
IRF8	3394	hgsc.bcm.edu	37	16	85936784	85936784	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:85936784T>G	ENST00000268638.5	+	2	585	c.163T>G	c.(163-165)Tcc>Gcc	p.S55A	IRF8_ENST00000563180.1_Missense_Mutation_p.S55A	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	55					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.S55A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				AGTGGATGCCTCCATTTTTAA	0.483																																					p.S55A		Atlas-SNP	.											IRF8,lymph_node,lymphoid_neoplasm,0,1	IRF8	65	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T163G						PASS	.						74.0	70.0	71.0					16																	85936784		2198	4300	6498	SO:0001583	missense	3394	exon2			GATGCCTCCATTT	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.163T>G	16.37:g.85936784T>G	ENSP00000268638:p.Ser55Ala	75.0	0.0	0		88.0	69.0	0.784091	NM_002163	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	.	.	.	.	.	.	.	.	.	.	T	4.129	0.022168	0.08006	.	.	ENSG00000140968	ENST00000268638	D	0.97598	-4.45	5.58	5.58	0.84498	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.112568	0.64402	D	0.000006	D	0.89378	0.6698	N	0.00738	-1.235	0.80722	D	1	B;B	0.30973	0.302;0.041	B;B	0.43728	0.429;0.023	D	0.87510	0.2439	10	0.02654	T	1	-37.9646	11.4255	0.50007	0.0:0.0:0.1508:0.8491	.	55;55	B2R8V7;Q02556	.;IRF8_HUMAN	A	55	ENSP00000268638:S55A	ENSP00000268638:S55A	S	+	1	0	IRF8	84494285	1.000000	0.71417	0.997000	0.53966	0.596000	0.36781	3.823000	0.55715	2.122000	0.65172	0.454000	0.30748	TCC	.	.	none		0.483	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163	
EFHD1	80303	hgsc.bcm.edu	37	2	233546429	233546429	+	Nonstop_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:233546429G>T	ENST00000264059.3	+	4	1197	c.720G>T	c.(718-720)taG>taT	p.*240Y	EFHD1_ENST00000410095.1_Nonstop_Mutation_p.*128Y|EFHD1_ENST00000409708.1_Nonstop_Mutation_p.*128Y|EFHD1_ENST00000409613.1_Nonstop_Mutation_p.*144Y|snoU13_ENST00000459149.1_RNA	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	0					neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		TCAATACATAGTCCTGCTGAC	0.582																																					p.X240Y		Atlas-SNP	.											.	EFHD1	28	.	0			c.G720T						PASS	.						71.0	61.0	64.0					2																	233546429		2203	4300	6503	SO:0001578	stop_lost	80303	exon4			TACATAGTCCTGC		CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.720G>T	2.37:g.233546429G>T	ENSP00000264059:p.*240Tyrext*3	42.0	0.0	0		45.0	13.0	0.288889	NM_025202	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	ENST00000264059.3	37	CCDS2497.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.899836	0.72754	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187;ENST00000409708;ENST00000410095	.	.	.	5.59	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0595	0.25117	0.0907:0.1752:0.7341:0.0	.	.	.	.	Y	144;240;143;128;128	.	.	X	+	3	2	EFHD1	233254673	0.965000	0.33210	0.119000	0.21687	0.759000	0.43091	2.287000	0.43505	1.345000	0.45676	0.591000	0.81541	TAG	.	.	none		0.582	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2	NM_025202	
OR10C1	442194	hgsc.bcm.edu	37	6	29407999	29407999	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29407999G>C	ENST00000444197.2	+	1	917	c.207G>C	c.(205-207)gaG>gaC	p.E69D	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGGCCTTGGAGATTGGCTATA	0.572																																					p.E69D		Atlas-SNP	.											.	OR10C1	58	.	0			c.G207C						PASS	.						176.0	154.0	161.0					6																	29407999		1511	2708	4219	SO:0001583	missense	442194	exon1			CTTGGAGATTGGC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.207G>C	6.37:g.29407999G>C	ENSP00000419119:p.Glu69Asp	58.0	0.0	0		74.0	28.0	0.378378	NM_013941	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	G	3.194	-0.165267	0.06461	.	.	ENSG00000206474	ENST00000444197	T	0.00008	9.61	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001313	T	0.00012	0.0000	N	0.21240	0.645	0.22975	N	0.998488	B	0.18461	0.028	B	0.24394	0.053	T	0.49835	-0.8897	10	0.15499	T	0.54	.	2.6706	0.05066	0.1058:0.1827:0.5232:0.1884	.	69	Q96KK4	O10C1_HUMAN	D	69	ENSP00000419119:E69D	ENSP00000419119:E69D	E	+	3	2	OR10C1	29515978	0.000000	0.05858	0.633000	0.29310	0.011000	0.07611	-0.801000	0.04550	2.008000	0.58898	0.430000	0.28490	GAG	.	.	none		0.572	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
CDKL5	6792	hgsc.bcm.edu	37	X	18671625	18671625	+	Silent	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:18671625C>G	ENST00000379989.3	+	22	3339	c.3054C>G	c.(3052-3054)ctC>ctG	p.L1018L	RS1_ENST00000379984.3_Intron|CDKL5_ENST00000379996.3_Silent_p.L1018L|RS1_ENST00000476595.1_5'Flank	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	1018					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					AAGCTGCGCTCCTGACATACC	0.547																																					p.L1018L		Atlas-SNP	.											.	CDKL5	124	.	0			c.C3054G						PASS	.						70.0	52.0	58.0					X																	18671625		2203	4300	6503	SO:0001819	synonymous_variant	6792	exon21			TGCGCTCCTGACA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.3054C>G	X.37:g.18671625C>G		44.0	0.0	0		46.0	13.0	0.282609	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	37	CCDS14186.1																																																																																			.	.	none		0.547	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
MOS	4342	hgsc.bcm.edu	37	8	57026520	57026520	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:57026520G>A	ENST00000311923.1	-	1	21	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	8					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGGTAGGGGCGTAGGGCCAGG	0.642																																					p.R8C	Esophageal Squamous(124;373 2870 4778)	Atlas-SNP	.											.	MOS	63	.	0			c.C22T						PASS	.						14.0	17.0	16.0					8																	57026520		2187	4271	6458	SO:0001583	missense	4342	exon1			AGGGGCGTAGGGC		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.22C>T	8.37:g.57026520G>A	ENSP00000310722:p.Arg8Cys	144.0	0.0	0		112.0	33.0	0.294643	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763732	0.31228	.	.	ENSG00000172680	ENST00000311923	D	0.81739	-1.53	5.14	0.608	0.17569	.	0.727768	0.12172	N	0.492935	T	0.53254	0.1785	N	0.03115	-0.41	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46219	-0.9207	10	0.62326	D	0.03	.	0.6283	0.00789	0.1882:0.23:0.3053:0.2765	.	8	P00540	MOS_HUMAN	C	8	ENSP00000310722:R8C	ENSP00000310722:R8C	R	-	1	0	MOS	57189074	0.028000	0.19301	0.000000	0.03702	0.008000	0.06430	2.093000	0.41710	0.541000	0.28827	0.557000	0.71058	CGC	.	.	none		0.642	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
TMEM178B	100507421	hgsc.bcm.edu	37	7	141137460	141137460	+	Silent	SNP	C	C	T	rs13233459	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:141137460C>T	ENST00000565468.1	+	3	628	c.549C>T	c.(547-549)ctC>ctT	p.L183L		NM_001195278.1	NP_001182207.1	H3BS89	T178B_HUMAN	transmembrane protein 178B	183						integral component of membrane (GO:0016021)											CCATCATCCTCTTTGGCTGGA	0.622													C|||	958	0.191294	0.0265	0.3329	5008	,	,		20026	0.0972		0.4543	False		,,,				2504	0.1401				p.L183L		Atlas-SNP	.											.	.	.	.	0			c.C549T						PASS	.																																			SO:0001819	synonymous_variant	100507421	exon3			CATCCTCTTTGGC		CCDS59086.1	7q34	2012-06-29			ENSG00000261115	ENSG00000261115			44112	protein-coding gene	gene with protein product							Standard	NM_001195278		Approved	DKFZp547G036	uc003vwg.2	H3BS89	OTTHUMG00000172737	ENST00000565468.1:c.549C>T	7.37:g.141137460C>T		0.0	0.0	.		4.0	4.0	1	NM_001195278		Silent	SNP	ENST00000565468.1	37	CCDS59086.1																																																																																			C|0.785;T|0.215	0.215	strong		0.622	TMEM178B-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420337.4		
CTGF	1490	hgsc.bcm.edu	37	6	132271952	132271952	+	Missense_Mutation	SNP	G	G	C	rs7451102		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:132271952G>C	ENST00000367976.3	-	2	447	c.247C>G	c.(247-249)Cac>Gac	p.H83D	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	83	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.		H -> D (in dbSNP:rs7451102). {ECO:0000269|PubMed:1293144, ECO:0000269|PubMed:1654338, ECO:0000269|PubMed:9054739, ECO:0000269|Ref.12, ECO:0000269|Ref.4, ECO:0000269|Ref.5, ECO:0000269|Ref.6, ECO:0000269|Ref.7}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		GAGCCGAAGTGACAGAATAGG	0.711													C|||	5007	0.9998	1.0	1.0	5008	,	,		8487	1.0		0.999	False		,,,				2504	1.0				p.H83D	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.C247G						PASS	.						7.0	8.0	7.0					6																	132271952		2119	4187	6306	SO:0001583	missense	1490	exon2			CGAAGTGACAGAA	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.247C>G	6.37:g.132271952G>C	ENSP00000356954:p.His83Asp	0.0	0.0	.		6.0	6.0	1	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	ENST00000367976.3	37	CCDS5151.1	2184	1.0	492	1.0	362	1.0	572	1.0	758	1.0	C	8.018	0.758919	0.15846	.	.	ENSG00000118523	ENST00000367976	T	0.62232	0.04	5.28	5.28	0.74379	Insulin-like growth factor-binding protein, IGFBP (2);	0.048665	0.85682	N	0.000000	T	0.06781	0.0173	N	0.00042	-2.475	0.40675	P	0.017750000000000044	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.02654	T	1	.	15.7931	0.78384	0.0:0.863:0.137:0.0	rs7451102;rs59294435	83	P29279	CTGF_HUMAN	D	83	ENSP00000356954:H83D	ENSP00000356954:H83D	H	-	1	0	CTGF	132313645	1.000000	0.71417	0.923000	0.36655	0.645000	0.38454	4.000000	0.57039	1.236000	0.43740	-0.293000	0.09583	CAC	G|0.000;C|1.000	1.000	strong		0.711	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
EPHX2	2053	hgsc.bcm.edu	37	8	27382956	27382956	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:27382956C>T	ENST00000521400.1	+	12	1566	c.1136C>T	c.(1135-1137)cCa>cTa	p.P379L	EPHX2_ENST00000521780.1_Missense_Mutation_p.P313L|EPHX2_ENST00000517536.1_Missense_Mutation_p.P196L|EPHX2_ENST00000380476.3_Missense_Mutation_p.P326L|EPHX2_ENST00000518379.1_Missense_Mutation_p.P347L	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	379	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		AAAGCCAACCCAGTATTTGAT	0.478																																					p.P379L		Atlas-SNP	.											EPHX2,NS,carcinoma,-1,1	EPHX2	57	1	0			c.C1136T						PASS	.						161.0	143.0	149.0					8																	27382956		2203	4300	6503	SO:0001583	missense	2053	exon12			CCAACCCAGTATT	L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.1136C>T	8.37:g.27382956C>T	ENSP00000430269:p.Pro379Leu	115.0	0.0	0		154.0	55.0	0.357143	NM_001979	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	ENST00000521400.1	37	CCDS6060.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470626	0.63625	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93	5.24	4.35	0.52113	Alpha/beta hydrolase fold-1 (1);	2.166600	0.01505	N	0.017652	T	0.21347	0.0514	M	0.81802	2.56	0.49582	D	0.999806	D;D;D	0.89917	0.993;0.998;1.0	D;D;D	0.74023	0.978;0.944;0.982	T	0.02868	-1.1100	10	0.24483	T	0.36	-1.3552	12.0912	0.53728	0.0:0.9128:0.0:0.0872	.	347;379;379	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	L	379;196;313;326;326;347	ENSP00000430269:P379L;ENSP00000428875:P196L;ENSP00000430302:P313L;ENSP00000369843:P326L;ENSP00000427956:P347L	ENSP00000369843:P326L	P	+	2	0	EPHX2	27438873	0.977000	0.34250	0.428000	0.26697	0.035000	0.12851	3.791000	0.55469	2.421000	0.82119	0.563000	0.77884	CCA	.	.	none		0.478	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219954.4		
B2M	567	hgsc.bcm.edu	37	15	45007809	45007809	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:45007809T>G	ENST00000558401.1	+	2	326	c.256T>G	c.(256-258)Tac>Gac	p.Y86D	B2M_ENST00000544417.1_Missense_Mutation_p.Y86D|B2M_ENST00000559220.1_Intron|B2M_ENST00000559916.1_Missense_Mutation_p.Y86D	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	86	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.Y86N(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CTATCTCTTGTACTACACTGA	0.423																																					p.Y86D		Atlas-SNP	.											B2M,NS,lymphoid_neoplasm,-2,2	B2M	99	2	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T256G						scavenged	.						172.0	169.0	170.0					15																	45007809		2198	4298	6496	SO:0001583	missense	567	exon2			CTCTTGTACTACA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.256T>G	15.37:g.45007809T>G	ENSP00000452780:p.Tyr86Asp	147.0	1.0	0.00680272		98.0	56.0	0.571429	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880536	0.51801	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.02709	4.19	6.03	0.942	0.19525	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.726338	0.14242	N	0.332034	T	0.02970	0.0088	N	0.08118	0	0.09310	N	0.999997	P;P	0.51537	0.946;0.57	P;P	0.56042	0.79;0.708	T	0.45920	-0.9228	10	0.59425	D	0.04	.	4.1475	0.10222	0.222:0.0:0.486:0.292	.	86;86	F5H6I0;P61769	.;B2MG_HUMAN	D	86	ENSP00000437604:Y86D	ENSP00000340858:Y86D	Y	+	1	0	B2M	42795101	0.992000	0.36948	0.077000	0.20336	0.001000	0.01503	2.183000	0.42565	-0.061000	0.13110	-1.392000	0.01152	TAC	.	.	none		0.423	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
KALRN	8997	hgsc.bcm.edu	37	3	124175525	124175525	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:124175525C>T	ENST00000240874.3	+	23	3955	c.3798C>T	c.(3796-3798)gaC>gaT	p.D1266D	KALRN_ENST00000460856.1_Silent_p.D1257D|KALRN_ENST00000360013.3_Silent_p.D1266D	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1266					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AGCTGCGGGACGCCAACCACG	0.557																																					p.D1266D		Atlas-SNP	.											.	KALRN	556	.	0			c.C3798T						PASS	.						105.0	100.0	102.0					3																	124175525		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon23			GCGGGACGCCAAC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3798C>T	3.37:g.124175525C>T		174.0	0.0	0		174.0	51.0	0.293103	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	C	9.785	1.176432	0.21704	.	.	ENSG00000160145	ENST00000354186	.	.	.	4.88	-9.12	0.00707	.	.	.	.	.	T	0.59972	0.2233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68401	-0.5418	4	.	.	.	.	15.3034	0.73972	0.0:0.5754:0.0:0.4246	.	.	.	.	M	1235	.	.	T	+	2	0	KALRN	125658215	0.014000	0.17966	0.808000	0.32385	0.960000	0.62799	-0.945000	0.03909	-1.767000	0.01300	-0.966000	0.02617	ACG	.	.	none		0.557	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
PPP2CA	5515	hgsc.bcm.edu	37	5	133561476	133561476	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:133561476G>A	ENST00000481195.1	-	1	357	c.77C>T	c.(76-78)tCc>tTc	p.S26F	CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000609654.1_Intron|CDKL3_ENST00000609383.1_Intron|CTD-2410N18.3_ENST00000602919.1_lincRNA|MIR3661_ENST00000577394.1_RNA|PPP2CA_ENST00000231504.5_5'UTR|CTD-2410N18.5_ENST00000519718.1_Missense_Mutation_p.S26F	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	26					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	CTTGACCTGGGACTCGGACAG	0.662																																					p.S26F		Atlas-SNP	.											.	PPP2CA	29	.	0			c.C77T						PASS	.						76.0	68.0	71.0					5																	133561476		2203	4300	6503	SO:0001583	missense	5515	exon1			ACCTGGGACTCGG		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.77C>T	5.37:g.133561476G>A	ENSP00000418447:p.Ser26Phe	15.0	0.0	0		37.0	17.0	0.459459	NM_002715	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	37	CCDS4173.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453473	0.63290	.	.	ENSG00000113558;ENSG00000113575	ENST00000519718;ENST00000481195	T;T	0.46819	0.86;0.95	5.1	5.1	0.69264	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.390870	0.24755	N	0.035880	T	0.47967	0.1474	M	0.79011	2.435	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	T	0.52704	-0.8540	10	0.72032	D	0.01	-1.9595	8.9806	0.35964	0.0:0.205:0.6547:0.1403	.	26	P67775	PP2AA_HUMAN	F	26	ENSP00000430774:S26F;ENSP00000418447:S26F	ENSP00000418447:S26F	S	-	2	0	PPP2CA;SKP1	133589375	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.051000	0.49885	2.653000	0.90120	0.655000	0.94253	TCC	.	.	none		0.662	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715	
MEGF9	1955	hgsc.bcm.edu	37	9	123367753	123367753	+	Silent	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:123367753T>C	ENST00000373930.3	-	6	1635	c.1524A>G	c.(1522-1524)gtA>gtG	p.V508V	MEGF9_ENST00000426959.1_Silent_p.V545V	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	508						integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						GGGTCCATGATACATCAGCTA	0.423																																					p.V508V		Atlas-SNP	.											.	MEGF9	33	.	0			c.A1524G						PASS	.						95.0	90.0	92.0					9																	123367753		1927	4140	6067	SO:0001819	synonymous_variant	1955	exon6			CCATGATACATCA	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.1524A>G	9.37:g.123367753T>C		205.0	0.0	0		202.0	74.0	0.366337	NM_001080497	B7Z315|O75098	Silent	SNP	ENST00000373930.3	37	CCDS48010.2																																																																																			.	.	none		0.423	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
CDH2	1000	hgsc.bcm.edu	37	18	25583075	25583075	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr18:25583075C>T	ENST00000269141.3	-	7	1329	c.906G>A	c.(904-906)ggG>ggA	p.G302G	CDH2_ENST00000399380.3_Silent_p.G271G	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	302	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ACCTCAACATCCCATTGAGGG	0.458																																					p.G302G		Atlas-SNP	.											CDH2,right_upper_lobe,carcinoma,-1,2	CDH2	194	2	0			c.G906A						scavenged	.						235.0	171.0	193.0					18																	25583075		2203	4300	6503	SO:0001819	synonymous_variant	1000	exon7			CAACATCCCATTG	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.906G>A	18.37:g.25583075C>T		148.0	1.0	0.00675676		107.0	41.0	0.383178	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	ENST00000269141.3	37	CCDS11891.1																																																																																			.	.	none		0.458	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
HLA-A	3105	hgsc.bcm.edu	37	6	29910609	29910609	+	Missense_Mutation	SNP	G	G	T	rs199474372		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:29910609G>T	ENST00000396634.1	+	4	490	c.149G>T	c.(148-150)gGc>gTc	p.G50V	HLA-A_ENST00000376809.5_Missense_Mutation_p.G50V|HLA-A_ENST00000376802.2_Missense_Mutation_p.G50V|HLA-A_ENST00000376806.5_Missense_Mutation_p.G50V			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	50	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ATCGCCGTGGGCTACGTGGAC	0.687									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.G50V		Atlas-SNP	.											.	HLA-A	89	.	0			c.G149T						PASS	.						38.0	33.0	35.0					6																	29910609		2202	4299	6501	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	CCGTGGGCTACGT	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.149G>T	6.37:g.29910609G>T	ENSP00000379873:p.Gly50Val	174.0	0.0	0		200.0	107.0	0.535	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	15.22	2.768304	0.49680	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.01438	4.89;4.89;4.89;4.89	3.72	3.72	0.42706	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.000000	0.34110	U	0.004248	T	0.12817	0.0311	H	0.99859	4.855	0.48975	D	0.999735	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.985;1.0;0.999;1.0;0.999	T	0.14727	-1.0462	10	0.87932	D	0	.	11.3314	0.49479	0.0:0.0:1.0:0.0	.	50;50;50;50;50	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	V	50	ENSP00000379873:G50V;ENSP00000366002:G50V;ENSP00000366005:G50V;ENSP00000365998:G50V	ENSP00000348012:G50V	G	+	2	0	HLA-A	30018588	0.997000	0.39634	0.992000	0.48379	0.629000	0.37895	2.884000	0.48562	2.112000	0.64535	0.478000	0.44815	GGC	.	.	alt		0.687	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
CIDEB	27141	hgsc.bcm.edu	37	14	24775219	24775219	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr14:24775219G>A	ENST00000336557.5	-	7	1763	c.461C>T	c.(460-462)gCc>gTc	p.A154V	LTB4R2_ENST00000528054.1_5'Flank|CIDEB_ENST00000258807.5_Missense_Mutation_p.A154V|NOP9_ENST00000267425.3_3'UTR|CIDEB_ENST00000554411.1_Missense_Mutation_p.A154V			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	154					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		GTAGAATGTGGCTTTGACATT	0.512																																					p.A154V		Atlas-SNP	.											.	CIDEB	17	.	0			c.C461T						PASS	.						160.0	146.0	151.0					14																	24775219		2203	4300	6503	SO:0001583	missense	27141	exon6			AATGTGGCTTTGA	AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.461C>T	14.37:g.24775219G>A	ENSP00000337731:p.Ala154Val	60.0	0.0	0		65.0	23.0	0.353846	NM_014430	D3DS73|Q546V8|Q9NNW9	Missense_Mutation	SNP	ENST00000336557.5	37	CCDS32056.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325029	0.95708	.	.	ENSG00000136305	ENST00000554411;ENST00000336557;ENST00000258807;ENST00000541830	D;D;D	0.84516	-1.86;-1.86;-1.86	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.93644	0.6967	10	0.87932	D	0	-23.741	17.4084	0.87480	0.0:0.0:1.0:0.0	.	154	Q9UHD4	CIDEB_HUMAN	V	154	ENSP00000451089:A154V;ENSP00000337731:A154V;ENSP00000258807:A154V	ENSP00000258807:A154V	A	-	2	0	CIDEB	23845059	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.787000	0.75099	2.654000	0.90174	0.563000	0.77884	GCC	.	.	none		0.512	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414120.1		
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E		Atlas-SNP	.											RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2	128	2	0			c.C211G						scavenged	.						6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu	17.0	1.0	0.0588235		24.0	2.0	0.0833333	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG	.	.	none		0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
RNASE4	6038	hgsc.bcm.edu	37	14	21167775	21167775	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr14:21167775G>A	ENST00000555835.1	+	2	921	c.245G>A	c.(244-246)cGt>cAt	p.R82H	AL163636.6_ENST00000553909.1_3'UTR|RNASE4_ENST00000304704.4_Missense_Mutation_p.R82H|RNASE4_ENST00000397995.2_Missense_Mutation_p.R82H|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000555597.1_Missense_Mutation_p.R82H	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	82					cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		TGGAACATTCGTAGTATCTGC	0.463																																					p.R82H	Esophageal Squamous(59;1059 1362 26290 51151)	Atlas-SNP	.											RNASE4,caecum,carcinoma,+1,2	RNASE4	18	2	0			c.G245A						PASS	.						165.0	134.0	145.0					14																	21167775		2203	4300	6503	SO:0001583	missense	6038	exon2			ACATTCGTAGTAT	U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.245G>A	14.37:g.21167775G>A	ENSP00000452245:p.Arg82His	36.0	0.0	0		34.0	8.0	0.235294	NM_002937		Missense_Mutation	SNP	ENST00000555835.1	37	CCDS9555.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021831	0.35701	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.81	-3.72	0.04411	Ribonuclease A, domain (4);	0.988640	0.08242	N	0.975881	T	0.61689	0.2367	L	0.48877	1.53	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.52193	-0.8608	10	0.56958	D	0.05	-2.1766	4.7289	0.12955	0.4995:0.0:0.2424:0.2581	.	82	P34096	RNAS4_HUMAN	H	82	ENSP00000452245:R82H;ENSP00000381081:R82H;ENSP00000451624:R82H;ENSP00000381087:R82H;ENSP00000307096:R82H;ENSP00000381085:R82H	ENSP00000307096:R82H	R	+	2	0	AL163636.2;RNASE4	20237615	0.000000	0.05858	0.001000	0.08648	0.915000	0.54546	-0.828000	0.04419	-0.537000	0.06290	-0.899000	0.02877	CGT	.	.	none		0.463	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073729.3		
MARCKSL1	65108	hgsc.bcm.edu	37	1	32800454	32800454	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:32800454T>A	ENST00000329421.7	-	2	677	c.332A>T	c.(331-333)gAg>gTg	p.E111V		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	111					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACCCCCACCCTCCTTCCGATT	0.572																																					p.E111V		Atlas-SNP	.											.	MARCKSL1	17	.	0			c.A332T						PASS	.						45.0	45.0	45.0					1																	32800454		2203	4300	6503	SO:0001583	missense	65108	exon2			CCACCCTCCTTCC	AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.332A>T	1.37:g.32800454T>A	ENSP00000362638:p.Glu111Val	42.0	0.0	0		48.0	13.0	0.270833	NM_023009	D3DPQ0|Q5TEE6|Q6NXS5	Missense_Mutation	SNP	ENST00000329421.7	37	CCDS361.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858221	0.71834	.	.	ENSG00000175130	ENST00000329421	T	0.47528	0.84	5.17	4.04	0.47022	.	0.310671	0.35805	N	0.002978	T	0.52041	0.1710	L	0.52011	1.625	0.41063	D	0.985396	D	0.53462	0.96	P	0.52386	0.697	T	0.55250	-0.8170	10	0.87932	D	0	-5.9678	11.0117	0.47667	0.0:0.0745:0.0:0.9254	.	111	P49006	MRP_HUMAN	V	111	ENSP00000362638:E111V	ENSP00000362638:E111V	E	-	2	0	MARCKSL1	32573041	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.764000	0.55264	0.923000	0.37045	0.459000	0.35465	GAG	.	.	none		0.572	MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020059.3	NM_023009	
CACNA2D4	93589	hgsc.bcm.edu	37	12	1993483	1993483	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:1993483C>T	ENST00000382722.5	-	12	1639	c.1277G>A	c.(1276-1278)cGa>cAa	p.R426Q	CACNA2D4_ENST00000588077.1_Missense_Mutation_p.R362Q|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.R426Q|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.R426Q|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.R362Q|CACNA2D4_ENST00000585732.1_Intron	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	426	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		AGTGAAAACTCGGACCTAACC	0.478																																					p.R426Q	Colon(2;101 179 21030 23310 28141)	Atlas-SNP	.											.	CACNA2D4	220	.	0			c.G1277A						PASS	.						78.0	85.0	82.0					12																	1993483		2017	4193	6210	SO:0001583	missense	93589	exon12			AAAACTCGGACCT	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1277G>A	12.37:g.1993483C>T	ENSP00000372169:p.Arg426Gln	71.0	0.0	0		78.0	28.0	0.358974	NM_172364	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	ENST00000382722.5	37	CCDS44785.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206269	0.95033	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.09163	3.01	5.27	5.27	0.74061	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.38772	0.1053	M	0.90082	3.085	0.80722	D	1	D	0.69078	0.997	P	0.59424	0.857	T	0.50118	-0.8865	10	0.87932	D	0	.	18.4934	0.90855	0.0:1.0:0.0:0.0	.	426	Q7Z3S7	CA2D4_HUMAN	Q	362;426;426	ENSP00000372169:R426Q	ENSP00000280663:R426Q	R	-	2	0	CACNA2D4	1863744	1.000000	0.71417	0.834000	0.33040	0.831000	0.47069	7.780000	0.85658	2.463000	0.83235	0.603000	0.83216	CGA	.	.	none		0.478	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2		
RASSF9	9182	hgsc.bcm.edu	37	12	86198771	86198771	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:86198771G>A	ENST00000361228.3	-	2	1385	c.1017C>T	c.(1015-1017)atC>atT	p.I339I		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	339					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCTCTTTCTGGATGCCACTCA	0.373																																					p.I339I		Atlas-SNP	.											.	RASSF9	100	.	0			c.C1017T						PASS	.						179.0	182.0	181.0					12																	86198771		1854	4089	5943	SO:0001819	synonymous_variant	9182	exon2			TTTCTGGATGCCA		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.1017C>T	12.37:g.86198771G>A		133.0	0.0	0		113.0	45.0	0.39823	NM_005447	B3KMQ4|Q8N5U8	Silent	SNP	ENST00000361228.3	37	CCDS44950.1																																																																																			.	.	none		0.373	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
ZNF709	163051	hgsc.bcm.edu	37	19	12577645	12577645	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:12577645T>C	ENST00000397732.3	-	2	194	c.23A>G	c.(22-24)gAt>gGt	p.D8G	CTD-3105H18.18_ENST00000598753.1_Missense_Mutation_p.D8G|ZNF709_ENST00000428311.1_Missense_Mutation_p.D8G	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						CACAGCCACATCCTCAAAGAC	0.473																																					p.D8G	GBM(33;565 669 12371 29134 51667)	Atlas-SNP	.											.	ZNF709	80	.	0			c.A23G						PASS	.						92.0	93.0	93.0					19																	12577645		2203	4300	6503	SO:0001583	missense	163051	exon2			GCCACATCCTCAA	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.23A>G	19.37:g.12577645T>C	ENSP00000380840:p.Asp8Gly	78.0	0.0	0		50.0	11.0	0.22	NM_152601	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525627	0.64860	.	.	ENSG00000242852;ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000455490;ENST00000428311	T;T;T	0.11930	2.73;2.73;2.73	3.09	3.09	0.35607	Krueppel-associated box (4);	0.000000	0.34828	N	0.003641	T	0.48624	0.1510	H	0.97465	4.01	0.34327	D	0.687282	D	0.89917	1.0	D	0.97110	1.0	T	0.70608	-0.4825	10	0.87932	D	0	.	9.6307	0.39778	0.0:0.0:0.0:1.0	.	8	Q8N972	ZN709_HUMAN	G	8;37;8	ENSP00000380840:D8G;ENSP00000398085:D37G;ENSP00000404127:D8G	ENSP00000404127:D8G	D	-	2	0	ZNF709;CTD-2192J16.17	12438645	0.989000	0.36119	1.000000	0.80357	0.994000	0.84299	1.442000	0.35046	1.660000	0.50760	0.402000	0.26972	GAT	.	.	none		0.473	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
HELT	391723	hgsc.bcm.edu	37	4	185941741	185941741	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:185941741G>A	ENST00000515777.1	+	4	632	c.544G>A	c.(544-546)Gcg>Acg	p.A182T	HELT_ENST00000505610.1_Missense_Mutation_p.A181T|HELT_ENST00000338875.4_Missense_Mutation_p.A267T			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	182	Pro-rich.				central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GCCGCCTGGCGCGGCCCGCAG	0.756																																					p.A267T		Atlas-SNP	.											.	HELT	34	.	0			c.G799A						PASS	.						7.0	9.0	8.0					4																	185941741		2021	4009	6030	SO:0001583	missense	391723	exon4			CCTGGCGCGGCCC	BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.544G>A	4.37:g.185941741G>A	ENSP00000426033:p.Ala182Thr	31.0	0.0	0		21.0	11.0	0.52381	NM_001029887	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	ENST00000515777.1	37		.	.	.	.	.	.	.	.	.	.	G	5.378	0.255065	0.10185	.	.	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;T	0.64260	-0.08;-0.09;1.92	4.96	1.05	0.20165	.	0.293161	0.33916	N	0.004423	T	0.31796	0.0808	N	0.12182	0.205	0.28373	N	0.919909	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.06588	-1.0818	10	0.13853	T	0.58	.	1.5726	0.02618	0.3402:0.3161:0.2239:0.1198	.	267;182;181	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	T	181;182;267	ENSP00000422140:A181T;ENSP00000426033:A182T;ENSP00000343464:A267T	ENSP00000343464:A267T	A	+	1	0	HELT	186178735	0.996000	0.38824	0.101000	0.21167	0.038000	0.13279	0.539000	0.23175	0.138000	0.18790	0.561000	0.74099	GCG	.	.	none		0.756	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000360792.1	NM_001300781	
ZC3H4	23211	hgsc.bcm.edu	37	19	47572412	47572412	+	Missense_Mutation	SNP	C	C	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:47572412C>G	ENST00000253048.5	-	14	2372	c.2335G>C	c.(2335-2337)Gag>Cag	p.E779Q	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	779							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TCCTCCTCCTCCTGCTGCTTC	0.701																																					p.E779Q		Atlas-SNP	.											ZC3H4,colon,carcinoma,0,1	ZC3H4	96	1	0			c.G2335C						scavenged	.						60.0	69.0	66.0					19																	47572412		2082	4205	6287	SO:0001583	missense	23211	exon14			CCTCCTCCTGCTG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.2335G>C	19.37:g.47572412C>G	ENSP00000253048:p.Glu779Gln	45.0	0.0	0		35.0	2.0	0.0571429	NM_015168	Q9Y420	Missense_Mutation	SNP	ENST00000253048.5	37	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.765923	0.90020	.	.	ENSG00000130749	ENST00000253048	T	0.21361	2.01	5.03	5.03	0.67393	.	0.259884	0.30043	N	0.010552	T	0.41305	0.1153	L	0.48642	1.525	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	T	0.13202	-1.0518	10	0.56958	D	0.05	.	17.2939	0.87164	0.0:1.0:0.0:0.0	.	779	Q9UPT8	ZC3H4_HUMAN	Q	779	ENSP00000253048:E779Q	ENSP00000253048:E779Q	E	-	1	0	ZC3H4	52264252	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.347000	0.59373	2.619000	0.88677	0.491000	0.48974	GAG	.	.	none		0.701	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
VPRBP	9730	hgsc.bcm.edu	37	3	51497147	51497147	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:51497147C>T	ENST00000335891.5	-	4	367	c.358G>A	c.(358-360)Gtc>Atc	p.V120I				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	120					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGAAAGACGACAGCAGTTTCC	0.373																																					p.V120I		Atlas-SNP	.											VPRBP,colon,carcinoma,+1,1	VPRBP	107	1	0			c.G358A						scavenged	.						56.0	52.0	53.0					3																	51497147		1903	4142	6045	SO:0001583	missense	9730	exon6			AGACGACAGCAGT	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.358G>A	3.37:g.51497147C>T	ENSP00000338857:p.Val120Ile	83.0	1.0	0.0120482		100.0	38.0	0.38	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	C	27.4	4.825197	0.90955	.	.	ENSG00000145041	ENST00000335891;ENST00000504652	T;T	0.57595	0.39;0.81	5.51	5.51	0.81932	Armadillo-type fold (1);	0.057232	0.64402	D	0.000002	T	0.54711	0.1875	M	0.65975	2.015	0.30565	N	0.764119	P	0.41784	0.762	B	0.38327	0.271	T	0.63506	-0.6622	10	0.51188	T	0.08	-11.4123	19.0105	0.92871	0.0:1.0:0.0:0.0	.	120	Q9Y4B6	VPRBP_HUMAN	I	120	ENSP00000338857:V120I;ENSP00000421724:V120I	ENSP00000338857:V120I	V	-	1	0	VPRBP	51472187	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.332000	0.79203	2.589000	0.87451	0.561000	0.74099	GTC	.	.	none		0.373	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
SALL4	57167	hgsc.bcm.edu	37	20	50408196	50408196	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr20:50408196T>G	ENST00000217086.4	-	2	937	c.826A>C	c.(826-828)Agc>Cgc	p.S276R	SALL4_ENST00000395997.3_Missense_Mutation_p.S276R|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	276					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTTTCTGGCTGAGCAAAGCC	0.607																																					p.S276R		Atlas-SNP	.											.	SALL4	168	.	0			c.A826C						PASS	.						53.0	44.0	47.0					20																	50408196		2203	4300	6503	SO:0001583	missense	57167	exon2			TCTGGCTGAGCAA	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.826A>C	20.37:g.50408196T>G	ENSP00000217086:p.Ser276Arg	41.0	0.0	0		29.0	8.0	0.275862	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481871	0.63849	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.70631	-0.5;-0.5	5.29	4.17	0.49024	.	0.116249	0.39759	N	0.001276	T	0.65302	0.2678	M	0.80028	2.48	0.80722	D	1	P;P	0.47302	0.893;0.744	B;B	0.39068	0.289;0.289	T	0.71199	-0.4663	10	0.87932	D	0	-37.3797	3.3042	0.06993	0.0:0.3594:0.0:0.6406	.	276;276	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	R	276	ENSP00000217086:S276R;ENSP00000379319:S276R	ENSP00000217086:S276R	S	-	1	0	SALL4	49841603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.877000	0.63086	1.996000	0.58369	0.533000	0.62120	AGC	.	.	none		0.607	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
CTSD	1509	hgsc.bcm.edu	37	11	1780809	1780809	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:1780809C>T	ENST00000236671.2	-	3	421	c.289G>A	c.(289-291)Gac>Aac	p.D97N	RP11-295K3.1_ENST00000427721.1_5'Flank|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	97					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GAGCCCGTGTCGAAGACGACT	0.657																																					p.D97N		Atlas-SNP	.											.	CTSD	26	.	0			c.G289A						PASS	.						65.0	63.0	64.0					11																	1780809		2202	4299	6501	SO:0001583	missense	1509	exon3			CCGTGTCGAAGAC	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.289G>A	11.37:g.1780809C>T	ENSP00000236671:p.Asp97Asn	29.0	0.0	0		23.0	7.0	0.304348	NM_001909	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.	.	.	.	.	.	.	.	.	.	c	29.3	4.994971	0.93167	.	.	ENSG00000117984	ENST00000236671;ENST00000438213;ENST00000367196	D;T;D	0.84944	-1.92;-1.39;-1.83	4.2	4.2	0.49525	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.052549	0.64402	D	0.000001	D	0.96027	0.8706	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98537	1.0630	10	0.87932	D	0	.	16.9432	0.86224	0.0:1.0:0.0:0.0	.	97	P07339	CATD_HUMAN	N	97;82;62	ENSP00000236671:D97N;ENSP00000415036:D82N;ENSP00000356164:D62N	ENSP00000236671:D97N	D	-	1	0	CTSD	1737385	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	6.980000	0.76160	2.061000	0.61500	0.486000	0.48141	GAC	.	.	none		0.657	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
AHCYL2	23382	hgsc.bcm.edu	37	7	129028933	129028933	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:129028933C>T	ENST00000325006.3	+	3	566	c.512C>T	c.(511-513)tCg>tTg	p.S171L	AHCYL2_ENST00000446544.2_Missense_Mutation_p.S170L|AHCYL2_ENST00000474594.1_Missense_Mutation_p.S68L|AHCYL2_ENST00000531335.2_Missense_Mutation_p.S90L|AHCYL2_ENST00000472554.1_3'UTR|AHCYL2_ENST00000446212.1_Missense_Mutation_p.S69L|AHCYL2_ENST00000490911.1_Missense_Mutation_p.S68L	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	171					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GATGAGACATCGCCCAGGGAC	0.398																																					p.S171L	Pancreas(160;1736 1964 29875 40941 45605)	Atlas-SNP	.											AHCYL2,caecum,carcinoma,-1,1	AHCYL2	79	1	0			c.C512T						scavenged	.						100.0	94.0	96.0					7																	129028933		2203	4300	6503	SO:0001583	missense	23382	exon3			AGACATCGCCCAG	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.512C>T	7.37:g.129028933C>T	ENSP00000315931:p.Ser171Leu	175.0	1.0	0.00571429		180.0	77.0	0.427778	NM_015328	B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.086009|5.086009	0.94100|0.94100	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000466924|ENST00000325006;ENST00000446544;ENST00000531335;ENST00000460109;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993	.|T;T;T;T;T;T;T	.|0.78595	.|-1.19;-1.19;-1.15;-1.14;-1.14;-1.14;-0.96	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85039|0.85039	0.5606|0.5606	L|L	0.45352|0.45352	1.415|1.415	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.87578	.|0.996;0.996;0.996;0.996;0.998	D|D	0.86023|0.86023	0.1508|0.1508	5|10	.|0.87932	.|D	.|0	-15.2176|-15.2176	18.6782|18.6782	0.91537|0.91537	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|68;69;171;68;170	.|B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.|.;.;SAHH3_HUMAN;.;.	C|L	78|171;170;90;69;68;69;68;69	.|ENSP00000315931:S171L;ENSP00000413639:S170L;ENSP00000431787:S90L;ENSP00000420459:S68L;ENSP00000405267:S69L;ENSP00000420801:S68L;ENSP00000419608:S69L	.|ENSP00000315931:S171L	R|S	+|+	1|2	0|0	AHCYL2|AHCYL2	128816169|128816169	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.991000|0.991000	0.79684|0.79684	7.776000|7.776000	0.85560|0.85560	2.648000|2.648000	0.89879|0.89879	0.650000|0.650000	0.86243|0.86243	CGC|TCG	.	.	none		0.398	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
HYDIN	54768	hgsc.bcm.edu	37	16	70989411	70989411	+	Silent	SNP	G	G	A	rs375756894	byFrequency	TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr16:70989411G>A	ENST00000393567.2	-	40	6333	c.6183C>T	c.(6181-6183)aaC>aaT	p.N2061N		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2061					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCAGGCTGCGTTGTAGTACT	0.552													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19316	0.0		0.001	False		,,,				2504	0.0				p.N2061N		Atlas-SNP	.											.	HYDIN	788	.	0			c.C6183T						PASS	.	G		2,3706		0,2,1852	24.0	22.0	23.0		6180	-8.0	0.0	16		23	2,8124		0,2,4061	no	coding-synonymous	HYDIN	NM_032821.2		0,4,5913	AA,AG,GG		0.0246,0.0539,0.0338		2060/5121	70989411	4,11830	1854	4063	5917	SO:0001819	synonymous_variant	54768	exon40			GGCTGCGTTGTAG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6183C>T	16.37:g.70989411G>A		47.0	0.0	0		39.0	12.0	0.307692	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.	.	weak		0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
C5orf42	65250	hgsc.bcm.edu	37	5	37224369	37224369	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:37224369T>C	ENST00000508244.1	-	13	2660	c.2567A>G	c.(2566-2568)gAa>gGa	p.E856G	C5orf42_ENST00000425232.2_Missense_Mutation_p.E856G|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	856						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTCTTCGATTTCTTGTAGAGC	0.328																																					p.E856G		Atlas-SNP	.											.	C5orf42	422	.	0			c.A2567G						PASS	.						266.0	193.0	215.0					5																	37224369		692	1588	2280	SO:0001583	missense	65250	exon14			TCGATTTCTTGTA		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.2567A>G	5.37:g.37224369T>C	ENSP00000421690:p.Glu856Gly	156.0	0.0	0		123.0	39.0	0.317073	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	18.35	3.603999	0.66445	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.27402	1.67;1.67	5.38	5.38	0.77491	.	0.192036	0.31821	U	0.007004	T	0.55081	0.1898	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.58335	-0.7654	10	0.62326	D	0.03	-11.8602	15.3477	0.74355	0.0:0.0:0.0:1.0	.	856	E9PH94	.	G	856	ENSP00000421690:E856G;ENSP00000389014:E856G	ENSP00000389014:E856G	E	-	2	0	C5orf42	37260126	1.000000	0.71417	0.986000	0.45419	0.706000	0.40770	3.584000	0.53936	2.175000	0.68902	0.533000	0.62120	GAA	.	.	none		0.328	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
GPN3	51184	hgsc.bcm.edu	37	12	110902947	110902947	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:110902947G>A	ENST00000228827.3	-	2	183	c.121C>T	c.(121-123)Cca>Tca	p.P41S	GPN3_ENST00000537466.2_Missense_Mutation_p.P51S|GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000543199.1_Missense_Mutation_p.P80S	NM_016301.3	NP_057385.3			GPN-loop GTPase 3											endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						TCTGCTGCTGGATCCAGGTTT	0.537																																					p.P80S		Atlas-SNP	.											.	GPN3	37	.	0			c.C238T						PASS	.						197.0	157.0	170.0					12																	110902947		2203	4300	6503	SO:0001583	missense	51184	exon2			CTGCTGGATCCAG	BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.121C>T	12.37:g.110902947G>A	ENSP00000228827:p.Pro41Ser	94.0	0.0	0		87.0	37.0	0.425287	NM_001164372		Missense_Mutation	SNP	ENST00000228827.3	37	CCDS9147.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541728	0.96474	.	.	ENSG00000111231	ENST00000228827;ENST00000543199;ENST00000537466;ENST00000550974	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.92738	3.34	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.79108	0.987;0.992	T	0.82172	-0.0589	10	0.87932	D	0	-14.8795	20.3789	0.98926	0.0:0.0:1.0:0.0	.	51;41	Q9UHW5-2;Q9UHW5	.;GPN3_HUMAN	S	41;80;51;19	ENSP00000228827:P41S;ENSP00000442770:P80S;ENSP00000443068:P51S;ENSP00000447480:P19S	ENSP00000228827:P41S	P	-	1	0	GPN3	109387330	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.221000	0.95188	2.826000	0.97356	0.563000	0.77884	CCA	.	.	none		0.537	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
CRISP3	10321	hgsc.bcm.edu	37	6	49704124	49704124	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:49704124C>A	ENST00000393666.1	-	2	175	c.169G>T	c.(169-171)Gcc>Tcc	p.A57S	CRISP3_ENST00000433368.2_Missense_Mutation_p.A80S|CRISP3_ENST00000371159.4_Missense_Mutation_p.A88S|CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000263045.4_Missense_Mutation_p.A70S			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	57	SCP.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATGTTTCTGGCAGGGGGAGAT	0.458																																					p.A80S		Atlas-SNP	.											.	CRISP3	67	.	0			c.G238T						PASS	.						183.0	163.0	170.0					6																	49704124		2203	4300	6503	SO:0001583	missense	10321	exon3			TTCTGGCAGGGGG	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.169G>T	6.37:g.49704124C>A	ENSP00000377274:p.Ala57Ser	125.0	0.0	0		107.0	37.0	0.345794	NM_001190986	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	37		.	.	.	.	.	.	.	.	.	.	C	17.17	3.321590	0.60634	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000371159;ENST00000354620	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	4.9	4.02	0.46733	CAP domain (3);	0.000000	0.64402	U	0.000005	T	0.54565	0.1866	H	0.94222	3.51	0.80722	D	1	P	0.50943	0.94	D	0.66602	0.945	T	0.67059	-0.5766	10	0.87932	D	0	.	11.4692	0.50257	0.0:0.8177:0.1823:0.0	.	57	P54108	CRIS3_HUMAN	S	70;80;57;88;80	ENSP00000263045:A70S;ENSP00000389026:A80S;ENSP00000377274:A57S;ENSP00000360201:A88S;ENSP00000346636:A80S	ENSP00000263045:A70S	A	-	1	0	CRISP3	49812083	0.735000	0.28153	0.754000	0.31244	0.652000	0.38707	1.138000	0.31491	1.179000	0.42884	0.561000	0.74099	GCC	.	.	none		0.458	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
S1PR2	9294	hgsc.bcm.edu	37	19	10334796	10334796	+	Missense_Mutation	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:10334796G>T	ENST00000590320.1	-	2	896	c.786C>A	c.(784-786)caC>caA	p.H262Q	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	262					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TCGGGCAGGAGTGGACGGGAC	0.597																																					p.H262Q	Pancreas(194;229 3020 15179 45747)	Atlas-SNP	.											.	S1PR2	36	.	0			c.C786A						PASS	.						79.0	67.0	71.0					19																	10334796		2203	4300	6503	SO:0001583	missense	9294	exon2			GCAGGAGTGGACG	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.786C>A	19.37:g.10334796G>T	ENSP00000466933:p.His262Gln	40.0	0.0	0		18.0	8.0	0.444444	NM_004230	Q86UN8	Missense_Mutation	SNP	ENST00000590320.1	37	CCDS12229.1	.	.	.	.	.	.	.	.	.	.	G	5.422	0.263065	0.10294	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.63	-9.3	0.00649	GPCR, rhodopsin-like superfamily (1);	0.279293	0.32068	N	0.006628	T	0.15176	0.0366	N	0.11673	0.155	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.12811	-1.0533	9	0.36615	T	0.2	.	8.6306	0.33917	0.1406:0.6179:0.1056:0.136	.	262	O95136	S1PR2_HUMAN	Q	262	.	ENSP00000322049:H262Q	H	-	3	2	S1PR2	10195796	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-2.194000	0.01243	-0.667000	0.05303	-0.141000	0.14075	CAC	.	.	none		0.597	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
DACH2	117154	hgsc.bcm.edu	37	X	85403679	85403679	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:85403679C>T	ENST00000373125.4	+	1	55	c.55C>T	c.(55-57)Ccg>Tcg	p.P19S	DACH2_ENST00000373131.1_Missense_Mutation_p.P19S	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	19					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CGCCGGCGTCCCGGGGGGCTT	0.582																																					p.P19S		Atlas-SNP	.											.	DACH2	263	.	0			c.C55T						PASS	.						17.0	17.0	17.0					X																	85403679		2201	4291	6492	SO:0001583	missense	117154	exon1			GGCGTCCCGGGGG	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.55C>T	X.37:g.85403679C>T	ENSP00000362217:p.Pro19Ser	164.0	0.0	0		121.0	41.0	0.338843	NM_001139514	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	C	1.400	-0.578490	0.03854	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;T	0.81499	-1.5;-1.49	4.64	2.87	0.33458	.	0.669254	0.13433	N	0.388254	T	0.55337	0.1914	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.37572	-0.9700	10	0.10377	T	0.69	.	3.1449	0.06468	0.0:0.4362:0.2055:0.3583	.	19;19	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	S	19	ENSP00000362223:P19S;ENSP00000362217:P19S	ENSP00000345134:P19S	P	+	1	0	DACH2	85290335	0.011000	0.17503	0.888000	0.34837	0.009000	0.06853	0.048000	0.14078	0.409000	0.25649	-0.276000	0.10085	CCG	.	.	none		0.582	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
PNPLA6	10908	hgsc.bcm.edu	37	19	7620541	7620541	+	Silent	SNP	C	C	T	rs572115607		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:7620541C>T	ENST00000221249.6	+	27	3302	c.2871C>T	c.(2869-2871)gtC>gtT	p.V957V	PNPLA6_ENST00000450331.3_Silent_p.V957V|PNPLA6_ENST00000414982.3_Silent_p.V1005V|PNPLA6_ENST00000545201.2_Silent_p.V930V|PNPLA6_ENST00000600737.1_Silent_p.V995V	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	996					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						AGGCGGGGGTCCCCGTGGACC	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		10953	0.0		0.0	False		,,,				2504	0.0				p.V1005V		Atlas-SNP	.											.	PNPLA6	163	.	0			c.C3015T						PASS	.						33.0	33.0	33.0					19																	7620541		2203	4300	6503	SO:0001819	synonymous_variant	10908	exon26			GGGGGTCCCCGTG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2871C>T	19.37:g.7620541C>T		70.0	0.0	0		84.0	36.0	0.428571	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			.	.	none		0.672	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
FAM81B	153643	hgsc.bcm.edu	37	5	94764428	94764428	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr5:94764428G>A	ENST00000283357.5	+	6	824	c.778G>A	c.(778-780)Gac>Aac	p.D260N		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	260						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		CAAGAACTTGGACATGAAGGT	0.408																																					p.D260N		Atlas-SNP	.											FAM81B,NS,carcinoma,0,1	FAM81B	51	1	0			c.G778A						scavenged	.						115.0	106.0	109.0					5																	94764428		1844	4088	5932	SO:0001583	missense	153643	exon6			AACTTGGACATGA		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.778G>A	5.37:g.94764428G>A	ENSP00000283357:p.Asp260Asn	180.0	1.0	0.00555556		195.0	67.0	0.34359	NM_152548		Missense_Mutation	SNP	ENST00000283357.5	37	CCDS43341.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860601	0.71834	.	.	ENSG00000153347	ENST00000283357;ENST00000512365	T	0.21361	2.01	5.87	5.87	0.94306	.	0.251835	0.40469	N	0.001099	T	0.47266	0.1436	M	0.69823	2.125	0.36848	D	0.887755	D	0.76494	0.999	D	0.69479	0.964	T	0.46679	-0.9174	10	0.46703	T	0.11	-11.1539	18.9772	0.92742	0.0:0.0:1.0:0.0	.	260	Q96LP2	FA81B_HUMAN	N	260;16	ENSP00000283357:D260N	ENSP00000283357:D260N	D	+	1	0	FAM81B	94790184	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.789000	0.69029	2.780000	0.95670	0.655000	0.94253	GAC	.	.	none		0.408	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
PEG3	5178	hgsc.bcm.edu	37	19	57327786	57327786	+	Missense_Mutation	SNP	C	C	G	rs371769465		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57327786C>G	ENST00000326441.9	-	10	2387	c.2024G>C	c.(2023-2025)cGt>cCt	p.R675P	ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R675P|PEG3_ENST00000598410.1_Missense_Mutation_p.R551P|PEG3_ENST00000593695.1_Missense_Mutation_p.R549P	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	675					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGTTTTCTGACGCCTTTTAAG	0.423																																					p.R675P		Atlas-SNP	.											ZIM2_ENST00000326441,NS,carcinoma,0,4	PEG3	414	4	0			c.G2024C						PASS	.						106.0	108.0	107.0					19																	57327786		2203	4300	6503	SO:0001583	missense	5178	exon9			TTCTGACGCCTTT	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2024G>C	19.37:g.57327786C>G	ENSP00000326581:p.Arg675Pro	198.0	0.0	0		181.0	8.0	0.0441989	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872774	0.51695	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02682	4.2;4.2	4.05	0.0115	0.14087	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.662273	0.13428	N	0.388633	T	0.10165	0.0249	M	0.73962	2.25	.	.	.	D;D;D	0.71674	0.976;0.997;0.998	P;P;D	0.65323	0.706;0.902;0.934	T	0.10847	-1.0612	9	0.72032	D	0.01	-9.8771	6.8386	0.23951	0.0:0.4257:0.0:0.5743	.	551;675;610	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	P	675	ENSP00000326581:R675P;ENSP00000403051:R675P	ENSP00000326581:R675P	R	-	2	0	ZIM2	62019598	0.746000	0.28272	0.080000	0.20451	0.673000	0.39480	0.972000	0.29409	0.072000	0.16694	0.585000	0.79938	CGT	.	.	alt		0.423	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
S1PR2	9294	hgsc.bcm.edu	37	19	10334795	10334795	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:10334795A>G	ENST00000590320.1	-	2	897	c.787T>C	c.(787-789)Tcc>Ccc	p.S263P	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	263					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						ATCGGGCAGGAGTGGACGGGA	0.602																																					p.S263P	Pancreas(194;229 3020 15179 45747)	Atlas-SNP	.											.	S1PR2	36	.	0			c.T787C						PASS	.						79.0	67.0	71.0					19																	10334795		2203	4300	6503	SO:0001583	missense	9294	exon2			GGCAGGAGTGGAC	AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.787T>C	19.37:g.10334795A>G	ENSP00000466933:p.Ser263Pro	40.0	0.0	0		18.0	8.0	0.444444	NM_004230	Q86UN8	Missense_Mutation	SNP	ENST00000590320.1	37	CCDS12229.1	.	.	.	.	.	.	.	.	.	.	A	7.551	0.662679	0.14645	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.63	-11.3	0.00108	GPCR, rhodopsin-like superfamily (1);	0.999489	0.08097	N	0.998495	T	0.23289	0.0563	N	0.13352	0.335	0.19775	N	0.999952	B	0.27316	0.175	B	0.31869	0.137	T	0.40136	-0.9579	9	0.12766	T	0.61	.	17.8161	0.88634	0.8127:0.1317:0.0:0.0557	.	263	O95136	S1PR2_HUMAN	P	263	.	ENSP00000322049:S263P	S	-	1	0	S1PR2	10195795	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.435000	0.00472	-2.793000	0.00355	-0.319000	0.08680	TCC	.	.	none		0.602	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451194.1	NM_004230	
ZNF547	284306	hgsc.bcm.edu	37	19	57889498	57889498	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57889498A>C	ENST00000282282.3	+	4	1304	c.1154A>C	c.(1153-1155)aAa>aCa	p.K385T	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K385R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAATGTGGGAAATTCTTTAGG	0.448																																					p.K385T		Atlas-SNP	.											ZNF547,NS,carcinoma,0,1	ZNF547	45	1	1	Substitution - Missense(1)	endometrium(1)	c.A1154C						PASS	.						75.0	68.0	70.0					19																	57889498		2203	4300	6503	SO:0001583	missense	284306	exon4			GTGGGAAATTCTT	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.1154A>C	19.37:g.57889498A>C	ENSP00000282282:p.Lys385Thr	63.0	0.0	0		73.0	19.0	0.260274	NM_173631	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387608	0.61956	.	.	ENSG00000152433	ENST00000282282	T	0.60299	0.2	1.81	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75398	0.3844	M	0.92459	3.31	0.23144	N	0.998222	D	0.61697	0.99	P	0.58577	0.841	T	0.64300	-0.6440	8	.	.	.	.	8.9234	0.35625	1.0:0.0:0.0:0.0	.	385	Q8IVP9	ZN547_HUMAN	T	385	ENSP00000282282:K385T	.	K	+	2	0	ZNF547	62581310	0.988000	0.35896	0.327000	0.25402	0.678000	0.39670	0.685000	0.25378	1.088000	0.41272	0.397000	0.26171	AAA	.	.	none		0.448	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
ITGAV	3685	hgsc.bcm.edu	37	2	187533626	187533626	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:187533626G>A	ENST00000261023.3	+	25	2845	c.2571G>A	c.(2569-2571)gaG>gaA	p.E857E	ITGAV_ENST00000474571.1_3'UTR|ITGAV_ENST00000433736.2_Silent_p.E811E|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Silent_p.E821E	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	857					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CAGATATGGAGATCAACCCTT	0.323																																					p.E857E	Melanoma(58;108 1995 6081)	Atlas-SNP	.											.	ITGAV	124	.	0			c.G2571A						PASS	.						116.0	114.0	115.0					2																	187533626		2203	4300	6503	SO:0001819	synonymous_variant	3685	exon25			TATGGAGATCAAC		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2571G>A	2.37:g.187533626G>A		187.0	0.0	0		174.0	60.0	0.344828	NM_002210	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	37	CCDS2292.1	.	.	.	.	.	.	.	.	.	.	G	8.464	0.856071	0.17106	.	.	ENSG00000138448	ENST00000430709	.	.	.	5.54	3.75	0.43078	.	.	.	.	.	T	0.59321	0.2185	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54302	-0.8314	4	.	.	.	.	9.257	0.37590	0.2825:0.0:0.7175:0.0	.	.	.	.	K	8	.	.	R	+	2	0	ITGAV	187241871	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.129000	0.31381	0.716000	0.32124	-0.143000	0.13931	AGA	.	.	none		0.323	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
SLC25A37	51312	hgsc.bcm.edu	37	8	23429084	23429084	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:23429084G>A	ENST00000519973.1	+	4	931	c.733G>A	c.(733-735)Ggg>Agg	p.G245R	FP15737_ENST00000399967.3_5'Flank	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	245					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)	p.G245W(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CGGGCTGGCCGGGGCCCTCGC	0.652																																					p.G245R		Atlas-SNP	.											SLC25A37,NS,carcinoma,0,1	SLC25A37	27	1	1	Substitution - Missense(1)	lung(1)	c.G733A						PASS	.						25.0	29.0	28.0					8																	23429084		1907	4113	6020	SO:0001583	missense	51312	exon4			CTGGCCGGGGCCC	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.733G>A	8.37:g.23429084G>A	ENSP00000429200:p.Gly245Arg	87.0	0.0	0		86.0	35.0	0.406977	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	CCDS47828.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004468	0.93287	.	.	ENSG00000147454	ENST00000519973	D	0.85339	-1.97	5.8	5.8	0.92144	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94984	0.8377	H	0.95114	3.625	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.95928	0.8936	10	0.87932	D	0	-3.0931	18.6148	0.91299	0.0:0.0:1.0:0.0	.	245	Q9NYZ2	MFRN1_HUMAN	R	245	ENSP00000429200:G245R	ENSP00000429200:G245R	G	+	1	0	SLC25A37	23485029	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.460000	0.97641	2.740000	0.93945	0.650000	0.86243	GGG	.	.	none		0.652	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
FMN2	56776	hgsc.bcm.edu	37	1	240370997	240370997	+	Missense_Mutation	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:240370997C>A	ENST00000319653.9	+	5	3115	c.2885C>A	c.(2884-2886)gCa>gAa	p.A962E		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	962	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTTCCCGGGGCAGGCATACCC	0.697																																					p.A962E		Atlas-SNP	.											FMN2,NS,carcinoma,-1,2	FMN2	451	2	0			c.C2885A						scavenged	.						20.0	23.0	22.0					1																	240370997		2200	4297	6497	SO:0001583	missense	56776	exon5			CCGGGGCAGGCAT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2885C>A	1.37:g.240370997C>A	ENSP00000318884:p.Ala962Glu	93.0	1.0	0.0107527		96.0	64.0	0.666667	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	7.783	0.709962	0.15239	.	.	ENSG00000155816	ENST00000319653	T	0.56941	0.43	3.8	-3.7	0.04437	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	.	.	.	.	T	0.31295	0.0792	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22173	-1.0224	8	.	.	.	.	0.4251	0.00462	0.2272:0.1627:0.2561:0.3541	.	962	Q9NZ56	FMN2_HUMAN	E	962	ENSP00000318884:A962E	.	A	+	2	0	FMN2	238437620	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-6.269000	0.00073	-0.532000	0.06332	-0.878000	0.02970	GCA	.	.	none		0.697	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
SPIDR	23514	hgsc.bcm.edu	37	8	48614293	48614293	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:48614293A>C	ENST00000297423.4	+	13	2168	c.1784A>C	c.(1783-1785)cAt>cCt	p.H595P	SPIDR_ENST00000517693.1_Missense_Mutation_p.H70P|SPIDR_ENST00000518074.1_Missense_Mutation_p.H535P|SPIDR_ENST00000541342.1_Missense_Mutation_p.H525P|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	595					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											ATAAAAACTCATCTGCCTCCT	0.348																																					p.H595P		Atlas-SNP	.											KIAA0146,bladder,carcinoma,+1,1	KIAA0146	64	1	0			c.A1784C						PASS	.						129.0	121.0	124.0					8																	48614293		1882	4119	6001	SO:0001583	missense	23514	exon13			AAACTCATCTGCC	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1784A>C	8.37:g.48614293A>C	ENSP00000297423:p.His595Pro	126.0	0.0	0		111.0	40.0	0.36036	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.029|9.029	0.986713|0.986713	0.18889|0.18889	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000519141;ENST00000517693;ENST00000519362|ENST00000519401	.|.	.|.	.|.	5.4|5.4	2.96|2.96	0.34315|0.34315	.|.	0.536026|.	0.20846|.	N|.	0.084612|.	T|T	0.35740|0.35740	0.0942|0.0942	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.23442|.	0.001;0.001;0.013;0.011;0.085;0.009;0.001;0.05|.	B;B;B;B;B;B;B;B|.	0.18561|.	0.001;0.001;0.014;0.012;0.014;0.007;0.001;0.022|.	T|T	0.21861|0.21861	-1.0233|-1.0233	9|5	0.48119|.	T|.	0.1|.	.|.	6.9387|6.9387	0.24481|0.24481	0.7729:0.1496:0.0775:0.0|0.7729:0.1496:0.0775:0.0	.|.	85;100;535;525;595;284;70;595|.	B4DZY2;B4DWT8;B4E0Y6;B4DFV2;B4DEV5;B4DFT3;B3KP42;Q14159|.	.;.;.;.;.;.;.;K0146_HUMAN|.	P|L	595;535;525;100;70;70|277	.|.	ENSP00000297423:H595P|.	H|I	+|+	2|1	0|0	KIAA0146|KIAA0146	48776846|48776846	0.000000|0.000000	0.05858|0.05858	0.056000|0.056000	0.19401|0.19401	0.921000|0.921000	0.55340|0.55340	0.966000|0.966000	0.29331|0.29331	0.336000|0.336000	0.23639|0.23639	0.528000|0.528000	0.53228|0.53228	CAT|ATC	.	.	none		0.348	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
CTGF	1490	hgsc.bcm.edu	37	6	132271959	132271959	+	Silent	SNP	T	T	G	rs12206231		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr6:132271959T>G	ENST00000367976.3	-	2	440	c.240A>C	c.(238-240)ctA>ctC	p.L80L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	80	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)			breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		AGTGACAGAATAGGCCCTTGT	0.701													G|||	5008	1.0	1.0	1.0	5008	,	,		8368	1.0		1.0	False		,,,				2504	1.0				p.L80L	Esophageal Squamous(127;510 1660 12817 24400 38449)	Atlas-SNP	.											.	CTGF	36	.	0			c.A240C						PASS	.						7.0	8.0	7.0					6																	132271959		2127	4192	6319	SO:0001819	synonymous_variant	1490	exon2			ACAGAATAGGCCC	X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.240A>C	6.37:g.132271959T>G		0.0	0.0	.		5.0	5.0	1	NM_001901	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Silent	SNP	ENST00000367976.3	37	CCDS5151.1																																																																																			T|0.000;G|1.000	1.000	strong		0.701	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042239.2	NM_001901	
PTPN3	5774	hgsc.bcm.edu	37	9	112225710	112225710	+	Missense_Mutation	SNP	G	G	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:112225710G>C	ENST00000374541.2	-	2	109	c.5C>G	c.(4-6)aCc>aGc	p.T2S	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	2					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TAACCGGGAGGTCATAACTAT	0.408																																					p.T2S		Atlas-SNP	.											.	PTPN3	106	.	0			c.C5G						PASS	.						100.0	99.0	100.0					9																	112225710		2203	4300	6503	SO:0001583	missense	5774	exon2			CGGGAGGTCATAA		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.5C>G	9.37:g.112225710G>C	ENSP00000363667:p.Thr2Ser	99.0	0.0	0		103.0	36.0	0.349515	NM_001145368	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799131	0.50208	.	.	ENSG00000070159	ENST00000394831;ENST00000374541	T	0.70749	-0.51	5.25	4.23	0.50019	.	0.157695	0.41396	D	0.000896	T	0.49932	0.1586	N	0.17082	0.46	0.80722	D	1	B;P;B	0.35612	0.172;0.512;0.067	B;B;B	0.31442	0.058;0.13;0.034	T	0.50363	-0.8837	10	0.29301	T	0.29	.	10.8355	0.46685	0.0:0.0:0.6104:0.3896	.	2;2;2	B7Z9V1;Q45VJ3;P26045	.;.;PTN3_HUMAN	S	2	ENSP00000363667:T2S	ENSP00000363667:T2S	T	-	2	0	PTPN3	111265531	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.591000	0.53986	2.604000	0.88044	0.557000	0.71058	ACC	.	.	none		0.408	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
SCNN1A	6337	hgsc.bcm.edu	37	12	6471387	6471387	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr12:6471387G>A	ENST00000228916.2	-	4	803	c.705C>T	c.(703-705)gaC>gaT	p.D235D	SCNN1A_ENST00000360168.3_Silent_p.D294D|SCNN1A_ENST00000540037.1_5'UTR|SCNN1A_ENST00000538979.1_Intron|SCNN1A_ENST00000358945.3_Silent_p.D235D|SCNN1A_ENST00000543768.1_Silent_p.D258D|SCNN1A_ENST00000396966.2_Silent_p.D235D	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	235					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	GGTAGAAGCAGTCCGATTTGT	0.562																																					p.D294D		Atlas-SNP	.											SCNN1A,NS,adenocarcinoma,-2,1	SCNN1A	54	1	0			c.C882T						PASS	.						158.0	112.0	128.0					12																	6471387		2203	4300	6503	SO:0001819	synonymous_variant	6337	exon3			GAAGCAGTCCGAT	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.705C>T	12.37:g.6471387G>A		97.0	0.0	0		97.0	24.0	0.247423	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	ENST00000228916.2	37	CCDS8543.1																																																																																			.	.	none		0.562	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
ZSCAN20	7579	hgsc.bcm.edu	37	1	33956948	33956948	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:33956948C>T	ENST00000361328.3	+	6	1243	c.1090C>T	c.(1090-1092)Cta>Tta	p.L364L	ZSCAN20_ENST00000373413.2_Silent_p.L310L	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	364					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCAGAGCAGCTAAGGGCAAG	0.532																																					p.L364L		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C1090T						PASS	.						94.0	98.0	97.0					1																	33956948		1957	4167	6124	SO:0001819	synonymous_variant	7579	exon6			GAGCAGCTAAGGG	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1090C>T	1.37:g.33956948C>T		135.0	0.0	0		107.0	42.0	0.392523	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	37	CCDS41300.1																																																																																			.	.	none		0.532	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
CISD2	493856	hgsc.bcm.edu	37	4	103806567	103806567	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:103806567A>T	ENST00000273986.4	+	2	405	c.298A>T	c.(298-300)Agg>Tgg	p.R100W	SLC9B1_ENST00000394789.3_Intron|CISD2_ENST00000503643.1_Missense_Mutation_p.R110W	NM_001008388.4	NP_001008389.1	Q8N5K1	CISD2_HUMAN	CDGSH iron sulfur domain 2	100					mitochondrion degradation (GO:0000422)|multicellular organismal aging (GO:0010259)|regulation of autophagy (GO:0010506)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)	4				OV - Ovarian serous cystadenocarcinoma(123;1.97e-08)		AGCTTATTGTAGGTGTTGGCG	0.343																																					p.R100W		Atlas-SNP	.											.	CISD2	9	.	0			c.A298T						PASS	.						53.0	51.0	52.0					4																	103806567		2203	4300	6503	SO:0001583	missense	493856	exon2			TATTGTAGGTGTT	BX537971	CCDS34040.1	4q24	2009-03-25	2007-08-10	2007-08-10	ENSG00000145354	ENSG00000145354		"""CDGSH iron sulfur domain containing"""	24212	protein-coding gene	gene with protein product	"""mitoNEET related 1"", ""endoplasmic reticulum intermembrane small protein"""	611507	"""zinc finger, CDGSH-type domain 2"", ""Wolfram syndrome 2"""	ZCD2, WFS2		17376863, 17584744, 17846994	Standard	NM_001008388		Approved	Miner1, ERIS	uc003hwt.4	Q8N5K1	OTTHUMG00000161014	ENST00000273986.4:c.298A>T	4.37:g.103806567A>T	ENSP00000273986:p.Arg100Trp	96.0	0.0	0		97.0	34.0	0.350515	NM_001008388	Q7Z3D5	Missense_Mutation	SNP	ENST00000273986.4	37	CCDS34040.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.460468	0.84317	.	.	ENSG00000145354	ENST00000273986;ENST00000503643	.	.	.	6.17	2.16	0.27623	Iron sulphur-containing domain, CDGSH-type, subfamily (1);Iron sulphur-containing domain, CDGSH-type (1);	0.000000	0.85682	D	0.000000	D	0.83691	0.5309	M	0.89904	3.07	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.85812	0.1380	9	0.87932	D	0	-30.1136	14.2849	0.66240	0.4988:0.5012:0.0:0.0	.	100	Q8N5K1	CISD2_HUMAN	W	100;110	.	ENSP00000273986:R100W	R	+	1	2	CISD2	104026002	0.999000	0.42202	0.964000	0.40570	0.979000	0.70002	1.460000	0.35244	0.142000	0.18901	0.533000	0.62120	AGG	.	.	none		0.343	CISD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363417.2	NM_001008388	
ZNF547	284306	hgsc.bcm.edu	37	19	57889497	57889497	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:57889497A>G	ENST00000282282.3	+	4	1303	c.1153A>G	c.(1153-1155)Aaa>Gaa	p.K385E	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAATGTGGGAAATTCTTTAG	0.448																																					p.K385E		Atlas-SNP	.											ZNF547,NS,carcinoma,-1,1	ZNF547	45	1	0			c.A1153G						PASS	.						75.0	68.0	70.0					19																	57889497		2203	4300	6503	SO:0001583	missense	284306	exon4			TGTGGGAAATTCT	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.1153A>G	19.37:g.57889497A>G	ENSP00000282282:p.Lys385Glu	63.0	0.0	0		73.0	20.0	0.273973	NM_173631	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893684	0.52121	.	.	ENSG00000152433	ENST00000282282	T	0.60040	0.22	1.81	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59128	0.2171	M	0.75447	2.3	0.22354	N	0.999175	P	0.50369	0.934	P	0.45660	0.489	T	0.51973	-0.8637	8	.	.	.	.	8.9234	0.35625	1.0:0.0:0.0:0.0	.	385	Q8IVP9	ZN547_HUMAN	E	385	ENSP00000282282:K385E	.	K	+	1	0	ZNF547	62581309	0.987000	0.35691	0.383000	0.26132	0.685000	0.39939	0.230000	0.17852	1.088000	0.41272	0.397000	0.26171	AAA	.	.	none		0.448	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
TNN	63923	hgsc.bcm.edu	37	1	175049323	175049323	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:175049323T>C	ENST00000239462.4	+	4	922	c.809T>C	c.(808-810)cTg>cCg	p.L270P		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	270	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGCCTGCAGCTGCTCAAGAAC	0.607																																					p.L270P		Atlas-SNP	.											.	TNN	297	.	0			c.T809C						PASS	.						49.0	51.0	50.0					1																	175049323		2203	4300	6503	SO:0001583	missense	63923	exon4			TGCAGCTGCTCAA	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.809T>C	1.37:g.175049323T>C	ENSP00000239462:p.Leu270Pro	32.0	0.0	0		40.0	14.0	0.35	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159759	0.78226	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.58940	0.3	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.146450	0.47455	D	0.000233	T	0.76884	0.4050	M	0.81802	2.56	0.80722	D	1	D;B	0.76494	0.999;0.118	D;B	0.73708	0.981;0.118	T	0.80246	-0.1462	10	0.66056	D	0.02	.	15.4264	0.75055	0.0:0.0:0.0:1.0	.	270;270	B3KXB6;Q9UQP3	.;TENN_HUMAN	P	270	ENSP00000239462:L270P	ENSP00000239462:L270P	L	+	2	0	TNN	173315946	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.954000	0.56708	2.119000	0.64992	0.528000	0.53228	CTG	.	.	none		0.607	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
ATOH1	474	hgsc.bcm.edu	37	4	94751127	94751127	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr4:94751127G>A	ENST00000306011.3	+	1	1086	c.1050G>A	c.(1048-1050)tcG>tcA	p.S350S		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	350					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		ACAGTGACTCGGATGAGGCAA	0.547																																					p.S350S		Atlas-SNP	.											.	ATOH1	40	.	0			c.G1050A						PASS	.						53.0	57.0	56.0					4																	94751127		2203	4294	6497	SO:0001819	synonymous_variant	474	exon1			TGACTCGGATGAG	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.1050G>A	4.37:g.94751127G>A		74.0	0.0	0		83.0	23.0	0.277108	NM_005172	Q14CT9	Silent	SNP	ENST00000306011.3	37	CCDS3638.1																																																																																			.	.	none		0.547	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
APOA1	335	hgsc.bcm.edu	37	11	116707093	116707093	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr11:116707093A>G	ENST00000236850.4	-	4	600	c.235T>C	c.(235-237)Tcc>Ccc	p.S79P	APOA1_ENST00000375320.1_Missense_Mutation_p.S79P|APOA1_ENST00000375323.1_Missense_Mutation_p.S79P|AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375329.2_Missense_Mutation_p.S57P|APOA1_ENST00000359492.2_Missense_Mutation_p.S79P	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	79	10 X approximate tandem repeats.				adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CTGAAGGTGGAGGTCACGCTG	0.612																																					p.S79P		Atlas-SNP	.											.	APOA1	19	.	0			c.T235C						PASS	.						50.0	48.0	48.0					11																	116707093		2201	4292	6493	SO:0001583	missense	335	exon4			AGGTGGAGGTCAC	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.235T>C	11.37:g.116707093A>G	ENSP00000236850:p.Ser79Pro	66.0	0.0	0		78.0	32.0	0.410256	NM_000039	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	37	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.378823	0.42207	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375329;ENST00000375323;ENST00000236850	T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9	5.38	-7.41	0.01392	Apolipoprotein/apolipophorin (1);	0.971554	0.08387	N	0.953551	T	0.58878	0.2153	L	0.55743	1.74	0.09310	N	1	B	0.14805	0.011	B	0.17979	0.02	T	0.51301	-0.8723	10	0.45353	T	0.12	-4.2027	1.3102	0.02096	0.4455:0.194:0.0931:0.2674	.	79	P02647	APOA1_HUMAN	P	79;79;57;79;79	ENSP00000364469:S79P;ENSP00000352471:S79P;ENSP00000364478:S57P;ENSP00000364472:S79P;ENSP00000236850:S79P	ENSP00000236850:S79P	S	-	1	0	APOA1	116212303	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.029000	0.03585	-0.810000	0.04375	-0.379000	0.06801	TCC	.	.	none		0.612	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039	
USH2A	7399	hgsc.bcm.edu	37	1	216251568	216251568	+	Missense_Mutation	SNP	A	A	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:216251568A>C	ENST00000307340.3	-	27	5821	c.5435T>G	c.(5434-5436)aTa>aGa	p.I1812R	USH2A_ENST00000366943.2_Missense_Mutation_p.I1812R|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1812	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTTGCTGATATGAAAGAGCC	0.438										HNSCC(13;0.011)																											p.I1812R		Atlas-SNP	.											.	USH2A	1168	.	0			c.T5435G						PASS	.						156.0	158.0	158.0					1																	216251568		2203	4300	6503	SO:0001583	missense	7399	exon27			GCTGATATGAAAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5435T>G	1.37:g.216251568A>C	ENSP00000305941:p.Ile1812Arg	130.0	0.0	0		114.0	39.0	0.342105	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	18.27	3.586819	0.66105	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.79141	-1.24;-1.24	5.01	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.468184	0.17640	N	0.167065	D	0.82706	0.5095	M	0.66939	2.045	0.09310	N	1	P	0.47484	0.896	P	0.55455	0.776	T	0.73858	-0.3850	10	0.72032	D	0.01	.	10.3204	0.43762	0.922:0.0:0.078:0.0	.	1812	O75445	USH2A_HUMAN	R	1812	ENSP00000305941:I1812R;ENSP00000355910:I1812R	ENSP00000305941:I1812R	I	-	2	0	USH2A	214318191	0.191000	0.23288	0.001000	0.08648	0.523000	0.34469	4.275000	0.58927	0.772000	0.33382	0.528000	0.53228	ATA	.	.	none		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
MURC	347273	hgsc.bcm.edu	37	9	103348299	103348299	+	Missense_Mutation	SNP	A	A	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr9:103348299A>T	ENST00000307584.5	+	2	726	c.661A>T	c.(661-663)Att>Ttt	p.I221F		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	221					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				AGTGAACAGAATTAGAACTAG	0.478																																					p.I221F		Atlas-SNP	.											.	MURC	43	.	0			c.A661T						PASS	.						110.0	118.0	115.0					9																	103348299		2203	4300	6503	SO:0001583	missense	347273	exon2			AACAGAATTAGAA	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.661A>T	9.37:g.103348299A>T	ENSP00000418668:p.Ile221Phe	111.0	0.0	0		115.0	38.0	0.330435	NM_001018116	B1PRL3|B4DT88	Missense_Mutation	SNP	ENST00000307584.5	37	CCDS35083.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.955464	0.53293	.	.	ENSG00000170681	ENST00000307584	T	0.61274	0.12	5.27	4.09	0.47781	.	0.186907	0.46758	D	0.000270	T	0.51466	0.1676	L	0.49126	1.545	0.44603	D	0.997578	P	0.41131	0.739	B	0.40066	0.318	T	0.52548	-0.8561	10	0.56958	D	0.05	-8.7658	10.5979	0.45349	0.838:0.162:0.0:0.0	.	221	Q5BKX8	MURC_HUMAN	F	221	ENSP00000418668:I221F	ENSP00000418668:I221F	I	+	1	0	MURC	102388120	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.488000	0.45276	0.905000	0.36596	0.459000	0.35465	ATT	.	.	none		0.478	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053419.2	NM_001018116	
RASL12	51285	hgsc.bcm.edu	37	15	65347441	65347441	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr15:65347441G>A	ENST00000220062.4	-	5	873	c.597C>T	c.(595-597)tcC>tcT	p.S199S	RASL12_ENST00000434605.2_Silent_p.S188S|RASL12_ENST00000421977.3_Silent_p.S180S	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	199					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						CCCTCTCCTCGGAGATGAAGA	0.662																																					p.S199S		Atlas-SNP	.											.	RASL12	32	.	0			c.C597T						PASS	.						15.0	16.0	16.0					15																	65347441		2200	4298	6498	SO:0001819	synonymous_variant	51285	exon5			CTCCTCGGAGATG	AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.597C>T	15.37:g.65347441G>A		33.0	0.0	0		49.0	16.0	0.326531	NM_016563	B2RC29|B4DJW2|B4DU82	Silent	SNP	ENST00000220062.4	37	CCDS10200.1																																																																																			.	.	none		0.662	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256782.2	NM_016563	
CYP2C8	1558	hgsc.bcm.edu	37	10	96802724	96802724	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:96802724A>G	ENST00000371270.3	-	7	1166	c.1072T>C	c.(1072-1074)Tac>Cac	p.Y358H	CYP2C8_ENST00000539050.1_Missense_Mutation_p.Y272H|CYP2C8_ENST00000535898.1_Missense_Mutation_p.Y256H	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	358					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	AGGTCACTGTATCTCTGGATC	0.498																																					p.Y358H		Atlas-SNP	.											.	CYP2C8	73	.	0			c.T1072C						PASS	.						273.0	218.0	236.0					10																	96802724		2203	4300	6503	SO:0001583	missense	1558	exon7			CACTGTATCTCTG	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.1072T>C	10.37:g.96802724A>G	ENSP00000360317:p.Tyr358His	111.0	0.0	0		133.0	49.0	0.368421	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	37	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.531632	0.27387	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.69806	-0.43;-0.43;-0.43	4.49	3.32	0.38043	.	0.348041	0.24856	U	0.035053	T	0.58352	0.2116	L	0.31845	0.965	0.25918	N	0.983155	B;P;P;B	0.45594	0.426;0.862;0.554;0.303	B;P;P;B	0.46237	0.282;0.508;0.462;0.329	T	0.53330	-0.8454	10	0.72032	D	0.01	.	8.5378	0.33373	0.8271:0.0:0.0:0.1729	.	272;256;326;358	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	H	358;325;256;272	ENSP00000360317:Y358H;ENSP00000445062:Y256H;ENSP00000442343:Y272H	ENSP00000360317:Y358H	Y	-	1	0	CYP2C8	96792714	1.000000	0.71417	0.923000	0.36655	0.130000	0.20726	4.231000	0.58639	0.725000	0.32318	0.477000	0.44152	TAC	.	.	none		0.498	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
LTN1	26046	hgsc.bcm.edu	37	21	30365143	30365143	+	5'UTR	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr21:30365143G>A	ENST00000361371.5	-	0	63				LTN1_ENST00000389194.2_Missense_Mutation_p.T41I|LTN1_ENST00000389195.2_Missense_Mutation_p.T41I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1						protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GGTTGCAGCTGTACTCTGAGC	0.637																																					p.T41I		Atlas-SNP	.											.	LTN1	141	.	0			c.C122T						PASS	.						71.0	56.0	61.0					21																	30365143		2203	4300	6503	SO:0001623	5_prime_UTR_variant	26046	exon1			GCAGCTGTACTCT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.-17C>T	21.37:g.30365143G>A		85.0	0.0	0		84.0	27.0	0.321429	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	G	11.79	1.744234	0.30865	.	.	ENSG00000198862	ENST00000389194;ENST00000389195	T;T	0.23950	2.24;1.88	4.49	-1.12	0.09808	.	.	.	.	.	T	0.11324	0.0276	N	0.14661	0.345	0.20196	N	0.999928	.	.	.	.	.	.	T	0.29852	-0.9998	7	0.26408	T	0.33	.	2.0606	0.03591	0.314:0.1198:0.4439:0.1224	.	.	.	.	I	41	ENSP00000373846:T41I;ENSP00000373847:T41I	ENSP00000373846:T41I	T	-	2	0	LTN1	29287014	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	-0.194000	0.09559	-0.140000	0.11394	-0.345000	0.07892	ACA	.	.	none		0.637	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
ADAM22	53616	hgsc.bcm.edu	37	7	87765308	87765308	+	Silent	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr7:87765308C>T	ENST00000265727.7	+	14	1261	c.1182C>T	c.(1180-1182)tgC>tgT	p.C394C	ADAM22_ENST00000398209.3_Silent_p.C394C|ADAM22_ENST00000315984.7_Silent_p.C394C|ADAM22_ENST00000398201.4_Silent_p.C394C|ADAM22_ENST00000398204.4_Silent_p.C394C			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	394	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			AATGTAAATGCGAGGACACGT	0.383																																					p.C394C		Atlas-SNP	.											.	ADAM22	280	.	0			c.C1182T						PASS	.						177.0	167.0	170.0					7																	87765308		1890	4107	5997	SO:0001819	synonymous_variant	53616	exon14			TAAATGCGAGGAC	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.1182C>T	7.37:g.87765308C>T		79.0	0.0	0		72.0	19.0	0.263889	NM_021722	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1																																																																																			.	.	none		0.383	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
MAGEC1	9947	hgsc.bcm.edu	37	X	140995449	140995449	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:140995449G>A	ENST00000285879.4	+	4	2545	c.2259G>A	c.(2257-2259)ttG>ttA	p.L753L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	753										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCACTTCTTTGAGTCTTCCCC	0.552										HNSCC(15;0.026)																											p.L753L		Atlas-SNP	.											.	MAGEC1	317	.	0			c.G2259A						PASS	.						133.0	145.0	141.0					X																	140995449		2203	4300	6503	SO:0001819	synonymous_variant	9947	exon4			TTCTTTGAGTCTT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2259G>A	X.37:g.140995449G>A		52.0	0.0	0		49.0	17.0	0.346939	NM_005462	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																			.	.	none		0.552	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MUC4	4585	hgsc.bcm.edu	37	3	195515026	195515026	+	Missense_Mutation	SNP	G	G	C	rs200763050		TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:195515026G>C	ENST00000463781.3	-	2	3884	c.3425C>G	c.(3424-3426)aCt>aGt	p.T1142S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T1142S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	616					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T1142S(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.567																																					p.T1142S		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,4	MUC4	1505	4	3	Substitution - Missense(3)	skin(2)|kidney(1)	c.C3425G						PASS	.						11.0	7.0	8.0					3																	195515026		675	1482	2157	SO:0001583	missense	4585	exon2			GAGGAAGTGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3425C>G	3.37:g.195515026G>C	ENSP00000417498:p.Thr1142Ser	90.0	0.0	0		87.0	5.0	0.0574713	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.313	-0.140308	0.06669	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.35	0.545	-0.879	0.10613	.	.	.	.	.	T	0.31420	0.0796	N	0.14661	0.345	0.09310	N	1	D	0.60160	0.987	D	0.63488	0.915	T	0.16394	-1.0404	8	.	.	.	.	3.9497	0.09363	0.5686:0.0:0.4314:0.0	.	1142	E7ESK3	.	S	1142	ENSP00000417498:T1142S;ENSP00000420243:T1142S	.	T	-	2	0	MUC4	196999421	0.002000	0.14202	0.000000	0.03702	0.066000	0.16364	0.481000	0.22260	-0.332000	0.08489	0.064000	0.15345	ACT	G|0.998;C|0.002	0.002	weak		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NUDT5	11164	hgsc.bcm.edu	37	10	12215729	12215729	+	Missense_Mutation	SNP	C	C	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:12215729C>T	ENST00000491614.1	-	6	768	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	NUDT5_ENST00000378927.3_Missense_Mutation_p.E125K|NUDT5_ENST00000378940.3_Missense_Mutation_p.E125K|NUDT5_ENST00000378937.3_Missense_Mutation_p.E138K|NUDT5_ENST00000537776.1_Missense_Mutation_p.E125K|NUDT5_ENST00000378952.3_5'UTR			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5	125	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				GGAGAACATTCGGCAATGTCC	0.463																																					p.E125K		Atlas-SNP	.											.	NUDT5	10	.	0			c.G373A						PASS	.						180.0	176.0	178.0					10																	12215729		2203	4300	6503	SO:0001583	missense	11164	exon6			AACATTCGGCAAT	AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.373G>A	10.37:g.12215729C>T	ENSP00000419628:p.Glu125Lys	77.0	0.0	0		60.0	21.0	0.35	NM_014142	A8K516|Q6IAG0|Q9UH49	Missense_Mutation	SNP	ENST00000491614.1	37	CCDS7089.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279041	0.80692	.	.	ENSG00000165609	ENST00000491614;ENST00000378929;ENST00000378937;ENST00000537776;ENST00000378940;ENST00000378927	T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16	5.76	5.76	0.90799	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.047168	0.85682	D	0.000000	T	0.18002	0.0432	L	0.28776	0.89	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	P;P	0.62491	0.903;0.707	T	0.01557	-1.1325	10	0.28530	T	0.3	-33.9397	20.3242	0.98691	0.0:1.0:0.0:0.0	.	125;125	A6NCQ0;Q9UKK9	.;NUDT5_HUMAN	K	125;125;138;125;125;125	ENSP00000419628:E125K;ENSP00000368219:E138K;ENSP00000445116:E125K;ENSP00000368222:E125K;ENSP00000368209:E125K	ENSP00000368209:E125K	E	-	1	0	NUDT5	12255735	1.000000	0.71417	0.984000	0.44739	0.547000	0.35210	6.507000	0.73717	2.882000	0.98803	0.655000	0.94253	GAA	.	.	none		0.463	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046811.1		
ZWINT	11130	hgsc.bcm.edu	37	10	58120984	58120984	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr10:58120984T>C	ENST00000373944.3	-	1	52	c.14A>G	c.(13-15)gAg>gGg	p.E5G	ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000361148.6_Missense_Mutation_p.E5G|ZWINT_ENST00000395405.1_Missense_Mutation_p.E5G|ZWINT_ENST00000318387.2_5'Flank			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	5					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						CGCCTCTGTCTCCGCTGCCTC	0.587																																					p.E5G		Atlas-SNP	.											.	ZWINT	39	.	0			c.A14G						PASS	.						37.0	35.0	36.0					10																	58120984		2203	4300	6503	SO:0001583	missense	11130	exon1			TCTGTCTCCGCTG	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.14A>G	10.37:g.58120984T>C	ENSP00000363055:p.Glu5Gly	26.0	0.0	0		27.0	16.0	0.592593	NM_007057	A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	ENST00000373944.3	37	CCDS7249.1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737651	0.30774	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000373940;ENST00000361148	T;T;T	0.38401	1.14;1.14;1.17	4.03	-2.36	0.06663	.	0.931407	0.08897	N	0.877771	T	0.25754	0.0627	L	0.44542	1.39	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.27123	-1.0083	10	0.38643	T	0.18	0.0641	5.5396	0.17031	0.0:0.4279:0.1986:0.3735	.	5;5	A6NNV6;O95229	.;ZWINT_HUMAN	G	5	ENSP00000363055:E5G;ENSP00000378801:E5G;ENSP00000354921:E5G	ENSP00000354921:E5G	E	-	2	0	ZWINT	57790990	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.057000	0.14279	-0.452000	0.07087	-0.256000	0.11100	GAG	.	.	none		0.587	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1		
XIRP1	165904	hgsc.bcm.edu	37	3	39230658	39230658	+	Silent	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:39230658G>A	ENST00000340369.3	-	2	507	c.279C>T	c.(277-279)tgC>tgT	p.C93C	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Silent_p.C93C	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	93					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TCCAGCGCATGCACTGAACGT	0.607																																					p.C93C		Atlas-SNP	.											.	XIRP1	173	.	0			c.C279T						PASS	.						72.0	70.0	71.0					3																	39230658		2203	4300	6503	SO:0001819	synonymous_variant	165904	exon2			GCGCATGCACTGA	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.279C>T	3.37:g.39230658G>A		63.0	0.0	0		63.0	6.0	0.0952381	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	ENST00000340369.3	37	CCDS2683.1																																																																																			.	.	none		0.607	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
FAAH2	158584	hgsc.bcm.edu	37	X	57515299	57515299	+	Silent	SNP	G	G	T			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chrX:57515299G>T	ENST00000374900.4	+	11	1653	c.1533G>T	c.(1531-1533)ctG>ctT	p.L511L	FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	511						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						ATGATCATCTGACCCTGGCTG	0.527										HNSCC(52;0.14)																											p.L511L		Atlas-SNP	.											.	FAAH2	66	.	0			c.G1533T						PASS	.						85.0	74.0	78.0					X																	57515299		2203	4300	6503	SO:0001819	synonymous_variant	158584	exon11			TCATCTGACCCTG	AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1533G>T	X.37:g.57515299G>T		131.0	0.0	0		130.0	34.0	0.261538	NM_174912	Q86VT2|Q96N98	Silent	SNP	ENST00000374900.4	37	CCDS14375.1																																																																																			.	.	none		0.527	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
STARD13	90627	hgsc.bcm.edu	37	13	33684064	33684064	+	Missense_Mutation	SNP	T	T	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr13:33684064T>A	ENST00000336934.5	-	12	3109	c.2993A>T	c.(2992-2994)cAg>cTg	p.Q998L	STARD13_ENST00000399365.3_Missense_Mutation_p.Q880L|STARD13_ENST00000255486.4_Missense_Mutation_p.Q990L	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	998	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CAGCACATACTGGTAGATCTC	0.527											OREG0022359	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q998L		Atlas-SNP	.											.	STARD13	100	.	0			c.A2993T						PASS	.						233.0	186.0	202.0					13																	33684064		2203	4300	6503	SO:0001583	missense	90627	exon12			ACATACTGGTAGA	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2993A>T	13.37:g.33684064T>A	ENSP00000338785:p.Gln998Leu	81.0	0.0	0	841	81.0	32.0	0.395062	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812965	0.70912	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.29397	1.57;1.57;1.57	5.86	5.86	0.93980	Lipid-binding START (3);START-like domain (1);	0.053876	0.85682	D	0.000000	T	0.48677	0.1513	M	0.84683	2.71	0.80722	D	1	B;B;B	0.32653	0.107;0.379;0.215	B;B;B	0.40901	0.11;0.343;0.139	T	0.54070	-0.8348	10	0.87932	D	0	.	16.255	0.82510	0.0:0.0:0.0:1.0	.	963;998;990	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	L	880;990;998	ENSP00000382300:Q880L;ENSP00000255486:Q990L;ENSP00000338785:Q998L	ENSP00000255486:Q990L	Q	-	2	0	STARD13	32582064	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	7.950000	0.87804	2.240000	0.73641	0.533000	0.62120	CAG	.	.	none		0.527	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
TMEM177	80775	hgsc.bcm.edu	37	2	120438454	120438454	+	Missense_Mutation	SNP	G	G	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr2:120438454G>A	ENST00000424086.1	+	2	498	c.25G>A	c.(25-27)Gca>Aca	p.A9T	TMEM177_ENST00000409951.1_Missense_Mutation_p.A9T|TMEM177_ENST00000401466.1_Missense_Mutation_p.A9T|TMEM177_ENST00000496203.1_Intron|TMEM177_ENST00000272521.6_Missense_Mutation_p.A9T	NM_001105198.1	NP_001098668.1	Q53S58	TM177_HUMAN	transmembrane protein 177	9						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					GTGGCGGACCGCAGCATTTGT	0.577																																					p.A9T		Atlas-SNP	.											.	TMEM177	26	.	0			c.G25A						PASS	.						31.0	32.0	32.0					2																	120438454		2203	4300	6503	SO:0001583	missense	80775	exon2			CGGACCGCAGCAT	BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000424086.1:c.25G>A	2.37:g.120438454G>A	ENSP00000402661:p.Ala9Thr	97.0	0.0	0		98.0	37.0	0.377551	NM_030577	Q9BT20	Missense_Mutation	SNP	ENST00000424086.1	37	CCDS2128.1	.	.	.	.	.	.	.	.	.	.	G	3.212	-0.161456	0.06502	.	.	ENSG00000144120	ENST00000401466;ENST00000424086;ENST00000272521;ENST00000445518;ENST00000409951;ENST00000415646	T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26	4.05	-1.07	0.09968	.	0.587988	0.18617	N	0.135983	T	0.10380	0.0254	L	0.47716	1.5	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.10450	0.005;0.003	T	0.25257	-1.0137	10	0.26408	T	0.33	.	0.9877	0.01450	0.3926:0.1542:0.296:0.1572	.	9;9	B8ZZT5;Q53S58	.;TM177_HUMAN	T	9	ENSP00000385966:A9T;ENSP00000402661:A9T;ENSP00000272521:A9T;ENSP00000405898:A9T;ENSP00000386430:A9T	ENSP00000272521:A9T	A	+	1	0	TMEM177	120154924	0.001000	0.12720	0.000000	0.03702	0.267000	0.26476	-0.011000	0.12721	-0.221000	0.09973	0.549000	0.68633	GCA	.	.	none		0.577	TMEM177-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330673.1	NM_030577	
MYD88	4615	hgsc.bcm.edu	37	3	38181908	38181908	+	Missense_Mutation	SNP	A	A	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr3:38181908A>G	ENST00000396334.3	+	3	716	c.532A>G	c.(532-534)Atc>Gtc	p.I178V	MYD88_ENST00000443433.2_Intron|MYD88_ENST00000417037.2_Missense_Mutation_p.I178V|MYD88_ENST00000424893.1_Missense_Mutation_p.I133V|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000495303.1_Intron	NM_002468.4	NP_002459.2	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	165	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CGATGCCTTCATCTGCTATTG	0.552			Mis		ABC-DLBCL																																p.I178V		Atlas-SNP	.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	.	MYD88	900	.	0			c.A532G						PASS	.						118.0	91.0	100.0					3																	38181908		2203	4300	6503	SO:0001583	missense	4615	exon3			GCCTTCATCTGCT	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000396334.3:c.532A>G	3.37:g.38181908A>G	ENSP00000379625:p.Ile178Val	37.0	0.0	0		40.0	27.0	0.675	NM_002468	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000396334.3	37	CCDS2674.2	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805447	0.50315	.	.	ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.61	5.61	0.85477	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	L	0.43701	1.375	0.80722	D	1	B;B;B	0.22909	0.077;0.031;0.031	B;B;B	0.29077	0.086;0.098;0.098	T	0.05550	-1.0878	10	0.14252	T	0.57	.	15.3005	0.73945	1.0:0.0:0.0:0.0	.	120;165;154	Q99836-2;Q99836;B4E3D6	.;MYD88_HUMAN;.	V	178;178;133;177;154	ENSP00000401399:I178V;ENSP00000379625:I178V;ENSP00000389979:I133V;ENSP00000391753:I177V	ENSP00000379625:I178V	I	+	1	0	MYD88	38156912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.964000	0.76061	2.281000	0.76405	0.533000	0.62120	ATC	.	.	none		0.552	MYD88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253743.4	NM_002468	
ZHX2	22882	hgsc.bcm.edu	37	8	123966206	123966206	+	Missense_Mutation	SNP	T	T	C			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr8:123966206T>C	ENST00000314393.4	+	3	3291	c.2456T>C	c.(2455-2457)gTg>gCg	p.V819A		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	819					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GCAGAAGGTGTGTCGGAACTG	0.597																																					p.V819A	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.T2456C						PASS	.						101.0	73.0	82.0					8																	123966206		2203	4300	6503	SO:0001583	missense	22882	exon3			AAGGTGTGTCGGA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2456T>C	8.37:g.123966206T>C	ENSP00000314709:p.Val819Ala	87.0	0.0	0		98.0	50.0	0.510204	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.328921	0.00229	.	.	ENSG00000178764	ENST00000314393	T	0.16073	2.37	6.04	-2.28	0.06826	.	2.219640	0.01526	N	0.018567	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17258	-1.0375	10	0.08179	T	0.78	0.1412	0.4746	0.00538	0.2626:0.3085:0.1678:0.2611	.	819	Q9Y6X8	ZHX2_HUMAN	A	819	ENSP00000314709:V819A	ENSP00000314709:V819A	V	+	2	0	ZHX2	124035387	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.290000	0.18975	-0.298000	0.08921	-2.109000	0.00356	GTG	.	.	none		0.597	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
FCER1G	2207	hgsc.bcm.edu	37	1	161187859	161187859	+	Silent	SNP	C	C	A			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr1:161187859C>A	ENST00000289902.1	+	2	158	c.133C>A	c.(133-135)Cga>Aga	p.R45R	AL590714.1_ENST00000594609.1_5'Flank|FCER1G_ENST00000490414.1_Intron|FCER1G_ENST00000367992.3_Silent_p.R45R	NM_004106.1	NP_004097.1	P30273	FCERG_HUMAN	Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide	45					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|negative regulation of mast cell apoptotic process (GO:0033026)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|phagocytosis, engulfment (GO:0006911)|platelet activation (GO:0030168)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I hypersensitivity (GO:0001812)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|protein localization to plasma membrane (GO:0072659)|regulation of platelet activation (GO:0010543)|serotonin secretion by platelet (GO:0002554)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			endometrium(1)|lung(5)	6	all_cancers(52;1.35e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Benzylpenicilloyl Polylysine(DB00895)	CCTCTACTGTCGACTGAAGGT	0.562																																					p.R45R		Atlas-SNP	.											FCER1G,NS,carcinoma,-1,2	FCER1G	11	2	0			c.C133A						PASS	.						145.0	133.0	137.0					1																	161187859		2203	4300	6503	SO:0001819	synonymous_variant	2207	exon2			TACTGTCGACTGA		CCDS1225.1	1q23	2008-02-05			ENSG00000158869	ENSG00000158869			3611	protein-coding gene	gene with protein product		147139				2138619	Standard	NM_004106		Approved		uc001fyz.1	P30273	OTTHUMG00000034343	ENST00000289902.1:c.133C>A	1.37:g.161187859C>A		52.0	0.0	0		74.0	24.0	0.324324	NM_004106	Q5VTW4	Silent	SNP	ENST00000289902.1	37	CCDS1225.1																																																																																			.	.	none		0.562	FCER1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083012.1	NM_004106	
APBA3	9546	hgsc.bcm.edu	37	19	3751204	3751204	+	Missense_Mutation	SNP	T	T	G			TCGA-RQ-A6JB-01A-11D-A31X-10	TCGA-RQ-A6JB-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	820fd611-7c08-4a0a-8884-6d25954b28f4	47b47ec9-ab7b-47f1-b2f6-e76b3584891f	g.chr19:3751204T>G	ENST00000316757.3	-	10	1839	c.1639A>C	c.(1639-1641)Acc>Ccc	p.T547P	AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	547	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGGCCTCGGTGAGCAGCTCG	0.706																																					p.T547P		Atlas-SNP	.											.	APBA3	28	.	0			c.A1639C						PASS	.						15.0	14.0	14.0					19																	3751204		2142	4234	6376	SO:0001583	missense	9546	exon10			CCTCGGTGAGCAG	AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1639A>C	19.37:g.3751204T>G	ENSP00000315136:p.Thr547Pro	55.0	0.0	0		33.0	10.0	0.30303	NM_004886	O60483|Q9UPZ2	Missense_Mutation	SNP	ENST00000316757.3	37	CCDS12110.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801049	0.31869	.	.	ENSG00000011132	ENST00000316757	T	0.28069	1.63	4.68	3.66	0.41972	PDZ/DHR/GLGF (4);	0.126503	0.52532	D	0.000076	T	0.45558	0.1348	M	0.64997	1.995	0.47009	D	0.999282	D	0.76494	0.999	D	0.69824	0.966	T	0.37709	-0.9694	10	0.66056	D	0.02	.	5.0977	0.14742	0.1586:0.0873:0.0:0.7542	.	547	O96018	APBA3_HUMAN	P	547	ENSP00000315136:T547P	ENSP00000315136:T547P	T	-	1	0	APBA3	3702204	1.000000	0.71417	0.838000	0.33150	0.015000	0.08874	3.472000	0.53114	0.637000	0.30526	-0.441000	0.05720	ACC	.	.	none		0.706	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453634.2		
