#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48259060	48259060	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:48259060A>G	ENST00000435803.1	+	4	421	c.397A>G	c.(397-399)Aaa>Gaa	p.K133E		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	133					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GGACAAGGCAAAAAACTTAAA	0.433																																																	0													125.0	118.0	120.0					7																	48259060		1866	4106	5972	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.397A>G	7.37:g.48259060A>G	ENSP00000411096:p.Lys133Glu		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K133E	ENST00000435803.1	37	c.397	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	11.53	1.667231	0.29604	.	.	ENSG00000179869	ENST00000435803	T	0.30448	1.53	5.58	-1.87	0.07737	.	0.791973	0.11031	N	0.607240	T	0.20007	0.0481	L	0.47716	1.5	0.09310	N	1	B;B	0.21381	0.055;0.052	B;B	0.20767	0.008;0.031	T	0.35549	-0.9784	10	0.11794	T	0.64	.	5.7779	0.18289	0.4026:0.4338:0.1635:0.0	.	133;133	Q86UQ4;Q86UQ4-2	ABCAD_HUMAN;.	E	133	ENSP00000411096:K133E	ENSP00000409268:K133E	K	+	1	0	ABCA13	48229606	0.000000	0.05858	0.004000	0.12327	0.771000	0.43674	-0.295000	0.08298	-0.126000	0.11682	0.533000	0.62120	AAA	ABCA13	-	NULL	ENSG00000179869		0.433	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	55	0	A	NM_152701		48259060	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	15.38	66	12	SNP	0.000	G
ABCA13	154664	genome.wustl.edu	37	7	48619851	48619851	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:48619851G>A	ENST00000435803.1	+	56	14410	c.14386G>A	c.(14386-14388)Gca>Aca	p.A4796T	ABCA13_ENST00000544596.1_Missense_Mutation_p.A526T	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4796	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCTGGCACGGCAGGCGTGCT	0.537																																																	0													24.0	28.0	27.0					7																	48619851		1971	4159	6130	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14386G>A	7.37:g.48619851G>A	ENSP00000411096:p.Ala4796Thr		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A4796T	ENST00000435803.1	37	c.14386	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255425	0.59321	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.40756	1.02;1.02;1.02	5.0	3.11	0.35812	ATPase, AAA+ type, core (1);ABC transporter-like (2);	1.306700	0.05639	N	0.583050	T	0.53867	0.1823	M	0.77820	2.39	0.09310	N	1	B;P;P	0.49559	0.203;0.818;0.925	B;B;P	0.48270	0.149;0.311;0.572	T	0.36212	-0.9757	10	0.33141	T	0.24	.	10.1867	0.43002	0.0:0.0:0.6384:0.3616	.	526;2498;4796	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	T	4796;569;526	ENSP00000411096:A4796T;ENSP00000391042:A569T;ENSP00000442634:A526T	ENSP00000391042:A569T	A	+	1	0	ABCA13	48590397	0.075000	0.21258	0.001000	0.08648	0.001000	0.01503	2.868000	0.48436	0.455000	0.26910	0.637000	0.83480	GCA	ABCA13	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000179869		0.537	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2		0.00	36	0	G	NM_152701		48619851	+1			no_errors	ENST00000435803	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.002	A
ACSF2	80221	genome.wustl.edu	37	17	48540593	48540593	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:48540593G>A	ENST00000300441.4	+	7	973	c.869G>A	c.(868-870)cGc>cAc	p.R290H	ACSF2_ENST00000541920.1_Missense_Mutation_p.R130H|ACSF2_ENST00000427954.2_Missense_Mutation_p.R315H|ACSF2_ENST00000502667.1_Missense_Mutation_p.R277H|ACSF2_ENST00000504392.1_Missense_Mutation_p.R247H	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	290					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TTAGGAGAGCGCCTGAAACTG	0.627																																																	0													80.0	86.0	84.0					17																	48540593		2203	4300	6503	SO:0001583	missense	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.869G>A	17.37:g.48540593G>A	ENSP00000300441:p.Arg290His		B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R290H	ENST00000300441.4	37	c.869	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882285	0.33255	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	4.67	4.67	0.58626	AMP-dependent synthetase/ligase (1);	0.136685	0.52532	D	0.000073	T	0.66944	0.2841	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.63148	-0.6702	10	0.15499	T	0.54	-20.1513	17.7883	0.88545	0.0:0.0:1.0:0.0	.	277;315;247;290	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	H	290;130;247;315;277	ENSP00000300441:R290H;ENSP00000437987:R130H;ENSP00000425964:R247H;ENSP00000401831:R315H;ENSP00000421884:R277H	ENSP00000300441:R290H	R	+	2	0	ACSF2	45895592	1.000000	0.71417	0.942000	0.38095	0.191000	0.23601	8.811000	0.91954	2.421000	0.82119	0.563000	0.77884	CGC	ACSF2	-	pfam_AMP-dep_Synth/Lig	ENSG00000167107		0.627	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	-	0.00	28	0	G	NM_025149		48540593	+1	tier1	-	no_errors	ENST00000300441	ensembl	human	known	74_37	missense	21.43	22	6	SNP	0.875	A
ACSS3	79611	genome.wustl.edu	37	12	81648634	81648634	+	Splice_Site	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:81648634A>G	ENST00000548058.1	+	16	2905		c.e16-1		ACSS3_ENST00000261206.3_Splice_Site|ACSS3_ENST00000548324.1_Splice_Site			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3							mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TTTTTTTTCCAGATAACTTCT	0.333																																																	0													81.0	87.0	85.0					12																	81648634		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1996-1A>G	12.37:g.81648634A>G			Q8NC66	Splice_Site	SNP	-	e16-2	ENST00000548058.1	37	c.1996-2	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	A	11.46	1.644124	0.29246	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4116	0.83717	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSS3	80172765	1.000000	0.71417	0.575000	0.28536	0.043000	0.13939	6.243000	0.72384	2.276000	0.75962	0.528000	0.53228	.	ACSS3	-	-	ENSG00000111058		0.333	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	117	0	A	NM_024560	Intron	81648634	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	splice_site	8.70	63	6	SNP	1.000	G
ADORA1	134	genome.wustl.edu	37	1	203134918	203134918	+	Missense_Mutation	SNP	C	C	T	rs201703869		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:203134918C>T	ENST00000367236.4	+	3	1792	c.871C>T	c.(871-873)Cgc>Tgc	p.R291C	ADORA1_ENST00000472535.1_3'UTR|ADORA1_ENST00000337894.4_Missense_Mutation_p.R291C|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000309502.3_Missense_Mutation_p.R291C	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	291					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	CTATGCCTTCCGCATCCAGAA	0.562																																																	0													215.0	157.0	176.0					1																	203134918		2203	4300	6503	SO:0001583	missense	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.871C>T	1.37:g.203134918C>T	ENSP00000356205:p.Arg291Cys		A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adenosn_rcpt,prints_GPCR_Rhodpsn,prints_Adeno_A1_rcpt	p.R291C	ENST00000367236.4	37	c.871	CCDS1434.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.090066	0.76756	.	.	ENSG00000163485	ENST00000309502;ENST00000367236;ENST00000337894	T;T;T	0.40476	1.03;1.03;1.03	5.37	5.37	0.77165	.	0.047094	0.85682	D	0.000000	T	0.59985	0.2234	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.985;0.994	T	0.60326	-0.7285	10	0.54805	T	0.06	-38.2386	13.6736	0.62440	0.2832:0.7168:0.0:0.0	.	324;223;291	B7Z379;B7Z1L9;P30542	.;.;AA1R_HUMAN	C	291	ENSP00000308549:R291C;ENSP00000356205:R291C;ENSP00000338435:R291C	ENSP00000308549:R291C	R	+	1	0	ADORA1	201401541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.955000	0.49121	2.505000	0.84491	0.655000	0.94253	CGC	ADORA1	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn	ENSG00000163485		0.562	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	-	0.00	25	0	C	NM_000674		203134918	+1	tier1	rs201703869	no_errors	ENST00000309502	ensembl	human	known	74_37	missense	65.62	11	21	SNP	1.000	T
ADRBK1	156	genome.wustl.edu	37	11	67052330	67052330	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:67052330G>A	ENST00000308595.5	+	19	1957	c.1667G>A	c.(1666-1668)gGc>gAc	p.G556D	ADRBK1_ENST00000526285.1_Intron|ADRBK1_ENST00000527176.1_3'UTR	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	556					activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	TACGCCCTGGGCAAGGACTGC	0.587																																																	0													81.0	59.0	66.0					11																	67052330		2199	4295	6494	SO:0001583	missense	0			X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.1667G>A	11.37:g.67052330G>A	ENSP00000312262:p.Gly556Asp		B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.G556D	ENST00000308595.5	37	c.1667	CCDS8156.1	11	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490094	0.44249	.	.	ENSG00000173020	ENST00000308595	T	0.56444	0.46	4.27	3.34	0.38264	.	0.146914	0.31922	N	0.006848	T	0.44307	0.1287	L	0.44542	1.39	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.33369	-0.9871	10	0.29301	T	0.29	-18.3517	13.9671	0.64216	0.0:0.1537:0.8463:0.0	.	556	P25098	ARBK1_HUMAN	D	556	ENSP00000312262:G556D	ENSP00000312262:G556D	G	+	2	0	ADRBK1	66808906	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	8.631000	0.90991	1.117000	0.41842	0.591000	0.81541	GGC	ADRBK1	-	NULL	ENSG00000173020		0.587	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK1	HGNC	protein_coding	OTTHUMT00000393153.1		0.00	91	0	G	NM_001619		67052330	+1			no_errors	ENST00000308595	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
ADRBK2	157	genome.wustl.edu	37	22	26063736	26063736	+	Silent	SNP	C	C	A	rs200930672		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:26063736C>A	ENST00000324198.6	+	6	664	c.472C>A	c.(472-474)Cga>Aga	p.R158R		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	158	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	TGAAAGCCTTCGAGGTGACAT	0.328																																																	0													67.0	67.0	67.0					22																	26063736		2203	4299	6502	SO:0001819	synonymous_variant	0			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.472C>A	22.37:g.26063736C>A			Q9UGW9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.R158	ENST00000324198.6	37	c.472	CCDS13832.1	22																																																																																			ADRBK2	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000100077		0.328	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK2	HGNC	protein_coding	OTTHUMT00000317296.4	-	0.00	24	0	C	NM_005160		26063736	+1	tier1	-	no_errors	ENST00000324198	ensembl	human	known	74_37	silent	17.65	14	3	SNP	1.000	A
AFP	174	genome.wustl.edu	37	4	74321406	74321406	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:74321406C>T	ENST00000395792.2	+	0	1999				AFP_ENST00000226359.2_Missense_Mutation_p.T615I|AFP_ENST00000506820.1_3'UTR	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein						ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTAATTTTAACTGATTTAACA	0.274									Alpha-Fetoprotein, Hereditary Persistence of																																								0																																										SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.*69C>T	4.37:g.74321406C>T			B2RBU3	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP,prints_Alpha-fetoprotein,prints_ALB/AFP/VDB	p.T615I	ENST00000395792.2	37	c.1844	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	C	10.79	1.449713	0.26074	.	.	ENSG00000081051	ENST00000226359	T	0.57273	0.41	4.32	1.41	0.22369	.	.	.	.	.	T	0.47173	0.1431	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45760	-0.9239	6	0.87932	D	0	.	4.2829	0.10841	0.4112:0.4781:0.0:0.1107	.	.	.	.	I	615	ENSP00000226359:T615I	ENSP00000226359:T615I	T	+	2	0	AFP	74540270	0.001000	0.12720	0.040000	0.18447	0.058000	0.15608	-0.118000	0.10692	0.471000	0.27319	0.563000	0.77884	ACT	AFP	-	NULL	ENSG00000081051		0.274	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	-	0.00	84	0	C			74321406	+1	tier1	-	no_errors	ENST00000226359	ensembl	human	putative	74_37	missense	14.29	54	9	SNP	0.011	T
AIM1L	55057	genome.wustl.edu	37	1	26655271	26655271	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:26655271C>T	ENST00000308182.5	-	15	1702	c.1273G>A	c.(1273-1275)Gag>Aag	p.E425K	AIM1L_ENST00000527815.1_Missense_Mutation_p.E596K			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	425	Beta/gamma crystallin 'Greek key' 9. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)	p.E596K(1)|p.E425K(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		TTGAAGCCCTCGGCTTGCAGG	0.602																																																	2	Substitution - Missense(2)	lung(2)											153.0	130.0	138.0					1																	26655271		2203	4300	6503	SO:0001583	missense	0					1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.1273G>A	1.37:g.26655271C>T	ENSP00000310435:p.Glu425Lys		B2RNG3|Q5T137|Q5T150	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E596K	ENST00000308182.5	37	c.1786		1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586353	0.86851	.	.	ENSG00000176092	ENST00000527815;ENST00000308182	T;T	0.74526	-0.85;-0.85	5.03	4.1	0.47936	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	L	0.28274	0.84	0.80722	D	1	P	0.50369	0.934	B	0.42361	0.385	T	0.59794	-0.7387	10	0.20046	T	0.44	.	15.0212	0.71632	0.0:0.8568:0.1432:0.0	.	425	Q8N1P7	AIM1L_HUMAN	K	596;425	ENSP00000433931:E596K;ENSP00000310435:E425K	ENSP00000310435:E425K	E	-	1	0	AIM1L	26527858	0.979000	0.34478	0.990000	0.47175	0.892000	0.51952	2.477000	0.45180	1.303000	0.44873	0.561000	0.74099	GAG	AIM1L	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin	ENSG00000176092		0.602	AIM1L-201	KNOWN	basic	protein_coding	AIM1L	HGNC	protein_coding		-	0.00	43	0	C	NM_001039775.2		26655271	-1	tier1	-	no_errors	ENST00000527815	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.998	T
AKAP11	11215	genome.wustl.edu	37	13	42887235	42887235	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:42887235G>T	ENST00000025301.2	+	10	5501	c.5326G>T	c.(5326-5328)Gag>Tag	p.E1776*		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1776					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AGATTTGTATGAGGACAATTT	0.393																																																	0													135.0	122.0	126.0					13																	42887235		2203	4300	6503	SO:0001587	stop_gained	0			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5326G>T	13.37:g.42887235G>T	ENSP00000025301:p.Glu1776*		O75124|Q9NUK7	Nonsense_Mutation	SNP	NULL	p.E1776*	ENST00000025301.2	37	c.5326	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	G	46	12.665273	0.99686	.	.	ENSG00000023516	ENST00000025301	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.9719	0.97287	0.0:0.0:1.0:0.0	.	.	.	.	X	1776	.	ENSP00000025301:E1776X	E	+	1	0	AKAP11	41785235	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.718000	0.92993	0.650000	0.86243	GAG	AKAP11	-	NULL	ENSG00000023516		0.393	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	-	0.00	77	0	G	NM_016248		42887235	+1	tier1	-	no_errors	ENST00000025301	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	T
AKAP13	11214	genome.wustl.edu	37	15	86122396	86122396	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:86122396A>G	ENST00000394518.2	+	7	1192	c.1097A>G	c.(1096-1098)gAc>gGc	p.D366G	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.D366G	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	366					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAGAATACAGACCGTTCCTGT	0.493																																					Melanoma(94;603 1453 3280 32295 32951)												0													72.0	74.0	73.0					15																	86122396		2202	4299	6501	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1097A>G	15.37:g.86122396A>G	ENSP00000378026:p.Asp366Gly		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.D366G	ENST00000394518.2	37	c.1097	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	A	9.662	1.144523	0.21288	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.09538	2.97;2.98	5.52	1.86	0.25419	.	.	.	.	.	T	0.07279	0.0184	L	0.27053	0.805	0.09310	N	0.999995	B;B	0.13594	0.005;0.008	B;B	0.13407	0.004;0.009	T	0.36187	-0.9758	9	0.66056	D	0.02	.	3.6898	0.08341	0.657:0.0:0.177:0.166	.	366;366	Q12802;Q12802-2	AKP13_HUMAN;.	G	366;366;365;365	ENSP00000354718:D366G;ENSP00000378026:D366G	ENSP00000354718:D366G	D	+	2	0	AKAP13	83923400	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	-0.124000	0.10595	0.116000	0.18110	-0.256000	0.11100	GAC	AKAP13	-	NULL	ENSG00000170776		0.493	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	40	0	A	NM_007200		86122396	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	35.00	25	14	SNP	0.002	G
ANKRD30A	91074	genome.wustl.edu	37	10	37421184	37421184	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:37421184T>C	ENST00000602533.1	+	4	458	c.359T>C	c.(358-360)cTt>cCt	p.L120P	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.L120P|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.L120P|RNU6-811P_ENST00000384069.1_RNA			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	176					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTCACACCACTTTTACTATCC	0.294																																																	0													58.0	56.0	56.0					10																	37421184		1802	4070	5872	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.359T>C	10.37:g.37421184T>C	ENSP00000473551:p.Leu120Pro		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L120P	ENST00000602533.1	37	c.359		10	.	.	.	.	.	.	.	.	.	.	.	12.39	1.923823	0.34002	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	D;D	0.88277	-2.36;-2.36	2.37	2.37	0.29283	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.95592	0.8567	H	0.98005	4.125	0.47547	D	0.999455	D	0.69078	0.997	D	0.81914	0.995	D	0.93749	0.7057	9	0.66056	D	0.02	.	6.4334	0.21809	0.0:0.0:0.0:1.0	.	176	Q9BXX3	AN30A_HUMAN	P	120	ENSP00000354432:L120P;ENSP00000363792:L120P	ENSP00000354432:L120P	L	+	2	0	ANKRD30A	37461190	0.990000	0.36364	0.366000	0.25914	0.076000	0.17211	2.756000	0.47549	0.974000	0.38366	0.240000	0.17902	CTT	ANKRD30A	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.294	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2		0.00	76	0	T	NM_052997		37421184	+1			no_errors	ENST00000361713	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.742	C
APOL3	80833	genome.wustl.edu	37	22	36537959	36537959	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:36537959G>T	ENST00000349314.2	-	3	535	c.498C>A	c.(496-498)tcC>tcA	p.S166S	APOL3_ENST00000361710.2_5'UTR|APOL3_ENST00000397287.2_5'UTR|APOL3_ENST00000397293.2_Silent_p.S95S|APOL3_ENST00000424878.2_5'UTR|APOL3_ENST00000487423.1_5'UTR	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	166					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						GCTTTTCTATGGACTCCTGGA	0.493																																																	0													129.0	118.0	122.0					22																	36537959		2203	4300	6503	SO:0001819	synonymous_variant	0			AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.498C>A	22.37:g.36537959G>T			B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Silent	SNP	pfam_ApoL	p.S166	ENST00000349314.2	37	c.498	CCDS13922.1	22																																																																																			APOL3	-	pfam_ApoL	ENSG00000128284		0.493	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APOL3	HGNC	protein_coding	OTTHUMT00000319268.1	-	0.00	45	0	G	NM_145641		36537959	-1	tier1	-	no_errors	ENST00000349314	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.026	T
ARHGAP21	57584	genome.wustl.edu	37	10	24886905	24886905	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:24886905G>T	ENST00000396432.2	-	15	3652	c.3166C>A	c.(3166-3168)Cga>Aga	p.R1056R	ARHGAP21_ENST00000493154.1_5'UTR|ARHGAP21_ENST00000320481.6_Silent_p.R843R	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1055	Interaction with ARF1 and ARF6.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.R1055*(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TTTATTCTTCGACTAATTAGA	0.338																																																	1	Substitution - Nonsense(1)	lung(1)											180.0	170.0	173.0					10																	24886905		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3166C>A	10.37:g.24886905G>T			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R1056	ENST00000396432.2	37	c.3166	CCDS7144.2	10																																																																																			ARHGAP21	-	NULL	ENSG00000107863		0.338	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4		0.00	49	0	G	NM_020824		24886905	-1			no_errors	ENST00000396432	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	T
ARHGEF17	9828	genome.wustl.edu	37	11	73020375	73020376	+	In_Frame_Ins	INS	-	-	CTC	rs113363731|rs79815384|rs376101926|rs139105330	byFrequency	TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:73020375_73020376insCTC	ENST00000263674.3	+	1	1042_1043	c.692_693insCTC	c.(691-696)tgctcc>tgCTCctcc	p.235_236insS	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	235	Poly-Ser.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CGGGCCTCCTGCTCCTCCTCCT	0.693														1497	0.298922	0.7489	0.1671	5008	,	,		13735	0.0466		0.2068	False		,,,				2504	0.1391																0									,	61,2354,1453		19,0,23,836,682,374					,	3.1	1.0		dbSNP_119	18	29,1495,5912		6,0,17,234,1027,2434	no	codingComplex,codingComplex	ARHGEF17,LOC100287837	XM_002343116.2,NM_014786.3	,	25,0,40,1070,1709,2808	A1A1,A1A2,A1R,A2A2,A2R,RR		20.4949,39.1417,34.8461	,	,		90,3849,7365				SO:0001652	inframe_insertion	0			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.702_704dupCTC	11.37:g.73020382_73020384dupCTC	ENSP00000263674:p.Ser235_Ser235dup		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	In_Frame_Ins	INS	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.235in_frame_insS	ENST00000263674.3	37	c.692_693	CCDS8221.1	11																																																																																			ARHGEF17	-	NULL	ENSG00000110237		0.693	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1		0.00	14	0	-	NM_014786		73020376	+1	tier1		no_errors	ENST00000263674	ensembl	human	known	74_37	in_frame_ins	50.00	10	10	INS	0.998:1.000	CTC
ASTN1	460	genome.wustl.edu	37	1	176903418	176903418	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:176903418C>T	ENST00000367654.3	-	16	2776	c.2565G>A	c.(2563-2565)gcG>gcA	p.A855A	ASTN1_ENST00000361833.2_Silent_p.A847A|ASTN1_ENST00000367657.3_Silent_p.A847A|ASTN1_ENST00000281881.3_5'Flank|ASTN1_ENST00000424564.2_Silent_p.A847A	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	855					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.A847A(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GGTCCAACAGCGCCACAAAAT	0.542																																																	1	Substitution - coding silent(1)	large_intestine(1)											111.0	92.0	99.0					1																	176903418		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2565G>A	1.37:g.176903418C>T			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.A855	ENST00000367654.3	37	c.2565		1																																																																																			ASTN1	-	smart_MACPF	ENSG00000152092		0.542	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	40	0	C	NM_004319		176903418	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	47.62	22	20	SNP	0.149	T
ASTN1	460	genome.wustl.edu	37	1	176918382	176918382	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:176918382G>T	ENST00000367654.3	-	12	2228	c.2017C>A	c.(2017-2019)Ctc>Atc	p.L673I	ASTN1_ENST00000361833.2_Missense_Mutation_p.L665I|ASTN1_ENST00000367657.3_Missense_Mutation_p.L665I|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.L665I	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	673	EGF-like 3.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ATCTGCTGGAGGCACAGCTGC	0.607											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													68.0	66.0	67.0					1																	176918382		2203	4300	6503	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2017C>A	1.37:g.176918382G>T	ENSP00000356626:p.Leu673Ile	1934	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.L673I	ENST00000367654.3	37	c.2017		1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911354	0.92178	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.95865	0.8654	N	0.12746	0.255	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.996	D;D;D	0.77557	0.99;0.986;0.986	D	0.97317	0.9941	10	0.62326	D	0.03	-25.3959	18.5626	0.91105	0.0:0.0:1.0:0.0	.	673;665;665	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	I	665;665;673;665;665	ENSP00000356629:L665I;ENSP00000354536:L665I;ENSP00000356626:L673I;ENSP00000395041:L665I	ENSP00000354536:L665I	L	-	1	0	ASTN1	175185005	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	9.689000	0.98673	2.480000	0.83734	0.655000	0.94253	CTC	ASTN1	-	smart_EG-like_dom	ENSG00000152092		0.607	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	43	0	G	NM_004319		176918382	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	T
ASXL3	80816	genome.wustl.edu	37	18	31311980	31311980	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:31311980G>T	ENST00000269197.5	+	9	928	c.928G>T	c.(928-930)Gaa>Taa	p.E310*		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TCTAAATAATGAATTCTTTGC	0.378																																																	0													138.0	128.0	131.0					18																	31311980		1882	4100	5982	SO:0001587	stop_gained	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.928G>T	18.37:g.31311980G>T	ENSP00000269197:p.Glu310*		Q6ZMX6|Q96MU3|Q9UFC5	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.E310*	ENST00000269197.5	37	c.928	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	38	6.680997	0.97759	.	.	ENSG00000141431	ENST00000269197	.	.	.	6.04	6.04	0.98038	.	0.341741	0.28700	N	0.014432	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	.	.	.	X	310	.	ENSP00000269197:E310X	E	+	1	0	ASXL3	29565978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.984000	0.93482	2.873000	0.98535	0.563000	0.77884	GAA	ASXL3	-	NULL	ENSG00000141431		0.378	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	72	0	G			31311980	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	T
ATAD3A	55210	genome.wustl.edu	37	1	1459346	1459346	+	Splice_Site	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:1459346T>G	ENST00000378755.5	+	10	1327		c.e10+2		ATAD3A_ENST00000378756.3_Splice_Site|ATAD3A_ENST00000536055.1_Splice_Site	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A						cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		TTTGCCAAGGTGAGAGCGCCT	0.627																																																	0													69.0	65.0	66.0					1																	1459346		2203	4298	6501	SO:0001630	splice_region_variant	0			AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.1233+2T>G	1.37:g.1459346T>G			B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Splice_Site	SNP	-	e10+2	ENST00000378755.5	37	c.1233+2	CCDS31.1	1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.164999	0.38217	.	.	ENSG00000197785	ENST00000378756;ENST00000378755;ENST00000378759;ENST00000339113;ENST00000536055	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4032	0.60896	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAD3A	1449209	1.000000	0.71417	0.976000	0.42696	0.714000	0.41099	7.646000	0.83445	1.755000	0.51935	0.454000	0.30748	.	ATAD3A	-	-	ENSG00000197785		0.627	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	ATAD3A	HGNC	protein_coding	OTTHUMT00000001365.1	-	0.00	140	0	T	NM_018188	Intron	1459346	+1	tier1	-	no_errors	ENST00000378755	ensembl	human	known	74_37	splice_site	42.86	68	51	SNP	1.000	G
ATN1	1822	genome.wustl.edu	37	12	7045860	7045860	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:7045860C>T	ENST00000356654.4	+	5	1667	c.1430C>T	c.(1429-1431)tCa>tTa	p.S477L	ATN1_ENST00000396684.2_Missense_Mutation_p.S477L	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	477					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CCACCAGTCTCAACACATCAC	0.632																																																	0													109.0	120.0	116.0					12																	7045860		2203	4300	6503	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1430C>T	12.37:g.7045860C>T	ENSP00000349076:p.Ser477Leu		Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.S477L	ENST00000356654.4	37	c.1430	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.904663	0.00512	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.44083	0.93;0.93;0.93	3.88	1.97	0.26223	.	1.837880	0.03733	N	0.253792	T	0.28764	0.0713	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.14924	-1.0455	10	0.22706	T	0.39	.	4.9215	0.13872	0.3693:0.5257:0.0:0.1051	.	477;477	Q86V38;P54259	.;ATN1_HUMAN	L	477;477;477;62	ENSP00000349076:S477L;ENSP00000379915:S477L;ENSP00000441744:S477L	ENSP00000229279:S62L	S	+	2	0	ATN1	6916121	0.000000	0.05858	0.012000	0.15200	0.010000	0.07245	-0.164000	0.09983	0.229000	0.21039	-0.301000	0.09380	TCA	ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.632	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	-	0.00	98	0	C	NM_001940		7045860	+1	tier1	-	no_errors	ENST00000356654	ensembl	human	known	74_37	missense	18.82	69	16	SNP	0.056	T
ATP8B5P	158381	genome.wustl.edu	37	9	35450933	35450933	+	RNA	DEL	T	T	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:35450933delT	ENST00000430846.1	+	0	3783									ATPase, class I, type 8B, member 5, pseudogene																		GTGTTTAAACTTTTTTTTGAG	0.353																																																	0																																												0					9p13.3	2010-09-22			ENSG00000179766	ENSG00000179766		"""ATPases / P-type"""	27245	pseudogene	pseudogene	"""flippase expressed in testis splicing form A pseudogene"""					20210903, 19657017	Standard	NR_003582		Approved	FetA	uc010mkn.2		OTTHUMG00000019862		9.37:g.35450933delT				RNA	DEL	-	NULL	ENST00000430846.1	37	NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.353	ATP8B5P-002	KNOWN	basic	processed_transcript	ATP8B5P	HGNC	pseudogene	OTTHUMT00000052312.1		0.00	124	0	T	NR_003581.1		35450933	+1			no_errors	ENST00000430846	ensembl	human	known	74_37	rna	5.43	122	7	DEL	0.108	0
BAIAP2L2	80115	genome.wustl.edu	37	22	38481381	38481381	+	Splice_Site	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:38481381C>T	ENST00000381669.3	-	14	1660	c.1516G>A	c.(1516-1518)Ggc>Agc	p.G506S	SLC16A8_ENST00000320521.5_5'Flank|SLC16A8_ENST00000469516.1_5'Flank	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	506					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					GGATTTGTGCCCCTGTAGGAG	0.612																																																	0													69.0	77.0	74.0					22																	38481381		2116	4220	6336	SO:0001630	splice_region_variant	0			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1515-1G>A	22.37:g.38481381C>T			B0QYE2|Q96BG7	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.G506S	ENST00000381669.3	37	c.1516	CCDS43018.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.17|13.17	2.157289|2.157289	0.38119|0.38119	.|.	.|.	ENSG00000128298|ENSG00000128298	ENST00000428572|ENST00000381669;ENST00000402500	T|T	0.42513|0.68479	0.97|-0.33	4.14|4.14	3.11|3.11	0.35812|0.35812	.|.	0.000000|0.000000	0.85682|0.85682	U|U	0.000000|0.000000	T|T	0.76870|0.76870	0.4048|0.4048	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.77387|0.77387	-0.2607|-0.2607	8|10	0.46703|0.87932	T|D	0.11|0	-6.8437|-6.8437	10.2006|10.2006	0.43082|0.43082	0.0:0.9043:0.0:0.0957|0.0:0.9043:0.0:0.0957	.|.	.|506	.|Q6UXY1	.|BI2L2_HUMAN	E|S	181|506;492	ENSP00000410074:G181E|ENSP00000371085:G506S	ENSP00000410074:G181E|ENSP00000371085:G506S	G|G	-|-	2|1	0|0	BAIAP2L2|BAIAP2L2	36811327|36811327	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.530000|0.530000	0.34684|0.34684	5.660000|5.660000	0.68018|0.68018	0.846000|0.846000	0.35142|0.35142	0.491000|0.491000	0.48974|0.48974	GGG|GGC	BAIAP2L2	-	NULL	ENSG00000128298		0.612	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	HGNC	protein_coding	OTTHUMT00000321727.1	-	0.00	56	0	C	NM_025045	Missense_Mutation	38481381	-1	tier1	-	no_errors	ENST00000381669	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
BATF	10538	genome.wustl.edu	37	14	75989066	75989066	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:75989066G>A	ENST00000286639.6	+	1	299	c.41G>A	c.(40-42)cGc>cAc	p.R14H	BATF_ENST00000555504.1_Missense_Mutation_p.R14H|BATF_ENST00000555795.1_Intron	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	14					cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		AGCTTCAGCCGCTCTCCTCCC	0.582																																																	0													81.0	74.0	76.0					14																	75989066		2203	4300	6503	SO:0001583	missense	0			AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.41G>A	14.37:g.75989066G>A	ENSP00000286639:p.Arg14His			Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.R14H	ENST00000286639.6	37	c.41	CCDS9843.1	14	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986688	0.53934	.	.	ENSG00000156127	ENST00000286639;ENST00000555504	T	0.77877	-1.13	4.92	4.92	0.64577	.	0.132608	0.50627	D	0.000116	T	0.51822	0.1697	N	0.08118	0	0.36008	D	0.837863	P	0.36789	0.57	B	0.17098	0.017	T	0.64786	-0.6325	10	0.51188	T	0.08	-16.2395	9.6678	0.39994	0.1251:0.0:0.8749:0.0	.	14	Q16520	BATF_HUMAN	H	14	ENSP00000286639:R14H	ENSP00000286639:R14H	R	+	2	0	BATF	75058819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.801000	0.62532	2.715000	0.92844	0.655000	0.94253	CGC	BATF	-	NULL	ENSG00000156127		0.582	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF	HGNC	protein_coding	OTTHUMT00000413669.1	-	0.00	52	0	G	NM_006399		75989066	+1	tier1	-	no_errors	ENST00000286639	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
BBS12	166379	genome.wustl.edu	37	4	123664549	123664549	+	Missense_Mutation	SNP	C	C	T	rs138011813		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:123664549C>T	ENST00000314218.3	+	2	1695	c.1502C>T	c.(1501-1503)aCg>aTg	p.T501M	BBS12_ENST00000542236.1_Missense_Mutation_p.T501M	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	501			T -> M (in BBS12; significantly reduces the interaction with MKKS; shows significantly decreased interaction with BBS7; the interaction with BBS10 is not affected by this mutation). {ECO:0000269|PubMed:17160889, ECO:0000269|PubMed:21344540}.		cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)	p.T501M(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						AATTTGGTTACGGCCGTGCTC	0.423									Bardet-Biedl syndrome				C|||	1	0.000199681	0.0008	0.0	5008	,	,		21652	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)	GRCh37	CM070031	BBS12	M	rs138011813	C	MET/THR,MET/THR	2,4404	6.2+/-15.9	0,2,2201	90.0	88.0	89.0		1502,1502	5.7	1.0	4	dbSNP_134	89	0,8600		0,0,4300	no	missense,missense	BBS12	NM_001178007.1,NM_152618.2	81,81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	501/711,501/711	123664549	2,13004	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1502C>T	4.37:g.123664549C>T	ENSP00000319062:p.Thr501Met		D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.T501M	ENST00000314218.3	37	c.1502	CCDS3728.1	4	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747648	0.69533	4.54E-4	0.0	ENSG00000181004	ENST00000314218;ENST00000542236	D;D	0.82619	-1.63;-1.63	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.91412	0.7290	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91732	0.5397	10	0.87932	D	0	-22.761	19.8362	0.96658	0.0:1.0:0.0:0.0	.	501	Q6ZW61	BBS12_HUMAN	M	501	ENSP00000319062:T501M;ENSP00000438273:T501M	ENSP00000319062:T501M	T	+	2	0	BBS12	123883999	1.000000	0.71417	0.978000	0.43139	0.408000	0.30992	6.968000	0.76086	2.684000	0.91462	0.585000	0.79938	ACG	BBS12	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000181004		0.423	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS12	HGNC	protein_coding	OTTHUMT00000256710.1		0.00	49	0	C	NM_152618		123664549	+1			no_errors	ENST00000314218	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
BLNK	29760	genome.wustl.edu	37	10	97966768	97966768	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:97966768T>A	ENST00000224337.5	-	11	957	c.816A>T	c.(814-816)gaA>gaT	p.E272D	BLNK_ENST00000371176.2_Splice_Site_p.E249D|BLNK_ENST00000413476.2_Splice_Site_p.E272D|BLNK_ENST00000427367.2_Splice_Site_p.E272D	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	272					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		AGATTTTACCTTCACAAACAC	0.308																																																	0													82.0	86.0	85.0					10																	97966768		2203	4300	6503	SO:0001630	splice_region_variant	0			AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.817+1A>T	10.37:g.97966768T>A			O75498|O75499|Q2MD49	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.E272D	ENST00000224337.5	37	c.816	CCDS7446.1	10	.	.	.	.	.	.	.	.	.	.	T	19.98	3.927035	0.73327	.	.	ENSG00000095585	ENST00000224337;ENST00000371176;ENST00000427367;ENST00000413476;ENST00000537049	.	.	.	5.63	5.63	0.86233	.	0.473283	0.25857	N	0.027858	T	0.67646	0.2915	M	0.62723	1.935	0.38564	D	0.949774	D;D;D;D;D;D	0.67145	0.986;0.996;0.986;0.974;0.977;0.994	P;D;P;P;P;P	0.63793	0.737;0.918;0.824;0.689;0.65;0.793	T	0.65578	-0.6134	9	0.13853	T	0.58	-27.9035	12.5296	0.56106	0.0:0.0:0.0:1.0	.	249;272;249;167;249;272	Q2MD54;Q2MD49;Q8WV28-2;Q2MD59;Q2MD52;Q8WV28	.;.;.;.;.;BLNK_HUMAN	D	272;249;272;272;167	.	ENSP00000224337:E272D	E	-	3	2	BLNK	97956758	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	3.521000	0.53472	2.281000	0.76405	0.533000	0.62120	GAA	BLNK	-	NULL	ENSG00000095585		0.308	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	HGNC	protein_coding	OTTHUMT00000049593.1	-	0.00	81	0	T	NM_013314	Missense_Mutation	97966768	-1	tier1	-	no_errors	ENST00000224337	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
BMP7	655	genome.wustl.edu	37	20	55803475	55803475	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:55803475C>G	ENST00000395863.3	-	2	926	c.421G>C	c.(421-423)Gaa>Caa	p.E141Q	BMP7_ENST00000450594.2_Missense_Mutation_p.E141Q|BMP7_ENST00000395864.3_Missense_Mutation_p.E141Q	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	141					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			TTGTCATGTTCCACTGGAAGA	0.507																																																	0													132.0	128.0	129.0					20																	55803475		2203	4300	6503	SO:0001583	missense	0				CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.421G>C	20.37:g.55803475C>G	ENSP00000379204:p.Glu141Gln		Q9H512|Q9NTQ7	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.E141Q	ENST00000395863.3	37	c.421	CCDS13455.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.13|19.13	3.767559|3.767559	0.69878|0.69878	.|.	.|.	ENSG00000101144|ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594|ENST00000433911	T;T;T|.	0.66460|.	-0.21;-0.21;-0.21|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Transforming growth factor-beta, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75287|0.75287	0.3829|0.3829	M|M	0.69185|0.69185	2.1|2.1	0.80722|0.80722	D|D	1|1	D;B;D|.	0.71674|.	0.967;0.389;0.998|.	P;B;D|.	0.72625|.	0.834;0.403;0.978|.	T|T	0.73509|0.73509	-0.3960|-0.3960	10|5	0.44086|.	T|.	0.13|.	.|.	19.3842|19.3842	0.94550|0.94550	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	141;141;141|.	B1AKZ9;P18075;B1AL00|.	.;BMP7_HUMAN;.|.	Q|A	141|26	ENSP00000379204:E141Q;ENSP00000379205:E141Q;ENSP00000398687:E141Q|.	ENSP00000379204:E141Q|.	E|G	-|-	1|2	0|0	BMP7|BMP7	55236882|55236882	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.606000|0.606000	0.37113|0.37113	5.564000|5.564000	0.67359|0.67359	2.644000|2.644000	0.89710|0.89710	0.655000|0.655000	0.94253|0.94253	GAA|GGA	BMP7	-	pfam_TGF-b_N	ENSG00000101144		0.507	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BMP7	HGNC	protein_coding	OTTHUMT00000079831.2	-	0.00	29	0	C			55803475	-1	tier1	-	no_errors	ENST00000395863	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	G
BMPR2	659	genome.wustl.edu	37	2	203420071	203420071	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:203420071C>T	ENST00000374580.4	+	12	2222	c.1683C>T	c.(1681-1683)agC>agT	p.S561S	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	561					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						ATACTGACAGCATCGTGAAGA	0.398																																																	0													122.0	119.0	120.0					2																	203420071		2203	4300	6503	SO:0001819	synonymous_variant	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1683C>T	2.37:g.203420071C>T			Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S561	ENST00000374580.4	37	c.1683	CCDS33361.1	2																																																																																			BMPR2	-	NULL	ENSG00000204217		0.398	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1		0.00	35	0	C	NM_001204		203420071	+1			no_errors	ENST00000374580	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13606489	13606489	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:13606489G>A	ENST00000040738.5	-	10	2170	c.2035C>T	c.(2035-2037)Caa>Taa	p.Q679*		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	679	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										CGTTCTACTTGCCTTTTTACA	0.398																																																	0													257.0	269.0	265.0					4																	13606489		2203	4300	6503	SO:0001587	stop_gained	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2035C>T	4.37:g.13606489G>A	ENSP00000040738:p.Gln679*		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Nonsense_Mutation	SNP	NULL	p.Q679*	ENST00000040738.5	37	c.2035	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	37	5.984945	0.97173	.	.	ENSG00000038219	ENST00000040738	.	.	.	5.71	4.87	0.63330	.	0.350257	0.20979	N	0.082241	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-8.0221	13.0758	0.59087	0.0746:0.0:0.9254:0.0	.	.	.	.	X	679	.	ENSP00000040738:Q679X	Q	-	1	0	BOD1L	13215587	1.000000	0.71417	0.017000	0.16124	0.394000	0.30568	7.102000	0.77005	1.424000	0.47217	0.563000	0.77884	CAA	BOD1L1	-	NULL	ENSG00000038219		0.398	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	62	0	G	NM_148894		13606489	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	nonsense	29.27	29	12	SNP	0.082	A
BTF3	689	genome.wustl.edu	37	5	72795014	72795014	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:72795014G>A	ENST00000335895.8	+	2	207	c.56G>A	c.(55-57)cGc>cAc	p.R19H	RP11-79P5.9_ENST00000607001.1_lincRNA|BTF3_ENST00000380591.3_Missense_Mutation_p.R63H|BTF3_ENST00000514505.2_Intron	NM_001207.4	NP_001198.2	O00478	BT3A3_HUMAN	basic transcription factor 3	0					T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(2)	5		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		GCACAAGTGCGCATTGGTGGG	0.363																																																	0													66.0	71.0	69.0					5																	72795014		2203	4300	6503	SO:0001583	missense	0			M90352	CCDS4019.1, CCDS34185.1	5q13.3	2010-06-17			ENSG00000145741	ENSG00000145741			1125	protein-coding gene	gene with protein product		602542	"""nascent-polypeptide-associated complex beta polypeptide"""	NACB		2320128, 1386332, 15716105	Standard	NM_001207		Approved	BTF3a, BTF3b	uc003kcr.1	P20290	OTTHUMG00000102031	ENST00000335895.8:c.56G>A	5.37:g.72795014G>A	ENSP00000338516:p.Arg19His		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	p.R63H	ENST00000335895.8	37	c.188	CCDS4019.1	5	.	.	.	.	.	.	.	.	.	.	G	18.81	3.704067	0.68615	.	.	ENSG00000145741	ENST00000335895;ENST00000380591;ENST00000507081	.	.	.	4.5	4.5	0.54988	.	0.133257	0.51477	N	0.000098	T	0.58878	0.2153	L	0.50847	1.595	0.80722	D	1	B	0.19817	0.039	B	0.12156	0.007	T	0.60193	-0.7311	9	0.59425	D	0.04	-2.1294	17.7347	0.88389	0.0:0.0:1.0:0.0	.	63	P20290	BTF3_HUMAN	H	19;63;19	.	ENSP00000338516:R19H	R	+	2	0	BTF3	72830770	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.567000	0.98161	2.474000	0.83562	0.655000	0.94253	CGC	BTF3	-	NULL	ENSG00000145741		0.363	BTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTF3	HGNC	protein_coding	OTTHUMT00000219815.2	-	0.00	105	0	G	NM_001207		72795014	+1	tier1	-	no_errors	ENST00000380591	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	A
C1QL3	389941	genome.wustl.edu	37	10	16562539	16562539	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:16562539G>A	ENST00000298943.3	-	1	1465	c.526C>T	c.(526-528)Cac>Tac	p.H176Y		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	176	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						ATCAGGACGTGGTAGGTGAAG	0.642																																																	0													107.0	103.0	104.0					10																	16562539		2203	4300	6503	SO:0001583	missense	0				CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.526C>T	10.37:g.16562539G>A	ENSP00000298943:p.His176Tyr		A0PJY4|A0PJY5	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.H176Y	ENST00000298943.3	37	c.526	CCDS31156.1	10	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111065	0.77210	.	.	ENSG00000165985	ENST00000298943;ENST00000448557	T	0.76060	-0.99	4.05	4.05	0.47172	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.75150	2.29	0.58432	D	0.999999	D	0.76494	0.999	D	0.72982	0.979	D	0.87251	0.2273	10	0.62326	D	0.03	.	16.3885	0.83524	0.0:0.0:1.0:0.0	.	176	Q5VWW1	C1QL3_HUMAN	Y	176;153	ENSP00000298943:H176Y	ENSP00000298943:H176Y	H	-	1	0	C1QL3	16602545	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.666000	0.83877	2.245000	0.73994	0.637000	0.83480	CAC	C1QL3	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000165985		0.642	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QL3	HGNC	protein_coding	OTTHUMT00000047003.1	-	0.00	36	0	G	XM_372305		16562539	-1	tier1	-	no_errors	ENST00000298943	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
C6orf1	221491	genome.wustl.edu	37	6	34214625	34214625	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:34214625A>T	ENST00000476320.1	-	5	828	c.146T>A	c.(145-147)gTg>gAg	p.V49E	C6orf1_ENST00000468145.1_Missense_Mutation_p.V49E|C6orf1_ENST00000394990.4_Missense_Mutation_p.V49E|C6orf1_ENST00000335352.3_Missense_Mutation_p.V29E|C6orf1_ENST00000413013.2_Missense_Mutation_p.V29E|C6orf1_ENST00000481533.1_Missense_Mutation_p.V49E	NM_001008703.1	NP_001008703.1	Q86T20	CF001_HUMAN	chromosome 6 open reading frame 1	49						extracellular region (GO:0005576)				endometrium(1)|prostate(1)	2		Ovarian(999;0.0228)		BRCA - Breast invasive adenocarcinoma(397;1.11e-10)		GCTGGTAGCCACTCTGCCAGC	0.632											OREG0017364	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													19.0	20.0	20.0					6																	34214625		2171	4237	6408	SO:0001583	missense	0			AY062936	CCDS4790.1, CCDS75433.1	6p21.3	2011-12-12			ENSG00000186577	ENSG00000186577			1340	protein-coding gene	gene with protein product		611419				10036196	Standard	NM_178508		Approved	LBH, MGC57858	uc003ojh.3	Q86T20	OTTHUMG00000159754	ENST00000476320.1:c.146T>A	6.37:g.34214625A>T	ENSP00000417604:p.Val49Glu	846	A8K299	Missense_Mutation	SNP	NULL	p.V49E	ENST00000476320.1	37	c.146	CCDS4790.1	6	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958079	0.53400	.	.	ENSG00000186577	ENST00000476320;ENST00000335352;ENST00000394990;ENST00000481533;ENST00000413013;ENST00000468145	T;T;T;T;T;T	0.37058	1.23;1.22;1.23;1.23;1.22;1.23	4.88	-2.74	0.05932	.	0.654486	0.11690	N	0.538964	T	0.07324	0.0185	N	0.14661	0.345	0.30001	N	0.816028	P	0.37101	0.582	B	0.36464	0.225	T	0.17592	-1.0364	10	0.62326	D	0.03	-0.2407	5.6375	0.17544	0.3432:0.0:0.4985:0.1583	.	49	Q86T20	CF001_HUMAN	E	49;29;49;49;29;49	ENSP00000417604:V49E;ENSP00000334260:V29E;ENSP00000378441:V49E;ENSP00000418062:V49E;ENSP00000387460:V29E;ENSP00000418884:V49E	ENSP00000334260:V29E	V	-	2	0	C6orf1	34322603	0.534000	0.26362	0.961000	0.40146	0.978000	0.69477	-0.185000	0.09684	-0.308000	0.08792	-0.375000	0.07067	GTG	C6orf1	-	NULL	ENSG00000186577		0.632	C6orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf1	HGNC	protein_coding	OTTHUMT00000357175.1	-	0.00	33	0	A	NM_178508		34214625	-1	tier1	-	no_errors	ENST00000394990	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.835	T
CFAP69	79846	genome.wustl.edu	37	7	89937151	89937151	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:89937151A>G	ENST00000389297.4	+	21	2784	c.2533A>G	c.(2533-2535)Aac>Gac	p.N845D	C7orf63_ENST00000497910.1_Missense_Mutation_p.N827D|C7orf63_ENST00000316089.8_Missense_Mutation_p.N799D	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		845										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TAGAACATCAAACGCTAAAAC	0.343																																																	0													66.0	65.0	65.0					7																	89937151		1840	4094	5934	SO:0001583	missense	0																														ENST00000389297.4:c.2533A>G	7.37:g.89937151A>G	ENSP00000373948:p.Asn845Asp		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N845D	ENST00000389297.4	37	c.2533	CCDS43613.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.39|18.39	3.613365|3.613365	0.66672|0.66672	.|.	.|.	ENSG00000105792|ENSG00000105792	ENST00000412839;ENST00000445156|ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577	.|T;T;T;T	.|0.25414	.|2.46;2.35;2.45;1.8	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.115504	.|0.53938	.|D	.|0.000045	T|T	0.46112|0.46112	0.1376|0.1376	L|L	0.56396|0.56396	1.775|1.775	0.43662|0.43662	D|D	0.99608|0.99608	.|B;D	.|0.76494	.|0.259;0.999	.|B;D	.|0.83275	.|0.137;0.996	T|T	0.30446|0.30446	-0.9978|-0.9978	5|10	.|0.34782	.|T	.|0.22	-21.6192|-21.6192	14.1944|14.1944	0.65659|0.65659	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|827;845	.|A5D8W1-5;A5D8W1	.|.;CG063_HUMAN	R|D	73;31|845;799;827;382	.|ENSP00000373948:N845D;ENSP00000321753:N799D;ENSP00000419549:N827D;ENSP00000391571:N382D	.|ENSP00000321753:N799D	K|N	+|+	2|1	0|0	C7orf63|C7orf63	89775087|89775087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	3.940000|3.940000	0.56599|0.56599	1.949000|1.949000	0.56562|0.56562	0.528000|0.528000	0.53228|0.53228	AAA|AAC	C7orf63	-	NULL	ENSG00000105792		0.343	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4		0.00	68	0	A			89937151	+1			no_errors	ENST00000389297	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	G
CACNA1C	775	genome.wustl.edu	37	12	2666138	2666138	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:2666138G>T	ENST00000347598.4	+	11	1503	c.1503G>T	c.(1501-1503)aaG>aaT	p.K501N	CACNA1C_ENST00000399621.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000406454.3_Missense_Mutation_p.K501N|CACNA1C_ENST00000335762.5_Missense_Mutation_p.K526N|CACNA1C_ENST00000399637.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399601.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399591.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399597.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000480911.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399595.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000344100.3_Missense_Mutation_p.K501N|CACNA1C_ENST00000399655.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399603.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399644.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399638.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399629.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399641.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399649.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399634.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000399617.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000327702.7_Missense_Mutation_p.K501N|CACNA1C_ENST00000491104.1_3'UTR|CACNA1C_ENST00000399606.1_Missense_Mutation_p.K501N|CACNA1C_ENST00000402845.3_Missense_Mutation_p.K501N	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	501					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.K501N(3)|p.K36N(1)|p.K531N(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCAAGTCAAAGTTCAGGTGAG	0.493																																																	5	Substitution - Missense(5)	lung(5)											92.0	88.0	89.0					12																	2666138		1929	4134	6063	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1503G>T	12.37:g.2666138G>T	ENSP00000266376:p.Lys501Asn		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.K501N	ENST00000347598.4	37	c.1503	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646861	0.67358	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41	5.05	3.1	0.35709	.	1.031700	0.07717	N	0.943060	D	0.96364	0.8814	M	0.80508	2.5	0.51767	D	0.999934	P;D;D;P;D;D;D;D;P;D;D;P;B;D;B;D;B;B;B;B;P;B;B;P;B;P	0.71674	0.865;0.998;0.993;0.683;0.997;0.998;0.993;0.996;0.573;0.975;0.998;0.952;0.109;0.992;0.068;0.993;0.138;0.067;0.164;0.09;0.952;0.164;0.164;0.952;0.021;0.952	B;D;P;B;D;D;P;D;B;P;D;P;B;D;B;P;B;B;B;B;P;B;B;P;B;P	0.81914	0.377;0.995;0.835;0.265;0.995;0.916;0.835;0.916;0.257;0.804;0.916;0.709;0.061;0.916;0.014;0.826;0.022;0.037;0.067;0.137;0.709;0.067;0.067;0.709;0.006;0.709	D	0.90557	0.4513	10	0.72032	D	0.01	.	8.2008	0.31424	0.3447:0.0:0.6553:0.0	.	170;501;498;501;501;501;501;501;501;501;501;501;472;501;501;501;501;501;501;501;501;501;501;501;501;501	Q5V9X8;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	N	526;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;501;342	ENSP00000336982:K526N;ENSP00000382563:K501N;ENSP00000437936:K501N;ENSP00000382552:K501N;ENSP00000382547:K501N;ENSP00000382506:K501N;ENSP00000382530:K501N;ENSP00000382546:K501N;ENSP00000382500:K501N;ENSP00000382549:K501N;ENSP00000266376:K501N;ENSP00000382515:K501N;ENSP00000382510:K501N;ENSP00000341092:K501N;ENSP00000382537:K501N;ENSP00000329877:K501N;ENSP00000382557:K501N;ENSP00000385724:K501N;ENSP00000382512:K501N;ENSP00000382542:K501N;ENSP00000382526:K501N;ENSP00000385896:K501N;ENSP00000382504:K501N	ENSP00000323129:K342N	K	+	3	2	CACNA1C	2536399	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	2.558000	0.45879	0.537000	0.28751	0.655000	0.94253	AAG	CACNA1C	-	prints_VDCC_L_a1su	ENSG00000151067		0.493	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1		0.00	25	0	G	NM_000719		2666138	+1			no_errors	ENST00000399634	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
CASZ1	54897	genome.wustl.edu	37	1	10708045	10708045	+	Missense_Mutation	SNP	C	C	T	rs201167368		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:10708045C>T	ENST00000377022.3	-	16	3627	c.3310G>A	c.(3310-3312)Gct>Act	p.A1104T	CASZ1_ENST00000344008.5_Missense_Mutation_p.A1104T|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1104	Pro-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGGCTGGGAGCGGGCCCCTCC	0.706													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14043	0.0		0.0	False		,,,				2504	0.0																0								C	THR/ALA,THR/ALA	1,4399	2.1+/-5.4	0,1,2199	26.0	30.0	28.0		3310,3310	-8.9	0.1	1		28	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	CASZ1	NM_001079843.1,NM_017766.3	58,58	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	1104/1760,1104/1167	10708045	2,12994	2200	4298	6498	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3310G>A	1.37:g.10708045C>T	ENSP00000366221:p.Ala1104Thr		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1104T	ENST00000377022.3	37	c.3310	CCDS41246.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	5.343	0.248657	0.10130	2.27E-4	1.16E-4	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	5.62	-8.92	0.00774	.	0.731493	0.14470	N	0.317601	T	0.29423	0.0733	L	0.31294	0.92	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.06405	0.002;0.001	T	0.06844	-1.0804	9	0.23302	T	0.38	0.5299	16.7818	0.85564	0.0901:0.6912:0.0:0.2187	.	1104;1104	Q86V15-2;Q86V15	.;CASZ1_HUMAN	T	1104	.	ENSP00000339445:A1104T	A	-	1	0	CASZ1	10630632	0.318000	0.24598	0.100000	0.21137	0.231000	0.25187	-0.204000	0.09425	-1.701000	0.01413	-1.267000	0.01435	GCT	CASZ1	-	NULL	ENSG00000130940		0.706	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2		0.00	64	0	C	NM_017766		10708045	-1			no_errors	ENST00000377022	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.056	T
CCDC155	147872	genome.wustl.edu	37	19	49920666	49920668	+	In_Frame_Del	DEL	CTG	CTG	-	rs139882972		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:49920666_49920668delCTG	ENST00000447857.3	+	20	1793_1795	c.1588_1590delCTG	c.(1588-1590)ctgdel	p.L536del		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	536	Poly-Leu.					chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TGTCCTGGGCctgctgctgctgc	0.65																																																	0										2,210,3744		1,0,0,70,70,1837						-4.5	0.9		dbSNP_134	52	8,291,7573		1,0,6,67,157,3705	no	codingComplex	CCDC155	NM_144688.4		2,0,6,137,227,5542	A1A1,A1A2,A1R,A2A2,A2R,RR		3.7983,5.3589,4.3203				10,501,11317				SO:0001651	inframe_deletion	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1588_1590delCTG	19.37:g.49920675_49920677delCTG	ENSP00000404220:p.Leu536del		Q96MC3	In_Frame_Del	DEL	NULL	p.L533in_frame_del	ENST00000447857.3	37	c.1588_1590	CCDS46140.1	19																																																																																			CCDC155	-	NULL	ENSG00000161609		0.650	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2		0.00	29	0	CTG	NM_144688		49920668	+1	tier1		no_errors	ENST00000447857	ensembl	human	known	74_37	in_frame_del	10.34	26	3	DEL	0.981:1.000:1.000	-
CCDC158	339965	genome.wustl.edu	37	4	77300523	77300523	+	Missense_Mutation	SNP	G	G	T	rs374690016		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:77300523G>T	ENST00000388914.3	-	8	1101	c.949C>A	c.(949-951)Cgt>Agt	p.R317S	CCDC158_ENST00000434846.2_Missense_Mutation_p.R317S	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	317										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						CTGAGCTGACGCATATACATA	0.398																																																	0													149.0	136.0	140.0					4																	77300523		1879	4108	5987	SO:0001583	missense	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.949C>A	4.37:g.77300523G>T	ENSP00000373566:p.Arg317Ser		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	superfamily_Prefoldin	p.R317S	ENST00000388914.3	37	c.949	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887703	0.72410	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.77750	-1.12;1.39	5.35	5.35	0.76521	.	0.000000	0.53938	D	0.000057	T	0.71307	0.3324	N	0.19112	0.55	0.38508	D	0.948402	P;P	0.51537	0.946;0.841	P;B	0.47118	0.538;0.324	T	0.77918	-0.2408	10	0.66056	D	0.02	.	15.9979	0.80265	0.0:0.0:1.0:0.0	.	317;317	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	S	317	ENSP00000373566:R317S;ENSP00000401742:R317S	ENSP00000316815:R317S	R	-	1	0	CCDC158	77519547	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	3.783000	0.55409	2.500000	0.84329	0.650000	0.86243	CGT	CCDC158	-	NULL	ENSG00000163749		0.398	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2		0.00	75	0	G	NM_001042784		77300523	-1			no_errors	ENST00000388914	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
CCNE1	898	genome.wustl.edu	37	19	30303882	30303882	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:30303882C>T	ENST00000262643.3	+	4	397	c.118C>T	c.(118-120)Cag>Tag	p.Q40*	CCNE1_ENST00000444983.2_Nonsense_Mutation_p.Q25*|CCNE1_ENST00000357943.5_Nonsense_Mutation_p.Q40*	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	40					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			TTAGTTTTTGCAGGATCCAGA	0.532			A		serous ovarian																																			Dom	yes		19	19q12	898	cyclin E1		E	0													80.0	84.0	82.0					19																	30303882		2203	4300	6503	SO:0001587	stop_gained	0			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.118C>T	19.37:g.30303882C>T	ENSP00000262643:p.Gln40*		A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Nonsense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.Q40*	ENST00000262643.3	37	c.118	CCDS12419.1	19	.	.	.	.	.	.	.	.	.	.	C	40	8.223493	0.98714	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	.	.	.	4.58	4.58	0.56647	.	0.127336	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.713	0.85389	0.0:1.0:0.0:0.0	.	.	.	.	X	40;40;25	.	ENSP00000262643:Q40X	Q	+	1	0	CCNE1	34995722	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.705000	0.74644	2.217000	0.71921	0.561000	0.74099	CAG	CCNE1	-	pirsf_Cyclin_A/B/D/E	ENSG00000105173		0.532	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	-	0.00	94	0	C	NM_001238		30303882	+1	tier1	-	no_errors	ENST00000262643	ensembl	human	known	74_37	nonsense	5.43	87	5	SNP	1.000	T
CDC7	8317	genome.wustl.edu	37	1	91967309	91967309	+	Silent	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:91967309A>G	ENST00000428239.1	+	2	295	c.36A>G	c.(34-36)ccA>ccG	p.P12P	CDC7_ENST00000234626.6_Silent_p.P12P|CDC7_ENST00000430031.2_Silent_p.P12P|CDC7_ENST00000497611.1_3'UTR	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	12					cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		TGGATGAGCCAATGGCTTTTT	0.463											OREG0013599	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													150.0	157.0	155.0					1																	91967309		2203	4300	6503	SO:0001819	synonymous_variant	0			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.36A>G	1.37:g.91967309A>G		1286	D3DT31|O00558|Q5T5U5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P12	ENST00000428239.1	37	c.36	CCDS734.1	1																																																																																			CDC7	-	NULL	ENSG00000097046		0.463	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC7	HGNC	protein_coding	OTTHUMT00000027928.1	-	0.00	69	0	A	NM_003503		91967309	+1	tier1	-	no_errors	ENST00000234626	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.059	G
CDH11	1009	genome.wustl.edu	37	16	64982611	64982611	+	Intron	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr16:64982611A>C	ENST00000268603.4	-	13	2510				CDH11_ENST00000394156.3_Missense_Mutation_p.F658L|CDH11_ENST00000566827.1_Intron	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TAACATAGGAAAATAGCATCA	0.463			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													20.0	19.0	20.0					16																	64982611		876	1991	2867	SO:0001627	intron_variant	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1895-609T>G	16.37:g.64982611A>C			A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F658L	ENST00000268603.4	37	c.1974	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	A	13.32	2.202112	0.38905	.	.	ENSG00000140937	ENST00000394156	T	0.55234	0.53	3.79	1.41	0.22369	.	.	.	.	.	T	0.35740	0.0942	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24764	-1.0151	8	0.48119	T	0.1	.	4.3295	0.11057	0.5861:0.2111:0.0:0.2028	.	658	P55287-2	.	L	658	ENSP00000377711:F658L	ENSP00000377711:F658L	F	-	3	2	CDH11	63540112	0.001000	0.12720	0.001000	0.08648	0.029000	0.11900	1.200000	0.32247	0.251000	0.21505	0.460000	0.39030	TTT	CDH11	-	NULL	ENSG00000140937		0.463	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	56	0	A	NM_033664		64982611	-1	tier1	-	no_errors	ENST00000394156	ensembl	human	known	74_37	missense	45.45	24	20	SNP	0.001	C
CDH2	1000	genome.wustl.edu	37	18	25568592	25568592	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:25568592delA	ENST00000269141.3	-	11	2060	c.1637delT	c.(1636-1638)atafs	p.I546fs	CDH2_ENST00000399380.3_Frame_Shift_Del_p.I515fs	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	546	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CACAGGATCTATTTTTAGCCA	0.294																																																	0													103.0	107.0	105.0					18																	25568592		2203	4300	6503	SO:0001589	frameshift_variant	0			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1637delT	18.37:g.25568592delA	ENSP00000269141:p.Ile546fs		A8MWK3|B0YIY6|Q14923|Q8N173	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.I546fs	ENST00000269141.3	37	c.1637	CCDS11891.1	18																																																																																			CDH2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin/Desmocollin	ENSG00000170558		0.294	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3		0.00	49	0	A	NM_001792		25568592	-1	tier1		no_errors	ENST00000269141	ensembl	human	known	74_37	frame_shift_del	63.16	14	24	DEL	1.000	-
CDH2	1000	genome.wustl.edu	37	18	25568598	25568598	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:25568598A>T	ENST00000269141.3	-	11	2054	c.1631T>A	c.(1630-1632)cTa>cAa	p.L544Q	CDH2_ENST00000399380.3_Missense_Mutation_p.L513Q	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	544	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ATCTATTTTTAGCCAATTGGC	0.289																																																	0													99.0	103.0	101.0					18																	25568598		2203	4300	6503	SO:0001583	missense	0			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1631T>A	18.37:g.25568598A>T	ENSP00000269141:p.Leu544Gln		A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.L544Q	ENST00000269141.3	37	c.1631	CCDS11891.1	18	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468038	0.84533	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.62364	0.03;0.03	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84813	0.5555	H	0.94734	3.575	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.983	D	0.89229	0.3576	10	0.87932	D	0	.	15.9238	0.79597	1.0:0.0:0.0:0.0	.	513;544	A8MWK3;P19022	.;CADH2_HUMAN	Q	544;513	ENSP00000269141:L544Q;ENSP00000382312:L513Q	ENSP00000269141:L544Q	L	-	2	0	CDH2	23822596	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.902000	0.92568	2.221000	0.72209	0.533000	0.62120	CTA	CDH2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin/Desmocollin	ENSG00000170558		0.289	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3	-	0.00	45	0	A	NM_001792		25568598	-1	tier1	-	no_errors	ENST00000269141	ensembl	human	known	74_37	missense	63.16	12	24	SNP	1.000	T
CDH23	64072	genome.wustl.edu	37	10	73558899	73558899	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:73558899C>T	ENST00000224721.6	+	50	7106	c.7101C>T	c.(7099-7101)taC>taT	p.Y2367Y	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Silent_p.Y122Y	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2362	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CAGTGGACTACGAGGAGGTGC	0.572																																																	0													89.0	99.0	96.0					10																	73558899		2015	4186	6201	SO:0001819	synonymous_variant	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7101C>T	10.37:g.73558899C>T			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y122	ENST00000224721.6	37	c.366		10																																																																																			CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.572	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4		0.00	70	0	C	NM_052836		73558899	+1			no_errors	ENST00000398788	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.572	T
CDH9	1007	genome.wustl.edu	37	5	26988340	26988340	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:26988340C>A	ENST00000231021.4	-	2	273	c.101G>T	c.(100-102)aGc>aTc	p.S34I		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	34					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TATCTTTTTGCTTGATAAATA	0.388																																					Melanoma(8;187 585 15745 40864 52829)												0													138.0	137.0	137.0					5																	26988340		2203	4300	6503	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.101G>T	5.37:g.26988340C>A	ENSP00000231021:p.Ser34Ile		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S34I	ENST00000231021.4	37	c.101	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	6.599	0.478952	0.12581	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.58358	0.48;0.34;1.87	5.64	0.111	0.14619	.	1.105540	0.06623	N	0.757737	T	0.34658	0.0905	N	0.22421	0.69	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.001	T	0.20672	-1.0268	9	.	.	.	.	5.8522	0.18699	0.0:0.455:0.223:0.3221	.	34;34	E7EPN0;Q9ULB4	.;CADH9_HUMAN	I	34	ENSP00000231021:S34I;ENSP00000426239:S34I;ENSP00000422538:S34I	.	S	-	2	0	CDH9	27024097	0.000000	0.05858	0.005000	0.12908	0.267000	0.26476	-0.779000	0.04659	0.311000	0.23014	0.591000	0.81541	AGC	CDH9	-	NULL	ENSG00000113100		0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	36	0	C	NM_016279		26988340	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.000	A
CHDC2	286464	genome.wustl.edu	37	X	36122690	36122690	+	Silent	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:36122690A>G	ENST00000313548.4	+	8	1113	c.927A>G	c.(925-927)aaA>aaG	p.K309K		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	309						integral component of membrane (GO:0016021)											ATACACCAAAAGTCAATCCTT	0.358																																																	0													125.0	104.0	111.0					X																	36122690		2202	4300	6502	SO:0001819	synonymous_variant	0			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.927A>G	X.37:g.36122690A>G				Silent	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain	p.K309	ENST00000313548.4	37	c.927	CCDS14238.1	X																																																																																			CHDC2	-	NULL	ENSG00000176034		0.358	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDC2	HGNC	protein_coding		-	0.00	70	0	A	NM_173695		36122690	+1	tier1	-	no_errors	ENST00000313548	ensembl	human	known	74_37	silent	71.70	15	38	SNP	0.004	G
CIR1	9541	genome.wustl.edu	37	2	175213712	175213713	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:175213712_175213713insT	ENST00000342016.3	-	10	957_958	c.865_866insA	c.(865-867)atafs	p.I289fs	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	289	Lys/Ser-rich.				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						cttcctttgtatttttttttct	0.381																																																	0																																										SO:0001589	frameshift_variant	0			AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.866dupA	2.37:g.175213721_175213721dupT	ENSP00000339723:p.Ile289fs		A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Frame_Shift_Ins	INS	pfam_CIR_N_dom,superfamily_Znf_CCHC	p.I289fs	ENST00000342016.3	37	c.866_865	CCDS2256.1	2																																																																																			CIR1	-	NULL	ENSG00000138433		0.381	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIR1	HGNC	protein_coding	OTTHUMT00000255460.1		0.00	28	0	-	NM_004882		175213713	-1	tier1		no_errors	ENST00000342016	ensembl	human	known	74_37	frame_shift_ins	14.81	23	4	INS	0.109:0.130	T
CLEC17A	388512	genome.wustl.edu	37	19	14710574	14710574	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:14710574G>A	ENST00000417570.1	+	11	730	c.692G>A	c.(691-693)cGt>cAt	p.R231H	CLEC17A_ENST00000397439.2_Missense_Mutation_p.R214H|CLEC17A_ENST00000547437.1_Missense_Mutation_p.R231H	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	231						cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										GACATTGCCCGTGTAAGAGCT	0.567																																																	0													52.0	54.0	53.0					19																	14710574		2030	4192	6222	SO:0001583	missense	0			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.692G>A	19.37:g.14710574G>A	ENSP00000393719:p.Arg231His		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.R231H	ENST00000417570.1	37	c.692	CCDS56087.1	19	.	.	.	.	.	.	.	.	.	.	G	6.731	0.503584	0.12822	.	.	ENSG00000187912	ENST00000547437;ENST00000397439;ENST00000417570	T;T;T	0.64085	-0.08;-0.08;-0.08	4.5	-1.24	0.09435	.	0.683764	0.11645	N	0.543345	T	0.37433	0.1003	N	0.12746	0.255	0.09310	N	1	B;B;B	0.17465	0.022;0.022;0.013	B;B;B	0.09377	0.004;0.004;0.002	T	0.18241	-1.0343	10	0.34782	T	0.22	-17.8235	6.9495	0.24538	0.5982:0.0:0.4018:0.0	.	231;231;231	Q6ZS10-2;Q6ZS10-3;Q6ZS10	.;.;CL17A_HUMAN	H	231;214;231	ENSP00000450065:R231H;ENSP00000380581:R214H;ENSP00000393719:R231H	ENSP00000341620:R231H	R	+	2	0	CLEC17A	14571574	0.000000	0.05858	0.003000	0.11579	0.292000	0.27327	-1.565000	0.02150	0.025000	0.15241	0.655000	0.94253	CGT	CLEC17A	-	NULL	ENSG00000187912		0.567	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC17A	HGNC	protein_coding	OTTHUMT00000403400.1		0.00	47	0	G	NM_207390		14710574	+1			no_errors	ENST00000417570	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.001	A
CNTN3	5067	genome.wustl.edu	37	3	74411155	74411155	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:74411155T>G	ENST00000263665.6	-	10	1277	c.1250A>C	c.(1249-1251)aAg>aCg	p.K417T		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	417	Ig-like C2-type 5.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGAACCAACTTCTTCATTGG	0.473																																																	0													64.0	69.0	67.0					3																	74411155		2203	4300	6503	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1250A>C	3.37:g.74411155T>G	ENSP00000263665:p.Lys417Thr		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K417T	ENST00000263665.6	37	c.1250	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	T	14.92	2.678446	0.47886	.	.	ENSG00000113805	ENST00000263665	T	0.69561	-0.41	5.71	4.54	0.55810	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.239916	0.42964	D	0.000635	T	0.56062	0.1960	L	0.41961	1.31	0.29403	N	0.861774	B	0.14438	0.01	B	0.22152	0.038	T	0.51419	-0.8708	10	0.33141	T	0.24	.	9.0758	0.36519	0.0:0.1443:0.0:0.8557	.	417	Q9P232	CNTN3_HUMAN	T	417	ENSP00000263665:K417T	ENSP00000263665:K417T	K	-	2	0	CNTN3	74493845	0.893000	0.30496	0.817000	0.32601	0.989000	0.77384	1.790000	0.38734	2.178000	0.69098	0.482000	0.46254	AAG	CNTN3	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000113805		0.473	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	54	0	T	NM_020872		74411155	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	missense	61.54	10	16	SNP	0.703	G
COL6A1	1291	genome.wustl.edu	37	21	47404277	47404277	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr21:47404277G>T	ENST00000361866.3	+	3	436	c.322G>T	c.(322-324)Ggc>Tgc	p.G108C		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	108	N-terminal globular domain.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GCGCATGCCTGGCGGCCGCGA	0.617																																																	0													74.0	52.0	59.0					21																	47404277		2200	4298	6498	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.322G>T	21.37:g.47404277G>T	ENSP00000355180:p.Gly108Cys		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G108C	ENST00000361866.3	37	c.322	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880938	0.33255	.	.	ENSG00000142156	ENST00000361866;ENST00000538397	D	0.83250	-1.7	4.27	-1.47	0.08772	von Willebrand factor, type A (3);	0.257891	0.38436	N	0.001682	T	0.78811	0.4342	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	D	0.68192	0.956	T	0.72447	-0.4291	10	0.52906	T	0.07	-20.584	8.9661	0.35877	0.82:0.0:0.18:0.0	.	108	P12109	CO6A1_HUMAN	C	108	ENSP00000355180:G108C	ENSP00000355180:G108C	G	+	1	0	COL6A1	46228705	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	0.550000	0.23345	-0.652000	0.05408	0.555000	0.69702	GGC	COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142156		0.617	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	-	0.00	59	0	G	NM_001848		47404277	+1	tier1	-	no_errors	ENST00000361866	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.004	T
CRISP3	10321	genome.wustl.edu	37	6	49700907	49700907	+	Splice_Site	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:49700907C>T	ENST00000393666.1	-	5	528		c.e5+1		CRISP3_ENST00000423399.2_Splice_Site|CRISP3_ENST00000371159.4_Splice_Site|CRISP3_ENST00000263045.4_Splice_Site|CRISP3_ENST00000433368.2_Splice_Site			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3						defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)		p.?(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TATATACTTACGCAGGACAAT	0.299																																																	2	Unknown(2)	lung(1)|kidney(1)											103.0	107.0	106.0					6																	49700907		2203	4298	6501	SO:0001630	splice_region_variant	0			X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.521+1G>A	6.37:g.49700907C>T			A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Splice_Site	SNP	-	e6+1	ENST00000393666.1	37	c.590+1		6	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763998	0.49574	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000423399;ENST00000371159	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3304	0.66553	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRISP3	49808866	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	3.148000	0.50647	2.526000	0.85167	0.561000	0.74099	.	CRISP3	-	-	ENSG00000096006		0.299	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	CRISP3	HGNC	protein_coding		-	0.00	56	0	C	NM_006061	Intron	49700907	-1	tier1	-	no_errors	ENST00000433368	ensembl	human	known	74_37	splice_site	32.08	36	17	SNP	1.000	T
CYP4V2	285440	genome.wustl.edu	37	4	187130387	187130387	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:187130387G>T	ENST00000378802.4	+	10	1670	c.1366G>T	c.(1366-1368)Gcc>Tcc	p.A456S	CYP4V2_ENST00000502665.1_3'UTR	NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	456					fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		CCATCCATATGCCTACGTGCC	0.537																																																	0													115.0	104.0	108.0					4																	187130387		2203	4300	6503	SO:0001583	missense	0			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.1366G>T	4.37:g.187130387G>T	ENSP00000368079:p.Ala456Ser		B7U6W2|Q6ZTM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.A456S	ENST00000378802.4	37	c.1366	CCDS34119.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.76|13.76	2.333316|2.333316	0.41297|0.41297	.|.	.|.	ENSG00000145476|ENSG00000164344	ENST00000378802;ENST00000274118|ENST00000511608	T|.	0.70164|.	-0.46|.	5.39|5.39	1.57|1.57	0.23409|0.23409	.|.	0.216802|.	0.47455|.	N|.	0.000231|.	T|T	0.64907|0.64907	0.2641|0.2641	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	P|.	0.34826|.	0.471|.	B|.	0.37508|.	0.252|.	T|T	0.60167|0.60167	-0.7316|-0.7316	10|5	0.41790|.	T|.	0.15|.	.|.	15.0427|15.0427	0.71803|0.71803	0.0:0.0:0.5137:0.4863|0.0:0.0:0.5137:0.4863	.|.	456|.	Q6ZWL3|.	CP4V2_HUMAN|.	S|I	456;434|54	ENSP00000368079:A456S|.	ENSP00000274118:A434S|.	A|M	+|+	1|3	0|0	CYP4V2|KLKB1	187367381|187367381	0.996000|0.996000	0.38824|0.38824	0.000000|0.000000	0.03702|0.03702	0.196000|0.196000	0.23810|0.23810	2.724000|2.724000	0.47285|0.47285	0.072000|0.072000	0.16694|0.16694	-0.169000|-0.169000	0.13324|0.13324	GCC|ATG	CYP4V2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV	ENSG00000145476		0.537	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4V2	HGNC	protein_coding	OTTHUMT00000360398.1	-	0.00	34	0	G	XM_209612		187130387	+1	tier1	-	no_errors	ENST00000378802	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.611	T
CYTIP	9595	genome.wustl.edu	37	2	158300475	158300475	+	Missense_Mutation	SNP	C	C	T	rs200094703		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:158300475C>T	ENST00000264192.3	-	1	179	c.58G>A	c.(58-60)Gct>Act	p.A20T	CYTIP_ENST00000540637.1_Intron|AC019201.1_ENST00000401235.1_RNA|CYTIP_ENST00000497432.1_Intron	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	20					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						GCTGGCCCAGCGCAGAAGTCC	0.507																																																	0													160.0	149.0	153.0					2																	158300475		2203	4300	6503	SO:0001583	missense	0			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.58G>A	2.37:g.158300475C>T	ENSP00000264192:p.Ala20Thr		B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A20T	ENST00000264192.3	37	c.58	CCDS2204.1	2	.	.	.	.	.	.	.	.	.	.	C	6.584	0.476115	0.12521	.	.	ENSG00000115165	ENST00000264192	T	0.17691	2.26	5.72	-7.48	0.01360	.	1.291780	0.04953	N	0.460646	T	0.08223	0.0205	N	0.24115	0.695	0.09310	N	0.999995	B	0.06786	0.001	B	0.04013	0.001	T	0.30679	-0.9970	10	0.36615	T	0.2	1.107	1.6025	0.02677	0.2044:0.1346:0.2019:0.4591	.	20	O60759	CYTIP_HUMAN	T	20	ENSP00000264192:A20T	ENSP00000264192:A20T	A	-	1	0	CYTIP	158008721	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.306000	0.02735	-1.125000	0.02932	-0.136000	0.14681	GCT	CYTIP	-	NULL	ENSG00000115165		0.507	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTIP	HGNC	protein_coding	OTTHUMT00000254926.1	-	0.00	52	0	C	NM_004288		158300475	-1	tier1	rs200094703	no_errors	ENST00000264192	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	T
DAGLB	221955	genome.wustl.edu	37	7	6452617	6452617	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:6452617C>T	ENST00000297056.6	-	12	1645	c.1476G>A	c.(1474-1476)ctG>ctA	p.L492L	DAGLB_ENST00000436575.1_Silent_p.L451L|DAGLB_ENST00000428902.2_Missense_Mutation_p.G352R|DAGLB_ENST00000425398.2_Silent_p.L363L|DAGLB_ENST00000421761.2_Intron	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	492					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CATCCTTCCCCAGGACGAGTG	0.547																																																	0													63.0	59.0	60.0					7																	6452617		2203	4300	6503	SO:0001819	synonymous_variant	0			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1476G>A	7.37:g.6452617C>T			A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	pfam_Lipase_3	p.G352R	ENST00000297056.6	37	c.1054	CCDS5350.1	7	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136931	0.21123	.	.	ENSG00000164535	ENST00000428902	.	.	.	5.52	-11.0	0.00169	.	.	.	.	.	T	0.29288	0.0729	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33752	-0.9856	5	0.21014	T	0.42	-7.5718	1.5254	0.02524	0.2862:0.4562:0.1271:0.1304	.	.	.	.	R	352	.	ENSP00000416046:G352R	G	-	1	0	DAGLB	6419142	0.006000	0.16342	0.044000	0.18714	0.253000	0.25986	-1.082000	0.03400	-2.343000	0.00623	-0.345000	0.07892	GGG	DAGLB	-	NULL	ENSG00000164535		0.547	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLB	HGNC	protein_coding	OTTHUMT00000246840.2		0.00	39	0	C	NM_139179		6452617	-1			no_errors	ENST00000428902	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.547	T
DAPK1	1612	genome.wustl.edu	37	9	90321181	90321181	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:90321181C>T	ENST00000408954.3	+	26	3530	c.3195C>T	c.(3193-3195)acC>acT	p.T1065T	DAPK1_ENST00000472284.1_Silent_p.T1065T|DAPK1_ENST00000469640.2_Silent_p.T1090T|DAPK1_ENST00000358077.5_Silent_p.T1065T|DAPK1_ENST00000491893.1_Silent_p.T999T	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1065					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GCCGCTACACCGTGGAGGACA	0.677									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													28.0	34.0	32.0					9																	90321181		2100	4219	6319	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3195C>T	9.37:g.90321181C>T			B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.T1090	ENST00000408954.3	37	c.3270	CCDS43842.1	9																																																																																			DAPK1	-	NULL	ENSG00000196730		0.677	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	-	0.00	46	0	C	NM_004938		90321181	+1	tier1	-	no_errors	ENST00000469640	ensembl	human	known	74_37	silent	24.49	37	12	SNP	0.738	T
DCAF4L1	285429	genome.wustl.edu	37	4	41984854	41984854	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:41984854C>T	ENST00000333141.5	+	1	1142	c.1045C>T	c.(1045-1047)Ctc>Ttc	p.L349F		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	349										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						TGCCCACCTGCTCAGAACCAT	0.637																																																	0													93.0	77.0	83.0					4																	41984854		2203	4300	6503	SO:0001583	missense	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.1045C>T	4.37:g.41984854C>T	ENSP00000327796:p.Leu349Phe		B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L349F	ENST00000333141.5	37	c.1045	CCDS33978.1	4	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372773	0.61624	.	.	ENSG00000182308	ENST00000333141	T	0.34072	1.38	0.97	0.97	0.19692	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.42131	0.1189	M	0.85859	2.78	0.37957	D	0.932839	D	0.63046	0.992	P	0.48627	0.584	T	0.49579	-0.8925	10	0.87932	D	0	.	3.297	0.06970	0.0:0.6995:0.0:0.3004	.	349	Q3SXM0	DC4L1_HUMAN	F	349	ENSP00000327796:L349F	ENSP00000327796:L349F	L	+	1	0	DCAF4L1	41679611	1.000000	0.71417	0.021000	0.16686	0.508000	0.34012	1.807000	0.38902	0.821000	0.34540	0.313000	0.20887	CTC	DCAF4L1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000182308		0.637	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	-	0.00	70	0	C	NM_001029955		41984854	+1	tier1	-	no_errors	ENST00000333141	ensembl	human	known	74_37	missense	69.84	19	44	SNP	1.000	T
DCAF4L1	285429	genome.wustl.edu	37	4	41984856	41984856	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:41984856C>T	ENST00000333141.5	+	1	1144	c.1047C>T	c.(1045-1047)ctC>ctT	p.L349L		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	349										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						CCCACCTGCTCAGAACCATCC	0.637																																																	0													93.0	77.0	82.0					4																	41984856		2203	4300	6503	SO:0001819	synonymous_variant	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.1047C>T	4.37:g.41984856C>T			B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L349	ENST00000333141.5	37	c.1047	CCDS33978.1	4																																																																																			DCAF4L1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000182308		0.637	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	-	0.00	66	0	C	NM_001029955		41984856	+1	tier1	-	no_errors	ENST00000333141	ensembl	human	known	74_37	silent	68.33	19	41	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32472939	32472939	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:32472939C>T	ENST00000357033.4	-	26	3649	c.3443G>A	c.(3442-3444)aGa>aAa	p.R1148K	DMD_ENST00000378677.2_Missense_Mutation_p.R1144K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1148					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGCCTCCTTTCTGGCATAGAC	0.363																																																	0													99.0	87.0	91.0					X																	32472939		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3443G>A	X.37:g.32472939C>T	ENSP00000354923:p.Arg1148Lys		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R1148K	ENST00000357033.4	37	c.3443	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	8.888	0.953260	0.18431	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.59638	0.25;0.25	5.25	3.11	0.35812	.	0.600320	0.13383	U	0.391966	T	0.24967	0.0606	N	0.02247	-0.625	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.12156	0.001;0.007;0.002	T	0.13980	-1.0489	10	0.06625	T	0.88	.	5.9327	0.19148	0.0:0.5389:0.0:0.4611	.	1140;1148;1144	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	K	1140;1144;1148;1148;1025	ENSP00000367948:R1144K;ENSP00000354923:R1148K	ENSP00000354923:R1148K	R	-	2	0	DMD	32382860	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.002000	0.63952	0.989000	0.38761	0.594000	0.82650	AGA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.363	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	39	0	C	NM_004006		32472939	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	76.92	9	30	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196765009	196765009	+	Silent	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:196765009C>A	ENST00000312428.6	-	28	4645	c.4545G>T	c.(4543-4545)ctG>ctT	p.L1515L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1515					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCTCTACCTTCAGATTCCCAG	0.408																																																	0													129.0	125.0	126.0					2																	196765009		1913	4138	6051	SO:0001819	synonymous_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4545G>T	2.37:g.196765009C>A			B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L1515	ENST00000312428.6	37	c.4545	CCDS42794.1	2																																																																																			DNAH7	-	superfamily_P-loop_NTPase	ENSG00000118997		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	70	0	C	NM_018897		196765009	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	silent	39.62	32	21	SNP	0.530	A
DNALI1	7802	genome.wustl.edu	37	1	38027201	38027203	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:38027201_38027203delGCT	ENST00000296218.7	+	4	517_519	c.507_509delGCT	c.(505-510)gggctg>ggg	p.L173del	DNALI1_ENST00000541606.1_In_Frame_Del_p.L25del|DNALI1_ENST00000497858.1_3'UTR	NM_003462.3	NP_003453.2	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	151					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGAGAGGGGGCTGCTGCTGCTG	0.606											OREG0013380	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001651	inframe_deletion	0			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000296218.7:c.507_509delGCT	1.37:g.38027210_38027212delGCT	ENSP00000296218:p.Leu173del	875	A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	In_Frame_Del	DEL	pfam_Axonemal_dynein_light_chain	p.L173in_frame_del	ENST00000296218.7	37	c.507_509	CCDS420.1	1																																																																																			DNALI1	-	pfam_Axonemal_dynein_light_chain	ENSG00000163879		0.606	DNALI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	HGNC	protein_coding	OTTHUMT00000012159.1		0.00	35	0	GCT	NM_003462		38027203	+1	tier1		no_errors	ENST00000296218	ensembl	human	known	74_37	in_frame_del	6.06	31	2	DEL	0.797:1.000:1.000	-
DNM1P47	100216544	genome.wustl.edu	37	15	102299761	102299761	+	RNA	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:102299761G>A	ENST00000561463.1	+	0	7807									DNM1 pseudogene 47																		TCATGGAGGAGTCGGCAGAGC	0.582																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299761G>A				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	14	0	G	NG_009149		102299761	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	54.55	5	6	SNP	1.000	A
DPF3	8110	genome.wustl.edu	37	14	73137681	73137681	+	Intron	DEL	G	G	-	rs566073429	byFrequency	TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:73137681delG	ENST00000556509.1	-	8	871				DPF3_ENST00000541685.1_3'UTR|DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000546183.1_3'UTR	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ACAGAGGGGTGGGGGGAGGGA	0.433																																																	0																																										SO:0001627	intron_variant	0			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.871+3266C>-	14.37:g.73137681delG			A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	RNA	DEL	-	NULL	ENST00000556509.1	37	NULL		14																																																																																			DPF3	-	-	ENSG00000205683		0.433	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2		0.00	32	0	G			73137681	-1	tier1		no_errors	ENST00000557704	ensembl	human	known	74_37	rna	12.50	14	2	DEL	0.000	-
DVL2	1856	genome.wustl.edu	37	17	7130508	7130508	+	Silent	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:7130508G>A	ENST00000005340.5	-	13	1726	c.1444C>T	c.(1444-1446)Ctg>Ttg	p.L482L	DVL2_ENST00000575458.1_Silent_p.L476L|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	482	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GCTTTGAGCAGCCCGCTGGCA	0.597																																																	0													135.0	125.0	128.0					17																	7130508		2203	4300	6503	SO:0001819	synonymous_variant	0			BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1444C>T	17.37:g.7130508G>A			D3DTN3|Q53XM0	Silent	SNP	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_2,prints_Dishevelled_fam	p.L482	ENST00000005340.5	37	c.1444	CCDS11091.1	17																																																																																			DVL2	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000004975		0.597	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DVL2	HGNC	protein_coding	OTTHUMT00000219999.2		0.00	44	0	G	NM_004422		7130508	-1			no_errors	ENST00000005340	ensembl	human	known	74_37	silent	8.00	23	2	SNP	1.000	A
DYNC1LI2	1783	genome.wustl.edu	37	16	66776515	66776515	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr16:66776515G>T	ENST00000258198.2	-	4	561	c.355C>A	c.(355-357)Ctg>Atg	p.L119M	DYNC1LI2_ENST00000440564.2_Missense_Mutation_p.L80M|DYNC1LI2_ENST00000443351.2_Intron|DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.L119M	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	119					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		GCAAATTTCAGCAGGCCTTTG	0.468																																																	0													85.0	78.0	80.0					16																	66776515		2200	4300	6500	SO:0001583	missense	0			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.355C>A	16.37:g.66776515G>T	ENSP00000258198:p.Leu119Met		A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.L119M	ENST00000258198.2	37	c.355	CCDS10818.1	16	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684532	0.68157	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000440564	T;T;T	0.24538	1.85;1.85;1.85	5.07	3.06	0.35304	.	0.000000	0.64402	D	0.000001	T	0.52092	0.1713	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.973;0.99	T	0.58719	-0.7587	10	0.87932	D	0	-19.4179	9.7737	0.40605	0.2628:0.0:0.7372:0.0	.	80;119;119	B4E2E0;B4DHD8;O43237	.;.;DC1L2_HUMAN	M	119;119;80	ENSP00000258198:L119M;ENSP00000368795:L119M;ENSP00000408566:L80M	ENSP00000258198:L119M	L	-	1	2	DYNC1LI2	65334016	0.702000	0.27816	1.000000	0.80357	0.993000	0.82548	1.089000	0.30890	1.434000	0.47414	0.563000	0.77884	CTG	DYNC1LI2	-	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	ENSG00000135720		0.468	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI2	HGNC	protein_coding	OTTHUMT00000268846.1	-	0.00	47	0	G	NM_006141		66776515	-1	tier1	-	no_errors	ENST00000258198	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
E2F7	144455	genome.wustl.edu	37	12	77421832	77421832	+	Silent	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:77421832G>A	ENST00000322886.7	-	11	2206	c.1971C>T	c.(1969-1971)ggC>ggT	p.G657G	E2F7_ENST00000416496.2_Silent_p.G657G	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	657					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CAGGGAGTTGGCCATTCACAT	0.448																																																	0													116.0	109.0	111.0					12																	77421832		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1971C>T	12.37:g.77421832G>A			A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	pfam_E2F_TDP	p.G657	ENST00000322886.7	37	c.1971	CCDS9016.1	12																																																																																			E2F7	-	NULL	ENSG00000165891		0.448	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	HGNC	protein_coding	OTTHUMT00000406716.1		0.00	60	0	G	XM_084871		77421832	-1			no_errors	ENST00000322886	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.000	A
EIF4A2	1974	genome.wustl.edu	37	3	186503674	186503674	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:186503674C>T	ENST00000323963.5	+	5	415	c.351C>T	c.(349-351)atC>atT	p.I117I	SNORA63_ENST00000363548.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_Silent_p.I22I|EIF4A2_ENST00000440191.2_Silent_p.I118I|SNORA81_ENST00000408493.2_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	117	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GGTTTTAGATCCAAAAGGTAA	0.398			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0													72.0	72.0	72.0					3																	186503674		2203	4300	6503	SO:0001819	synonymous_variant	0			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.351C>T	3.37:g.186503674C>T			D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,pfscan_RNA_helicase_DEAD_Q_motif	p.P72S	ENST00000323963.5	37	c.214	CCDS3282.1	3																																																																																			EIF4A2	-	NULL	ENSG00000156976		0.398	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	HGNC	protein_coding	OTTHUMT00000344609.1		0.00	40	0	C	NM_001967		186503674	+1			no_errors	ENST00000443963	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
EMID1	129080	genome.wustl.edu	37	22	29627097	29627097	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:29627097C>T	ENST00000404820.3	+	6	681	c.554C>T	c.(553-555)gCc>gTc	p.A185V	EMID1_ENST00000404755.3_Missense_Mutation_p.A185V|EMID1_ENST00000334018.6_Missense_Mutation_p.A185V|EMID1_ENST00000484039.1_3'UTR			Q96A84	EMID1_HUMAN	EMI domain containing 1	183	Collagen-like.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)		p.A185V(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						CCCCCTCCTGCCCAGGGCAGC	0.617																																																	1	Substitution - Missense(1)	ovary(1)											51.0	53.0	52.0					22																	29627097		2203	4300	6503	SO:0001583	missense	0			AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.554C>T	22.37:g.29627097C>T	ENSP00000384452:p.Ala185Val		B0QYK6|Q6ICG1|Q86SS7	Missense_Mutation	SNP	pfam_Collagen,pfam_EMI_domain,pfscan_EMI_domain	p.A185V	ENST00000404820.3	37	c.554		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.645|9.645	1.139924|1.139924	0.21205|0.21205	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127|ENST00000433143	D;T;D;D;T|.	0.90324|.	-2.65;0.59;-2.51;-2.65;0.69|.	4.95|4.95	1.69|1.69	0.24217|0.24217	.|.	0.682217|.	0.12677|.	N|.	0.448313|.	T|T	0.35770|0.35770	0.0943|0.0943	N|N	0.17564|0.17564	0.495|0.495	0.37107|0.37107	D|D	0.900188|0.900188	B;B;B;B|.	0.10296|.	0.002;0.002;0.002;0.003|.	B;B;B;B|.	0.09377|.	0.002;0.002;0.002;0.004|.	T|T	0.19844|0.19844	-1.0293|-1.0293	10|5	0.27785|.	T|.	0.31|.	-4.8813|-4.8813	7.0351|7.0351	0.24989|0.24989	0.0:0.7298:0.0:0.2702|0.0:0.7298:0.0:0.2702	.|.	185;185;183;185|.	B0QYK4;B0QYK5;Q96A84;Q96A84-3|.	.;.;EMID1_HUMAN;.|.	V|S	185;185;185;185;157|31	ENSP00000335481:A185V;ENSP00000403816:A185V;ENSP00000385414:A185V;ENSP00000384452:A185V;ENSP00000399760:A157V|.	ENSP00000335481:A185V|.	A|P	+|+	2|1	0|0	EMID1|EMID1	27957097|27957097	0.948000|0.948000	0.32251|0.32251	0.999000|0.999000	0.59377|0.59377	0.026000|0.026000	0.11368|0.11368	2.095000|2.095000	0.41729|0.41729	0.622000|0.622000	0.30249|0.30249	0.585000|0.585000	0.79938|0.79938	GCC|CCC	EMID1	-	NULL	ENSG00000186998		0.617	EMID1-002	NOVEL	basic|appris_principal	protein_coding	EMID1	HGNC	protein_coding	OTTHUMT00000321075.1		0.00	47	0	C	NM_133455		29627097	+1			no_errors	ENST00000334018	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.998	T
ENPP3	5169	genome.wustl.edu	37	6	131973681	131973681	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:131973681G>T	ENST00000414305.1	+	5	605		c.e5-1		ENPP3_ENST00000358229.5_Splice_Site|ENPP3_ENST00000470930.1_Splice_Site|ENPP3_ENST00000543135.1_Splice_Site|ENPP3_ENST00000427148.2_Splice_Site|ENPP3_ENST00000357639.3_Splice_Site			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3						immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TCGTTTTACAGCTCGAATATG	0.343																																																	0													129.0	126.0	127.0					6																	131973681		2203	4300	6503	SO:0001630	splice_region_variant	0			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.278-1G>T	6.37:g.131973681G>T			Q5JTL3	Splice_Site	SNP	-	e4-1	ENST00000414305.1	37	c.278-1	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	G	9.606	1.129910	0.21041	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3803	0.83458	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ENPP3	132015374	1.000000	0.71417	0.983000	0.44433	0.031000	0.12232	6.213000	0.72194	2.597000	0.87782	0.650000	0.86243	.	ENPP3	-	-	ENSG00000154269		0.343	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	-	0.00	79	0	G		Intron	131973681	+1	tier1	-	no_errors	ENST00000357639	ensembl	human	known	74_37	splice_site	6.67	56	4	SNP	1.000	T
AC105245.1	0	genome.wustl.edu	37	18	26776475	26776475	+	RNA	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:26776475T>C	ENST00000390796.2	-	0	17																											ccgcaattacttttgcaccaa	0.313																																																	0																																												0																															18.37:g.26776475T>C				RNA	SNP	-	NULL	ENST00000390796.2	37	NULL		18																																																																																			AC105245.1	-	-	ENSG00000212085		0.313	AC105245.1-201	NOVEL	basic	miRNA	ENSG00000212085	Clone_based_ensembl_gene	miRNA		-	0.00	76	0	T			26776475	-1	tier1	-	no_errors	ENST00000390796	ensembl	human	novel	74_37	rna	66.67	16	32	SNP	0.024	C
AL445258.1	0	genome.wustl.edu	37	X	145072453	145072453	+	RNA	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:145072453T>G	ENST00000401213.1	-	0	2				hsa-mir-892c_ENST00000516410.1_RNA																							AGTAGGGAACTTCCCACAGCA	0.483																																																	0																																												0																															X.37:g.145072453T>G				RNA	SNP	-	NULL	ENST00000401213.1	37	NULL		X																																																																																			AL445258.1	-	-	ENSG00000216032		0.483	AL445258.1-201	NOVEL	basic	miRNA	ENSG00000216032	Clone_based_ensembl_gene	miRNA		-	0.00	27	0	T			145072453	-1	tier1	-	no_errors	ENST00000401213	ensembl	human	novel	74_37	rna	58.62	12	17	SNP	0.000	G
AK5	26289	genome.wustl.edu	37	1	77857162	77857163	+	Intron	INS	-	-	TGTA	rs201658908		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:77857162_77857163insTGTA	ENST00000354567.2	+	7	1154				AC095030.1_ENST00000408737.1_RNA|AK5_ENST00000344720.5_Intron	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						acatatgtgtgtgtgtatgtgt	0.233																																																	0																																										SO:0001627	intron_variant	0			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19503->TGTA	1.37:g.77857162_77857163insTGTA			Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	INS	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			AC095030.1	-	-	ENSG00000221664		0.233	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000026993.4		0.00	46	0	-	NM_174858		77857163	-1	tier1		no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	15.22	39	7	INS	0.991:0.991	TGTA
MYADM	91663	genome.wustl.edu	37	19	54379103	54379103	+	3'UTR	SNP	C	C	A	rs75956082|rs566590150|rs369211393		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:54379103C>A	ENST00000391769.2	+	0	2600				AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_3'UTR|MYADM_ENST00000391770.4_3'UTR|MYADM_ENST00000391771.1_3'UTR	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker						establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		gactccatctcaaaaaaaaaa	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.*1351C>A	19.37:g.54379103C>A			B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	RNA	SNP	-	NULL	ENST00000391769.2	37	NULL	CCDS12866.1	19																																																																																			AC008440.5	-	-	ENSG00000232220		0.498	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232220	Clone_based_vega_gene	protein_coding	OTTHUMT00000134337.1	-	0.00	30	0	C	NM_138373		54379103	-1	tier1	rs75956082	no_errors	ENST00000413496	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.000	A
CSNK1E	1454	genome.wustl.edu	37	22	38766010	38766010	+	Intron	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:38766010C>A	ENST00000400206.2	-	4	193				RP3-449O17.1_ENST00000457665.1_RNA			P49674	KC1E_HUMAN	casein kinase 1, epsilon						cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GCAACATTTTCAGCATCTCCA	0.358																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)												0																																										SO:0001627	intron_variant	0				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000400206.2:c.273-8445G>T	22.37:g.38766010C>A				RNA	SNP	-	NULL	ENST00000400206.2	37	NULL	CCDS13970.1	22																																																																																			RP3-449O17.1	-	-	ENSG00000244627		0.358	CSNK1E-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000244627	Clone_based_vega_gene	protein_coding	OTTHUMT00000321460.1	-	0.00	78	0	C	NM_001894		38766010	-1	tier1	-	no_errors	ENST00000381645	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.007	A
NARS2	79731	genome.wustl.edu	37	11	78154811	78154811	+	Intron	DEL	A	A	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:78154811delA	ENST00000281038.5	-	12	1540				NARS2_ENST00000528850.1_Intron|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)						asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	CAACCTAAGGAAAAAAAAAAA	0.393																																																	0													35.0	37.0	36.0					11																	78154811		2200	4292	6492	SO:0001627	intron_variant	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1165-7T>-	11.37:g.78154811delA			G3V178	RNA	DEL	-	NULL	ENST00000281038.5	37	NULL	CCDS8261.1	11																																																																																			RP11-452H21.1	-	-	ENSG00000254420		0.393	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254420	Clone_based_vega_gene	protein_coding	OTTHUMT00000391138.2		0.00	24	0	A	NM_024678		78154811	+1	tier1		no_errors	ENST00000534168	ensembl	human	known	74_37	rna	16.00	21	4	DEL	0.000	-
RP11-597A11.6	0	genome.wustl.edu	37	14	20146080	20146080	+	lincRNA	SNP	G	G	A	rs201264404		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:20146080G>A	ENST00000555580.1	-	0	285				RP11-597A11.1_ENST00000548261.1_RNA																							TCGATCTTCAGTTGAGCTTCC	0.463																																																	0																																												0																															14.37:g.20146080G>A				RNA	SNP	-	NULL	ENST00000555580.1	37	NULL		14																																																																																			RP11-597A11.1	-	-	ENSG00000258027		0.463	RP11-597A11.6-001	KNOWN	basic	lincRNA	ENSG00000258027	Clone_based_vega_gene	lincRNA	OTTHUMT00000409767.1	-	0.00	21	0	G			20146080	+1	tier1	rs201264404	no_errors	ENST00000548261	ensembl	human	known	74_37	rna	26.67	11	4	SNP	1.000	A
EPB41L3	23136	genome.wustl.edu	37	18	5433926	5433926	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:5433926A>G	ENST00000341928.2	-	7	1140	c.800T>C	c.(799-801)gTg>gCg	p.V267A	EPB41L3_ENST00000400111.3_Missense_Mutation_p.V267A|EPB41L3_ENST00000544123.1_Missense_Mutation_p.V267A|EPB41L3_ENST00000540638.2_Missense_Mutation_p.V267A|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.V267A	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	267	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CAGCTCGATCACTTTGTCTTC	0.498																																																	0													290.0	255.0	267.0					18																	5433926		2203	4300	6503	SO:0001583	missense	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.800T>C	18.37:g.5433926A>G	ENSP00000343158:p.Val267Ala		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V267A	ENST00000341928.2	37	c.800	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	A	31	5.103370	0.94245	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	6.16	6.16	0.99307	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.165284	0.52532	D	0.000063	D	0.90480	0.7018	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.71674	0.992;0.998;0.998;0.998;0.997	D;D;D;D;D	0.81914	0.987;0.965;0.995;0.991;0.989	D	0.91580	0.5278	10	0.87932	D	0	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	267;267;158;267;267	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	A	267;158;267;158;267;267	ENSP00000343158:V267A;ENSP00000441174:V267A;ENSP00000341138:V267A;ENSP00000382981:V267A	ENSP00000343158:V267A	V	-	2	0	EPB41L3	5423926	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.367000	0.80283	0.528000	0.53228	GTG	EPB41L3	-	pirsf_Band_41_protein,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000082397		0.498	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	62	0	A	NM_012307		5433926	-1	tier1	-	no_errors	ENST00000341928	ensembl	human	known	74_37	missense	26.04	70	25	SNP	1.000	G
EPHA5	2044	genome.wustl.edu	37	4	66280141	66280141	+	Silent	SNP	C	C	T	rs368999628		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:66280141C>T	ENST00000273854.3	-	7	2148	c.1548G>A	c.(1546-1548)acG>acA	p.T516T	EPHA5_ENST00000511294.1_Silent_p.T516T|EPHA5_ENST00000354839.4_Silent_p.T516T|EPHA5_ENST00000432638.2_Silent_p.T352T	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	516	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ATTTGATAATCGTGTAGCTGG	0.393										TSP Lung(17;0.13)																																							0								C	,	0,4406		0,0,2203	176.0	142.0	153.0		1548,1548	-5.7	0.9	4		153	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	EPHA5	NM_004439.5,NM_182472.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	516/1038,516/1016	66280141	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1548G>A	4.37:g.66280141C>T			Q7Z3F2	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T516	ENST00000273854.3	37	c.1548	CCDS3513.1	4																																																																																			EPHA5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3	ENSG00000145242		0.393	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	-	0.00	33	0	C	NM_004439		66280141	-1	tier1	-	no_errors	ENST00000273854	ensembl	human	known	74_37	silent	73.91	6	17	SNP	0.836	T
EPHX3	79852	genome.wustl.edu	37	19	15341894	15341894	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:15341894C>T	ENST00000221730.3	-	4	715	c.495G>A	c.(493-495)tcG>tcA	p.S165S	EPHX3_ENST00000435261.1_Silent_p.S165S|EPHX3_ENST00000602233.1_Silent_p.S165S	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	165						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						GGATGCACTTCGAGTAACCTG	0.572																																																	0													91.0	78.0	83.0					19																	15341894		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.495G>A	19.37:g.15341894C>T			A3KMR3	Silent	SNP	pfam_AB_hydrolase_1,prints_Epox_hydrolase-like,prints_AB_hydrolase_1	p.S165	ENST00000221730.3	37	c.495	CCDS12327.1	19																																																																																			EPHX3	-	pfam_AB_hydrolase_1	ENSG00000105131		0.572	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EPHX3	HGNC	protein_coding	OTTHUMT00000465797.1		0.00	50	0	C	NM_024794		15341894	-1			no_errors	ENST00000221730	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.999	T
ERC2	26059	genome.wustl.edu	37	3	56330140	56330140	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:56330140C>T	ENST00000288221.6	-	3	1236	c.981G>A	c.(979-981)gaG>gaA	p.E327E		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	327						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GCCGCGTTCGCTCATTGTCAT	0.448																																																	0													179.0	177.0	177.0					3																	56330140		1903	4114	6017	SO:0001819	synonymous_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.981G>A	3.37:g.56330140C>T			Q2T9F6|Q86TK4	Silent	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.E327	ENST00000288221.6	37	c.981	CCDS46851.1	3																																																																																			ERC2	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000187672		0.448	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	84	0	C	NM_015576		56330140	-1	tier1	-	no_errors	ENST00000288221	ensembl	human	known	74_37	silent	40.70	51	35	SNP	0.981	T
EVA1A	84141	genome.wustl.edu	37	2	75720457	75720457	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:75720457G>T	ENST00000233712.1	-	4	801	c.364C>A	c.(364-366)Cag>Aag	p.Q122K	EVA1A_ENST00000410010.1_Missense_Mutation_p.Q110K|EVA1A_ENST00000410113.1_Missense_Mutation_p.Q122K|EVA1A_ENST00000393913.3_Missense_Mutation_p.Q122K|EVA1A_ENST00000410071.1_Missense_Mutation_p.Q122K|EVA1A_ENST00000490746.1_Intron	NM_032181.2	NP_115557.1	Q9H8M9	EVA1A_HUMAN	eva-1 homolog A (C. elegans)	122					apoptotic process (GO:0006915)|autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)											TCCAGCCGCTGGGCGCGCTCC	0.617																																																	0													42.0	45.0	44.0					2																	75720457		2203	4300	6503	SO:0001583	missense	0			BC016157	CCDS1959.1	2p12	2012-11-05	2012-11-05	2012-11-05	ENSG00000115363	ENSG00000115363			25816	protein-coding gene	gene with protein product			"""transmembrane protein 166"", ""family with sequence similarity 176, member A"""	TMEM166, FAM176A		12477932	Standard	NM_001135032		Approved	FLJ13391	uc002sni.2	Q9H8M9	OTTHUMG00000129991	ENST00000233712.1:c.364C>A	2.37:g.75720457G>T	ENSP00000233712:p.Gln122Lys		D6W5J3|Q9HC41	Missense_Mutation	SNP	NULL	p.Q122K	ENST00000233712.1	37	c.364	CCDS1959.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.104752	0.94245	.	.	ENSG00000115363	ENST00000393913;ENST00000233712;ENST00000410113;ENST00000410010;ENST00000410071;ENST00000432649	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	M	0.84846	2.72	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.73170	-0.4067	10	0.66056	D	0.02	0.685	16.7196	0.85407	0.0:0.0:1.0:0.0	.	122	Q9H8M9	F176A_HUMAN	K	122;122;122;110;122;122	ENSP00000377490:Q122K;ENSP00000233712:Q122K;ENSP00000386435:Q122K;ENSP00000386835:Q110K;ENSP00000386930:Q122K;ENSP00000398249:Q122K	ENSP00000233712:Q122K	Q	-	1	0	FAM176A	75573965	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	9.751000	0.98889	2.722000	0.93159	0.655000	0.94253	CAG	EVA1A	-	NULL	ENSG00000115363		0.617	EVA1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EVA1A	HGNC	protein_coding	OTTHUMT00000328707.1	-	0.00	43	0	G	NM_032181		75720457	-1	tier1	-	no_errors	ENST00000233712	ensembl	human	known	74_37	missense	30.95	29	13	SNP	1.000	T
FAM155A	728215	genome.wustl.edu	37	13	108518848	108518848	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:108518848C>T	ENST00000375915.2	-	1	235	c.97G>A	c.(97-99)Gag>Aag	p.E33K		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	33						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TGAGCCCTCTCGGAATCGATG	0.532																																																	0													163.0	172.0	169.0					13																	108518848		2203	4300	6503	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.97G>A	13.37:g.108518848C>T	ENSP00000365080:p.Glu33Lys		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.E33K	ENST00000375915.2	37	c.97	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761680	0.89932	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	L	0.50333	1.59	0.50813	D	0.999893	D	0.76494	0.999	D	0.76071	0.987	T	0.77874	-0.2425	9	0.87932	D	0	.	17.5823	0.87972	0.0:1.0:0.0:0.0	.	33	B1AL88	F155A_HUMAN	K	33	.	ENSP00000365080:E33K	E	-	1	0	FAM155A	107316849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.437000	0.66544	2.390000	0.81377	0.650000	0.86243	GAG	FAM155A	-	NULL	ENSG00000204442		0.532	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	78	0	C	NM_001080396		108518848	-1	tier1	-	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	7.25	64	5	SNP	1.000	T
FAM173B	134145	genome.wustl.edu	37	5	10239369	10239369	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:10239369delA	ENST00000511437.1	-	2	128	c.116delT	c.(115-117)ttafs	p.L40fs	FAM173B_ENST00000280330.8_5'UTR|FAM173B_ENST00000510047.1_Frame_Shift_Del_p.L40fs|FAM173B_ENST00000510052.1_5'UTR	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	40						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						CCCAGTAAGTAAGAACCCCCA	0.483																																																	0													102.0	108.0	106.0					5																	10239369		1964	4149	6113	SO:0001589	frameshift_variant	0				CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.116delT	5.37:g.10239369delA	ENSP00000422338:p.Leu40fs		B4DT41|B4DXK2|E9PBZ4	Frame_Shift_Del	DEL	NULL	p.L39fs	ENST00000511437.1	37	c.116	CCDS43301.1	5																																																																																			FAM173B	-	NULL	ENSG00000150756		0.483	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM173B	HGNC	protein_coding	OTTHUMT00000366048.2		0.00	55	0	A	NM_199133		10239369	-1	tier1		no_errors	ENST00000511437	ensembl	human	known	74_37	frame_shift_del	13.33	13	2	DEL	0.000	-
FAM170A	340069	genome.wustl.edu	37	5	118969736	118969736	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:118969736G>A	ENST00000515256.1	+	3	465	c.293G>A	c.(292-294)cGc>cAc	p.R98H				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	98					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R98H(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						ACTCCTCCCCGCTCACAACAT	0.483																																																	1	Substitution - Missense(1)	large_intestine(1)											101.0	106.0	105.0					5																	118969736		1935	4141	6076	SO:0001583	missense	0			AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.293G>A	5.37:g.118969736G>A	ENSP00000422684:p.Arg98His		Q66LM8|Q7Z4V2|Q8IW94	Missense_Mutation	SNP	NULL	p.R98H	ENST00000515256.1	37	c.293		5	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922949	0.18056	.	.	ENSG00000164334	ENST00000296787;ENST00000515256;ENST00000509264	T;T	0.29917	1.55;1.55	4.35	-2.1	0.07210	.	2.326850	0.01275	N	0.009541	T	0.15782	0.0380	N	0.08118	0	0.09310	N	1	B;D;D	0.57571	0.0;0.963;0.98	B;B;P	0.44597	0.001;0.36;0.454	T	0.03818	-1.1001	9	.	.	.	0.2677	1.5766	0.02626	0.236:0.4185:0.1677:0.1778	.	51;98;98	D6RIE9;A1A519;A2VCN0	.;F170A_HUMAN;.	H	51;98;98	ENSP00000422684:R98H;ENSP00000423697:R98H	.	R	+	2	0	FAM170A	118997635	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.938000	0.01546	-0.453000	0.07076	-0.826000	0.03091	CGC	FAM170A	-	NULL	ENSG00000164334		0.483	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	FAM170A	HGNC	protein_coding	OTTHUMT00000371126.1		0.00	76	0	G	NM_182761		118969736	+1			no_errors	ENST00000515256	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.000	A
FAM179A	165186	genome.wustl.edu	37	2	29222063	29222063	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:29222063G>T	ENST00000379558.4	+	4	507	c.156G>T	c.(154-156)gaG>gaT	p.E52D	FAM179A_ENST00000403861.2_Missense_Mutation_p.E52D	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	52										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCCAGCCTGAGCCAAGAGCCC	0.622																																																	0													36.0	39.0	38.0					2																	29222063		2122	4232	6354	SO:0001583	missense	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.156G>T	2.37:g.29222063G>T	ENSP00000368876:p.Glu52Asp		Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.E52D	ENST00000379558.4	37	c.156	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714534	0.30413	.	.	ENSG00000189350	ENST00000420297;ENST00000379558;ENST00000403861	T;T;T	0.44881	0.91;3.07;2.89	5.51	-0.871	0.10642	.	.	.	.	.	T	0.21145	0.0509	N	0.14661	0.345	0.09310	N	1	B;B	0.18310	0.027;0.016	B;B	0.23018	0.043;0.019	T	0.21245	-1.0251	9	0.27785	T	0.31	.	3.9533	0.09379	0.2666:0.0:0.4617:0.2717	.	52;52	F8W8E4;Q6ZUX3	.;F179A_HUMAN	D	52	ENSP00000402415:E52D;ENSP00000368876:E52D;ENSP00000384699:E52D	ENSP00000368876:E52D	E	+	3	2	FAM179A	29075567	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.348000	0.07740	-0.521000	0.06426	-0.362000	0.07510	GAG	FAM179A	-	NULL	ENSG00000189350		0.622	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	-	0.00	47	0	G	NM_199280		29222063	+1	tier1	-	no_errors	ENST00000379558	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.000	T
FARP2	9855	genome.wustl.edu	37	2	242312706	242312706	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:242312706G>T	ENST00000264042.3	+	2	353		c.e2+1		FARP2_ENST00000479427.1_Splice_Site|FARP2_ENST00000373287.4_Splice_Site|FARP2_ENST00000545004.1_Splice_Site	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TGACATTGAGGTAAGAAGCAT	0.408																																																	0													72.0	75.0	74.0					2																	242312706		2203	4300	6503	SO:0001630	splice_region_variant	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.183+1G>T	2.37:g.242312706G>T			B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Splice_Site	SNP	-	e1+1	ENST00000264042.3	37	c.183+1	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141173	0.37825	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000418082;ENST00000445489	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9066	0.88920	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FARP2	241961379	1.000000	0.71417	1.000000	0.80357	0.331000	0.28603	7.651000	0.83577	2.653000	0.90120	0.563000	0.77884	.	FARP2	-	-	ENSG00000006607		0.408	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	-	0.00	72	0	G		Intron	242312706	+1	tier1	-	no_errors	ENST00000264042	ensembl	human	known	74_37	splice_site	64.86	13	24	SNP	1.000	T
FAT2	2196	genome.wustl.edu	37	5	150900870	150900870	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:150900870G>A	ENST00000261800.5	-	18	11296	c.11284C>T	c.(11284-11286)Cgg>Tgg	p.R3762W		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3762					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGTGGTGCCGCGGGGTTAGG	0.607																																																	0													62.0	56.0	58.0					5																	150900870		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11284C>T	5.37:g.150900870G>A	ENSP00000261800:p.Arg3762Trp		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R3762W	ENST00000261800.5	37	c.11284	CCDS4317.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.67|13.67	2.305303|2.305303	0.40795|0.40795	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.52295	.|0.67	5.99|5.99	1.65|1.65	0.23941|0.23941	.|Concanavalin A-like lectin/glucanase, subgroup (1);	.|0.121842	.|0.36444	.|N	.|0.002588	T|T	0.61413|0.61413	0.2345|0.2345	M|M	0.73217|0.73217	2.22|2.22	0.09310|0.09310	N|N	0.999996|0.999996	.|D;D	.|0.89917	.|0.997;1.0	.|P;P	.|0.56434	.|0.798;0.798	T|T	0.62955|0.62955	-0.6744|-0.6744	5|10	.|0.66056	.|D	.|0.02	.|.	16.8995|16.8995	0.86109|0.86109	0.0:0.0:0.4665:0.5335|0.0:0.0:0.4665:0.5335	.|.	.|3762;953	.|Q9NYQ8;E9PDJ8	.|FAT2_HUMAN;.	V|W	620|3762	.|ENSP00000261800:R3762W	.|ENSP00000261800:R3762W	A|R	-|-	2|1	0|2	FAT2|FAT2	150881063|150881063	0.966000|0.966000	0.33281|0.33281	0.454000|0.454000	0.27019|0.27019	0.299000|0.299000	0.27559|0.27559	2.427000|2.427000	0.44740|0.44740	0.389000|0.389000	0.25086|0.25086	-0.169000|-0.169000	0.13324|0.13324	GCG|CGG	FAT2	-	NULL	ENSG00000086570		0.607	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	28	0	G	NM_001447		150900870	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	69.57	7	16	SNP	0.047	A
FAT3	120114	genome.wustl.edu	37	11	92531188	92531188	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:92531188A>C	ENST00000298047.6	+	9	5026	c.5009A>C	c.(5008-5010)aAg>aCg	p.K1670T	FAT3_ENST00000525166.1_Missense_Mutation_p.K1520T|FAT3_ENST00000409404.2_Missense_Mutation_p.K1670T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1670	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCTCACCCCAAGTTCATTCAC	0.423										TCGA Ovarian(4;0.039)																																							0													104.0	103.0	103.0					11																	92531188		1982	4164	6146	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5009A>C	11.37:g.92531188A>C	ENSP00000298047:p.Lys1670Thr		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.K1670T	ENST00000298047.6	37	c.5009		11	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880202	0.72294	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.60548	0.18;0.18;0.18	5.93	3.62	0.41486	.	.	.	.	.	T	0.55737	0.1939	L	0.39692	1.235	0.80722	D	1	D	0.56287	0.975	P	0.52386	0.697	T	0.48681	-0.9014	9	0.32370	T	0.25	.	10.1965	0.43058	0.8659:0.0:0.1341:0.0	.	1670	Q8TDW7-3	.	T	1670;1670;1520	ENSP00000298047:K1670T;ENSP00000387040:K1670T;ENSP00000432586:K1520T	ENSP00000298047:K1670T	K	+	2	0	FAT3	92170836	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	5.287000	0.65645	0.502000	0.28037	0.482000	0.46254	AAG	FAT3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.423	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	41	0	A	NM_001008781		92531188	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	60.71	11	17	SNP	1.000	C
FAT3	120114	genome.wustl.edu	37	11	92534875	92534875	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:92534875G>T	ENST00000298047.6	+	9	8713	c.8696G>T	c.(8695-8697)gGa>gTa	p.G2899V	FAT3_ENST00000525166.1_Missense_Mutation_p.G2749V|FAT3_ENST00000409404.2_Missense_Mutation_p.G2899V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2899	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCTGACCTTGGAGAGGCATTC	0.507										TCGA Ovarian(4;0.039)																																							0													104.0	104.0	104.0					11																	92534875		2096	4224	6320	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8696G>T	11.37:g.92534875G>T	ENSP00000298047:p.Gly2899Val		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G2899V	ENST00000298047.6	37	c.8696		11	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217449	0.79352	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.06218	3.33;3.33;3.33	6.04	6.04	0.98038	.	.	.	.	.	T	0.45657	0.1353	H	0.98507	4.25	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.65911	-0.6053	9	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	2899	Q8TDW7-3	.	V	2899;2899;2749	ENSP00000298047:G2899V;ENSP00000387040:G2899V;ENSP00000432586:G2749V	ENSP00000298047:G2899V	G	+	2	0	FAT3	92174523	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.951000	0.87819	2.873000	0.98535	0.563000	0.77884	GGA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.507	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	28	0	G	NM_001008781		92534875	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	T
FAXC	84553	genome.wustl.edu	37	6	99729193	99729193	+	Silent	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:99729193C>A	ENST00000389677.5	-	6	1359	c.1077G>T	c.(1075-1077)ctG>ctT	p.L359L	FAXC_ENST00000538471.1_Silent_p.L79L|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	359						integral component of membrane (GO:0016021)											AGCTAAAATCCAGCAGCGGGG	0.473																																																	0													100.0	99.0	99.0					6																	99729193		2203	4300	6503	SO:0001819	synonymous_variant	0			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.1077G>T	6.37:g.99729193C>A			B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Silent	SNP	superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.L359	ENST00000389677.5	37	c.1077	CCDS34500.1	6																																																																																			FAXC	-	NULL	ENSG00000146267		0.473	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	HGNC	protein_coding	OTTHUMT00000041589.4	-	0.00	38	0	C	NM_032511		99729193	-1	tier1	-	no_errors	ENST00000389677	ensembl	human	known	74_37	silent	15.91	37	7	SNP	1.000	A
FCHO2	115548	genome.wustl.edu	37	5	72377780	72377780	+	Silent	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:72377780G>A	ENST00000430046.2	+	23	2267	c.2151G>A	c.(2149-2151)acG>acA	p.T717T	FCHO2_ENST00000341845.6_Silent_p.T717T|FCHO2_ENST00000512348.1_Silent_p.T684T	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	717	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with DAB2, EPS15, EPS15R and ITSN1.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GAGGAGTAACGAACATGCAGT	0.423																																																	0													166.0	160.0	162.0					5																	72377780		1907	4121	6028	SO:0001819	synonymous_variant	0			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.2151G>A	5.37:g.72377780G>A			A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Silent	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.T717	ENST00000430046.2	37	c.2151	CCDS47230.1	5																																																																																			FCHO2	-	NULL	ENSG00000157107		0.423	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	-	0.00	92	0	G	XM_291142		72377780	+1	tier1	-	no_errors	ENST00000341845	ensembl	human	known	74_37	silent	52.38	20	22	SNP	0.884	A
FCRL2	79368	genome.wustl.edu	37	1	157737249	157737249	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:157737249C>T	ENST00000361516.3	-	6	982	c.934G>A	c.(934-936)Gca>Aca	p.A312T	FCRL2_ENST00000392274.3_Missense_Mutation_p.A312T|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000469986.1_Missense_Mutation_p.A59T	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	312	Ig-like C2-type 4.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCCCCCACTGCAGCCTGGGCC	0.552																																																	0													48.0	52.0	51.0					1																	157737249		2203	4300	6503	SO:0001583	missense	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.934G>A	1.37:g.157737249C>T	ENSP00000355157:p.Ala312Thr		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A312T	ENST00000361516.3	37	c.934	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993125	0.35131	.	.	ENSG00000132704	ENST00000361516;ENST00000392274;ENST00000469986	T;T;T	0.02737	4.18;4.18;4.18	3.99	-2.93	0.05598	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.361170	0.05387	N	0.538347	T	0.00580	0.0019	N	0.13272	0.32	0.09310	N	1	B;B;P	0.35139	0.271;0.12;0.486	B;B;B	0.38225	0.158;0.156;0.268	T	0.45131	-0.9282	10	0.14252	T	0.57	.	4.4426	0.11582	0.1677:0.3213:0.0:0.511	.	312;312;59	B4DVJ9;Q96LA5;Q96LA5-2	.;FCRL2_HUMAN;.	T	312;312;59	ENSP00000355157:A312T;ENSP00000376100:A312T;ENSP00000417393:A59T	ENSP00000355157:A312T	A	-	1	0	FCRL2	156003873	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.649000	0.00404	-0.472000	0.06881	0.591000	0.81541	GCA	FCRL2	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000132704		0.552	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	-	0.00	92	0	C	NM_030764		157737249	-1	tier1	-	no_errors	ENST00000361516	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
FKBP1A	2280	genome.wustl.edu	37	20	1350376	1350376	+	3'UTR	SNP	C	C	A	rs397795937		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:1350376C>A	ENST00000400137.4	-	0	867				FKBP1A_ENST00000460490.1_5'UTR|FKBP1A_ENST00000381724.3_3'UTR|SDCBP2-AS1_ENST00000609470.1_RNA|SDCBP2-AS1_ENST00000609285.1_RNA|SDCBP2-AS1_ENST00000446423.1_RNA	NM_000801.4	NP_000792.1	P62942	FKB1A_HUMAN	FK506 binding protein 1A, 12kDa						'de novo' protein folding (GO:0006458)|amyloid fibril formation (GO:1990000)|calcium ion transmembrane transport (GO:0070588)|chaperone-mediated protein folding (GO:0061077)|extracellular fibril organization (GO:0043206)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of amyloid precursor protein catabolic process (GO:1902991)|regulation of immune response (GO:0050776)|regulation of protein localization (GO:0032880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|SMAD protein complex assembly (GO:0007183)|T cell activation (GO:0042110)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|terminal cisterna (GO:0014802)|Z disc (GO:0030018)	activin binding (GO:0048185)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|macrolide binding (GO:0005527)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|type I transforming growth factor beta receptor binding (GO:0034713)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	ACCCCCCCCCCAACACCAATT	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M92423	CCDS13014.1, CCDS74688.1	20p13	2013-03-20	2002-08-29		ENSG00000088832	ENSG00000088832			3711	protein-coding gene	gene with protein product	"""calstabin 1"""	186945	"""FK506-binding protein 1A (12kD)"""	FKBP1		1930186	Standard	NM_000801		Approved	FKBP-12, FKBP12, PKC12, PPIASE, FKBP12C	uc002wey.3	P62942	OTTHUMG00000031666	ENST00000400137.4:c.*377G>T	20.37:g.1350376C>A			D3DVW6|P20071|Q4VC47|Q6FGD9|Q6LEU3|Q9H103|Q9H566	RNA	SNP	-	NULL	ENST00000400137.4	37	NULL	CCDS13014.1	20																																																																																			FKBP1A	-	-	ENSG00000088832		0.338	FKBP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP1A	HGNC	protein_coding	OTTHUMT00000077534.2		0.00	64	0	C			1350376	-1			no_errors	ENST00000460490	ensembl	human	known	74_37	rna	6.15	61	4	SNP	0.000	A
FREM3	166752	genome.wustl.edu	37	4	144620507	144620507	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:144620507A>C	ENST00000329798.5	-	1	1321	c.1322T>G	c.(1321-1323)cTt>cGt	p.L441R	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	441					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						AAAAAGCACAAGTCCCCTGTT	0.527																																																	0													57.0	48.0	51.0					4																	144620507		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.1322T>G	4.37:g.144620507A>C	ENSP00000332886:p.Leu441Arg			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L441R	ENST00000329798.5	37	c.1322	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	A	11.05	1.525711	0.27299	.	.	ENSG00000183090	ENST00000329798	T	0.38887	1.11	4.16	4.16	0.48862	.	0.098022	0.43416	D	0.000579	T	0.62502	0.2433	M	0.85197	2.74	0.39364	D	0.965961	.	.	.	.	.	.	T	0.71300	-0.4634	8	0.87932	D	0	-6.7345	12.3145	0.54948	1.0:0.0:0.0:0.0	.	.	.	.	R	441	ENSP00000332886:L441R	ENSP00000332886:L441R	L	-	2	0	FREM3	144839957	0.998000	0.40836	0.039000	0.18376	0.196000	0.23810	5.754000	0.68743	1.742000	0.51746	0.533000	0.62120	CTT	FREM3	-	NULL	ENSG00000183090		0.527	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	88	0	A	XM_094074		144620507	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	58.33	25	35	SNP	0.972	C
FRY	10129	genome.wustl.edu	37	13	32735315	32735315	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:32735315A>T	ENST00000380250.3	+	17	2315	c.1819A>T	c.(1819-1821)Acc>Tcc	p.T607S		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	607						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCTTTTCAGGACCTGTGTTGC	0.348																																																	0													174.0	159.0	164.0					13																	32735315		1878	4101	5979	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1819A>T	13.37:g.32735315A>T	ENSP00000369600:p.Thr607Ser		Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T607S	ENST00000380250.3	37	c.1819	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	A	32	5.120735	0.94385	.	.	ENSG00000073910	ENST00000380250	T	0.64438	-0.1	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.81456	0.4826	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82502	-0.0425	10	0.38643	T	0.18	.	15.9192	0.79547	1.0:0.0:0.0:0.0	.	607	Q5TBA9	FRY_HUMAN	S	607	ENSP00000369600:T607S	ENSP00000369600:T607S	T	+	1	0	FRY	31633315	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.164000	0.68074	0.533000	0.62120	ACC	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.348	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	-	0.00	62	0	A	NM_023037		32735315	+1	tier1	-	no_errors	ENST00000380250	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
FSIP2	401024	genome.wustl.edu	37	2	186672616	186672616	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:186672616C>A	ENST00000424728.1	+	17	18583	c.18583C>A	c.(18583-18585)Cca>Aca	p.P6195T	FSIP2_ENST00000343098.5_Missense_Mutation_p.P6284T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6195										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ATCTATATTTCCAAAAGTACA	0.294																																																	0													27.0	24.0	25.0					2																	186672616		1785	4049	5834	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18583C>A	2.37:g.186672616C>A	ENSP00000401306:p.Pro6195Thr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.P6284T	ENST00000424728.1	37	c.18850		2	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159913	0.38119	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.70282	-0.47;-0.46	4.96	4.96	0.65561	.	0.000000	0.52532	D	0.000061	T	0.72293	0.3442	L	0.52011	1.625	0.32840	D	0.505191	.	.	.	.	.	.	T	0.76788	-0.2830	8	0.31617	T	0.26	.	13.5718	0.61851	0.0:1.0:0.0:0.0	.	.	.	.	T	6284;6195	ENSP00000344403:P6284T;ENSP00000401306:P6195T	ENSP00000344403:P6284T	P	+	1	0	FSIP2	186380861	1.000000	0.71417	0.940000	0.37924	0.426000	0.31534	2.363000	0.44178	2.580000	0.87095	0.484000	0.47621	CCA	FSIP2	-	NULL	ENSG00000188738		0.294	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	98	0	C	NM_173651		186672616	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.933	A
GAB2	9846	genome.wustl.edu	37	11	77991745	77991745	+	Missense_Mutation	SNP	C	C	T	rs114762524		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:77991745C>T	ENST00000361507.4	-	2	363	c.278G>A	c.(277-279)cGc>cAc	p.R93H	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_Missense_Mutation_p.R55H	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	93	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GTAAAAGGTGCGTTCACTGGT	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		20236	0.0		0.001	False		,,,				2504	0.0																0													210.0	179.0	190.0					11																	77991745		2200	4292	6492	SO:0001583	missense	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.278G>A	11.37:g.77991745C>T	ENSP00000354952:p.Arg93His		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R93H	ENST00000361507.4	37	c.278	CCDS8259.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	34	5.295606	0.95574	.	.	ENSG00000033327	ENST00000340149;ENST00000361507;ENST00000528886;ENST00000530915	T;T;T;T	0.80566	-1.39;2.26;-1.39;-1.02	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	U	0.000001	D	0.91707	0.7378	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92798	0.6254	10	0.87932	D	0	-14.6409	19.4818	0.95013	0.0:1.0:0.0:0.0	.	93	Q9UQC2	GAB2_HUMAN	H	55;93;55;55	ENSP00000343959:R55H;ENSP00000354952:R93H;ENSP00000433762:R55H;ENSP00000431868:R55H	ENSP00000343959:R55H	R	-	2	0	GAB2	77669393	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.776000	0.85560	2.667000	0.90743	0.563000	0.77884	CGC	GAB2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000033327		0.488	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1		0.00	90	0	C	NM_080491		77991745	-1			no_errors	ENST00000361507	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
GABRB2	2561	genome.wustl.edu	37	5	160721287	160721287	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:160721287G>A	ENST00000393959.1	-	10	1339	c.1340C>T	c.(1339-1341)cCc>cTc	p.P447L	GABRB2_ENST00000274547.2_Missense_Mutation_p.P447L|GABRB2_ENST00000520240.1_Missense_Mutation_p.P409L|GABRB2_ENST00000517901.1_Missense_Mutation_p.P346L|GABRB2_ENST00000353437.6_Missense_Mutation_p.P409L|GABRB2_ENST00000517547.1_Missense_Mutation_p.P249L			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	447					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACTATGCCTGGGCAACCCAGC	0.537																																																	0													106.0	94.0	98.0					5																	160721287		2203	4300	6503	SO:0001583	missense	0				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1340C>T	5.37:g.160721287G>A	ENSP00000377531:p.Pro447Leu		A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,prints_GABAAa_rcpt,tigrfam_Neur_channel	p.P447L	ENST00000393959.1	37	c.1340	CCDS4355.1	5	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070391	0.55539	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.0;-2.0;-2.0;-2.0	5.49	4.6	0.57074	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.450751	0.25631	N	0.029347	T	0.78253	0.4254	N	0.16307	0.4	0.58432	D	0.999996	B;B;B;B	0.24186	0.017;0.007;0.099;0.003	B;B;B;B	0.32762	0.042;0.035;0.152;0.023	T	0.73228	-0.4049	10	0.37606	T	0.19	.	16.1538	0.81644	0.0:0.1338:0.8662:0.0	.	249;346;447;409	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	L	447;447;409;409;346;249	ENSP00000377531:P447L;ENSP00000274547:P447L;ENSP00000274546:P409L;ENSP00000429320:P409L;ENSP00000430532:P346L;ENSP00000429750:P249L	ENSP00000274547:P447L	P	-	2	0	GABRB2	160653865	1.000000	0.71417	0.983000	0.44433	0.925000	0.55904	7.751000	0.85126	1.271000	0.44313	0.650000	0.86243	CCC	GABRB2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000145864		0.537	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB2	HGNC	protein_coding	OTTHUMT00000252704.1		0.00	36	0	G			160721287	-1			no_errors	ENST00000274547	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
GABRB3	2562	genome.wustl.edu	37	15	26793097	26793097	+	Missense_Mutation	SNP	G	G	T	rs369631109		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:26793097G>T	ENST00000311550.5	-	9	1376	c.1265C>A	c.(1264-1266)cCg>cAg	p.P422Q	GABRB3_ENST00000400188.3_Missense_Mutation_p.P351Q|GABRB3_ENST00000541819.2_Missense_Mutation_p.P478Q|GABRB3_ENST00000299267.4_Missense_Mutation_p.P422Q|GABRB3_ENST00000545868.1_Missense_Mutation_p.P337Q	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	422					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTTCTTGTGCGGGAGGCTTCT	0.493																																																	0													85.0	75.0	78.0					15																	26793097		2203	4300	6503	SO:0001583	missense	0				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1265C>A	15.37:g.26793097G>T	ENSP00000308725:p.Pro422Gln		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.P422Q	ENST00000311550.5	37	c.1265	CCDS10019.1	15	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609648	0.28623	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.82	4.85	0.62838	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.456271	0.27147	N	0.020720	T	0.75939	0.3918	L	0.31420	0.93	0.44447	D	0.997373	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.72043	-0.4409	10	0.59425	D	0.04	.	9.0456	0.36345	0.0765:0.1492:0.7743:0.0	.	478;422;422	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	Q	422;478;422;351;337	ENSP00000308725:P422Q;ENSP00000442408:P478Q;ENSP00000299267:P422Q;ENSP00000383049:P351Q;ENSP00000439169:P337Q	ENSP00000299267:P422Q	P	-	2	0	GABRB3	24344190	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.847000	0.55895	2.752000	0.94435	0.655000	0.94253	CCG	GABRB3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000166206		0.493	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB3	HGNC	protein_coding	OTTHUMT00000251352.2	-	0.00	33	0	G			26793097	-1	tier1	-	no_errors	ENST00000299267	ensembl	human	known	74_37	missense	60.00	14	21	SNP	0.999	T
GALNT12	79695	genome.wustl.edu	37	9	101602293	101602293	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:101602293G>T	ENST00000375011.3	+	7	1222	c.1222G>T	c.(1222-1224)Ggg>Tgg	p.G408W		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	408					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GGAACCTTTTGGGGATGTGAC	0.493																																																	0													137.0	134.0	135.0					9																	101602293		2203	4300	6503	SO:0001583	missense	0			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.1222G>T	9.37:g.101602293G>T	ENSP00000364150:p.Gly408Trp		Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G408W	ENST00000375011.3	37	c.1222	CCDS6737.1	9	.	.	.	.	.	.	.	.	.	.	G	26.3	4.728058	0.89390	.	.	ENSG00000119514	ENST00000375011	T	0.67523	-0.27	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.88444	0.6438	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91601	0.5295	10	0.87932	D	0	.	17.8445	0.88725	0.0:0.0:1.0:0.0	.	408	Q8IXK2	GLT12_HUMAN	W	408	ENSP00000364150:G408W	ENSP00000364150:G408W	G	+	1	0	GALNT12	100642114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	GGG	GALNT12	-	NULL	ENSG00000119514		0.493	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	HGNC	protein_coding	OTTHUMT00000053382.1		0.00	84	0	G	NM_024642		101602293	+1			no_errors	ENST00000375011	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
GFRA1	2674	genome.wustl.edu	37	10	117853231	117853231	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:117853231T>C	ENST00000355422.6	-	8	1547	c.997A>G	c.(997-999)Aag>Gag	p.K333E	GFRA1_ENST00000369236.1_Missense_Mutation_p.K328E|GFRA1_ENST00000439649.3_Missense_Mutation_p.K328E|GFRA1_ENST00000544592.1_Missense_Mutation_p.K212E	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	333					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GTATTGTCCTTGAAGAAATTC	0.438																																					Ovarian(128;329 1725 45498 46808 50759)												0													73.0	71.0	72.0					10																	117853231		2203	4300	6503	SO:0001583	missense	0			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.997A>G	10.37:g.117853231T>C	ENSP00000347591:p.Lys333Glu		A8KA21|O15507|O43912	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt,prints_GDNF_rcpt_A1	p.K333E	ENST00000355422.6	37	c.997	CCDS44481.1	10	.	.	.	.	.	.	.	.	.	.	T	13.44	2.236899	0.39498	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.62639	0.01;0.01	5.93	4.78	0.61160	GDNF/GAS1 (2);	0.090665	0.85682	D	0.000000	T	0.52224	0.1721	L	0.44542	1.39	0.39897	D	0.973858	B;B	0.31413	0.322;0.275	B;B	0.28465	0.09;0.049	T	0.49513	-0.8932	10	0.29301	T	0.29	-25.5222	12.8175	0.57673	0.0:0.0:0.32:0.68	.	333;328	P56159;P56159-2	GFRA1_HUMAN;.	E	333;328;328;212;328	ENSP00000358239:K328E;ENSP00000442179:K212E	ENSP00000347591:K328E	K	-	1	0	GFRA1	117843221	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.792000	0.69052	1.052000	0.40392	0.482000	0.46254	AAG	GFRA1	-	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2	ENSG00000151892		0.438	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	HGNC	protein_coding	OTTHUMT00000050512.2	-	0.00	53	0	T	NM_145793		117853231	-1	tier1	-	no_errors	ENST00000355422	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	C
GIPC3	126326	genome.wustl.edu	37	19	3590156	3590156	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:3590156G>A	ENST00000322315.5	+	6	952	c.907G>A	c.(907-909)Gcc>Acc	p.A303T		NM_133261.2	NP_573568.1	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	303										breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTGTGGGCCGCCATCGGCGA	0.677																																																	0													26.0	31.0	29.0					19																	3590156		2202	4299	6501	SO:0001583	missense	0			AB073738	CCDS32871.1	19p13.3	2011-11-29				ENSG00000179855			18183	protein-coding gene	gene with protein product		608792	"""chromosome 19 open reading frame 64"", ""deafness, autosomal recessive 72"", ""deafness, autosomal recessive 15"""	C19orf64, DFNB72, DFNB15		11836571, 21326233	Standard	NM_133261		Approved	DFNB95	uc002lyd.4	Q8TF64		ENST00000322315.5:c.907G>A	19.37:g.3590156G>A	ENSP00000319254:p.Ala303Thr		O75227	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.A303T	ENST00000322315.5	37	c.907	CCDS32871.1	19	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296887	0.60086	.	.	ENSG00000179855	ENST00000322315	D	0.82619	-1.63	4.28	4.28	0.50868	.	0.070645	0.53938	D	0.000045	T	0.80401	0.4616	M	0.77486	2.375	0.58432	D	0.999999	P	0.50943	0.94	B	0.35182	0.197	D	0.84478	0.0603	10	0.59425	D	0.04	-27.0071	14.2223	0.65836	0.0:0.0:1.0:0.0	.	303	Q8TF64	GIPC3_HUMAN	T	303	ENSP00000319254:A303T	ENSP00000319254:A303T	A	+	1	0	GIPC3	3541156	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	9.126000	0.94411	1.948000	0.56530	0.491000	0.48974	GCC	GIPC3	-	pirsf_UCP038083_PDZ	ENSG00000179855		0.677	GIPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC3	HGNC	protein_coding	OTTHUMT00000394577.1	-	0.00	52	0	G	NM_133261		3590156	+1	tier1	-	no_errors	ENST00000322315	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.998	A
GLS	2744	genome.wustl.edu	37	2	191792160	191792160	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:191792160G>T	ENST00000320717.3	+	12	1635	c.1377G>T	c.(1375-1377)ttG>ttT	p.L459F	GLS_ENST00000409626.1_Missense_Mutation_p.L30F|GLS_ENST00000409428.1_5'Flank|GLS_ENST00000338435.4_Missense_Mutation_p.L459F|GLS_ENST00000409215.1_5'Flank	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	459					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	CATTGAGTTTGATGCATTCCT	0.438																																																	0													164.0	157.0	159.0					2																	191792160		2203	4300	6503	SO:0001583	missense	0			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1377G>T	2.37:g.191792160G>T	ENSP00000317379:p.Leu459Phe		Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	pfam_Glutaminase,pfam_Ankyrin_rpt,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_Glutaminase	p.L459F	ENST00000320717.3	37	c.1377	CCDS2308.1	2	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727388	0.69074	.	.	ENSG00000115419	ENST00000320717;ENST00000338435;ENST00000409626;ENST00000457316	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.62	-1.06	0.10002	Beta-lactamase/transpeptidase-like (1);	0.000000	0.64402	D	0.000001	T	0.64227	0.2579	M	0.86097	2.795	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.998;0.996;0.998;0.993	T	0.63111	-0.6710	10	0.87932	D	0	-11.8464	6.659	0.23004	0.3659:0.2044:0.4297:0.0	.	30;459;113;459;459	B7Z2P1;A8K132;Q68D38;O94925;O94925-3	.;.;.;GLSK_HUMAN;.	F	459;459;30;30	ENSP00000317379:L459F;ENSP00000340689:L459F;ENSP00000386417:L30F;ENSP00000395596:L30F	ENSP00000317379:L459F	L	+	3	2	GLS	191500405	0.992000	0.36948	0.992000	0.48379	0.993000	0.82548	0.311000	0.19380	-0.109000	0.12044	0.650000	0.86243	TTG	GLS	-	pfam_Glutaminase,superfamily_Beta-lactam/transpept-like,tigrfam_Glutaminase	ENSG00000115419		0.438	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS	HGNC	protein_coding	OTTHUMT00000255999.2	-	0.00	95	0	G			191792160	+1	tier1	-	no_errors	ENST00000320717	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.961	T
GRM3	2913	genome.wustl.edu	37	7	86416181	86416181	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:86416181A>T	ENST00000361669.2	+	3	2172	c.1073A>T	c.(1072-1074)aAg>aTg	p.K358M	AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.K358M|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.K356M|GRM3_ENST00000536043.1_Missense_Mutation_p.K230M	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	358					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGGGAGCAAAAGTTTCAGTGC	0.587																																					GBM(52;969 1098 3139 52280)												0													61.0	59.0	59.0					7																	86416181		2203	4300	6503	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1073A>T	7.37:g.86416181A>T	ENSP00000355316:p.Lys358Met		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.K358M	ENST00000361669.2	37	c.1073	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157133	0.78114	.	.	ENSG00000198822	ENST00000361669;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06	5.93	5.93	0.95920	Extracellular ligand-binding receptor (1);	0.049500	0.85682	D	0.000000	D	0.88662	0.6497	L	0.45352	1.415	0.58432	D	0.999999	B;D;B	0.67145	0.383;0.996;0.437	P;D;P	0.63793	0.822;0.918;0.888	D	0.88739	0.3242	10	0.49607	T	0.09	.	15.5577	0.76213	1.0:0.0:0.0:0.0	.	230;358;358	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	M	358;230;358;356	ENSP00000355316:K358M;ENSP00000441407:K230M;ENSP00000398767:K358M;ENSP00000378209:K356M	ENSP00000355316:K358M	K	+	2	0	GRM3	86254117	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.225000	0.72271	2.263000	0.75096	0.533000	0.62120	AAG	GRM3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000198822		0.587	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	-	0.00	44	0	A			86416181	+1	tier1	-	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
GRSF1	2926	genome.wustl.edu	37	4	71698910	71698910	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:71698910C>T	ENST00000254799.6	-	3	712	c.595G>A	c.(595-597)Gaa>Aaa	p.E199K	GRSF1_ENST00000502323.1_Missense_Mutation_p.E37K|GRSF1_ENST00000545193.1_Missense_Mutation_p.E81K|GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000439371.1_Missense_Mutation_p.E37K	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	199	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E199K(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GACTCCATTTCAATTAAGGCA	0.448																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											159.0	159.0	159.0					4																	71698910		2165	4262	6427	SO:0001583	missense	0			BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.595G>A	4.37:g.71698910C>T	ENSP00000254799:p.Glu199Lys		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E199K	ENST00000254799.6	37	c.595	CCDS47069.1	4	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456238	0.84317	.	.	ENSG00000132463	ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193	T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88	5.11	5.11	0.69529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	M	0.62209	1.925	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.942;0.998	T	0.00456	-1.1728	10	0.27785	T	0.31	-6.8523	19.0813	0.93182	0.0:1.0:0.0:0.0	.	112;199	B7Z5F9;Q12849	.;GRSF1_HUMAN	K	199;37;131;172;37;81	ENSP00000254799:E199K;ENSP00000389219:E37K;ENSP00000427354:E172K;ENSP00000425430:E37K;ENSP00000443380:E81K	ENSP00000254799:E199K	E	-	1	0	GRSF1	71917774	1.000000	0.71417	0.999000	0.59377	0.016000	0.09150	7.564000	0.82326	2.798000	0.96311	0.655000	0.94253	GAA	GRSF1	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000132463		0.448	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GRSF1	HGNC	protein_coding	OTTHUMT00000362642.1		0.00	39	0	C	NM_002092		71698910	-1			no_errors	ENST00000254799	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
HBD	3045	genome.wustl.edu	37	11	5254265	5254265	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:5254265G>T	ENST00000380299.3	-	3	587	c.373C>A	c.(373-375)Cca>Aca	p.P125T	HBD_ENST00000292901.3_Intron	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	125					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCATTTGTGGGGTGAATTCC	0.512																																																	0													145.0	122.0	130.0					11																	5254265		2201	4298	6499	SO:0001583	missense	0			AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.373C>A	11.37:g.5254265G>T	ENSP00000369654:p.Pro125Thr		Q3Y5H3|Q8WXT7	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,prints_Haemoglobin_b,pfscan_Globin	p.P125T	ENST00000380299.3	37	c.373	CCDS31376.1	11	.	.	.	.	.	.	.	.	.	.	g	11.16	1.557065	0.27827	.	.	ENSG00000223609	ENST00000380299	D	0.94576	-3.46	4.8	2.87	0.33458	Globin-like (1);Globin, structural domain (1);	0.227084	0.45606	D	0.000343	D	0.97448	0.9165	H	0.95294	3.65	0.36673	D	0.87861	D	0.69078	0.997	D	0.72338	0.977	D	0.97300	0.9930	10	0.87932	D	0	-0.0302	7.1984	0.25866	0.0933:0.1701:0.7366:0.0	.	125	P02042	HBD_HUMAN	T	125	ENSP00000369654:P125T	ENSP00000369654:P125T	P	-	1	0	HBD	5210841	0.049000	0.20398	0.220000	0.23810	0.017000	0.09413	1.567000	0.36407	0.699000	0.31761	0.650000	0.86243	CCA	HBD	-	superfamily_Globin-like,pfscan_Globin	ENSG00000223609		0.512	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBD	HGNC	protein_coding	OTTHUMT00000142970.1	-	0.00	76	0	G	NM_000519		5254265	-1	tier1	-	no_errors	ENST00000380299	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.584	T
HCFC1	3054	genome.wustl.edu	37	X	153222953	153222953	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:153222953A>G	ENST00000310441.7	-	13	3131	c.2165T>C	c.(2164-2166)cTg>cCg	p.L722P	HCFC1_ENST00000354233.3_Missense_Mutation_p.L653P|HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000369984.4_Missense_Mutation_p.L722P	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	722	Interaction with SIN3A.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCAGCTTCAGGATTGTTCC	0.622																																																	0													69.0	70.0	69.0					X																	153222953		2089	4186	6275	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2165T>C	X.37:g.153222953A>G	ENSP00000309555:p.Leu722Pro		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.L722P	ENST00000310441.7	37	c.2165	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388791	0.82902	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03663	3.91;3.91;3.85	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.09512	0.0234	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.09164	-1.0687	10	0.87932	D	0	.	13.4654	0.61251	1.0:0.0:0.0:0.0	.	722	P51610	HCFC1_HUMAN	P	722;722;653	ENSP00000309555:L722P;ENSP00000359001:L722P;ENSP00000346174:L653P	ENSP00000309555:L722P	L	-	2	0	HCFC1	152876147	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.719000	0.91436	1.822000	0.53115	0.486000	0.48141	CTG	HCFC1	-	NULL	ENSG00000172534		0.622	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	-	0.00	50	0	A	NM_005334		153222953	-1	tier1	-	no_errors	ENST00000310441	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	G
HERC2P3	283755	genome.wustl.edu	37	15	20644858	20644858	+	RNA	SNP	G	G	T	rs562650297		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:20644858G>T	ENST00000428453.1	-	0	3089							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TCGCCCTTTCGGTCTTGTCCC	0.448																																																	0													98.0	54.0	70.0					15																	20644858		1509	2699	4208			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644858G>T				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.448	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	262	0	G	NG_008269		20644858	-1	tier1	-	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	14.29	168	28	SNP	0.092	T
HMCN1	83872	genome.wustl.edu	37	1	185878594	185878594	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:185878594G>T	ENST00000271588.4	+	5	976	c.747G>T	c.(745-747)gtG>gtT	p.V249V	HMCN1_ENST00000367492.2_Silent_p.V249V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	249					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGGTCACTGTGTCTTTGAGTG	0.378																																																	0													114.0	106.0	109.0					1																	185878594		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.747G>T	1.37:g.185878594G>T			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V249	ENST00000271588.4	37	c.747	CCDS30956.1	1																																																																																			HMCN1	-	NULL	ENSG00000143341		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	81	0	G	NM_031935		185878594	+1			no_errors	ENST00000271588	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	T
HOXA1	3198	genome.wustl.edu	37	7	27135319	27135319	+	Silent	SNP	G	G	A	rs2074398		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:27135319G>A	ENST00000343060.4	-	1	274	c.213C>T	c.(211-213)caC>caT	p.H71H	HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOXA1_ENST00000355633.5_Silent_p.H71H|HOTAIRM1_ENST00000425358.2_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	71	Poly-His.				abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ggtggcgatggtggtggtggt	0.642											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													37.0	40.0	39.0					7																	27135319		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.213C>T	7.37:g.27135319G>A		792	A4D184|B2R8U7|O43363	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.H71	ENST00000343060.4	37	c.213	CCDS5401.1	7																																																																																			HOXA1	-	NULL	ENSG00000105991		0.642	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	HGNC	protein_coding	OTTHUMT00000358454.1	-	0.00	65	0	G			27135319	-1	tier1	rs2074398	no_errors	ENST00000343060	ensembl	human	known	74_37	silent	6.94	67	5	SNP	0.999	A
HTR2A	3356	genome.wustl.edu	37	13	47409764	47409764	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:47409764C>A	ENST00000378688.4	-	3	755	c.624G>T	c.(622-624)atG>atT	p.M208I	HTR2A_ENST00000542664.1_Missense_Mutation_p.M208I|HTR2A_ENST00000543956.1_Missense_Mutation_p.M124I			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	208					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTGGTATTGGCATGGATATAC	0.398																																																	0													49.0	50.0	50.0					13																	47409764		2203	4300	6503	SO:0001583	missense	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.624G>T	13.37:g.47409764C>A	ENSP00000367959:p.Met208Ile		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.M208I	ENST00000378688.4	37	c.624	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121075	0.37436	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.70631	-0.5;-0.5;-0.5	6.08	6.08	0.98989	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	N	0.01789	-0.72	0.80722	D	1	B;B	0.28470	0.113;0.213	B;B	0.28139	0.032;0.086	T	0.51212	-0.8734	10	0.10902	T	0.67	.	19.6603	0.95864	0.0:1.0:0.0:0.0	.	124;208	F5GWE8;P28223	.;5HT2A_HUMAN	I	208;124;208	ENSP00000367959:M208I;ENSP00000441861:M124I;ENSP00000437737:M208I	ENSP00000367959:M208I	M	-	3	0	HTR2A	46307765	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	6.041000	0.70988	2.894000	0.99253	0.591000	0.81541	ATG	HTR2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000102468		0.398	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	-	0.00	44	0	C	NM_000621		47409764	-1	tier1	-	no_errors	ENST00000378688	ensembl	human	known	74_37	missense	38.46	24	15	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3162097	3162097	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:3162097C>T	ENST00000355072.5	+	29	3987	c.3842C>T	c.(3841-3843)gCc>gTc	p.A1281V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1281					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTAGAGCTGGCCACACTGCAG	0.502																																																	0													209.0	200.0	203.0					4																	3162097		1972	4128	6100	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3842C>T	4.37:g.3162097C>T	ENSP00000347184:p.Ala1281Val		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.A1281V	ENST00000355072.5	37	c.3842	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510401	0.85389	.	.	ENSG00000197386	ENST00000355072	T	0.63580	-0.05	4.27	4.27	0.50696	.	0.057362	0.64402	D	0.000001	T	0.74839	0.3769	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.73833	-0.3858	10	0.33141	T	0.24	.	16.6252	0.84968	0.0:1.0:0.0:0.0	.	1281	P42858	HD_HUMAN	V	1281	ENSP00000347184:A1281V	ENSP00000347184:A1281V	A	+	2	0	HTT	3131895	1.000000	0.71417	0.873000	0.34254	0.745000	0.42441	7.014000	0.76380	2.069000	0.61940	0.563000	0.77884	GCC	HTT	-	NULL	ENSG00000197386		0.502	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	-	0.00	80	0	C	NM_002111		3162097	+1	tier1	-	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
IHH	3549	genome.wustl.edu	37	2	219920495	219920495	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:219920495T>C	ENST00000295731.6	-	3	669	c.670A>G	c.(670-672)Agg>Ggg	p.R224G	MIR3131_ENST00000583592.1_RNA	NM_002181.3	NP_002172.2	Q14623	IHH_HUMAN	indian hedgehog	224					bone resorption (GO:0045453)|camera-type eye photoreceptor cell fate commitment (GO:0060220)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|chondrocyte proliferation (GO:0035988)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint development (GO:0072498)|epithelial cell morphogenesis (GO:0003382)|epithelial cell-cell adhesion (GO:0090136)|head morphogenesis (GO:0060323)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intein-mediated protein splicing (GO:0016539)|maternal process involved in female pregnancy (GO:0060135)|multicellular organism growth (GO:0035264)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of eye pigmentation (GO:0048074)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell differentiation in thymus (GO:0033085)|neuron development (GO:0048666)|osteoblast differentiation (GO:0001649)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of growth (GO:0040008)|response to estradiol (GO:0032355)|retinal pigment epithelium development (GO:0003406)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|somite development (GO:0061053)|vitelline membrane formation (GO:0030704)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|patched binding (GO:0005113)|peptidase activity (GO:0008233)	p.R224G(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTCCCGGCCTCACGGCTGAC	0.677																																																	1	Substitution - Missense(1)	lung(1)											37.0	41.0	40.0					2																	219920495		2203	4300	6503	SO:0001583	missense	0			L38517	CCDS33380.1	2q33-q35	2013-02-15	2013-02-15		ENSG00000163501	ENSG00000163501			5956	protein-coding gene	gene with protein product		600726	"""Indian hedgehog (Drosophila) homolog"", ""Indian hedgehog homolog (Drosophila)"""			7590746, 14770182	Standard	NM_002181		Approved	HHG2, BDA1	uc002vjo.2	Q14623	OTTHUMG00000154631	ENST00000295731.6:c.670A>G	2.37:g.219920495T>C	ENSP00000295731:p.Arg224Gly		B9EGM5|O43322|Q8N4B9	Missense_Mutation	SNP	pirsf_Hedgehog,pfam_Hedgehog_signaling_dom,pfam_Hint_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,smart_Hint_dom_N,smart_Hint_dom_C,prints_Hedgehog,pfscan_Intein_splice_site	p.R224G	ENST00000295731.6	37	c.670	CCDS33380.1	2	.	.	.	.	.	.	.	.	.	.	T	11.88	1.769659	0.31320	.	.	ENSG00000163501	ENST00000295731	D	0.98958	-5.27	5.18	-0.304	0.12788	Hedgehog/intein hint, N-terminal (1);Peptidase C46, hedgehog protein, hint region (1);	0.307267	0.35615	N	0.003097	D	0.97607	0.9216	M	0.80616	2.505	0.35915	D	0.831368	B	0.32010	0.351	B	0.31390	0.129	D	0.95565	0.8633	10	0.56958	D	0.05	0.1865	16.2366	0.82380	0.0:0.0:0.6544:0.3456	.	224	Q14623	IHH_HUMAN	G	224	ENSP00000295731:R224G	ENSP00000295731:R224G	R	-	1	2	IHH	219628739	0.205000	0.23458	0.119000	0.21687	0.467000	0.32768	0.702000	0.25631	-0.032000	0.13758	-0.396000	0.06452	AGG	IHH	-	pirsf_Hedgehog,pfam_Hint_dom,smart_Hint_dom_N,pfscan_Intein_splice_site	ENSG00000163501		0.677	IHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IHH	HGNC	protein_coding	OTTHUMT00000336408.2		0.00	50	0	T	NM_002181		219920495	-1			no_errors	ENST00000295731	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.902	C
IL20	50604	genome.wustl.edu	37	1	207041865	207041865	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:207041865G>T	ENST00000367098.1	+	6	850	c.487G>T	c.(487-489)Ggg>Tgg	p.G163W	IL20_ENST00000367096.3_Missense_Mutation_p.G163W|IL20_ENST00000391930.2_Missense_Mutation_p.G138W			Q9UHF5	IL17B_HUMAN	interleukin 20	0					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)|urinary_tract(1)	9	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		GAAGGCTTTGGGGGAACTAGA	0.473																																																	0													105.0	93.0	97.0					1																	207041865		2203	4300	6503	SO:0001583	missense	0			AF224266	CCDS1470.1	1q32	2008-02-05			ENSG00000162891	ENSG00000162891		"""Interleukins and interleukin receptors"""	6002	protein-coding gene	gene with protein product		605619				11163236	Standard	NM_018724		Approved	ZCYTO10, IL10D, IL-20	uc001her.3	Q9NYY1	OTTHUMG00000036456	ENST00000367098.1:c.487G>T	1.37:g.207041865G>T	ENSP00000356065:p.Gly163Trp		Q14CE5	Missense_Mutation	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-20,prints_IL-24	p.G163W	ENST00000367098.1	37	c.487	CCDS1470.1	1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053982	0.55218	.	.	ENSG00000162891	ENST00000367098;ENST00000367096;ENST00000391930	T;T;T	0.40225	1.04;1.04;1.04	4.55	3.59	0.41128	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.126300	0.53938	D	0.000046	T	0.44644	0.1303	M	0.70903	2.155	0.43902	D	0.996536	P;B	0.45634	0.863;0.439	P;B	0.44647	0.456;0.249	T	0.47983	-0.9074	10	0.87932	D	0	-7.1784	8.4984	0.33144	0.1183:0.0:0.8817:0.0	.	138;163	Q2THG6;Q9NYY1	.;IL20_HUMAN	W	163;163;138	ENSP00000356065:G163W;ENSP00000356063:G163W;ENSP00000375796:G138W	ENSP00000356063:G163W	G	+	1	0	IL20	205108488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.070000	0.57548	1.154000	0.42482	0.650000	0.86243	GGG	IL20	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-24	ENSG00000162891		0.473	IL20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20	HGNC	protein_coding	OTTHUMT00000088676.1	-	0.00	75	0	G	NM_018724		207041865	+1	tier1	-	no_errors	ENST00000367096	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
IL6ST	3572	genome.wustl.edu	37	5	55236936	55236936	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:55236936G>A	ENST00000381298.2	-	17	3043	c.2731C>T	c.(2731-2733)Cgg>Tgg	p.R911W	IL6ST_ENST00000381287.4_3'UTR|CTD-2031P19.5_ENST00000576302.1_RNA|IL6ST_ENST00000381294.3_Missense_Mutation_p.R850W|IL6ST_ENST00000336909.5_Missense_Mutation_p.R911W|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.R911W	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	911					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				CCGCCTTGCCGTACAGTCTGT	0.438			O		hepatocellular ca																																			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													105.0	90.0	95.0					5																	55236936		2203	4300	6503	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.2731C>T	5.37:g.55236936G>A	ENSP00000370698:p.Arg911Trp		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R911W	ENST00000381298.2	37	c.2731	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138921	0.56936	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.52057	1.04;1.04;0.68	5.73	0.364	0.16124	.	0.143021	0.64402	D	0.000006	T	0.64516	0.2605	M	0.66939	2.045	0.29390	N	0.862668	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.66810	-0.5829	10	0.87932	D	0	.	15.18	0.72947	0.0:0.0:0.5203:0.4797	.	911;850;911	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	W	911;911;850	ENSP00000370698:R911W;ENSP00000338799:R911W;ENSP00000370694:R850W	ENSP00000338799:R911W	R	-	1	2	IL6ST	55272693	0.843000	0.29541	0.156000	0.22583	0.927000	0.56198	0.818000	0.27295	-0.090000	0.12462	-0.474000	0.04947	CGG	IL6ST	-	NULL	ENSG00000134352		0.438	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	-	0.00	54	0	G	NM_002184		55236936	-1	tier1	-	no_errors	ENST00000336909	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.250	A
INHBA	3624	genome.wustl.edu	37	7	41729788	41729788	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:41729788G>T	ENST00000242208.4	-	3	987	c.741C>A	c.(739-741)tgC>tgA	p.C247*	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Nonsense_Mutation_p.C247*	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	247					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CACTCTCCTGGCACTGCTCAC	0.597										TSP Lung(11;0.080)																																							0													41.0	42.0	42.0					7																	41729788		2203	4300	6503	SO:0001587	stop_gained	0				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.741C>A	7.37:g.41729788G>T	ENSP00000242208:p.Cys247*		Q14599	Nonsense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.C247*	ENST00000242208.4	37	c.741	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	37	6.583797	0.97684	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	.	.	.	6.06	4.28	0.50868	.	0.440586	0.26855	N	0.022147	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.6686	10.8331	0.46671	0.2496:0.0:0.7504:0.0	.	.	.	.	X	247	.	ENSP00000242208:C247X	C	-	3	2	INHBA	41696313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.404000	0.44539	0.916000	0.36871	0.655000	0.94253	TGC	INHBA	-	pfam_TGF-b_N	ENSG00000122641		0.597	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	-	0.00	46	0	G			41729788	-1	tier1	-	no_errors	ENST00000242208	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	T
INTS3	65123	genome.wustl.edu	37	1	153723688	153723688	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:153723688C>A	ENST00000318967.2	+	7	1270	c.702C>A	c.(700-702)gaC>gaA	p.D234E	RP11-216N14.9_ENST00000434575.1_RNA|INTS3_ENST00000435409.2_Missense_Mutation_p.D234E|INTS3_ENST00000512605.1_Missense_Mutation_p.D28E|RP11-216N14.8_ENST00000453778.1_RNA|INTS3_ENST00000456435.1_Missense_Mutation_p.D28E|snoU13_ENST00000458994.1_RNA|INTS3_ENST00000476843.1_3'UTR	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	235					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGGAAGTAGACTTCTGCATCT	0.542																																																	0													105.0	89.0	95.0					1																	153723688		2203	4300	6503	SO:0001583	missense	0			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.702C>A	1.37:g.153723688C>A	ENSP00000318641:p.Asp234Glu		A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	pfam_Int_cplx_su3	p.D234E	ENST00000318967.2	37	c.702	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888574	0.52014	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.95	3.03	0.35002	.	0.102468	0.64402	N	0.000004	T	0.11024	0.0269	N	0.12887	0.27	0.39682	D	0.970913	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.11421	-1.0588	9	0.16420	T	0.52	.	3.3658	0.07203	0.1785:0.5558:0.1729:0.0928	.	28;235;234	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	E	234;28;234;28	.	ENSP00000318641:D234E	D	+	3	2	INTS3	151990312	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.285000	0.33261	0.646000	0.30693	0.555000	0.69702	GAC	INTS3	-	NULL	ENSG00000143624		0.542	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding	OTTHUMT00000090045.2	-	0.00	41	0	C	NM_023015		153723688	+1	tier1	-	no_errors	ENST00000318967	ensembl	human	known	74_37	missense	27.27	32	12	SNP	1.000	A
JARID2	3720	genome.wustl.edu	37	6	15468930	15468930	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:15468930A>T	ENST00000341776.2	+	5	895	c.651A>T	c.(649-651)aaA>aaT	p.K217N	JARID2_ENST00000541660.1_Missense_Mutation_p.K179N|JARID2_ENST00000397311.3_Missense_Mutation_p.K45N	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	217					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K217fs*90(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AAACCCACAAACATGTTCACA	0.473																																																	1	Deletion - Frameshift(1)	prostate(1)											124.0	104.0	111.0					6																	15468930		2203	4300	6503	SO:0001583	missense	0			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.651A>T	6.37:g.15468930A>T	ENSP00000341280:p.Lys217Asn		A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_TF_JmjN,pfam_Znf_C5HC2,superfamily_ARID/BRIGHT_DNA-bd,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_ARID/BRIGHT_DNA-bd	p.K217N	ENST00000341776.2	37	c.651	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	A	14.55	2.569053	0.45798	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.36157	1.27;1.27;1.27	4.8	-2.08	0.07254	.	0.171329	0.51477	D	0.000095	T	0.26955	0.0660	L	0.29908	0.895	0.33371	D	0.573631	D;D;D	0.76494	0.993;0.999;0.979	D;D;P	0.68943	0.91;0.961;0.702	T	0.17868	-1.0355	10	0.44086	T	0.13	-10.4429	12.5089	0.55997	0.4911:0.0:0.5089:0.0	.	179;81;217	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	N	81;217;45;179	ENSP00000341280:K217N;ENSP00000380478:K45N;ENSP00000444623:K179N	ENSP00000341280:K217N	K	+	3	2	JARID2	15576909	1.000000	0.71417	0.970000	0.41538	0.888000	0.51559	0.623000	0.24447	-0.340000	0.08388	-0.924000	0.02725	AAA	JARID2	-	NULL	ENSG00000008083		0.473	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	HGNC	protein_coding	OTTHUMT00000039926.1		0.00	58	0	A	NM_004973		15468930	+1			no_errors	ENST00000341776	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.958	T
KAT2B	8850	genome.wustl.edu	37	3	20153121	20153121	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:20153121C>T	ENST00000263754.4	+	6	1340	c.885C>T	c.(883-885)tgC>tgT	p.C295C		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	295					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CACAGTTCTGCGACAGTCTAC	0.483																																																	0													143.0	121.0	128.0					3																	20153121		2203	4300	6503	SO:0001819	synonymous_variant	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.885C>T	3.37:g.20153121C>T			Q6NSK1	Silent	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom	p.C295	ENST00000263754.4	37	c.885	CCDS2634.1	3																																																																																			KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N	ENSG00000114166		0.483	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	-	0.00	73	0	C	NM_003884		20153121	+1	tier1	-	no_errors	ENST00000263754	ensembl	human	known	74_37	silent	15.69	43	8	SNP	0.996	T
KCNS2	3788	genome.wustl.edu	37	8	99441035	99441035	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:99441035G>T	ENST00000287042.4	+	2	1178	c.828G>T	c.(826-828)gtG>gtT	p.V276V	KCNS2_ENST00000521839.1_Silent_p.V276V	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	276					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TCACTCTGGTGGTGAACCTGG	0.537																																					Pancreas(138;844 2489 9202 24627)												0													183.0	177.0	179.0					8																	99441035		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.828G>T	8.37:g.99441035G>T			A8KAN1	Silent	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv2	p.V276	ENST00000287042.4	37	c.828	CCDS6279.1	8																																																																																			KCNS2	-	pfam_Ion_trans_dom	ENSG00000156486		0.537	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS2	HGNC	protein_coding	OTTHUMT00000103134.1		0.00	56	0	G	NM_020697		99441035	+1			no_errors	ENST00000287042	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.998	T
KDR	3791	genome.wustl.edu	37	4	55970908	55970908	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:55970908T>C	ENST00000263923.4	-	13	2184	c.1889A>G	c.(1888-1890)aAg>aGg	p.K630R		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	630	Ig-like C2-type 6.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGATGCATTCTTAAGCTCCAT	0.453			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																														Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													121.0	105.0	111.0					4																	55970908		2203	4300	6503	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1889A>G	4.37:g.55970908T>C	ENSP00000263923:p.Lys630Arg		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.K630R	ENST00000263923.4	37	c.1889	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	T	9.176	1.022485	0.19433	.	.	ENSG00000128052	ENST00000263923	T	0.11930	2.73	5.99	4.79	0.61399	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.245292	0.42964	D	0.000621	T	0.06416	0.0165	N	0.05230	-0.09	0.21675	N	0.999598	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35176	-0.9799	10	0.19147	T	0.46	.	10.5788	0.45244	0.0:0.1271:0.0:0.8729	.	630;630	P35968-2;P35968	.;VGFR2_HUMAN	R	630	ENSP00000263923:K630R	ENSP00000263923:K630R	K	-	2	0	KDR	55665665	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	1.978000	0.40598	2.292000	0.77174	0.533000	0.62120	AAG	KDR	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000128052		0.453	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	-	0.00	52	0	T			55970908	-1	tier1	-	no_errors	ENST00000263923	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	C
KIAA1468	57614	genome.wustl.edu	37	18	59888296	59888296	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:59888296delA	ENST00000398130.2	+	3	875	c.643delA	c.(643-645)aagfs	p.K215fs	KIAA1468_ENST00000256858.6_Frame_Shift_Del_p.K215fs	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	215										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				ACGGAAAGCCAAGGAGACCAT	0.418																																																	0													120.0	119.0	119.0					18																	59888296		1852	4093	5945	SO:0001589	frameshift_variant	0			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.643delA	18.37:g.59888296delA	ENSP00000381198:p.Lys215fs			Frame_Shift_Del	DEL	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.K215fs	ENST00000398130.2	37	c.643	CCDS11979.2	18																																																																																			KIAA1468	-	NULL	ENSG00000134444		0.418	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1		0.00	69	0	A	NM_020854		59888296	+1	tier1		no_errors	ENST00000256858	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	1.000	-
KIR3DL1	3811	genome.wustl.edu	37	19	55295113	55295113	+	Intron	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:55295113G>A	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL4_ENST00000396284.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.E299K|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.E325K|KIR3DL1_ENST00000541392.1_Intron|KIR2DL3_ENST00000434419.2_Missense_Mutation_p.E299K			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGACCCTCAGGAGGTGACATA	0.493																																																	0													15.0	17.0	16.0					19																	55295113		2092	4093	6185	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-33876G>A	19.37:g.55295113G>A			O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.E299K	ENST00000538269.1	37	c.895		19	.	.	.	.	.	.	.	.	.	.	G	13.44	2.237468	0.39498	.	.	ENSG00000243772;ENSG00000125498;ENSG00000125498	ENST00000434419;ENST00000336077;ENST00000291633	T;T;T	0.00509	7.1;7.07;6.91	1.08	-0.0262	0.13931	.	.	.	.	.	T	0.01421	0.0046	M	0.90814	3.15	0.09310	N	1	P;P;D;D	0.67145	0.866;0.602;0.969;0.996	P;B;P;P	0.62184	0.598;0.208;0.601;0.899	T	0.43048	-0.9415	9	0.87932	D	0	.	3.1205	0.06389	0.3249:0.0:0.6751:0.0	.	325;300;299;299	Q6IST4;E3NZD7;Q6H2H3;P43627	.;.;.;KI2L2_HUMAN	K	299;299;325	ENSP00000415758:E299K;ENSP00000336769:E299K;ENSP00000291633:E325K	ENSP00000291633:E325K	E	+	1	0	KIR2DL1;KIR2DL3	59986925	0.990000	0.36364	0.130000	0.21974	0.198000	0.23893	2.269000	0.43346	0.028000	0.15324	0.184000	0.17185	GAG	KIR2DL1	-	NULL	ENSG00000125498		0.493	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	HGNC	protein_coding		-	0.00	55	0	G	NM_013289		55295113	+1	tier1	-	no_errors	ENST00000336077	ensembl	human	known	74_37	missense	10.00	45	5	SNP	0.164	A
KLHL40	131377	genome.wustl.edu	37	3	42730124	42730124	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:42730124G>T	ENST00000287777.4	+	3	1436	c.1336G>T	c.(1336-1338)Gac>Tac	p.D446Y		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	446					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GGGTGAATCGGACCCGCTGCC	0.622																																																	0													79.0	65.0	69.0					3																	42730124		2203	4300	6503	SO:0001583	missense	0			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1336G>T	3.37:g.42730124G>T	ENSP00000287777:p.Asp446Tyr		Q86SI1|Q96MR2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D446Y	ENST00000287777.4	37	c.1336	CCDS2703.1	3	.	.	.	.	.	.	.	.	.	.	g	12.78	2.040815	0.35989	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.67171	-0.25	4.55	4.55	0.56014	Kelch-type beta propeller (1);	0.272385	0.41605	D	0.000858	T	0.68430	0.3000	M	0.75447	2.3	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.69409	-0.5153	10	0.59425	D	0.04	.	17.3734	0.87384	0.0:0.0:1.0:0.0	.	446	Q2TBA0	KBTB5_HUMAN	Y	446;191	ENSP00000287777:D446Y	ENSP00000287777:D446Y	D	+	1	0	KBTBD5	42705128	1.000000	0.71417	0.997000	0.53966	0.618000	0.37518	9.673000	0.98631	2.107000	0.64212	0.444000	0.29173	GAC	KLHL40	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000157119		0.622	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL40	HGNC	protein_coding	OTTHUMT00000256651.1	-	0.00	61	0	G	NM_152393		42730124	+1	tier1	-	no_errors	ENST00000287777	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49427264	49427264	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:49427264G>T	ENST00000301067.7	-	39	11223	c.11224C>A	c.(11224-11226)Cag>Aag	p.Q3742K	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3742	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										tgctgctgctgttgctgctgc	0.587																																																	0													15.0	18.0	17.0					12																	49427264		2196	4294	6490	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11224C>A	12.37:g.49427264G>T	ENSP00000301067:p.Gln3742Lys		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3742K	ENST00000301067.7	37	c.11224	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	3.358	-0.131143	0.06753	.	.	ENSG00000167548	ENST00000301067	T	0.79033	-1.23	5.11	5.11	0.69529	.	0.000000	0.33180	N	0.005189	T	0.60676	0.2287	N	0.08118	0	0.33097	D	0.538768	P	0.37864	0.61	B	0.32393	0.145	T	0.74506	-0.3643	10	0.87932	D	0	.	17.6784	0.88236	0.0:0.0:1.0:0.0	.	3742	O14686	MLL2_HUMAN	K	3742	ENSP00000301067:Q3742K	ENSP00000301067:Q3742K	Q	-	1	0	MLL2	47713531	0.916000	0.31088	0.998000	0.56505	0.192000	0.23643	3.000000	0.49481	2.547000	0.85894	0.462000	0.41574	CAG	KMT2D	-	NULL	ENSG00000167548		0.587	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	44	0	G			49427264	-1			no_errors	ENST00000301067	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.998	T
KRT27	342574	genome.wustl.edu	37	17	38937510	38937510	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:38937510T>A	ENST00000301656.3	-	2	497	c.457A>T	c.(457-459)Act>Tct	p.T153S		NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TTACTGGTAGTTGCAGAAATT	0.318																																																	0													83.0	74.0	77.0					17																	38937510		2203	4300	6503	SO:0001583	missense	0			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.457A>T	17.37:g.38937510T>A	ENSP00000301656:p.Thr153Ser			Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.T153S	ENST00000301656.3	37	c.457	CCDS11375.1	17	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946139	0.53079	.	.	ENSG00000171446	ENST00000301656	D	0.88664	-2.41	5.58	3.32	0.38043	Filament (1);	0.086419	0.50627	N	0.000106	D	0.85526	0.5717	L	0.49571	1.57	0.26284	N	0.978225	P	0.44816	0.844	P	0.47786	0.557	T	0.76958	-0.2766	10	0.44086	T	0.13	.	2.701	0.05149	0.1398:0.0812:0.1649:0.6141	.	153	Q7Z3Y8	K1C27_HUMAN	S	153	ENSP00000301656:T153S	ENSP00000301656:T153S	T	-	1	0	KRT27	36191036	0.368000	0.25031	0.857000	0.33713	0.869000	0.49853	1.285000	0.33261	0.461000	0.27071	-0.256000	0.11100	ACT	KRT27	-	pfam_IF	ENSG00000171446		0.318	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	HGNC	protein_coding	OTTHUMT00000257216.1		0.00	44	0	T	NM_181537		38937510	-1			no_errors	ENST00000301656	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.762	A
L2HGDH	79944	genome.wustl.edu	37	14	50745270	50745270	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:50745270T>A	ENST00000267436.4	-	6	1103	c.706A>T	c.(706-708)Atg>Ttg	p.M236L	L2HGDH_ENST00000421284.3_Missense_Mutation_p.M236L|L2HGDH_ENST00000261699.4_Missense_Mutation_p.M236L			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	236					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					GGATATTGCATTCCTGAAAAA	0.269																																																	0													28.0	31.0	30.0					14																	50745270		2186	4268	6454	SO:0001583	missense	0				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.706A>T	14.37:g.50745270T>A	ENSP00000267436:p.Met236Leu		Q9BRR1	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.M236L	ENST00000267436.4	37	c.706	CCDS9698.1	14	.	.	.	.	.	.	.	.	.	.	T	4.901	0.167410	0.09339	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284	D;D;D	0.92149	-2.8;-2.98;-2.98	4.99	-0.332	0.12675	FAD dependent oxidoreductase (1);	0.412464	0.33438	N	0.004920	T	0.71298	0.3323	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.58696	-0.7591	10	0.06494	T	0.89	-17.0048	1.1874	0.01858	0.2343:0.1418:0.1251:0.4988	.	236;236	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	L	236	ENSP00000261699:M236L;ENSP00000267436:M236L;ENSP00000405559:M236L	ENSP00000261699:M236L	M	-	1	0	L2HGDH	49815020	0.877000	0.30153	0.643000	0.29450	0.744000	0.42396	1.156000	0.31712	-0.130000	0.11599	0.482000	0.46254	ATG	L2HGDH	-	pfam_FAD-dep_OxRdtase	ENSG00000087299		0.269	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L2HGDH	HGNC	protein_coding	OTTHUMT00000276870.2	-	0.00	93	0	T	NM_024884		50745270	-1	tier1	-	no_errors	ENST00000267436	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.934	A
LILRA1	11024	genome.wustl.edu	37	19	55106867	55106867	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:55106867G>T	ENST00000251372.3	+	5	843	c.661G>T	c.(661-663)Ggt>Tgt	p.G221C	LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Splice_Site_p.G221*	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	221	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCTGGTCCTAGGTGAGAAATT	0.582																																																	0													101.0	111.0	108.0					19																	55106867		2203	4300	6503	SO:0001630	splice_region_variant	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.661+1G>T	19.37:g.55106867G>T			O75018|Q3MJA6	Nonsense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.G221*	ENST00000251372.3	37	c.661	CCDS12901.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.954889|4.954889	0.92726|0.92726	.|.	.|.	ENSG00000104974|ENSG00000104974	ENST00000251372|ENST00000453777	T|.	0.01397|.	4.94|.	2.24|2.24	2.24|2.24	0.28232|0.28232	Immunoglobulin-like fold (1);|.	0.160322|0.160322	0.29884|0.29884	N|N	0.010943|0.010943	D|.	0.82314|.	0.5010|.	H|H	0.97240|0.97240	3.965|3.965	0.80722|0.80722	A|A	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.91635|.	0.993;0.999|.	D|.	0.87607|.	0.2501|.	9|.	0.87932|0.87932	D|D	0|0	.|.	8.5316|8.5316	0.33337|0.33337	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	221;221|.	O75019-2;O75019|.	.;LIRA1_HUMAN|.	C|X	221|221	ENSP00000251372:G221C|.	ENSP00000251372:G221C|ENSP00000413715:G221X	G|G	+|+	1|1	0|0	LILRA1|LILRA1	59798679|59798679	0.999000|0.999000	0.42202|0.42202	0.248000|0.248000	0.24265|0.24265	0.255000|0.255000	0.26057|0.26057	2.332000|2.332000	0.43903|0.43903	1.198000|1.198000	0.43158|0.43158	0.194000|0.194000	0.17425|0.17425	GGT|GGA	LILRA1	-	NULL	ENSG00000104974		0.582	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	-	0.00	85	0	G	NM_006863	Missense_Mutation	55106867	+1	tier1	-	no_errors	ENST00000453777	ensembl	human	novel	74_37	nonsense	51.32	37	39	SNP	0.760	T
LIMK2	3985	genome.wustl.edu	37	22	31672776	31672776	+	Intron	SNP	G	G	C	rs540206607	byFrequency	TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:31672776G>C	ENST00000331728.4	+	15	1886				LIMK2_ENST00000406516.1_Splice_Site_p.A514P|LIMK2_ENST00000444929.2_Intron|LIMK2_ENST00000467301.1_Intron|LIMK2_ENST00000340552.4_Splice_Site_p.A571P|LIMK2_ENST00000333611.4_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2						phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TACTTTCAGAGCCCCCCCCGG	0.736																																																	0													8.0	9.0	9.0					22																	31672776		2174	4260	6434	SO:0001627	intron_variant	0			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1772+1482G>C	22.37:g.31672776G>C			A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PP1_inhibitor,pfam_PDZ,pfam_Znf_LIM,superfamily_Kinase-like_dom,superfamily_PP1_inhibitor,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A571P	ENST00000331728.4	37	c.1711	CCDS13891.1	22	.	.	.	.	.	.	.	.	.	.	.	0.009	-1.843532	0.00568	.	.	ENSG00000182541	ENST00000406516;ENST00000340552	D;D	0.85629	-2.01;-2.01	0.0465	0.0465	0.14256	.	0.135022	0.51477	N	0.000098	T	0.43188	0.1236	N	0.00178	-1.915	0.80722	D	1	B;B	0.12630	0.006;0.006	B;B	0.06405	0.002;0.002	T	0.51973	-0.8637	10	0.02654	T	1	-5.9433	3.6497	0.08198	2.0E-4:0.4937:0.5059:2.0E-4	.	571;514	Q7L3H5;B5MC51	.;.	P	514;571	ENSP00000384602:A514P;ENSP00000339916:A571P	ENSP00000339916:A571P	A	+	1	0	LIMK2	30002776	0.993000	0.37304	0.031000	0.17742	0.032000	0.12392	0.882000	0.28186	0.132000	0.18615	0.134000	0.15878	GCC	LIMK2	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000182541		0.736	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK2	HGNC	protein_coding	OTTHUMT00000321911.1		0.00	48	0	G	NM_016733		31672776	+1			no_errors	ENST00000340552	ensembl	human	putative	74_37	missense	10.34	26	3	SNP	0.995	C
LIMK2	3985	genome.wustl.edu	37	22	31672776	31672777	+	Intron	INS	-	-	C	rs540206607	byFrequency	TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:31672776_31672777insC	ENST00000331728.4	+	15	1886				LIMK2_ENST00000406516.1_Splice_Site_p.A514fs|LIMK2_ENST00000444929.2_Intron|LIMK2_ENST00000467301.1_Intron|LIMK2_ENST00000340552.4_Splice_Site_p.A571fs|LIMK2_ENST00000333611.4_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2						phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TACTTTCAGAGCCCCCCCCGGG	0.733													?|CCCCCCCC|CCCCCCCCC|unsure	14	0.00279553	0.0023	0.0	5008	,	,		7875	0.006		0.002	False		,,,				2504	0.0031																0																																										SO:0001627	intron_variant	0			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1772+1482->C	22.37:g.31672784_31672784dupC			A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Frame_Shift_Ins	INS	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PP1_inhibitor,pfam_PDZ,pfam_Znf_LIM,superfamily_Kinase-like_dom,superfamily_PP1_inhibitor,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G574fs	ENST00000331728.4	37	c.1711_1712	CCDS13891.1	22																																																																																			LIMK2	-	smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000182541		0.733	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK2	HGNC	protein_coding	OTTHUMT00000321911.1		0.00	48	0	-	NM_016733		31672777	+1	tier1		no_errors	ENST00000340552	ensembl	human	putative	74_37	frame_shift_ins	34.48	19	10	INS	0.995:0.996	C
LPHN2	23266	genome.wustl.edu	37	1	82416057	82416057	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:82416057T>G	ENST00000370728.1	+	9	2028	c.1383T>G	c.(1381-1383)atT>atG	p.I461M	LPHN2_ENST00000370717.2_Missense_Mutation_p.I461M|LPHN2_ENST00000370713.1_Missense_Mutation_p.I461M|LPHN2_ENST00000359929.3_Missense_Mutation_p.I461M|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370721.1_Intron|LPHN2_ENST00000370715.1_Missense_Mutation_p.I461M|LPHN2_ENST00000335786.5_Missense_Mutation_p.I461M|LPHN2_ENST00000370725.1_Missense_Mutation_p.I461M|LPHN2_ENST00000394879.1_Missense_Mutation_p.I461M|LPHN2_ENST00000370723.1_Missense_Mutation_p.I461M|LPHN2_ENST00000370727.1_Missense_Mutation_p.I461M|LPHN2_ENST00000370730.1_Missense_Mutation_p.I461M|LPHN2_ENST00000319517.6_Missense_Mutation_p.I461M|LPHN2_ENST00000271029.4_Missense_Mutation_p.I461M			O95490	LPHN2_HUMAN	latrophilin 2	461					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TAACAAATATTTTTCCCCTGC	0.473																																																	0													58.0	62.0	61.0					1																	82416057		2203	4300	6503	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1383T>G	1.37:g.82416057T>G	ENSP00000359763:p.Ile461Met		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.I461M	ENST00000370728.1	37	c.1383		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.890|9.890	1.204076|1.204076	0.22205|0.22205	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.68903	.|-0.36;-0.35;-0.3;-0.3;-0.26;-0.32;-0.32;-0.32;-0.32;-0.3;-0.26;-0.3;-0.35	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.221644	.|0.41396	.|D	.|0.000883	T|T	0.28764|0.28764	0.0713|0.0713	N|N	0.08118|0.08118	0|0	0.34715|0.34715	D|D	0.728106|0.728106	.|B;B;B	.|0.28605	.|0.013;0.217;0.004	.|B;B;B	.|0.27715	.|0.005;0.082;0.003	T|T	0.25363|0.25363	-1.0134|-1.0134	5|10	.|0.32370	.|T	.|0.25	.|.	11.3916|11.3916	0.49817|0.49817	0.1349:0.0:0.0:0.8651|0.1349:0.0:0.0:0.8651	.|.	.|461;461;461	.|O95490-3;O95490-4;O95490-2	.|.;.;.	C|M	329|461	.|ENSP00000359763:I461M;ENSP00000359765:I461M;ENSP00000359762:I461M;ENSP00000359760:I461M;ENSP00000359758:I461M;ENSP00000353006:I461M;ENSP00000359750:I461M;ENSP00000359748:I461M;ENSP00000322270:I461M;ENSP00000359752:I461M;ENSP00000378344:I461M;ENSP00000271029:I461M;ENSP00000337306:I461M	.|ENSP00000271029:I461M	F|I	+|+	2|3	0|3	LPHN2|LPHN2	82188645|82188645	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.360000|1.360000	0.34125|0.34125	2.246000|2.246000	0.74042|0.74042	0.533000|0.533000	0.62120|0.62120	TTT|ATT	LPHN2	-	NULL	ENSG00000117114		0.473	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	67	0	T	NM_012302		82416057	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	48.98	25	24	SNP	1.000	G
LRP2	4036	genome.wustl.edu	37	2	170094672	170094672	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:170094672G>A	ENST00000263816.3	-	27	4720	c.4435C>T	c.(4435-4437)Cgt>Tgt	p.R1479C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1479					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAAAAGATACGACCACTAATT	0.418																																																	0													126.0	109.0	115.0					2																	170094672		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.4435C>T	2.37:g.170094672G>A	ENSP00000263816:p.Arg1479Cys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R1479C	ENST00000263816.3	37	c.4435	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470780	0.84533	.	.	ENSG00000081479	ENST00000263816	D	0.91996	-2.95	5.39	5.39	0.77823	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.96433	0.8836	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96477	0.9353	10	0.52906	T	0.07	.	14.8292	0.70135	0.0:0.0:0.8555:0.1445	.	1479	P98164	LRP2_HUMAN	C	1479	ENSP00000263816:R1479C	ENSP00000263816:R1479C	R	-	1	0	LRP2	169802918	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	6.097000	0.71452	2.526000	0.85167	0.655000	0.94253	CGT	LRP2	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.418	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	62	0	G	NM_004525		170094672	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	26.87	49	18	SNP	1.000	A
MAML3	55534	genome.wustl.edu	37	4	140811081	140811081	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:140811081C>T	ENST00000509479.2	-	2	2365	c.1509G>A	c.(1507-1509)caG>caA	p.Q503Q	MAML3_ENST00000398940.1_Intron|MAML3_ENST00000327122.5_Silent_p.Q347Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.527																																																	0													23.0	31.0	29.0					4																	140811081		2165	4290	6455	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1509G>A	4.37:g.140811081C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q503	ENST00000509479.2	37	c.1509	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.527	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2		0.00	49	0	C			140811081	-1			no_errors	ENST00000509479	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	T
MARS2	92935	genome.wustl.edu	37	2	198571905	198571905	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:198571905G>T	ENST00000282276.6	+	1	1819	c.1776G>T	c.(1774-1776)cgG>cgT	p.R592R	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	592					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	AAGCCCACCGGACCTAGAAAC	0.423																																																	0													56.0	58.0	57.0					2																	198571905		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1776G>T	2.37:g.198571905G>T			A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.R592	ENST00000282276.6	37	c.1776	CCDS33358.1	2																																																																																			MARS2	-	NULL	ENSG00000247626		0.423	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS2	HGNC	protein_coding	OTTHUMT00000335477.1	-	0.00	49	0	G	NM_138395		198571905	+1	tier1	-	no_errors	ENST00000282276	ensembl	human	known	74_37	silent	32.61	31	15	SNP	0.913	T
MC4R	4160	genome.wustl.edu	37	18	58038855	58038855	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:58038855delC	ENST00000299766.3	-	1	1146	c.728delG	c.(727-729)ggafs	p.G243fs		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	243					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GGTAATCGCTCCCTTCATATT	0.498																																																	0													83.0	75.0	78.0					18																	58038855		2203	4300	6503	SO:0001589	frameshift_variant	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.728delG	18.37:g.58038855delC	ENSP00000299766:p.Gly243fs		B2RAC3|Q16317|Q3MIJ6	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.G243fs	ENST00000299766.3	37	c.728	CCDS11976.1	18																																																																																			MC4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn	ENSG00000166603		0.498	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1		0.00	43	0	C	NM_005912		58038855	-1	tier1		no_errors	ENST00000299766	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	1.000	-
MDFIC	29969	genome.wustl.edu	37	7	114619635	114619635	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:114619635A>G	ENST00000393486.1	+	4	882	c.292A>G	c.(292-294)Aac>Gac	p.N98D	MDFIC_ENST00000257724.3_Missense_Mutation_p.N207D	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						CAAGATAAAGAACGGCCACAC	0.473																																																	0													83.0	79.0	80.0					7																	114619635		2203	4300	6503	SO:0001583	missense	0			AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.292A>G	7.37:g.114619635A>G	ENSP00000377126:p.Asn98Asp			Missense_Mutation	SNP	NULL	p.N98D	ENST00000393486.1	37	c.292	CCDS55155.1	7	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097717	0.76870	.	.	ENSG00000135272	ENST00000257724;ENST00000393486;ENST00000427207;ENST00000498196	.	.	.	5.98	5.98	0.97165	.	0.060378	0.64402	D	0.000010	T	0.62600	0.2441	M	0.72894	2.215	0.80722	D	1	D	0.55385	0.971	P	0.47162	0.54	T	0.61282	-0.7094	9	0.19590	T	0.45	-10.1621	16.4696	0.84102	1.0:0.0:0.0:0.0	.	98	Q9P1T7	MDFIC_HUMAN	D	207;98;84;43	.	ENSP00000257724:N207D	N	+	1	0	MDFIC	114406871	1.000000	0.71417	0.984000	0.44739	0.464000	0.32679	7.135000	0.77276	2.289000	0.77006	0.482000	0.46254	AAC	MDFIC	-	NULL	ENSG00000135272		0.473	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDFIC	HGNC	protein_coding	OTTHUMT00000059968.4	-	0.00	50	0	A	NM_199072		114619635	+1	tier1	-	no_errors	ENST00000393486	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	G
TRIM13	10206	genome.wustl.edu	37	13	50570604	50570605	+	5'Flank	INS	-	-	A	rs201796222		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:50570604_50570605insA	ENST00000378182.3	+	0	0				MIR3613_ENST00000579844.1_RNA|TRIM13_ENST00000356017.4_5'Flank|TRIM13_ENST00000457662.2_5'Flank|TRIM13_ENST00000420995.2_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		ATGCAACGAACAAAAAAAAAAG	0.515																																																	0																																										SO:0001631	upstream_gene_variant	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926		13.37:g.50570614_50570614dupA	Exception_encountered		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	INS	-	NULL	ENST00000378182.3	37	NULL	CCDS9423.1	13																																																																																			MIR3613	-	-	ENSG00000264864		0.515	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	MIR3613	HGNC	protein_coding	OTTHUMT00000354875.1		0.00	30	0	-	NM_001007278		50570605	-1	tier1		no_errors	ENST00000579844	ensembl	human	known	74_37	rna	8.33	33	3	INS	1.000:1.000	A
TRIM13	10206	genome.wustl.edu	37	13	50570605	50570605	+	5'Flank	DEL	A	A	-	rs201796222		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:50570605delA	ENST00000378182.3	+	0	0				MIR3613_ENST00000579844.1_RNA|TRIM13_ENST00000356017.4_5'Flank|TRIM13_ENST00000457662.2_5'Flank|TRIM13_ENST00000420995.2_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TGCAACGAACAAAAAAAAAAG	0.512																																																	0																																										SO:0001631	upstream_gene_variant	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926		13.37:g.50570605delA	Exception_encountered		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	-	NULL	ENST00000378182.3	37	NULL	CCDS9423.1	13																																																																																			MIR3613	-	-	ENSG00000264864		0.512	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	MIR3613	HGNC	protein_coding	OTTHUMT00000354875.1		0.00	29	0	A	NM_001007278		50570605	-1	tier1		no_errors	ENST00000579844	ensembl	human	known	74_37	rna	11.11	32	4	DEL	1.000	-
GABRE	2564	genome.wustl.edu	37	X	151128132	151128132	+	Intron	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:151128132A>C	ENST00000370328.3	-	6	838				GABRE_ENST00000370325.1_Intron|MIR224_ENST00000384889.1_RNA|AF274855.1_ENST00000582865.1_RNA|GABRE_ENST00000393914.3_Intron|MIR452_ENST00000385020.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon						gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GATGAGACTGAGACATAGTTA	0.428																																																	0													160.0	132.0	140.0					X																	151128132		1568	3582	5150	SO:0001627	intron_variant	0			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.784+178T>G	X.37:g.151128132A>C			E7ET93|O15345|O15346|Q6PCD2|Q99520	RNA	SNP	-	NULL	ENST00000370328.3	37	NULL	CCDS14703.1	X																																																																																			MIR452	-	-	ENSG00000207753		0.428	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR452	HGNC	protein_coding	OTTHUMT00000060903.1	-	0.00	28	0	A	NM_004961, NM_021990, NM_021984		151128132	-1	tier1	-	no_errors	ENST00000385020	ensembl	human	known	74_37	rna	57.89	8	11	SNP	0.955	C
MT-ATP6	4508	genome.wustl.edu	37	M	9047	9047	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrM:9047T>C	ENST00000361899.2	+	1	521	c.521T>C	c.(520-522)aTt>aCt	p.I174T	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	174					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CATGCACCTAATTGGAAGCGC	0.448																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.521T>C	M.37:g.9047T>C	ENSP00000354632:p.Ile174Thr		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.I174T	ENST00000361899.2	37	c.521		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	ENSG00000198899		0.448	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		-	0.00	34	0	T	YP_003024031		9047	+1	tier1	-	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	66.67	1	2	SNP	NULL	C
MUC16	94025	genome.wustl.edu	37	19	9066962	9066962	+	Silent	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:9066962A>G	ENST00000397910.4	-	3	20687	c.20484T>C	c.(20482-20484)ccT>ccC	p.P6828P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6830	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATAGGAGAAGGAGTGGTGT	0.493																																																	0													178.0	173.0	174.0					19																	9066962		2058	4217	6275	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20484T>C	19.37:g.9066962A>G			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P6828	ENST00000397910.4	37	c.20484	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	44	0	A	NM_024690		9066962	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	27.59	21	8	SNP	0.000	G
MUC6	4588	genome.wustl.edu	37	11	1017612	1017612	+	Missense_Mutation	SNP	G	G	C	rs575890149		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:1017612G>C	ENST00000421673.2	-	31	5239	c.5189C>G	c.(5188-5190)aCc>aGc	p.T1730S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1730	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTCCCACTGGTGGTCACTGT	0.537																																																	0													430.0	441.0	437.0					11																	1017612		2177	4264	6441	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5189C>G	11.37:g.1017612G>C	ENSP00000406861:p.Thr1730Ser		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.T1730S	ENST00000421673.2	37	c.5189	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	-	0.094	-1.162601	0.01673	.	.	ENSG00000184956	ENST00000421673	T	0.35236	1.32	1.66	-0.493	0.12038	.	.	.	.	.	T	0.43389	0.1245	L	0.59436	1.845	0.09310	N	1	D	0.58620	0.983	D	0.63381	0.914	T	0.39057	-0.9632	9	0.12103	T	0.63	.	6.2222	0.20687	0.3128:0.0:0.6872:0.0	.	1730	Q6W4X9	MUC6_HUMAN	S	1730	ENSP00000406861:T1730S	ENSP00000406861:T1730S	T	-	2	0	MUC6	1007612	0.033000	0.19621	0.002000	0.10522	0.016000	0.09150	1.427000	0.34881	-0.139000	0.11414	-0.819000	0.03115	ACC	MUC6	-	NULL	ENSG00000184956		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	-	0.00	231	0	G	XM_290540		1017612	-1	tier1	-	no_errors	ENST00000421673	ensembl	human	known	74_37	missense	41.79	78	56	SNP	0.003	C
MUC5B	727897	genome.wustl.edu	37	11	1256435	1256435	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:1256435C>T	ENST00000529681.1	+	22	2809	c.2751C>T	c.(2749-2751)tgC>tgT	p.C917C	MUC5B_ENST00000447027.1_Silent_p.C920C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	917	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.|VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AAGGCAGCTGCGAGTACATCT	0.662																																																	0													80.0	93.0	88.0					11																	1256435		2122	4227	6349	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2751C>T	11.37:g.1256435C>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.C920	ENST00000529681.1	37	c.2760	CCDS44515.2	11																																																																																			MUC5B	-	pfam_VWF_type-D,smart_VWC_out,smart_VWF_C,smart_VWF_type-D	ENSG00000117983		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	69	0	C	XM_001126093		1256435	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	68.12	22	47	SNP	1.000	T
MYBPC2	4606	genome.wustl.edu	37	19	50939932	50939932	+	Missense_Mutation	SNP	G	G	A	rs373378823		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:50939932G>A	ENST00000357701.5	+	5	455	c.404G>A	c.(403-405)cGc>cAc	p.R135H		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	135	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GGGTATTACCGCCTCGAGGTC	0.612													-|||	0	0.0	0.0	0.0	5008	,	,		17489	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	1,4105		0,1,2052	109.0	108.0	108.0		404	3.2	1.0	19		108	1,8345		0,1,4172	no	missense	MYBPC2	NM_004533.3	29	0,2,6224	AA,AG,GG		0.012,0.0244,0.0161	probably-damaging	135/1142	50939932	2,12450	2053	4173	6226	SO:0001583	missense	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.404G>A	19.37:g.50939932G>A	ENSP00000350332:p.Arg135His		A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R135H	ENST00000357701.5	37	c.404	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	.	23.9	4.475284	0.84640	2.44E-4	1.2E-4	ENSG00000086967	ENST00000357701	T	0.44083	0.93	3.24	3.24	0.37175	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.29660	U	0.011540	T	0.65069	0.2656	M	0.82517	2.595	0.50467	D	0.99987	D	0.89917	1.0	D	0.71184	0.972	T	0.72779	-0.4190	10	0.72032	D	0.01	.	14.4405	0.67314	0.0:0.0:1.0:0.0	.	135	Q14324	MYPC2_HUMAN	H	135	ENSP00000350332:R135H	ENSP00000350332:R135H	R	+	2	0	MYBPC2	55631744	1.000000	0.71417	0.982000	0.44146	0.871000	0.50021	8.533000	0.90617	2.142000	0.66516	0.450000	0.29827	CGC	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.612	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	-	0.00	45	0	G	NM_004533		50939932	+1	tier1	-	no_errors	ENST00000357701	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
MYH7B	57644	genome.wustl.edu	37	20	33584467	33584467	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:33584467G>A	ENST00000262873.7	+	28	3390	c.3298G>A	c.(3298-3300)Gcc>Acc	p.A1100T		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1058						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CACGGAGCGGGCCAAGCGCAA	0.622																																																	0													29.0	31.0	31.0					20																	33584467		2202	4300	6502	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3298G>A	20.37:g.33584467G>A	ENSP00000262873:p.Ala1100Thr		Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1100T	ENST00000262873.7	37	c.3298	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113190	0.56398	.	.	ENSG00000078814	ENST00000262873	D	0.91011	-2.77	4.54	4.54	0.55810	.	0.000000	0.37669	N	0.001987	D	0.86527	0.5954	L	0.32530	0.975	0.41741	D	0.989615	B	0.14805	0.011	B	0.10450	0.005	T	0.83241	-0.0058	10	0.51188	T	0.08	.	17.8567	0.88765	0.0:0.0:1.0:0.0	.	1058	A7E2Y1	MYH7B_HUMAN	T	1100	ENSP00000262873:A1100T	ENSP00000262873:A1100T	A	+	1	0	MYH7B	33048128	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	4.626000	0.61269	2.525000	0.85131	0.655000	0.94253	GCC	MYH7B	-	NULL	ENSG00000078814		0.622	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2		0.00	30	0	G	NM_020884		33584467	+1			no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	5.13	74	4	SNP	0.998	A
NBEAL2	23218	genome.wustl.edu	37	3	47036669	47036669	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:47036669T>C	ENST00000450053.3	+	13	1623	c.1444T>C	c.(1444-1446)Tgc>Cgc	p.C482R	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.C482R	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	482					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CTGTGACAGCTGCCCTGCCAG	0.677																																																	0													7.0	9.0	8.0					3																	47036669		1963	4081	6044	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.1444T>C	3.37:g.47036669T>C	ENSP00000415034:p.Cys482Arg		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C482R	ENST00000450053.3	37	c.1444	CCDS46817.1	3	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774227	0.31411	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.50548	0.84;0.74	4.59	3.34	0.38264	Armadillo-like helical (1);Armadillo-type fold (1);	0.321554	0.35436	N	0.003214	T	0.40171	0.1106	L	0.44542	1.39	0.80722	D	1	P;B	0.47302	0.893;0.003	B;B	0.42653	0.394;0.002	T	0.41142	-0.9525	10	0.56958	D	0.05	.	10.7872	0.46411	0.0:0.0:0.1578:0.8422	.	448;482	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	R	482;482;448	ENSP00000292309:C482R;ENSP00000415034:C482R	ENSP00000292309:C482R	C	+	1	0	NBEAL2	47011673	0.013000	0.17824	1.000000	0.80357	0.984000	0.73092	0.114000	0.15520	2.053000	0.61076	0.459000	0.35465	TGC	NBEAL2	-	superfamily_ARM-type_fold	ENSG00000160796		0.677	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	-	0.00	17	0	T	XM_291064		47036669	+1	tier1	-	no_errors	ENST00000450053	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	C
NDST2	8509	genome.wustl.edu	37	10	75567398	75567398	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:75567398G>A	ENST00000309979.6	-	3	1305	c.749C>T	c.(748-750)cCc>cTc	p.P250L	RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.P250L|NDST2_ENST00000299641.4_Missense_Mutation_p.P127L			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	250	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					TGGCACTGCGGGCTCAGCTGG	0.582																																																	0													58.0	55.0	56.0					10																	75567398		2203	4300	6503	SO:0001583	missense	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.749C>T	10.37:g.75567398G>A	ENSP00000310657:p.Pro250Leu		Q2TB32|Q59H89	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.P250L	ENST00000309979.6	37	c.749	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	G	1.461	-0.562429	0.03939	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	T;T	0.41065	1.33;1.01	5.75	1.66	0.24008	.	0.865473	0.10492	N	0.668316	T	0.25044	0.0608	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21930	-1.0231	10	0.30854	T	0.27	.	9.0725	0.36502	0.3194:0.0:0.6806:0.0	.	127;250	B4E139;P52849	.;NDST2_HUMAN	L	250;127	ENSP00000310657:P250L;ENSP00000299641:P127L	ENSP00000299641:P127L	P	-	2	0	NDST2	75237404	0.039000	0.19947	0.005000	0.12908	0.305000	0.27757	1.769000	0.38522	0.031000	0.15407	-0.140000	0.14226	CCC	NDST2	-	pfam_Heparan_SO4_deacetylase	ENSG00000166507		0.582	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	-	0.00	46	0	G	NM_003635		75567398	-1	tier1	-	no_errors	ENST00000309979	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.120	A
NID1	4811	genome.wustl.edu	37	1	236144956	236144956	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:236144956G>A	ENST00000264187.6	-	16	3264	c.3182C>T	c.(3181-3183)aCt>aTt	p.T1061I	NID1_ENST00000366595.3_Missense_Mutation_p.T928I	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1061					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CACCAAGTCAGTCTCAAAGAG	0.498																																																	0													91.0	90.0	90.0					1																	236144956		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3182C>T	1.37:g.236144956G>A	ENSP00000264187:p.Thr1061Ile		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.T1061I	ENST00000264187.6	37	c.3182	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737968	0.89573	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.95918	-3.85;-3.85	5.87	5.87	0.94306	Six-bladed beta-propeller, TolB-like (1);	0.139173	0.64402	D	0.000004	D	0.98153	0.9390	M	0.89095	3.005	0.38593	D	0.950463	D;D	0.76494	0.999;0.999	D;D	0.74674	0.946;0.984	D	0.99793	1.1032	10	0.72032	D	0.01	.	20.207	0.98280	0.0:0.0:1.0:0.0	.	928;1061	P14543-2;P14543	.;NID1_HUMAN	I	1061;928	ENSP00000264187:T1061I;ENSP00000355554:T928I	ENSP00000264187:T1061I	T	-	2	0	NID1	234211579	1.000000	0.71417	0.790000	0.31976	0.587000	0.36485	4.691000	0.61738	2.765000	0.95021	0.650000	0.86243	ACT	NID1	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000116962		0.498	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	-	0.00	34	0	G	NM_002508		236144956	-1	tier1	-	no_errors	ENST00000264187	ensembl	human	known	74_37	missense	32.14	38	18	SNP	1.000	A
NME5	8382	genome.wustl.edu	37	5	137454539	137454539	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:137454539C>T	ENST00000265191.2	-	5	572	c.523G>A	c.(523-525)Gag>Aag	p.E175K	RNU6-460P_ENST00000391158.1_RNA	NM_003551.2	NP_003542.1	P56597	NDK5_HUMAN	NME/NM23 family member 5	175					cilium assembly (GO:0042384)|CTP biosynthetic process (GO:0006241)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|nucleoside metabolic process (GO:0009116)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)|ventricular system development (GO:0021591)	sperm flagellum (GO:0036126)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)			kidney(1)|large_intestine(1)|lung(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTACAAAGCTCTGTGAGTCCT	0.388																																																	0													72.0	71.0	71.0					5																	137454539		2203	4300	6503	SO:0001583	missense	0			Y14992	CCDS4197.1	5q31.2	2012-05-18	2012-05-18		ENSG00000112981	ENSG00000112981			7853	protein-coding gene	gene with protein product	"""radial spoke 23 homolog (Chlamydomonas)"""	603575	"""non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)"""			9742940, 19852809	Standard	NM_003551		Approved	nm23-H5, RSPH23	uc003lce.3	P56597	OTTHUMG00000129207	ENST00000265191.2:c.523G>A	5.37:g.137454539C>T	ENSP00000265191:p.Glu175Lys		B2R5G7	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Dpy-30_motif,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,pirsf_NDK_H5,prints_Nucleoside_diP_kinase	p.E175K	ENST00000265191.2	37	c.523	CCDS4197.1	5	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258584	0.39896	.	.	ENSG00000112981	ENST00000265191	T	0.56941	0.43	5.82	2.99	0.34606	Dpy-30 motif (1);	0.268520	0.41001	N	0.000980	T	0.58864	0.2152	M	0.91140	3.18	0.38076	D	0.93652	B	0.14805	0.011	B	0.23716	0.048	T	0.56565	-0.7958	10	0.30078	T	0.28	.	9.9342	0.41541	0.0:0.7688:0.0:0.2312	.	175	P56597	NDK5_HUMAN	K	175	ENSP00000265191:E175K	ENSP00000265191:E175K	E	-	1	0	NME5	137482438	0.986000	0.35501	0.976000	0.42696	0.996000	0.88848	2.308000	0.43690	0.327000	0.23409	0.591000	0.81541	GAG	NME5	-	pfam_Dpy-30_motif,pirsf_NDK_H5	ENSG00000112981		0.388	NME5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME5	HGNC	protein_coding	OTTHUMT00000251286.1	-	0.00	40	0	C	NM_003551		137454539	-1	tier1	-	no_errors	ENST00000265191	ensembl	human	known	74_37	missense	56.67	13	17	SNP	1.000	T
NOTCH3	4854	genome.wustl.edu	37	19	15290185	15290185	+	Silent	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:15290185T>A	ENST00000263388.2	-	21	3525	c.3450A>T	c.(3448-3450)ccA>ccT	p.P1150P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1150	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCAGCGTTCCTGGGGGACAGG	0.622																																																	0													66.0	64.0	65.0					19																	15290185		2203	4300	6503	SO:0001819	synonymous_variant	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3450A>T	19.37:g.15290185T>A			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P1150	ENST00000263388.2	37	c.3450	CCDS12326.1	19																																																																																			NOTCH3	-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.622	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1		0.00	61	0	T	NM_000435		15290185	-1			no_errors	ENST00000263388	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.183	A
NUDCD1	84955	genome.wustl.edu	37	8	110305697	110305697	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:110305697C>T	ENST00000239690.4	-	4	890	c.516G>A	c.(514-516)ctG>ctA	p.L172L	NUDCD1_ENST00000427660.2_Silent_p.L143L	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			CAGCATTTAGCAGTGAGATAC	0.333																																																	0													118.0	125.0	122.0					8																	110305697		2203	4300	6503	SO:0001819	synonymous_variant	0			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.516G>A	8.37:g.110305697C>T				Silent	SNP	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.L172	ENST00000239690.4	37	c.516	CCDS6312.1	8																																																																																			NUDCD1	-	NULL	ENSG00000120526		0.333	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD1	HGNC	protein_coding	OTTHUMT00000380996.1		0.00	35	0	C	NM_032869		110305697	-1			no_errors	ENST00000239690	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.992	T
OBSCN	84033	genome.wustl.edu	37	1	228476017	228476017	+	Missense_Mutation	SNP	C	C	T	rs527884891		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:228476017C>T	ENST00000422127.1	+	37	10111	c.10067C>T	c.(10066-10068)aCc>aTc	p.T3356I	OBSCN_ENST00000366707.4_Missense_Mutation_p.T475I|OBSCN_ENST00000366709.4_Missense_Mutation_p.T475I|OBSCN_ENST00000570156.2_Missense_Mutation_p.T3785I|OBSCN_ENST00000284548.11_Missense_Mutation_p.T3356I|OBSCN_ENST00000359599.6_Missense_Mutation_p.T2203I	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3356	Ig-like 33.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCTCACTCACCATCAGGCGT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		20880	0.0		0.001	False		,,,				2504	0.0																0													78.0	81.0	80.0					1																	228476017		2152	4249	6401	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.10067C>T	1.37:g.228476017C>T	ENSP00000409493:p.Thr3356Ile		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T3356I	ENST00000422127.1	37	c.10067	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.955062	0.34471	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	4.9	2.89	0.33648	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.100537	0.39687	N	0.001287	T	0.79281	0.4419	M	0.63169	1.94	0.09310	N	0.999996	D;D	0.69078	0.994;0.997	D;D	0.91635	0.999;0.968	T	0.67983	-0.5529	10	0.51188	T	0.08	.	10.2692	0.43473	0.2618:0.6094:0.1289:0.0	.	3356;3356	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	I	3356;3356;475;475;2203	ENSP00000284548:T3356I;ENSP00000409493:T3356I;ENSP00000355668:T475I;ENSP00000355670:T475I;ENSP00000352613:T2203I	ENSP00000284548:T3356I	T	+	2	0	OBSCN	226542640	0.000000	0.05858	0.124000	0.21820	0.012000	0.07955	-0.008000	0.12788	1.270000	0.44297	0.561000	0.74099	ACC	OBSCN	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	49	0	C	NM_052843		228476017	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.092	T
OR52A1	23538	genome.wustl.edu	37	11	5173189	5173189	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:5173189G>T	ENST00000380367.1	-	2	828	c.411C>A	c.(409-411)atC>atA	p.I137I	OR52A1_ENST00000328942.1_Silent_p.I137I			Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A, member 1	137					sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	19		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTGGGTGAAGATGTTGGCAT	0.493																																																	0													102.0	87.0	92.0					11																	5173189		2201	4298	6499	SO:0001819	synonymous_variant	0			AF154673	CCDS31374.1	11p15.4	2012-08-09			ENSG00000182070	ENSG00000182070		"""GPCR / Class A : Olfactory receptors"""	8318	protein-coding gene	gene with protein product						10512676	Standard	NM_012375		Approved	HPFH1OR	uc010qyy.2	Q9UKL2	OTTHUMG00000066603	ENST00000380367.1:c.411C>A	11.37:g.5173189G>T			Q6IF31	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I137	ENST00000380367.1	37	c.411	CCDS31374.1	11																																																																																			OR52A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000182070		0.493	OR52A1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR52A1	HGNC	protein_coding	OTTHUMT00000142810.2	-	0.00	20	0	G	NM_012375		5173189	-1	tier1	-	no_errors	ENST00000328942	ensembl	human	known	74_37	silent	73.33	4	11	SNP	1.000	T
OR5K4	403278	genome.wustl.edu	37	3	98072886	98072886	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:98072886G>T	ENST00000354924.2	+	1	189	c.189G>T	c.(187-189)ctG>ctT	p.L63L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G64fs*5(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						ACATCTTTCTGGGCAACCTGG	0.443																																																	1	Deletion - Frameshift(1)	lung(1)											301.0	296.0	298.0					3																	98072886		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.189G>T	3.37:g.98072886G>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L63	ENST00000354924.2	37	c.189	CCDS33802.1	3																																																																																			OR5K4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196098		0.443	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K4	HGNC	protein_coding	OTTHUMT00000359114.1	-	0.00	86	0	G			98072886	+1	tier1	-	no_errors	ENST00000354924	ensembl	human	known	74_37	silent	9.80	46	5	SNP	1.000	T
OR5M9	390162	genome.wustl.edu	37	11	56230198	56230198	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:56230198C>T	ENST00000279791.1	-	1	679	c.680G>A	c.(679-681)cGc>cAc	p.R227H		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					ATCGGCAGAGCGCATGCGTAG	0.488																																																	0													60.0	57.0	58.0					11																	56230198		2201	4296	6497	SO:0001583	missense	0			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.680G>A	11.37:g.56230198C>T	ENSP00000279791:p.Arg227His		Q6IEW5|Q96RB9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R227H	ENST00000279791.1	37	c.680	CCDS31531.1	11	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.377218	0.01214	.	.	ENSG00000150269	ENST00000279791	T	0.39229	1.09	4.39	-4.98	0.03019	GPCR, rhodopsin-like superfamily (1);	0.791679	0.10894	N	0.622411	T	0.26122	0.0637	L	0.39692	1.235	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.35176	-0.9799	10	0.11794	T	0.64	0.5555	8.7929	0.34861	0.0988:0.3406:0.0:0.5606	.	227	Q8NGP3	OR5M9_HUMAN	H	227	ENSP00000279791:R227H	ENSP00000279791:R227H	R	-	2	0	OR5M9	55986774	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	-2.450000	0.01007	-1.478000	0.01869	-1.228000	0.01579	CGC	OR5M9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000150269		0.488	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	HGNC	protein_coding	OTTHUMT00000391638.1	-	0.00	35	0	C	NM_001004743		56230198	-1	tier1	-	no_errors	ENST00000279791	ensembl	human	known	74_37	missense	68.75	5	11	SNP	0.000	T
OR8S1	341568	genome.wustl.edu	37	12	48920224	48920224	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:48920224G>C	ENST00000310194.1	+	1	810	c.810G>C	c.(808-810)ttG>ttC	p.L270F	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						CCATAGAGTTGATCTTCTCTG	0.478																																																	0													87.0	84.0	85.0					12																	48920224		2203	4300	6503	SO:0001583	missense	0				CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.810G>C	12.37:g.48920224G>C	ENSP00000310632:p.Leu270Phe			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L270F	ENST00000310194.1	37	c.810	CCDS31789.1	12	.	.	.	.	.	.	.	.	.	.	G	4.437	0.080822	0.08533	.	.	ENSG00000197376	ENST00000310194	T	0.00220	8.52	4.71	2.88	0.33553	GPCR, rhodopsin-like superfamily (1);	0.243970	0.21377	N	0.075533	T	0.00210	0.0006	M	0.66939	2.045	0.09310	N	1	B	0.20887	0.049	B	0.26614	0.071	T	0.36089	-0.9762	10	0.87932	D	0	-22.4997	5.7312	0.18040	0.297:0.0:0.703:0.0	.	270	Q8NH09	OR8S1_HUMAN	F	270	ENSP00000310632:L270F	ENSP00000310632:L270F	L	+	3	2	OR8S1	47206491	0.000000	0.05858	0.065000	0.19835	0.935000	0.57460	-0.812000	0.04496	1.344000	0.45657	0.655000	0.94253	TTG	OR8S1	-	pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197376		0.478	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8S1	HGNC	protein_coding	OTTHUMT00000406881.1	-	0.00	46	0	G			48920224	+1	tier1	-	no_errors	ENST00000310194	ensembl	human	known	74_37	missense	11.63	38	5	SNP	0.001	C
OSBPL11	114885	genome.wustl.edu	37	3	125286337	125286337	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:125286337G>C	ENST00000296220.5	-	6	1058	c.769C>G	c.(769-771)Ctc>Gtc	p.L257V		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	257					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						GTAGCTTTGAGCATTAAGAGA	0.428																																																	0													214.0	193.0	200.0					3																	125286337		2203	4300	6503	SO:0001583	missense	0			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.769C>G	3.37:g.125286337G>C	ENSP00000296220:p.Leu257Val		A8K9I7	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L257V	ENST00000296220.5	37	c.769	CCDS3033.1	3	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287167	0.59867	.	.	ENSG00000144909	ENST00000296220	T	0.46063	0.88	4.68	4.68	0.58851	.	0.071424	0.53938	D	0.000041	T	0.43055	0.1230	M	0.69463	2.115	0.80722	D	1	P	0.39282	0.666	B	0.35899	0.213	T	0.45101	-0.9284	10	0.34782	T	0.22	-10.5731	17.8139	0.88625	0.0:0.0:1.0:0.0	.	257	Q9BXB4	OSB11_HUMAN	V	257	ENSP00000296220:L257V	ENSP00000296220:L257V	L	-	1	0	OSBPL11	126769027	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.100000	0.94213	2.415000	0.81967	0.655000	0.94253	CTC	OSBPL11	-	NULL	ENSG00000144909		0.428	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL11	HGNC	protein_coding	OTTHUMT00000356295.1	-	0.00	74	0	G	NM_022776		125286337	-1	tier1	-	no_errors	ENST00000296220	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	C
OTUD6B	51633	genome.wustl.edu	37	8	92090640	92090640	+	Silent	SNP	T	T	C	rs370719791		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:92090640T>C	ENST00000285420.4	+	4	561	c.462T>C	c.(460-462)atT>atC	p.I154I	OTUD6B_ENST00000404789.3_Silent_p.I23I	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	124	Cys-loop. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.						cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AAGCTGAAATTGAAAACTTAA	0.373																																																	0								T		0,4402		0,0,2201	45.0	47.0	46.0		462	3.7	1.0	8		46	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	OTUD6B	NM_016023.3		0,1,6498	CC,CT,TT		0.0116,0.0,0.0077		154/324	92090640	1,12997	2201	4298	6499	SO:0001819	synonymous_variant	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.462T>C	8.37:g.92090640T>C			A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Silent	SNP	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.I154	ENST00000285420.4	37	c.462	CCDS6253.2	8																																																																																			OTUD6B	-	NULL	ENSG00000155100		0.373	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1	-	0.00	65	0	T	NM_016023		92090640	+1	tier1	-	no_errors	ENST00000285420	ensembl	human	known	74_37	silent	48.24	44	41	SNP	1.000	C
PAQR6	79957	genome.wustl.edu	37	1	156213678	156213679	+	3'UTR	DEL	CT	CT	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:156213678_156213679delCT	ENST00000292291.5	-	0	1434_1435				PAQR6_ENST00000335852.1_Frame_Shift_Del_p.G344fs|PAQR6_ENST00000492619.1_5'UTR|PAQR6_ENST00000356983.2_Frame_Shift_Del_p.G344fs|PAQR6_ENST00000368270.1_3'UTR	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI							integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					TGCATCTCCCCTCTCAGACCCT	0.589																																					GBM(16;219 398 12385 32425 38531)												0																																										SO:0001624	3_prime_UTR_variant	0			AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.*242AG>-	1.37:g.156213680_156213681delCT			B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Frame_Shift_Del	DEL	pfam_HlyIII-related	p.E345fs	ENST00000292291.5	37	c.1030_1029	CCDS1136.1	1																																																																																			PAQR6	-	NULL	ENSG00000160781		0.589	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAQR6	HGNC	protein_coding	OTTHUMT00000046297.2		0.00	91	0	CT	NM_024897		156213679	-1	tier1		no_errors	ENST00000335852	ensembl	human	known	74_37	frame_shift_del	54.05	34	40	DEL	0.387:0.383	-
PCDH11Y	83259	genome.wustl.edu	37	Y	4924899	4924899	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrY:4924899delC	ENST00000362095.5	+	1	769	c.35delC	c.(34-36)tccfs	p.S14fs	PCDH11Y_ENST00000215473.6_Frame_Shift_Del_p.S14fs|PCDH11Y_ENST00000333703.4_Intron	NM_032972.2	NP_116754.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	14					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ATTTCTTCTTCCTCTTCTCTC	0.378																																																	0																																										SO:0001589	frameshift_variant	0			AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000362095.5:c.35delC	Y.37:g.4924899delC	ENSP00000355419:p.Ser14fs		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S13fs	ENST00000362095.5	37	c.35	CCDS14777.1	Y																																																																																			PCDH11Y	-	NULL	ENSG00000099715		0.378	PCDH11Y-003	KNOWN	basic|CCDS	protein_coding	PCDH11Y	HGNC	protein_coding	OTTHUMT00000084980.1		0.00	46	0	C	NM_032973		4924899	+1	tier1		no_errors	ENST00000215473	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	0.001	-
PCDH12	51294	genome.wustl.edu	37	5	141335264	141335264	+	Missense_Mutation	SNP	G	G	A	rs147575499		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:141335264G>A	ENST00000231484.3	-	1	3363	c.2153C>T	c.(2152-2154)aCg>aTg	p.T718M	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	718					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T718M(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGATCACCGTCAGCATCGA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19970	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	large_intestine(1)						G	MET/THR	3,4403	6.2+/-15.9	0,3,2200	62.0	51.0	55.0		2153	2.7	0.3	5	dbSNP_134	55	0,8600		0,0,4300	yes	missense	PCDH12	NM_016580.2	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	718/1185	141335264	3,13003	2203	4300	6503	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2153C>T	5.37:g.141335264G>A	ENSP00000231484:p.Thr718Met		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T718M	ENST00000231484.3	37	c.2153	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	0.703	-0.790055	0.02884	6.81E-4	0.0	ENSG00000113555	ENST00000231484	T	0.54071	0.59	5.38	2.7	0.31948	.	0.525769	0.22027	N	0.065647	T	0.33644	0.0870	N	0.20685	0.6	0.09310	N	0.999991	B	0.13594	0.008	B	0.04013	0.001	T	0.21552	-1.0242	10	0.52906	T	0.07	.	7.1686	0.25706	0.3401:0.0:0.6599:0.0	.	718	Q9NPG4	PCD12_HUMAN	M	718	ENSP00000231484:T718M	ENSP00000231484:T718M	T	-	2	0	PCDH12	141315448	0.061000	0.20836	0.287000	0.24848	0.016000	0.09150	1.404000	0.34623	0.433000	0.26313	-0.137000	0.14449	ACG	PCDH12	-	NULL	ENSG00000113555		0.562	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1		0.00	28	0	G	NM_016580		141335264	-1			no_errors	ENST00000231484	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.493	A
PCDH20	64881	genome.wustl.edu	37	13	61986458	61986458	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:61986458T>C	ENST00000409186.1	-	5	3879	c.1774A>G	c.(1774-1776)Aca>Gca	p.T592A	PCDH20_ENST00000409204.4_Missense_Mutation_p.T592A			Q8N6Y1	PCD20_HUMAN	protocadherin 20	592	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GTAGAAACTGTCAGAATTCCT	0.468																																																	0													97.0	97.0	97.0					13																	61986458		2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.1774A>G	13.37:g.61986458T>C	ENSP00000386653:p.Thr592Ala		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T592A	ENST00000409186.1	37	c.1774	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	T	10.93	1.491024	0.26774	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.01613	4.73;4.73	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000004	T	0.05227	0.0139	M	0.85777	2.775	0.51767	D	0.999934	P	0.34462	0.454	B	0.40602	0.334	T	0.38222	-0.9671	10	0.19590	T	0.45	.	11.6726	0.51411	0.1322:0.0:0.0:0.8678	.	592	A8K1K9	.	A	592;592;338	ENSP00000387250:T592A;ENSP00000386653:T592A	ENSP00000351500:T338A	T	-	1	0	PCDH20	60884459	1.000000	0.71417	0.894000	0.35097	0.380000	0.30137	3.869000	0.56062	2.323000	0.78572	0.528000	0.53228	ACA	PCDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197991		0.468	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	-	0.00	24	0	T	NM_022843		61986458	-1	tier1	-	no_errors	ENST00000409186	ensembl	human	known	74_37	missense	38.10	13	8	SNP	1.000	C
PCDHB8	56128	genome.wustl.edu	37	5	140558518	140558518	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:140558518A>C	ENST00000239444.2	+	1	1148	c.903A>C	c.(901-903)gaA>gaC	p.E301D	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	301	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGACAGGAGAAATTCGACTAA	0.403																																																	0													118.0	175.0	155.0					5																	140558518		2203	4300	6503	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.903A>C	5.37:g.140558518A>C	ENSP00000239444:p.Glu301Asp		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E301D	ENST00000239444.2	37	c.903	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	A	7.727	0.698376	0.15106	.	.	ENSG00000120322	ENST00000239444	T	0.50813	0.73	4.25	1.59	0.23543	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45577	0.1349	L	0.58354	1.805	0.26333	N	0.977482	B	0.24317	0.101	B	0.36766	0.232	T	0.47209	-0.9135	9	0.38643	T	0.18	.	5.8024	0.18422	0.5854:0.3281:0.0866:0.0	.	301	Q9UN66	PCDB8_HUMAN	D	301	ENSP00000239444:E301D	ENSP00000239444:E301D	E	+	3	2	PCDHB8	140538702	0.001000	0.12720	0.661000	0.29709	0.142000	0.21351	-0.736000	0.04882	0.480000	0.27534	0.477000	0.44152	GAA	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.403	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	165	0	A	NM_019120		140558518	+1	tier1	-	no_errors	ENST00000239444	ensembl	human	known	74_37	missense	21.43	110	30	SNP	0.994	C
PCDHGA3	56112	genome.wustl.edu	37	5	140725370	140725370	+	Silent	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:140725370G>A	ENST00000253812.6	+	1	1770	c.1770G>A	c.(1768-1770)aaG>aaA	p.K590K	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	590	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGACCAAGGTGGTGGCGG	0.687																																																	0													46.0	53.0	51.0					5																	140725370		2203	4291	6494	SO:0001819	synonymous_variant	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1770G>A	5.37:g.140725370G>A			Q9Y5D4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K590	ENST00000253812.6	37	c.1770	CCDS47290.1	5																																																																																			PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254245		0.687	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	165	0	G	NM_018916		140725370	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	silent	43.80	68	53	SNP	1.000	A
PCNP	57092	genome.wustl.edu	37	3	101311691	101311692	+	3'UTR	INS	-	-	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:101311691_101311692insT	ENST00000265260.3	+	0	752_753				PCNP_ENST00000486406.1_3'UTR|PCNP_ENST00000469941.1_3'UTR|PCNP_ENST00000296024.5_3'UTR	NM_020357.1	NP_065090.1	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear protein						cell cycle (GO:0007049)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)				large_intestine(1)|lung(1)	2						TTTGGAGCCGCTTTTTTTTTCT	0.292																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS2942.1	3q12.3	2006-03-09			ENSG00000081154	ENSG00000081154			30023	protein-coding gene	gene with protein product		615210				12176013	Standard	NM_020357		Approved		uc003dva.3	Q8WW12	OTTHUMG00000159108	ENST00000265260.3:c.*95->T	3.37:g.101311700_101311700dupT			B2RBE7|D3DN52|Q53GF3|Q6AI44|Q96CU3|Q9NS81	RNA	INS	-	NULL	ENST00000265260.3	37	NULL	CCDS2942.1	3																																																																																			PCNP	-	-	ENSG00000081154		0.292	PCNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNP	HGNC	protein_coding	OTTHUMT00000353338.2		0.00	73	0	-	NM_020357		101311692	+1	tier1		no_errors	ENST00000486406	ensembl	human	known	74_37	rna	9.76	37	4	INS	0.740:0.864	T
PDE10A	10846	genome.wustl.edu	37	6	165827032	165827032	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:165827032T>A	ENST00000366882.1	-	14	1359	c.1205A>T	c.(1204-1206)aAa>aTa	p.K402I	PDE10A_ENST00000354448.4_Missense_Mutation_p.K402I|PDE10A_ENST00000539869.2_Missense_Mutation_p.K412I			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	402	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GGCAAACATTTTGAAGTTGTT	0.383																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													105.0	98.0	101.0					6																	165827032		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1205A>T	6.37:g.165827032T>A	ENSP00000355847:p.Lys402Ile		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.K412I	ENST00000366882.1	37	c.1235		6	.	.	.	.	.	.	.	.	.	.	T	31	5.102659	0.94245	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.68025	-0.3;-0.3	5.63	5.63	0.86233	GAF (2);	0.000000	0.85682	D	0.000000	T	0.65873	0.2733	N	0.20881	0.62	0.80722	D	1	D;P	0.89917	1.0;0.916	D;P	0.91635	0.999;0.827	T	0.73588	-0.3935	10	0.87932	D	0	.	15.87	0.79108	0.0:0.0:0.0:1.0	.	412;402	Q9ULW9;Q9Y233	.;PDE10_HUMAN	I	402;430;412;402;401	ENSP00000355847:K402I;ENSP00000346435:K402I	ENSP00000341187:K412I	K	-	2	0	PDE10A	165747022	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.537000	0.82033	2.145000	0.66743	0.533000	0.62120	AAA	PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.383	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	62	0	T			165827032	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57325627	57325627	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:57325627C>A	ENST00000326441.9	-	10	4546	c.4183G>T	c.(4183-4185)Gct>Tct	p.A1395S	ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.A1269S|PEG3_ENST00000598410.1_Missense_Mutation_p.A1271S|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.A1395S	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1395	Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCTGGCTCAGCAGCCTCTACG	0.572																																																	0													51.0	51.0	51.0					19																	57325627		2201	4293	6494	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4183G>T	19.37:g.57325627C>A	ENSP00000326581:p.Ala1395Ser		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A1395S	ENST00000326441.9	37	c.4183	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671969	0.67928	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02737	4.18;4.18	3.7	3.7	0.42460	.	0.000000	0.39834	N	0.001247	T	0.06645	0.0170	L	0.32530	0.975	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72075	0.976;0.976;0.976	T	0.44498	-0.9324	9	0.08381	T	0.77	-20.5021	13.7818	0.63087	0.0:1.0:0.0:0.0	.	1271;1395;1330	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	S	1395	ENSP00000326581:A1395S;ENSP00000403051:A1395S	ENSP00000326581:A1395S	A	-	1	0	ZIM2	62017439	0.246000	0.23909	0.980000	0.43619	0.818000	0.46254	1.059000	0.30517	2.372000	0.80975	0.655000	0.94253	GCT	PEG3	-	NULL	ENSG00000198300		0.572	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	84	0	C			57325627	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	35.16	59	32	SNP	1.000	A
PHRF1	57661	genome.wustl.edu	37	11	608012	608012	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:608012C>T	ENST00000264555.5	+	14	2684	c.2556C>T	c.(2554-2556)ccC>ccT	p.P852P	PHRF1_ENST00000413872.2_Silent_p.P850P|PHRF1_ENST00000533464.1_Silent_p.P848P|PHRF1_ENST00000416188.2_Silent_p.P851P	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	852					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GGTCTGGCCCCGGCCTCCTGC	0.662																																																	0													54.0	64.0	60.0					11																	608012		2024	4173	6197	SO:0001819	synonymous_variant	0			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.2556C>T	11.37:g.608012C>T			A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P852	ENST00000264555.5	37	c.2556		11																																																																																			PHRF1	-	NULL	ENSG00000070047		0.662	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1		0.00	58	0	C	NM_020901		608012	+1			no_errors	ENST00000264555	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.000	T
PHLDB1	23187	genome.wustl.edu	37	11	118516323	118516323	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:118516323T>C	ENST00000361417.2	+	17	3782	c.3371T>C	c.(3370-3372)aTc>aCc	p.I1124T	PHLDB1_ENST00000524713.1_Missense_Mutation_p.I267T|PHLDB1_ENST00000356063.5_Missense_Mutation_p.I1077T|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000527898.1_Missense_Mutation_p.I175T	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1124										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GAGACCAGCATCTCCACCGGG	0.657																																																	0													86.0	83.0	84.0					11																	118516323		2200	4295	6495	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3371T>C	11.37:g.118516323T>C	ENSP00000354498:p.Ile1124Thr		B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.I1124T	ENST00000361417.2	37	c.3371	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814149	0.70912	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063;ENST00000527898;ENST00000524713	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	5.25	5.25	0.73442	.	0.318671	0.35585	N	0.003114	T	0.69396	0.3106	M	0.68317	2.08	0.49483	D	0.999793	P;P;P;P;P	0.51449	0.867;0.82;0.945;0.868;0.94	P;P;P;P;P	0.55545	0.463;0.573;0.778;0.467;0.497	T	0.73049	-0.4105	10	0.62326	D	0.03	-21.1884	15.1756	0.72907	0.0:0.0:0.0:1.0	.	267;488;883;1077;1124	B4DK17;B0YJ65;Q5W9G0;Q86UU1-2;Q86UU1	.;.;.;.;PHLB1_HUMAN	T	1124;898;488;1077;175;267	ENSP00000354498:I1124T;ENSP00000348359:I1077T;ENSP00000435388:I175T;ENSP00000434905:I267T	ENSP00000348359:I1077T	I	+	2	0	PHLDB1	118021533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.623000	0.67757	1.981000	0.57761	0.533000	0.62120	ATC	PHLDB1	-	NULL	ENSG00000019144		0.657	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1		0.00	62	0	T	NM_015157		118516323	+1			no_errors	ENST00000361417	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	C
PKHD1	5314	genome.wustl.edu	37	6	51524568	51524568	+	Silent	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:51524568A>C	ENST00000371117.3	-	61	10631	c.10356T>G	c.(10354-10356)acT>acG	p.T3452T		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3452					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGACCCAGAAGTAGAGCAGG	0.393																																																	0													105.0	102.0	103.0					6																	51524568		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10356T>G	6.37:g.51524568A>C			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.T3452	ENST00000371117.3	37	c.10356	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	55	0	A	NM_138694		51524568	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	41.30	27	19	SNP	0.000	C
PNO1	56902	genome.wustl.edu	37	2	68389786	68389786	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:68389786T>A	ENST00000263657.2	+	5	702	c.611T>A	c.(610-612)tTg>tAg	p.L204*	RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	204	KH.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						AGGATAGTTTTGGCTGATGTG	0.343																																					NSCLC(83;642 1410 13044 32832 40058)												0													105.0	105.0	105.0					2																	68389786		2203	4300	6503	SO:0001587	stop_gained	0			AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.611T>A	2.37:g.68389786T>A	ENSP00000263657:p.Leu204*		A8K6Q0|Q53G13|Q8WVB8	Nonsense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.L204*	ENST00000263657.2	37	c.611	CCDS1885.1	2	.	.	.	.	.	.	.	.	.	.	T	36	5.839725	0.97009	.	.	ENSG00000115946	ENST00000263657	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.318	15.8223	0.78667	0.0:0.0:0.0:1.0	.	.	.	.	X	204	.	ENSP00000263657:L204X	L	+	2	0	PNO1	68243290	1.000000	0.71417	0.943000	0.38184	0.995000	0.86356	7.799000	0.85936	2.188000	0.69820	0.528000	0.53228	TTG	PNO1	-	pfam_KH_dom_type_1,smart_KH_dom	ENSG00000115946		0.343	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNO1	HGNC	protein_coding	OTTHUMT00000251756.1		0.00	88	0	T	NM_020143		68389786	+1			no_errors	ENST00000263657	ensembl	human	known	74_37	nonsense	6.06	62	4	SNP	1.000	A
PPIL3	53938	genome.wustl.edu	37	2	201750486	201750486	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:201750486G>T	ENST00000392283.4	-	3	281	c.13C>A	c.(13-15)Ctg>Atg	p.L5M	PPIL3_ENST00000286175.8_Missense_Mutation_p.L5M|PPIL3_ENST00000409449.1_Missense_Mutation_p.L5M|PPIL3_ENST00000465823.1_5'UTR|PPIL3_ENST00000409361.1_Missense_Mutation_p.L5M	NM_130906.2	NP_570981.1	Q9H2H8	PPIL3_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 3	5	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(1)|lung(2)	3						TCTGTATGCAGTGTCACAGAC	0.323																																																	0													111.0	103.0	106.0					2																	201750486		2203	4299	6502	SO:0001583	missense	0			AF251049	CCDS2332.1, CCDS2333.1	2q33.1	2008-02-05			ENSG00000240344	ENSG00000240344			9262	protein-coding gene	gene with protein product	"""Cyclophilin J"""	615811				11435694	Standard	NM_032472		Approved	CyPJ	uc002uwi.3	Q9H2H8	OTTHUMG00000132782	ENST00000392283.4:c.13C>A	2.37:g.201750486G>T	ENSP00000376107:p.Leu5Met		Q86WF9|Q96IA9|Q9BXZ1	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.L5M	ENST00000392283.4	37	c.13	CCDS2333.1	2	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967372	0.53507	.	.	ENSG00000240344	ENST00000286175;ENST00000392283;ENST00000409264;ENST00000409361;ENST00000409449;ENST00000443398;ENST00000457063	T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.2	-6.03	0.02185	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (2);Cyclophilin-like (1);	0.071307	0.56097	D	0.000024	T	0.62134	0.2403	L	0.55481	1.735	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.986;0.992	D;D;D	0.75020	0.984;0.931;0.985	T	0.69394	-0.5157	10	0.62326	D	0.03	.	17.5046	0.87741	0.1368:0.0:0.8632:0.0	.	5;5;5	Q86UR0;Q9H2H8-2;Q9H2H8	.;.;PPIL3_HUMAN	M	5;5;24;5;5;5;5	ENSP00000286175:L5M;ENSP00000376107:L5M;ENSP00000386893:L24M;ENSP00000386235:L5M;ENSP00000387012:L5M;ENSP00000391082:L5M;ENSP00000401196:L5M	ENSP00000286175:L5M	L	-	1	2	PPIL3	201458731	0.003000	0.15002	0.983000	0.44433	0.965000	0.64279	0.051000	0.14141	-0.590000	0.05866	-0.290000	0.09829	CTG	PPIL3	-	superfamily_Cyclophilin-like_PPIase_dom	ENSG00000240344		0.323	PPIL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL3	HGNC	protein_coding	OTTHUMT00000256190.3	-	0.00	28	0	G			201750486	-1	tier1	-	no_errors	ENST00000286175	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.971	T
PPP1R32	220004	genome.wustl.edu	37	11	61253310	61253310	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:61253310G>T	ENST00000338608.2	+	7	739	c.614G>T	c.(613-615)aGt>aTt	p.S205I	PPP1R32_ENST00000432063.2_Missense_Mutation_p.S205I	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	205							phosphatase binding (GO:0019902)										AAGGAGGGGAGTGGCTTCACC	0.592																																																	0													76.0	76.0	76.0					11																	61253310		2202	4299	6501	SO:0001583	missense	0			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.614G>T	11.37:g.61253310G>T	ENSP00000344140:p.Ser205Ile		Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.S205I	ENST00000338608.2	37	c.614	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	G	10.76	1.442540	0.25987	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.60920	0.15;0.68	4.77	2.89	0.33648	.	0.212906	0.32518	N	0.005986	T	0.49695	0.1572	L	0.52573	1.65	0.53688	D	0.999973	P;P	0.49090	0.815;0.919	B;B	0.43575	0.252;0.424	T	0.39800	-0.9596	9	.	.	.	-13.5269	8.6959	0.34296	0.1643:0.6621:0.1736:0.0	.	205;205	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	I	205	ENSP00000391560:S205I;ENSP00000344140:S205I	.	S	+	2	0	C11orf66	61009886	0.577000	0.26708	0.204000	0.23530	0.001000	0.01503	0.811000	0.27198	0.426000	0.26116	-0.379000	0.06801	AGT	PPP1R32	-	NULL	ENSG00000162148		0.592	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	-	0.00	36	0	G	NM_145017		61253310	+1	tier1	-	no_errors	ENST00000338608	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.704	T
PRIM2	5558	genome.wustl.edu	37	6	57467188	57467188	+	3'UTR	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:57467188A>C	ENST00000389488.2	+	0	1216				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CAATCCACCAAGCCAAGGGGA	0.438																																																	0													131.0	124.0	127.0					6																	57467188		1986	4183	6169	SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1213A>C	6.37:g.57467188A>C			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.438	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	-	0.00	169	0	A	NM_000947		57467188	+1	tier1	-	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	14.91	137	24	SNP	0.819	C
PRPF19	27339	genome.wustl.edu	37	11	60666044	60666044	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:60666044A>T	ENST00000227524.4	-	13	1314	c.1109T>A	c.(1108-1110)aTg>aAg	p.M370K		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						CTGAGAGTCCATGGTTCCTGT	0.552																																																	0													105.0	90.0	95.0					11																	60666044		2203	4299	6502	SO:0001583	missense	0			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.1109T>A	11.37:g.60666044A>T	ENSP00000227524:p.Met370Lys			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Pre-mRNA_splic_Prp19,pfam_Ubox_domain,superfamily_WD40_repeat_dom,smart_Ubox_domain,smart_WD40_repeat,pfscan_Ricin_B_lectin,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M370K	ENST00000227524.4	37	c.1109	CCDS7995.1	11	.	.	.	.	.	.	.	.	.	.	A	11.71	1.718732	0.30503	.	.	ENSG00000110107	ENST00000227524;ENST00000535326;ENST00000541371	T;T;T	0.58940	0.3;0.3;1.66	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);Ricin B lectin (1);	0.146577	0.64402	D	0.000004	T	0.36496	0.0969	N	0.12527	0.23	0.38398	D	0.945594	B	0.02656	0.0	B	0.01281	0.0	T	0.30031	-0.9992	10	0.07175	T	0.84	-29.9687	14.8627	0.70392	1.0:0.0:0.0:0.0	.	370	Q9UMS4	PRP19_HUMAN	K	370;42;242	ENSP00000227524:M370K;ENSP00000445435:M42K;ENSP00000440266:M242K	ENSP00000227524:M370K	M	-	2	0	PRPF19	60422620	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.416000	0.66417	2.168000	0.68352	0.533000	0.62120	ATG	PRPF19	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_Ricin_B_lectin,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000110107		0.552	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF19	HGNC	protein_coding	OTTHUMT00000396334.1	-	0.00	45	0	A	NM_014502		60666044	-1	tier1	-	no_errors	ENST00000227524	ensembl	human	known	74_37	missense	12.12	28	4	SNP	1.000	T
PRPF4B	8899	genome.wustl.edu	37	6	4057243	4057243	+	Intron	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:4057243A>G	ENST00000337659.6	+	13	2681				PRPF4B_ENST00000538861.1_Intron	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B						mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CTATCCTCGTATATTAAAACT	0.348																																																	0													60.0	61.0	61.0					6																	4057243		2202	4297	6499	SO:0001627	intron_variant	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2582-27A>G	6.37:g.4057243A>G			A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	RNA	SNP	-	NULL	ENST00000337659.6	37	NULL	CCDS4488.1	6																																																																																			PRPF4B	-	-	ENSG00000112739		0.348	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	-	0.00	90	0	A			4057243	+1	tier1	-	no_errors	ENST00000466185	ensembl	human	known	74_37	rna	51.43	34	36	SNP	0.000	G
PRR16	51334	genome.wustl.edu	37	5	120022198	120022198	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:120022198C>A	ENST00000407149.2	+	2	918	c.709C>A	c.(709-711)Cct>Act	p.P237T	PRR16_ENST00000505123.1_Missense_Mutation_p.P167T|PRR16_ENST00000446965.1_Missense_Mutation_p.P167T|PRR16_ENST00000379551.2_Missense_Mutation_p.P214T			Q569H4	LARGN_HUMAN	proline rich 16	237	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		ACACAGTGAACCTGTCCACCC	0.493																																																	0													87.0	84.0	85.0					5																	120022198		2203	4300	6503	SO:0001583	missense	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.709C>A	5.37:g.120022198C>A	ENSP00000385118:p.Pro237Thr		D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	NULL	p.P237T	ENST00000407149.2	37	c.709		5	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390858	0.25118	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000505123;ENST00000446965	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	4.94	3.06	0.35304	.	0.136085	0.51477	N	0.000100	T	0.49575	0.1565	L	0.44542	1.39	0.38733	D	0.953707	D;B	0.71674	0.998;0.005	D;B	0.66351	0.943;0.004	T	0.49204	-0.8964	9	.	.	.	-2.3718	9.534	0.39211	0.1448:0.774:0.0:0.0812	.	237;214	Q569H4;Q569H4-3	PRR16_HUMAN;.	T	237;214;167;167	ENSP00000385118:P237T;ENSP00000368869:P214T;ENSP00000423446:P167T;ENSP00000405491:P167T	.	P	+	1	0	PRR16	120050097	1.000000	0.71417	0.435000	0.26784	0.013000	0.08279	2.892000	0.48625	1.175000	0.42826	0.650000	0.86243	CCT	PRR16	-	NULL	ENSG00000184838		0.493	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1	-	0.00	50	0	C	NM_016644		120022198	+1	tier1	-	no_errors	ENST00000407149	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
PRR23A	729627	genome.wustl.edu	37	3	138724343	138724343	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:138724343C>T	ENST00000383163.2	-	1	767	c.768G>A	c.(766-768)ccG>ccA	p.P256P	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	256	Pro-rich.							p.P256P(1)		endometrium(3)|kidney(1)|lung(7)	11						GGGCCTTGCACGGAGGGCGTT	0.647																																																	1	Substitution - coding silent(1)	lung(1)											18.0	18.0	18.0					3																	138724343		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.768G>A	3.37:g.138724343C>T				Silent	SNP	pfam_UPF0572	p.P256	ENST00000383163.2	37	c.768	CCDS46923.1	3																																																																																			PRR23A	-	pfam_UPF0572	ENSG00000206260		0.647	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23A	HGNC	protein_coding	OTTHUMT00000361503.1	-	0.00	93	0	C	NM_001134659		138724343	-1	tier1	-	no_errors	ENST00000383163	ensembl	human	known	74_37	silent	10.34	52	6	SNP	0.000	T
PSMC5	5705	genome.wustl.edu	37	17	61905527	61905527	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:61905527C>T	ENST00000310144.6	+	2	362	c.54C>T	c.(52-54)agC>agT	p.S18S	PSMC5_ENST00000580864.1_Silent_p.S10S|PSMC5_ENST00000581882.1_Silent_p.S10S|PSMC5_ENST00000375812.4_Silent_p.S10S|FTSJ3_ENST00000580295.1_Intron|FTSJ3_ENST00000427159.2_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5	18					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						AGGCAGGCAGCGGACTCCGCC	0.537																																																	0													65.0	65.0	65.0					17																	61905527		2203	4300	6503	SO:0001819	synonymous_variant	0			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195		ENST00000310144.6:c.54C>T	17.37:g.61905527C>T			A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Silent	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.S18	ENST00000310144.6	37	c.54	CCDS11645.1	17																																																																																			PSMC5	-	NULL	ENSG00000087191		0.537	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC5	HGNC	protein_coding	OTTHUMT00000444404.1	-	0.00	51	0	C	NM_002805		61905527	+1	tier1	-	no_errors	ENST00000310144	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.998	T
PSMF1	9491	genome.wustl.edu	37	20	1115834	1115834	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:1115834T>C	ENST00000335877.6	+	4	612	c.436T>C	c.(436-438)Tgg>Cgg	p.W146R	PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000381898.4_Missense_Mutation_p.W58R|PSMF1_ENST00000246015.4_Missense_Mutation_p.W146R|PSMF1_ENST00000333082.3_Missense_Mutation_p.W146R|PSMF1_ENST00000438768.2_Intron	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	146	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						CCATGAGCAGTGGGAAAAGGC	0.552																																																	0													131.0	114.0	120.0					20																	1115834		2203	4300	6503	SO:0001583	missense	0			D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.436T>C	20.37:g.1115834T>C	ENSP00000338039:p.Trp146Arg		A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	pfam_FP_dom,pfam_PI31_Prot_Reg	p.W146R	ENST00000335877.6	37	c.436	CCDS13010.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.231|3.231	-0.157362|-0.157362	0.06544|0.06544	.|.	.|.	ENSG00000125818|ENSG00000125818	ENST00000435720|ENST00000333082;ENST00000381898;ENST00000381899;ENST00000454500;ENST00000246015;ENST00000335877	.|T;T;T;T;T	.|0.39997	.|1.05;1.05;1.05;1.05;1.05	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	.|0.464642	.|0.21861	.|N	.|0.068027	T|T	0.23014|0.23014	0.0556|0.0556	N|N	0.16368|0.16368	0.405|0.405	0.24569|0.24569	N|N	0.993937|0.993937	.|P;B;B;B	.|0.35982	.|0.531;0.229;0.001;0.0	.|B;B;B;B	.|0.35353	.|0.201;0.072;0.003;0.003	T|T	0.13308|0.13308	-1.0514|-1.0514	5|10	.|0.13470	.|T	.|0.59	-8.3812|-8.3812	7.654|7.654	0.28365|0.28365	0.0:0.0915:0.0:0.9085|0.0:0.0915:0.0:0.9085	.|.	.|58;58;146;146	.|F5H4Z3;B4DUJ0;Q5QPM7;Q92530	.|.;.;.;PSMF1_HUMAN	A|R	5|146;58;146;58;146;146	.|ENSP00000327704:W146R;ENSP00000371323:W58R;ENSP00000371324:W146R;ENSP00000246015:W146R;ENSP00000338039:W146R	.|ENSP00000246015:W146R	V|W	+|+	2|1	0|0	PSMF1|PSMF1	1063834|1063834	0.982000|0.982000	0.34865|0.34865	0.992000|0.992000	0.48379|0.48379	0.972000|0.972000	0.66771|0.66771	2.213000|2.213000	0.42844|0.42844	2.191000|2.191000	0.70037|0.70037	0.528000|0.528000	0.53228|0.53228	GTG|TGG	PSMF1	-	pfam_FP_dom	ENSG00000125818		0.552	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	HGNC	protein_coding	OTTHUMT00000077504.2	-	0.00	54	0	T	NM_178578		1115834	+1	tier1	-	no_errors	ENST00000333082	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.566	C
RARS	5917	genome.wustl.edu	37	5	167946086	167946086	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:167946086G>T	ENST00000231572.3	+	15	1928	c.1874G>T	c.(1873-1875)gGa>gTa	p.G625V	RARS_ENST00000538719.1_Splice_Site_p.G419V	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	625					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		ATCTTTTCAGGAAAAATATTG	0.338																																																	0													61.0	60.0	61.0					5																	167946086		2203	4300	6503	SO:0001630	splice_region_variant	0			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1874-1G>T	5.37:g.167946086G>T			B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tRNA-synth_N,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-ligase_Ia	p.G625V	ENST00000231572.3	37	c.1874	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.100230	0.94245	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.75704	-0.96;-0.96	5.6	5.6	0.85130	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);	0.000000	0.85682	D	0.000000	D	0.88507	0.6455	M	0.88570	2.965	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.89629	0.3854	9	.	.	.	.	18.3776	0.90440	0.0:0.0:1.0:0.0	.	625	P54136	SYRC_HUMAN	V	625;419	ENSP00000231572:G625V;ENSP00000439108:G419V	.	G	+	2	0	RARS	167878664	1.000000	0.71417	0.951000	0.38953	0.515000	0.34225	9.444000	0.97578	2.620000	0.88729	0.655000	0.94253	GGA	RARS	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd,tigrfam_Arg-tRNA-ligase_Ia	ENSG00000113643		0.338	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2	-	0.00	53	0	G	NM_002887	Missense_Mutation	167946086	+1	tier1	-	no_errors	ENST00000231572	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
RBM20	282996	genome.wustl.edu	37	10	112572140	112572140	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:112572140C>T	ENST00000369519.3	+	9	2043	c.1985C>T	c.(1984-1986)cCg>cTg	p.P662L		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	662					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CACAGCCCTCCGGGCCCCTCC	0.692																																																	0													10.0	15.0	14.0					10																	112572140		691	1590	2281	SO:0001583	missense	0			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1985C>T	10.37:g.112572140C>T	ENSP00000358532:p.Pro662Leu		A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	smart_Znf_U1,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.P662L	ENST00000369519.3	37	c.1985	CCDS44477.1	10	.	.	.	.	.	.	.	.	.	.	C	0.766	-0.767496	0.02974	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	T	0.71222	-0.55	5.79	2.28	0.28536	.	0.571142	0.15938	N	0.237311	T	0.49253	0.1546	N	0.25647	0.755	0.09310	N	0.999994	B	0.06786	0.001	B	0.01281	0.0	T	0.28870	-1.0030	10	0.06494	T	0.89	-1.2824	7.4078	0.27001	0.0:0.5084:0.0:0.4916	.	662	Q5T481	RBM20_HUMAN	L	662	ENSP00000358532:P662L	ENSP00000358532:P662L	P	+	2	0	RBM20	112562130	0.000000	0.05858	0.189000	0.23252	0.974000	0.67602	0.838000	0.27572	0.651000	0.30788	0.563000	0.77884	CCG	RBM20	-	NULL	ENSG00000203867		0.692	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM20	HGNC	protein_coding	OTTHUMT00000050339.2	-	0.00	37	0	C	NM_001134363		112572140	+1	tier1	-	no_errors	ENST00000369519	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.015	T
RCC1	1104	genome.wustl.edu	37	1	28864449	28864449	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:28864449G>A	ENST00000373833.6	+	13	1481	c.1196G>A	c.(1195-1197)cGt>cAt	p.R399H	RCC1_ENST00000373832.1_Missense_Mutation_p.R399H|RCC1_ENST00000398958.2_Missense_Mutation_p.R399H|RCC1_ENST00000373831.3_Missense_Mutation_p.R430H			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	399					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGAGAACCGTGTGGTCTTA	0.572																																																	0													79.0	78.0	78.0					1																	28864449		2203	4300	6503	SO:0001583	missense	0			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.1196G>A	1.37:g.28864449G>A	ENSP00000362939:p.Arg399His		Q16269|Q6NT97	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.R430H	ENST00000373833.6	37	c.1289	CCDS323.1	1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889380	0.72524	.	.	ENSG00000180198	ENST00000398958;ENST00000373833;ENST00000373832;ENST00000373831	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.17	5.17	0.71159	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.78310	0.4263	L	0.38649	1.16	0.80722	D	1	B;P;P	0.42649	0.337;0.786;0.658	B;B;B	0.35182	0.043;0.197;0.097	T	0.78780	-0.2070	10	0.33940	T	0.23	-6.2792	17.5978	0.88016	0.0:0.0:1.0:0.0	.	430;416;399	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	H	399;399;399;430	ENSP00000381931:R399H;ENSP00000362939:R399H;ENSP00000362938:R399H;ENSP00000362937:R430H	ENSP00000362937:R430H	R	+	2	0	RCC1	28737036	1.000000	0.71417	0.980000	0.43619	0.994000	0.84299	9.734000	0.98822	2.563000	0.86464	0.563000	0.77884	CGT	RCC1	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000180198		0.572	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RCC1	HGNC	protein_coding	OTTHUMT00000010323.3	-	0.00	55	0	G	NM_001269		28864449	+1	tier1	-	no_errors	ENST00000373831	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
RGPD4	285190	genome.wustl.edu	37	2	108488228	108488228	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:108488228A>C	ENST00000408999.3	+	20	3845	c.3768A>C	c.(3766-3768)gaA>gaC	p.E1256D	RGPD4_ENST00000354986.4_Missense_Mutation_p.E1256D	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1256					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						ATTTAAGGGAAGATGCTTTGG	0.443																																																	0													123.0	95.0	103.0					2																	108488228		692	1591	2283	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3768A>C	2.37:g.108488228A>C	ENSP00000386810:p.Glu1256Asp		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E1256D	ENST00000408999.3	37	c.3768	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	6.003	0.369036	0.11352	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.42900	0.96;0.97	2.33	-3.66	0.04489	.	.	.	.	.	T	0.21062	0.0507	N	0.17082	0.46	0.23862	N	0.996637	B	0.27450	0.179	B	0.22386	0.039	T	0.21109	-1.0255	9	0.21540	T	0.41	-35.2081	8.5477	0.33433	0.5526:0.0:0.4474:0.0	.	1256	Q7Z3J3	RGPD4_HUMAN	D	1256	ENSP00000347081:E1256D;ENSP00000386810:E1256D	ENSP00000347081:E1256D	E	+	3	2	RGPD4	107854660	0.998000	0.40836	0.958000	0.39756	0.292000	0.27327	0.832000	0.27490	-0.763000	0.04658	0.136000	0.15936	GAA	RGPD4	-	NULL	ENSG00000196862		0.443	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	197	0	A	XM_496581		108488228	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	35.44	133	73	SNP	0.994	C
RIF1	55183	genome.wustl.edu	37	2	152326341	152326341	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:152326341A>T	ENST00000243326.5	+	33	7541	c.7058A>T	c.(7057-7059)aAt>aTt	p.N2353I	RIF1_ENST00000453091.2_Missense_Mutation_p.N2327I|RIF1_ENST00000428287.2_Missense_Mutation_p.N2327I|RIF1_ENST00000444746.2_Missense_Mutation_p.N2353I|RIF1_ENST00000430328.2_Missense_Mutation_p.N2327I			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AAAGTGTCCAATGTAAAAAAG	0.318																																																	0													67.0	71.0	69.0					2																	152326341		2203	4299	6502	SO:0001583	missense	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.7058A>T	2.37:g.152326341A>T	ENSP00000243326:p.Asn2353Ile		A0AVS0|Q9NS16	Missense_Mutation	SNP	pfam_Rif1_N,superfamily_ARM-type_fold	p.N2353I	ENST00000243326.5	37	c.7058	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839293	0.71373	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	5.43	4.28	0.50868	.	0.133040	0.64402	D	0.000002	T	0.27419	0.0673	L	0.53249	1.67	0.80722	D	1	D;D	0.60575	0.979;0.988	D;D	0.69142	0.916;0.962	T	0.01397	-1.1365	10	0.87932	D	0	-19.0201	7.2327	0.26051	0.7796:0.1456:0.0748:0.0	.	2353;2327	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	I	2353;2327;2327;2353;2327	ENSP00000390181:N2353I;ENSP00000414615:N2327I;ENSP00000415691:N2327I;ENSP00000243326:N2353I;ENSP00000416123:N2327I	ENSP00000243326:N2353I	N	+	2	0	RIF1	152034587	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.478000	0.60230	1.004000	0.39156	0.454000	0.30748	AAT	RIF1	-	NULL	ENSG00000080345		0.318	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3		0.00	48	0	A			152326341	+1			no_errors	ENST00000243326	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
RNF5	6048	genome.wustl.edu	37	6	32147865	32147865	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:32147865C>T	ENST00000375094.3	+	5	565	c.407C>T	c.(406-408)aCc>aTc	p.T136I	RNF5_ENST00000427134.2_Missense_Mutation_p.T136I|AGPAT1_ENST00000336984.6_5'Flank|AGPAT1_ENST00000490711.1_5'Flank|AGPAT1_ENST00000395497.1_5'Flank|AGPAT1_ENST00000375104.2_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	136					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T136I(3)		endometrium(1)|lung(7)|urinary_tract(2)	10						TTTTTCACCACCGTCTTCAAT	0.557																																																	3	Substitution - Missense(3)	lung(3)											151.0	153.0	152.0					6																	32147865		1511	2709	4220	SO:0001583	missense	0			U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.407C>T	6.37:g.32147865C>T	ENSP00000364235:p.Thr136Ile		A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T136I	ENST00000375094.3	37	c.407	CCDS4745.1	6	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403896	0.83230	.	.	ENSG00000204308	ENST00000375094;ENST00000427134	D;D	0.93604	-3.25;-3.25	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	L	0.47716	1.5	0.58432	D	0.999999	B	0.33345	0.409	B	0.27715	0.082	D	0.86266	0.1658	10	0.37606	T	0.19	-2.0092	16.9524	0.86249	0.0:1.0:0.0:0.0	.	136	Q99942	RNF5_HUMAN	I	136	ENSP00000364235:T136I;ENSP00000407656:T136I	ENSP00000364235:T136I	T	+	2	0	RNF5	32255843	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.897000	0.75671	2.666000	0.90696	0.655000	0.94253	ACC	RNF5	-	NULL	ENSG00000204308		0.557	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF5	HGNC	protein_coding	OTTHUMT00000076133.2		0.00	33	0	C	NM_006913		32147865	+1			no_errors	ENST00000427134	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
ROBO1	6091	genome.wustl.edu	37	3	78734979	78734979	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:78734979C>T	ENST00000464233.1	-	10	1372	c.1259G>A	c.(1258-1260)cGa>cAa	p.R420Q	ROBO1_ENST00000495273.1_Missense_Mutation_p.R384Q|ROBO1_ENST00000467549.1_Missense_Mutation_p.R384Q|ROBO1_ENST00000436010.2_Missense_Mutation_p.R381Q	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	420	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AACATCAGATCGCTGGACATT	0.408																																																	0													66.0	65.0	65.0					3																	78734979		1919	4116	6035	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1259G>A	3.37:g.78734979C>T	ENSP00000420321:p.Arg420Gln		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R420Q	ENST00000464233.1	37	c.1259	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274912	0.80580	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.74842	-0.88;-0.88;1.64;1.64	5.42	5.42	0.78866	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.107189	0.56097	D	0.000028	T	0.71913	0.3396	N	0.20304	0.555	0.40113	D	0.976517	P;D;P;D;D	0.62365	0.846;0.991;0.916;0.991;0.988	B;P;P;P;P	0.58520	0.391;0.783;0.612;0.722;0.84	T	0.70655	-0.4812	9	.	.	.	.	12.8904	0.58068	0.0:0.9252:0.0:0.0748	.	384;420;384;384;381	Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	Q	381;384;420;384;384;420	ENSP00000406043:R381Q;ENSP00000420321:R420Q;ENSP00000420637:R384Q;ENSP00000417992:R384Q	.	R	-	2	0	ROBO1	78817669	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	4.900000	0.63252	2.700000	0.92200	0.563000	0.77884	CGA	ROBO1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000169855		0.408	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1		0.00	60	0	C	NM_002941		78734979	-1			no_errors	ENST00000464233	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
RREB1	6239	genome.wustl.edu	37	6	7230280	7230280	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:7230280C>T	ENST00000349384.6	+	10	2262	c.1948C>T	c.(1948-1950)Cag>Tag	p.Q650*	RREB1_ENST00000379938.2_Nonsense_Mutation_p.Q650*|RREB1_ENST00000334984.6_Nonsense_Mutation_p.Q650*|RREB1_ENST00000379933.3_Nonsense_Mutation_p.Q650*	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	650					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTTCTGCAACCAGGTGTTTGC	0.632																																																	0													35.0	34.0	35.0					6																	7230280		2202	4300	6502	SO:0001587	stop_gained	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1948C>T	6.37:g.7230280C>T	ENSP00000305560:p.Gln650*		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q650*	ENST00000349384.6	37	c.1948	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	C	39	7.591937	0.98378	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984;ENST00000483150	.	.	.	5.13	5.13	0.70059	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-53.4314	18.7851	0.91951	0.0:1.0:0.0:0.0	.	.	.	.	X	650	.	ENSP00000335574:Q650X	Q	+	1	0	RREB1	7175279	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.809000	0.47971	2.648000	0.89879	0.655000	0.94253	CAG	RREB1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124782		0.632	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	-	0.00	62	0	C			7230280	+1	tier1	-	no_errors	ENST00000379938	ensembl	human	known	74_37	nonsense	57.14	12	16	SNP	1.000	T
RUFY1	80230	genome.wustl.edu	37	5	178987059	178987059	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr5:178987059A>T	ENST00000319449.4	+	2	356	c.344A>T	c.(343-345)aAc>aTc	p.N115I	RUFY1_ENST00000393438.2_Missense_Mutation_p.N7I|RUFY1_ENST00000437570.2_Missense_Mutation_p.N7I|RUFY1_ENST00000377001.2_Missense_Mutation_p.N115I	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	115					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGCGTGCCAACCTGATGCAC	0.597										HNSCC(44;0.11)																																							0													85.0	62.0	70.0					5																	178987059		2203	4300	6503	SO:0001583	missense	0			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.344A>T	5.37:g.178987059A>T	ENSP00000325594:p.Asn115Ile		Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel,pfscan_Znf_RING	p.N115I	ENST00000319449.4	37	c.344	CCDS4445.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.3|27.3	4.821344|4.821344	0.90873|0.90873	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000319449;ENST00000377001;ENST00000437570;ENST00000393438|ENST00000502984	T;T;T;T|.	0.12774|.	2.65;2.65;2.65;2.65|.	5.56|5.56	4.41|4.41	0.53225|0.53225	.|.	0.042391|.	0.85682|.	D|.	0.000000|.	T|T	0.73682|0.73682	0.3618|0.3618	M|M	0.80616|0.80616	2.505|2.505	0.58432|0.58432	D|D	0.999996|0.999996	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.73949|0.73949	-0.3821|-0.3821	10|5	0.87932|.	D|.	0|.	-21.8491|-21.8491	11.2564|11.2564	0.49056|0.49056	0.9286:0.0:0.0714:0.0|0.9286:0.0:0.0714:0.0	.|.	115|.	Q96T51|.	RUFY1_HUMAN|.	I|S	115;115;7;7|73	ENSP00000325594:N115I;ENSP00000366200:N115I;ENSP00000390025:N7I;ENSP00000377087:N7I|.	ENSP00000325594:N115I|.	N|T	+|+	2|1	0|0	RUFY1|RUFY1	178919665|178919665	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.987000|0.987000	0.75469|0.75469	6.190000|6.190000	0.72057|0.72057	0.966000|0.966000	0.38159|0.38159	0.459000|0.459000	0.35465|0.35465	AAC|ACC	RUFY1	-	NULL	ENSG00000176783		0.597	RUFY1-001	KNOWN	basic|CCDS	protein_coding	RUFY1	HGNC	protein_coding	OTTHUMT00000253505.2	-	0.00	41	0	A	NM_001040451		178987059	+1	tier1	-	no_errors	ENST00000319449	ensembl	human	known	74_37	missense	67.35	16	33	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	38979876	38979876	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:38979876G>T	ENST00000359596.3	+	35	5607	c.5607G>T	c.(5605-5607)gaG>gaT	p.E1869D	RYR1_ENST00000355481.4_Missense_Mutation_p.E1869D|RYR1_ENST00000360985.3_Missense_Mutation_p.E1869D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1869	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTGAGCCTGAGGTCTTCACTg	0.512																																																	0													106.0	89.0	94.0					19																	38979876		2203	4300	6503	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5607G>T	19.37:g.38979876G>T	ENSP00000352608:p.Glu1869Asp		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E1869D	ENST00000359596.3	37	c.5607	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	a	10.36	1.329407	0.24167	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.06528	3.29;3.29;3.29	4.06	2.96	0.34315	.	0.630262	0.13644	U	0.372753	T	0.03651	0.0104	N	0.19112	0.55	0.28322	N	0.922206	P;P	0.37548	0.599;0.467	B;B	0.35312	0.137;0.2	T	0.35699	-0.9778	10	0.30854	T	0.27	.	2.7872	0.05377	0.425:0.0:0.232:0.3431	.	1869;1869	P21817-2;P21817	.;RYR1_HUMAN	D	1869	ENSP00000352608:E1869D;ENSP00000347667:E1869D;ENSP00000354254:E1869D	ENSP00000347667:E1869D	E	+	3	2	RYR1	43671716	0.348000	0.24861	0.975000	0.42487	0.666000	0.39218	0.066000	0.14489	0.595000	0.29777	-0.407000	0.06327	GAG	RYR1	-	NULL	ENSG00000196218		0.512	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1		0.00	48	0	G			38979876	+1			no_errors	ENST00000359596	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	T
SAMD4B	55095	genome.wustl.edu	37	19	39866396	39866396	+	Silent	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:39866396C>A	ENST00000314471.6	+	7	1809	c.774C>A	c.(772-774)gcC>gcA	p.A258A	SAMD4B_ENST00000596368.1_Silent_p.A258A|SAMD4B_ENST00000598913.1_Silent_p.A258A	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			AGCTTGGGGCCCGGGCTGCTT	0.652																																																	0													77.0	84.0	82.0					19																	39866396		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.774C>A	19.37:g.39866396C>A			A5Z0M6|Q6P194	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.A258	ENST00000314471.6	37	c.774	CCDS33020.1	19																																																																																			SAMD4B	-	NULL	ENSG00000179134		0.652	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	HGNC	protein_coding	OTTHUMT00000464467.1		0.00	54	0	C	NM_018028		39866396	+1			no_errors	ENST00000314471	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.998	A
SCN7A	6332	genome.wustl.edu	37	2	167334116	167334116	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:167334116C>A	ENST00000409855.1	-	2	217	c.91G>T	c.(91-93)Gaa>Taa	p.E31*		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	31					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TCATGGTCTTCATTATGTGTT	0.368																																																	0													68.0	62.0	64.0					2																	167334116		1825	4077	5902	SO:0001587	stop_gained	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.91G>T	2.37:g.167334116C>A	ENSP00000386796:p.Glu31*			Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.E31*	ENST00000409855.1	37	c.91	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878254	0.72294	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	.	.	.	4.63	4.63	0.57726	.	0.932660	0.08905	N	0.876671	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.0238	0.86440	0.0:1.0:0.0:0.0	.	.	.	.	X	31	.	ENSP00000259060:E31X	E	-	1	0	SCN7A	167042362	0.005000	0.15991	0.820000	0.32676	0.216000	0.24613	0.773000	0.26661	2.556000	0.86216	0.655000	0.94253	GAA	SCN7A	-	NULL	ENSG00000136546		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	43	0	C			167334116	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	nonsense	14.81	46	8	SNP	0.974	A
SCN8A	6334	genome.wustl.edu	37	12	52080158	52080158	+	Silent	SNP	T	T	C	rs559668426		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:52080158T>C	ENST00000354534.6	+	4	580	c.402T>C	c.(400-402)ttT>ttC	p.F134F	SCN8A_ENST00000545061.1_Silent_p.F134F|SCN8A_ENST00000550891.1_Silent_p.F134F	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	134					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTACAGTATTTAGCATGATCA	0.358																																																	0													162.0	143.0	149.0					12																	52080158		2000	4217	6217	SO:0001819	synonymous_variant	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.402T>C	12.37:g.52080158T>C			B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F134	ENST00000354534.6	37	c.402	CCDS44891.1	12																																																																																			SCN8A	-	NULL	ENSG00000196876		0.358	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	-	0.00	105	0	T	NM_014191		52080158	+1	tier1	-	no_errors	ENST00000354534	ensembl	human	known	74_37	silent	9.09	40	4	SNP	1.000	C
SEC14L6	730005	genome.wustl.edu	37	22	30925140	30925140	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:30925140C>T	ENST00000402034.2	-	8	597	c.598G>A	c.(598-600)Gta>Ata	p.V200I		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	200	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						TTGAAGGCTACGGCGAATAGC	0.607																																																	0																																										SO:0001583	missense	0				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.598G>A	22.37:g.30925140C>T	ENSP00000385695:p.Val200Ile			Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.V200I	ENST00000402034.2	37	c.598	CCDS54518.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.13|11.13	1.548238|1.548238	0.27652|0.27652	.|.	.|.	ENSG00000214491|ENSG00000214491	ENST00000437871|ENST00000402034	.|T	.|0.76448	.|-1.02	3.96|3.96	-0.826|-0.826	0.10805|0.10805	.|.	.|.	.|.	.|.	.|.	T|T	0.68824|0.68824	0.3043|0.3043	L|L	0.35593|0.35593	1.075|1.075	0.46954|0.46954	D|D	0.999266|0.999266	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.57791|0.57791	-0.7750|-0.7750	5|7	.|0.25106	.|T	.|0.35	-15.301|-15.301	9.3603|9.3603	0.38192|0.38192	0.0:0.715:0.0:0.285|0.0:0.715:0.0:0.285	.|.	.|.	.|.	.|.	H|I	4|200	.|ENSP00000385695:V200I	.|ENSP00000385695:V200I	R|V	-|-	2|1	0|0	SEC14L6|SEC14L6	29255140|29255140	0.826000|0.826000	0.29277|0.29277	0.028000|0.028000	0.17463|0.17463	0.009000|0.009000	0.06853|0.06853	1.559000|1.559000	0.36320|0.36320	-0.018000|-0.018000	0.14079|0.14079	0.430000|0.430000	0.28490|0.28490	CGT|GTA	SEC14L6	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000214491		0.607	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	-	0.00	47	0	C			30925140	-1	tier1	-	no_errors	ENST00000402034	ensembl	human	novel	74_37	missense	12.90	27	4	SNP	0.358	T
LSMEM2	132228	genome.wustl.edu	37	3	50314577	50314577	+	5'Flank	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:50314577G>A	ENST00000316436.3	+	0	0				SEMA3B_ENST00000418948.1_RNA	NM_153215.1	NP_694947.1	Q8N112	LSME2_HUMAN	leucine-rich single-pass membrane protein 2							integral component of membrane (GO:0016021)											AGCCAAAGCTGGAATGGCCCC	0.567																																																	0																																										SO:0001631	upstream_gene_variant	0			AK095927	CCDS2814.1	3p21.31	2013-03-08	2013-03-08	2013-03-08	ENSG00000179564	ENSG00000179564			26781	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 45"""	C3orf45			Standard	NM_153215		Approved	FLJ38608	uc003cyz.3	Q8N112	OTTHUMG00000156938		3.37:g.50314577G>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000316436.3	37	NULL	CCDS2814.1	3																																																																																			SEMA3B	-	-	ENSG00000012171		0.567	LSMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3B	HGNC	protein_coding	OTTHUMT00000346671.1	-	0.00	63	0	G	NM_153215		50314577	+1	tier1	-	no_errors	ENST00000418948	ensembl	human	known	74_37	rna	16.67	35	7	SNP	0.594	A
SEMA3D	223117	genome.wustl.edu	37	7	84628715	84628715	+	3'UTR	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:84628715T>G	ENST00000284136.6	-	0	2418				SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						AGGCAATGTTTTTATAGGTAA	0.353																																					Ovarian(63;442 1191 17318 29975 31528)												0													49.0	44.0	46.0					7																	84628715		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.*41A>C	7.37:g.84628715T>G			A6NK46|Q6UW77|Q8NCQ1	RNA	SNP	-	NULL	ENST00000284136.6	37	NULL	CCDS34676.1	7																																																																																			SEMA3D	-	-	ENSG00000153993		0.353	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	-	0.00	35	0	T	NM_152754		84628715	-1	tier1	-	no_errors	ENST00000484038	ensembl	human	known	74_37	rna	18.18	18	4	SNP	0.000	G
SEMA3D	223117	genome.wustl.edu	37	7	84629130	84629130	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:84629130T>G	ENST00000284136.6	-	17	2003	c.1960A>C	c.(1960-1962)Agt>Cgt	p.S654R	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	654	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TTCTGCAAACTTCGAATCAGT	0.398																																					Ovarian(63;442 1191 17318 29975 31528)												0													64.0	57.0	59.0					7																	84629130		2203	4300	6503	SO:0001583	missense	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1960A>C	7.37:g.84629130T>G	ENSP00000284136:p.Ser654Arg		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.S654R	ENST00000284136.6	37	c.1960	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	T	7.307	0.614171	0.14129	.	.	ENSG00000153993	ENST00000284136	T	0.65732	-0.17	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.211135	0.64402	N	0.000017	T	0.48642	0.1511	N	0.26162	0.8	0.80722	D	1	B	0.13145	0.007	B	0.12837	0.008	T	0.44345	-0.9334	10	0.10902	T	0.67	.	16.1968	0.82036	0.0:0.0:0.0:1.0	.	654	O95025	SEM3D_HUMAN	R	654	ENSP00000284136:S654R	ENSP00000284136:S654R	S	-	1	0	SEMA3D	84467066	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.825000	0.48096	2.225000	0.72522	0.533000	0.62120	AGT	SEMA3D	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000153993		0.398	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2		0.00	39	0	T	NM_152754		84629130	-1			no_errors	ENST00000284136	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	G
SERPINB1	1992	genome.wustl.edu	37	6	2833852	2833852	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:2833852G>A	ENST00000380739.5	-	7	1332	c.1130C>T	c.(1129-1131)tCt>tTt	p.S377F	SERPINB1_ENST00000476896.1_5'Flank|SERPINB1_ENST00000537185.1_Missense_Mutation_p.S226F	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	377					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		CTAAGGGGAAGAAAATCTCCC	0.373																																																	0													54.0	56.0	55.0					6																	2833852		2203	4300	6503	SO:0001583	missense	0			M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.1130C>T	6.37:g.2833852G>A	ENSP00000370115:p.Ser377Phe		A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S377F	ENST00000380739.5	37	c.1130	CCDS4477.1	6	.	.	.	.	.	.	.	.	.	.	G	17.59	3.428361	0.62844	.	.	ENSG00000021355	ENST00000380739;ENST00000542771;ENST00000537185	D;D	0.84442	-1.85;-1.85	5.69	1.78	0.24846	Serpin domain (3);	0.517070	0.22175	N	0.063591	D	0.84991	0.5595	M	0.68593	2.085	0.09310	N	1	D	0.63880	0.993	D	0.65987	0.94	T	0.79082	-0.1949	10	0.62326	D	0.03	.	11.1963	0.48715	0.0687:0.3906:0.5407:0.0	.	377	P30740	ILEU_HUMAN	F	377;339;226	ENSP00000370115:S377F;ENSP00000444543:S226F	ENSP00000370115:S377F	S	-	2	0	SERPINB1	2778851	0.282000	0.24268	0.013000	0.15412	0.240000	0.25518	1.747000	0.38298	0.099000	0.17552	0.650000	0.86243	TCT	SERPINB1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000021355		0.373	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB1	HGNC	protein_coding	OTTHUMT00000039637.1		0.00	42	0	G			2833852	-1			no_errors	ENST00000380739	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.033	A
SERAC1	84947	genome.wustl.edu	37	6	158535893	158535893	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:158535893G>T	ENST00000367104.3	-	15	1743	c.1612C>A	c.(1612-1614)Cgt>Agt	p.R538S	SERAC1_ENST00000367102.2_3'UTR|SERAC1_ENST00000367101.1_3'UTR	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	538					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		TCAGCCAAACGTGATCCATGA	0.383																																																	0													188.0	190.0	189.0					6																	158535893		2203	4300	6503	SO:0001583	missense	0			BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.1612C>A	6.37:g.158535893G>T	ENSP00000356071:p.Arg538Ser		Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	pfam_PGAP1-like,superfamily_ARM-type_fold	p.R538S	ENST00000367104.3	37	c.1612	CCDS5255.1	6	.	.	.	.	.	.	.	.	.	.	.	7.048	0.563884	0.13498	.	.	ENSG00000122335	ENST00000367104;ENST00000435180	D;D	0.85339	-1.97;-1.97	6.08	5.21	0.72293	.	0.607852	0.19487	N	0.113077	T	0.42086	0.1187	N	0.01209	-0.955	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.22277	-1.0221	10	0.07482	T	0.82	-5.92	15.2563	0.73588	0.0668:0.0:0.9332:0.0	.	538	Q96JX3	SRAC1_HUMAN	S	538;113	ENSP00000356071:R538S;ENSP00000391168:R113S	ENSP00000356071:R538S	R	-	1	0	SERAC1	158455881	1.000000	0.71417	0.024000	0.17045	0.984000	0.73092	7.277000	0.78572	-0.537000	0.06290	0.533000	0.62120	CGT	SERAC1	-	pfam_PGAP1-like	ENSG00000122335		0.383	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERAC1	HGNC	protein_coding	OTTHUMT00000042862.1	-	0.00	77	0	G	NM_032861		158535893	-1	tier1	-	no_errors	ENST00000367104	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.980	T
SH2D3C	10044	genome.wustl.edu	37	9	130509456	130509456	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:130509456C>T	ENST00000314830.8	-	6	1347	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	SH2D3C_ENST00000373276.3_Missense_Mutation_p.E344K|SH2D3C_ENST00000420366.1_Missense_Mutation_p.E254K|SH2D3C_ENST00000373274.3_Missense_Mutation_p.E252K|SH2D3C_ENST00000373277.4_Missense_Mutation_p.E255K|SH2D3C_ENST00000429553.1_Missense_Mutation_p.E58K|SH2D3C_ENST00000471939.1_Intron	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	412					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTAGGGCTCTCGGAGATGGGC	0.617																																																	0													101.0	93.0	95.0					9																	130509456		2203	4300	6503	SO:0001583	missense	0			AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.1234G>A	9.37:g.130509456C>T	ENSP00000317817:p.Glu412Lys		A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,pfscan_RasGRF_CDC25	p.E412K	ENST00000314830.8	37	c.1234	CCDS6877.1	9	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046336	0.75846	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	5.48	5.48	0.80851	.	0.198066	0.51477	D	0.000088	T	0.42449	0.1203	M	0.61703	1.905	0.80722	D	1	P;P;P;P;P	0.52316	0.739;0.84;0.952;0.949;0.83	B;B;B;B;B	0.42062	0.122;0.089;0.278;0.374;0.242	T	0.34329	-0.9833	10	0.14252	T	0.57	-14.8093	18.3472	0.90326	0.0:1.0:0.0:0.0	.	252;412;344;255;254	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	K	255;254;344;252;58;412	ENSP00000362374:E255K;ENSP00000388536:E254K;ENSP00000362373:E344K;ENSP00000362371:E252K;ENSP00000394632:E58K;ENSP00000317817:E412K	ENSP00000317817:E412K	E	-	1	0	SH2D3C	129549277	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.263000	0.78421	2.584000	0.87258	0.561000	0.74099	GAG	SH2D3C	-	NULL	ENSG00000095370		0.617	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D3C	HGNC	protein_coding	OTTHUMT00000054264.1	-	0.00	55	0	C	NM_005489		130509456	-1	tier1	-	no_errors	ENST00000314830	ensembl	human	known	74_37	missense	72.34	13	34	SNP	1.000	T
SHROOM4	57477	genome.wustl.edu	37	X	50377488	50377488	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:50377488C>A	ENST00000289292.7	-	4	1868	c.1585G>T	c.(1585-1587)Gcc>Tcc	p.A529S	SHROOM4_ENST00000460112.3_Missense_Mutation_p.A413S|SHROOM4_ENST00000376020.2_Missense_Mutation_p.A529S			Q9ULL8	SHRM4_HUMAN	shroom family member 4	529					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GAGCCAGAGGCAGAGGGTTGC	0.552																																																	0													51.0	41.0	45.0					X																	50377488		2203	4300	6503	SO:0001583	missense	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1585G>T	X.37:g.50377488C>A	ENSP00000289292:p.Ala529Ser		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A529S	ENST00000289292.7	37	c.1585	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	C	2.401	-0.337542	0.05278	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.15834	2.78;2.78;2.39	5.43	4.54	0.55810	.	0.896444	0.09577	N	0.783409	T	0.14184	0.0343	L	0.38838	1.175	0.31263	N	0.692645	B	0.27498	0.18	B	0.26517	0.07	T	0.15292	-1.0442	10	0.07813	T	0.8	.	12.2346	0.54508	0.0:0.833:0.167:0.0	.	529	Q9ULL8	SHRM4_HUMAN	S	529;529;413	ENSP00000289292:A529S;ENSP00000365188:A529S;ENSP00000421450:A413S	ENSP00000289292:A529S	A	-	1	0	SHROOM4	50394228	0.003000	0.15002	0.722000	0.30670	0.372000	0.29890	-0.019000	0.12546	1.228000	0.43614	0.600000	0.82982	GCC	SHROOM4	-	NULL	ENSG00000158352		0.552	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	-	0.00	35	0	C	NM_020717		50377488	-1	tier1	-	no_errors	ENST00000289292	ensembl	human	known	74_37	missense	31.25	22	10	SNP	0.895	A
SIN3A	25942	genome.wustl.edu	37	15	75676691	75676691	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:75676691G>T	ENST00000394947.3	-	17	3423	c.3109C>A	c.(3109-3111)Ctg>Atg	p.L1037M	SIN3A_ENST00000360439.4_Missense_Mutation_p.L1037M|SIN3A_ENST00000394949.4_Missense_Mutation_p.L1037M	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TGTGTGTTCAGCTGGCCTCCG	0.493																																																	0													96.0	99.0	98.0					15																	75676691		2197	4294	6491	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3109C>A	15.37:g.75676691G>T	ENSP00000378402:p.Leu1037Met			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.L1037M	ENST00000394947.3	37	c.3109	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664181	0.47572	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.50548	0.74;0.74;0.74	6.0	6.0	0.97389	.	0.240987	0.36482	N	0.002578	T	0.63792	0.2541	M	0.73598	2.24	0.80722	D	1	D	0.56287	0.975	P	0.59761	0.863	T	0.63166	-0.6698	10	0.45353	T	0.12	-16.1406	12.8026	0.57594	0.0738:0.0:0.9262:0.0	.	1037	Q96ST3	SIN3A_HUMAN	M	1037	ENSP00000378402:L1037M;ENSP00000378403:L1037M;ENSP00000353622:L1037M	ENSP00000353622:L1037M	L	-	1	2	SIN3A	73463744	0.990000	0.36364	1.000000	0.80357	0.989000	0.77384	1.137000	0.31479	2.868000	0.98415	0.556000	0.70494	CTG	SIN3A	-	NULL	ENSG00000169375		0.493	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	-	0.00	78	0	G	NM_015477		75676691	-1	tier1	-	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45204264	45204264	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:45204264C>T	ENST00000279027.4	-	10	1298	c.1280G>A	c.(1279-1281)tGg>tAg	p.W427*	SLC13A3_ENST00000435032.1_Intron|SLC13A3_ENST00000413164.2_Nonsense_Mutation_p.W377*|SLC13A3_ENST00000495082.1_Nonsense_Mutation_p.W380*|SLC13A3_ENST00000472148.1_Nonsense_Mutation_p.W345*|SLC13A3_ENST00000290317.5_Nonsense_Mutation_p.W380*|SLC13A3_ENST00000396360.1_Nonsense_Mutation_p.W345*	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	427					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GATGATGTTCCAGGGCACTGT	0.617																																																	0													89.0	69.0	76.0					20																	45204264		2203	4300	6503	SO:0001587	stop_gained	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1280G>A	20.37:g.45204264C>T	ENSP00000279027:p.Trp427*		B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Nonsense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.W427*	ENST00000279027.4	37	c.1280	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	38	7.228922	0.98150	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082;ENST00000468915	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6917	17.6296	0.88103	0.0:1.0:0.0:0.0	.	.	.	.	X	380;345;427;345;377;380;380	.	ENSP00000279027:W427X	W	-	2	0	SLC13A3	44637671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.711000	0.84669	2.399000	0.81585	0.655000	0.94253	TGG	SLC13A3	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000158296		0.617	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	-	0.00	56	0	C			45204264	-1	tier1	-	no_errors	ENST00000279027	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	1.000	T
SLC27A4	10999	genome.wustl.edu	37	9	131117388	131117388	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:131117388G>T	ENST00000300456.4	+	10	1498	c.1381G>T	c.(1381-1383)Gat>Tat	p.D461Y	SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	461					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.D461Y(1)		autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						GCGCCGCTTCGATGGCTACCT	0.622																																					Pancreas(107;1554 2241 10946 12953)												1	Substitution - Missense(1)	lung(1)											41.0	36.0	38.0					9																	131117388		2203	4300	6503	SO:0001583	missense	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1381G>T	9.37:g.131117388G>T	ENSP00000300456:p.Asp461Tyr		A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.D461Y	ENST00000300456.4	37	c.1381	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676731	0.88445	.	.	ENSG00000167114	ENST00000300456	T	0.41400	1.0	5.77	5.77	0.91146	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80437	-0.1383	10	0.59425	D	0.04	-24.9549	18.9865	0.92773	0.0:0.0:1.0:0.0	.	461	Q6P1M0	S27A4_HUMAN	Y	461	ENSP00000300456:D461Y	ENSP00000300456:D461Y	D	+	1	0	SLC27A4	130157209	1.000000	0.71417	0.625000	0.29200	0.998000	0.95712	7.644000	0.83416	2.724000	0.93272	0.561000	0.74099	GAT	SLC27A4	-	pfam_AMP-dep_Synth/Lig	ENSG00000167114		0.622	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2		0.00	69	0	G			131117388	+1			no_errors	ENST00000300456	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.998	T
SLC35B2	347734	genome.wustl.edu	37	6	44224561	44224561	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:44224561C>G	ENST00000393812.3	-	2	209	c.66G>C	c.(64-66)gaG>gaC	p.E22D	SLC35B2_ENST00000393810.1_Missense_Mutation_p.E22D|SLC35B2_ENST00000495706.1_Intron|SLC35B2_ENST00000537814.1_Intron|SLC35B2_ENST00000538577.1_5'UTR|MIR4647_ENST00000583964.1_RNA	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	22					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTTCGGGAGTCTCCCCACCTG	0.592																																																	0													70.0	76.0	74.0					6																	44224561		2203	4300	6503	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.66G>C	6.37:g.44224561C>G	ENSP00000377401:p.Glu22Asp		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.E22D	ENST00000393812.3	37	c.66	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	c	11.31	1.601812	0.28534	.	.	ENSG00000157593	ENST00000393810;ENST00000393812;ENST00000341553	T	0.31769	1.48	3.58	1.75	0.24633	.	0.322570	0.28247	N	0.016046	T	0.05547	0.0146	N	0.24115	0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23440	-1.0188	10	0.26408	T	0.33	-27.694	1.4821	0.02439	0.1559:0.4449:0.1526:0.2466	.	22	Q8TB61	S35B2_HUMAN	D	22	ENSP00000377401:E22D	ENSP00000342455:E22D	E	-	3	2	SLC35B2	44332539	0.008000	0.16893	0.732000	0.30844	0.719000	0.41307	0.135000	0.15952	0.205000	0.20568	0.561000	0.74099	GAG	SLC35B2	-	NULL	ENSG00000157593		0.592	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	-	0.00	86	0	C			44224561	-1	tier1	-	no_errors	ENST00000393812	ensembl	human	known	74_37	missense	11.59	206	27	SNP	0.060	G
SLC37A2	219855	genome.wustl.edu	37	11	124946707	124946707	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr11:124946707G>T	ENST00000403796.2	+	2	415	c.114G>T	c.(112-114)atG>atT	p.M38I	SLC37A2_ENST00000407458.1_Missense_Mutation_p.M38I|SLC37A2_ENST00000298280.5_Missense_Mutation_p.M38I|SLC37A2_ENST00000308074.4_Missense_Mutation_p.M38I	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	38					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		GCTATCACATGTCCAGGAAGC	0.562																																					Melanoma(11;373 620 21213 26083 47768)												0													182.0	131.0	149.0					11																	124946707		2201	4299	6500	SO:0001583	missense	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.114G>T	11.37:g.124946707G>T	ENSP00000384407:p.Met38Ile		A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M38I	ENST00000403796.2	37	c.114	CCDS44757.1	11	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678098	0.47886	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000298280;ENST00000532000;ENST00000308074	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.93;0.35	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.105005	0.64402	D	0.000003	T	0.56601	0.1996	M	0.76002	2.32	0.40232	D	0.977855	B;B	0.23249	0.082;0.022	B;B	0.28139	0.086;0.06	T	0.56456	-0.7976	10	0.44086	T	0.13	-38.4453	15.2137	0.73247	0.0:0.1817:0.8183:0.0	.	38;38	Q8TED4-2;Q8TED4	.;SPX2_HUMAN	I	38;38;38;1;38	ENSP00000384407:M38I;ENSP00000385126:M38I;ENSP00000298280:M38I;ENSP00000432254:M1I;ENSP00000311833:M38I	ENSP00000298280:M38I	M	+	3	0	SLC37A2	124451917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.835000	0.27531	2.633000	0.89246	0.655000	0.94253	ATG	SLC37A2	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000134955		0.562	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	-	0.00	61	0	G	XM_166184		124946707	+1	tier1	-	no_errors	ENST00000308074	ensembl	human	known	74_37	missense	56.67	26	34	SNP	1.000	T
SLC4A3	6508	genome.wustl.edu	37	2	220501511	220501511	+	Missense_Mutation	SNP	G	G	A	rs200405778		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:220501511G>A	ENST00000358055.3	+	16	2962	c.2450G>A	c.(2449-2451)cGc>cAc	p.R817H	SLC4A3_ENST00000317151.3_Missense_Mutation_p.R817H|SLC4A3_ENST00000373762.3_Missense_Mutation_p.R844H|SLC4A3_ENST00000373760.2_Missense_Mutation_p.R817H|SLC4A3_ENST00000273063.6_Missense_Mutation_p.R844H			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	817	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCCTGGTCCGCTACATCTCG	0.577																																																	0													198.0	181.0	187.0					2																	220501511		2203	4300	6503	SO:0001583	missense	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2450G>A	2.37:g.220501511G>A	ENSP00000350756:p.Arg817His		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.R844H	ENST00000358055.3	37	c.2531	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.104895	0.94245	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000356251;ENST00000317151	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	4.46	4.46	0.54185	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91496	0.7315	M	0.90369	3.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.997	D	0.93399	0.6758	10	0.87932	D	0	.	17.65	0.88161	0.0:0.0:1.0:0.0	.	521;817;844	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	H	817;817;844;844;80;817	ENSP00000350756:R817H;ENSP00000362865:R817H;ENSP00000273063:R844H;ENSP00000362867:R844H;ENSP00000314006:R817H	ENSP00000273063:R844H	R	+	2	0	SLC4A3	220209755	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.454000	0.97621	2.454000	0.82982	0.637000	0.83480	CGC	SLC4A3	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	ENSG00000114923		0.577	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1	-	0.00	51	0	G	NM_005070		220501511	+1	tier1	-	no_errors	ENST00000273063	ensembl	human	known	74_37	missense	26.09	34	12	SNP	1.000	A
SLC7A13	157724	genome.wustl.edu	37	8	87242065	87242065	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:87242065G>T	ENST00000297524.3	-	1	545	c.442C>A	c.(442-444)Ctg>Atg	p.L148M	SLC7A13_ENST00000520624.1_Intron|SLC7A13_ENST00000419776.2_Missense_Mutation_p.L148M	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	148						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						CGAGAAGTCAGAATTCCTACA	0.463																																																	0													105.0	95.0	99.0					8																	87242065		2203	4300	6503	SO:0001583	missense	0			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.442C>A	8.37:g.87242065G>T	ENSP00000297524:p.Leu148Met		Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.L148M	ENST00000297524.3	37	c.442	CCDS34917.1	8	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219173	0.39201	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.91237	-2.81;-2.81	4.74	3.87	0.44632	Amino acid permease domain (1);	0.159884	0.30235	N	0.010094	D	0.90170	0.6928	L	0.37800	1.135	0.29781	N	0.833973	P;D	0.64830	0.86;0.994	P;D	0.63283	0.661;0.913	D	0.85547	0.1219	10	0.87932	D	0	.	6.1616	0.20368	0.0946:0.0:0.7213:0.1841	.	148;148	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	M	148	ENSP00000297524:L148M;ENSP00000410982:L148M	ENSP00000297524:L148M	L	-	1	2	SLC7A13	87311181	0.961000	0.32948	0.991000	0.47740	0.451000	0.32288	0.817000	0.27281	1.367000	0.46095	0.514000	0.50259	CTG	SLC7A13	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	ENSG00000164893		0.463	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A13	HGNC	protein_coding	OTTHUMT00000374704.1	-	0.00	42	0	G	NM_138817		87242065	-1	tier1	-	no_errors	ENST00000297524	ensembl	human	known	74_37	missense	29.17	34	14	SNP	0.853	T
SLCO1C1	53919	genome.wustl.edu	37	12	20874909	20874909	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:20874909A>G	ENST00000266509.2	+	8	1315	c.947A>G	c.(946-948)aAg>aGg	p.K316R	SLCO1C1_ENST00000545102.1_Missense_Mutation_p.K198R|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.K267R|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.K316R|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.K316R	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	316					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	GAGAAATCCAAGTTTATTATA	0.368																																																	0													56.0	59.0	58.0					12																	20874909		2202	4300	6502	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.947A>G	12.37:g.20874909A>G	ENSP00000266509:p.Lys316Arg		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.K316R	ENST00000266509.2	37	c.947	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	A	11.36	1.614329	0.28712	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	4.76	2.34	0.29019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.501234	0.22311	N	0.061729	T	0.25901	0.0631	L	0.37466	1.105	0.32180	N	0.580427	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.002;0.001;0.002;0.003	T	0.20773	-1.0265	10	0.16896	T	0.51	.	4.7032	0.12837	0.6646:0.1615:0.1739:0.0	.	198;267;316;316	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	R	316;267;316;316;198	ENSP00000444149:K316R;ENSP00000438665:K267R;ENSP00000266509:K316R;ENSP00000370964:K316R;ENSP00000444527:K198R	ENSP00000266509:K316R	K	+	2	0	SLCO1C1	20766176	1.000000	0.71417	0.985000	0.45067	0.891000	0.51852	1.807000	0.38902	0.382000	0.24878	0.460000	0.39030	AAG	SLCO1C1	-	pfam_OA_transporter,pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.368	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	-	0.00	58	0	A	NM_017435		20874909	+1	tier1	-	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.988	G
SMC4	10051	genome.wustl.edu	37	3	160148955	160148955	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:160148955G>A	ENST00000357388.3	+	20	3527	c.3076G>A	c.(3076-3078)Gct>Act	p.A1026T	SMC4_ENST00000469762.1_Missense_Mutation_p.A1001T|SMC4_ENST00000344722.5_Missense_Mutation_p.A1026T|SMC4_ENST00000360111.2_Intron|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	1026					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGGTCACATTGCTGAACATAA	0.294																																																	0													40.0	42.0	41.0					3																	160148955		2202	4298	6500	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.3076G>A	3.37:g.160148955G>A	ENSP00000349961:p.Ala1026Thr		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.A1026T	ENST00000357388.3	37	c.3076	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469894	0.26423	.	.	ENSG00000113810	ENST00000357388;ENST00000469762;ENST00000344722;ENST00000545277	T;T;T	0.78003	-1.14;-0.85;-1.14	5.95	-2.11	0.07187	RecF/RecN/SMC (1);	0.549203	0.21981	N	0.066302	T	0.52661	0.1748	N	0.11870	0.19	0.58432	D	0.999997	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.11329	0.005;0.003;0.006	T	0.11155	-1.0599	10	0.24483	T	0.36	-0.8686	7.0387	0.25008	0.1794:0.0:0.3107:0.5099	.	1001;1001;1026	B3KXX5;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	T	1026;1001;1026;620	ENSP00000349961:A1026T;ENSP00000417964:A1001T;ENSP00000341382:A1026T	ENSP00000341382:A1026T	A	+	1	0	SMC4	161631649	0.772000	0.28567	0.991000	0.47740	0.997000	0.91878	0.065000	0.14466	-0.134000	0.11516	0.655000	0.94253	GCT	SMC4	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000113810		0.294	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	-	0.00	82	0	G			160148955	+1	tier1	-	no_errors	ENST00000344722	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.384	A
SNHG14	104472715	genome.wustl.edu	37	15	25333040	25333040	+	RNA	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:25333040T>A	ENST00000546682.1	+	0	586				SNORD116-20_ENST00000384529.1_lincRNA|SNHG14_ENST00000384430.1_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-19_ENST00000384729.1_RNA|SNORD116-20_ENST00000384507.1_lincRNA|SNHG14_ENST00000549804.2_RNA|SNORD116-18_ENST00000383961.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		GGCTCCCATGTATAGGAAATT	0.483																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25333040T>A				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNORD116-20	-	-	ENSG00000261069		0.483	SNHG14-022	KNOWN	basic	antisense	SNORD116-20	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	31	0	T			25333040	+1	tier1	-	no_errors	ENST00000567527	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.000	A
SOX8	30812	genome.wustl.edu	37	16	1032188	1032190	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr16:1032188_1032190delGCG	ENST00000293894.3	+	1	381_383	c.266_268delGCG	c.(265-270)cgcggc>cgc	p.G94del	RP11-161M6.2_ENST00000565467.1_lincRNA	NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	94					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G94delG(1)		central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				ATGCCGGTgcgcggcggcggcgg	0.729																																																	1	Deletion - In frame(1)	prostate(1)								56,2574		15,26,1274						3.1	1.0			3	200,5172		37,126,2523	no	coding	SOX8	NM_014587.3		52,152,3797	A1A1,A1R,RR		3.723,2.1293,3.1992				256,7746				SO:0001651	inframe_deletion	0			AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.266_268delGCG	16.37:g.1032197_1032199delGCG	ENSP00000293894:p.Gly94del		Q9NZW2	In_Frame_Del	DEL	pfam_HMG_box_dom,pfam_Sox_N,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.G93in_frame_del	ENST00000293894.3	37	c.266_268	CCDS10428.1	16																																																																																			SOX8	-	superfamily_HMG_box_dom	ENSG00000005513		0.729	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX8	HGNC	protein_coding	OTTHUMT00000242867.1		0.00	33	0	GCG			1032190	+1	tier1		no_errors	ENST00000293894	ensembl	human	known	74_37	in_frame_del	19.23	21	5	DEL	0.983:0.601:0.997	-
SP6	80320	genome.wustl.edu	37	17	45925335	45925335	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:45925335C>T	ENST00000536300.1	-	2	792	c.461G>A	c.(460-462)gGc>gAc	p.G154D	SP6_ENST00000342234.2_Missense_Mutation_p.G154D	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	154					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						TCCGACGTAGCCCCCCAAGCC	0.711																																																	0													9.0	11.0	11.0					17																	45925335		2165	4241	6406	SO:0001583	missense	0				CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.461G>A	17.37:g.45925335C>T	ENSP00000438209:p.Gly154Asp		B3KXS4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G154D	ENST00000536300.1	37	c.461	CCDS11520.1	17	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643667	0.87859	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.08634	3.07;3.07	4.35	4.35	0.52113	.	0.000000	0.44285	D	0.000463	T	0.10035	0.0246	L	0.36672	1.1	0.52099	D	0.999945	P	0.47409	0.895	B	0.43838	0.433	T	0.12915	-1.0529	10	0.42905	T	0.14	.	15.8112	0.78565	0.0:1.0:0.0:0.0	.	154	Q3SY56	SP6_HUMAN	D	154	ENSP00000340799:G154D;ENSP00000438209:G154D	ENSP00000340799:G154D	G	-	2	0	SP6	43280334	0.958000	0.32768	1.000000	0.80357	0.966000	0.64601	1.238000	0.32707	2.253000	0.74438	0.462000	0.41574	GGC	SP6	-	NULL	ENSG00000189120		0.711	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1		0.00	30	0	C	NM_199262		45925335	-1			no_errors	ENST00000342234	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
NPR2	4882	genome.wustl.edu	37	9	35811298	35811298	+	IGR	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:35811298G>A	ENST00000342694.2	+	0	3686				SPAG8_ENST00000396638.2_Nonsense_Mutation_p.Q249*|SPAG8_ENST00000479751.1_5'UTR|HINT2_ENST00000474908.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_Nonsense_Mutation_p.Q249*|SPAG8_ENST00000484764.1_Nonsense_Mutation_p.Q247*	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TCTAAGACTTGCAAAAATTCC	0.542																																																	0													111.0	134.0	126.0					9																	35811298		2201	4299	6500	SO:0001628	intergenic_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35811298G>A			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Nonsense_Mutation	SNP	prints_Antifreeze_1	p.Q249*	ENST00000342694.2	37	c.745	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959834	0.34565	.	.	ENSG00000137098	ENST00000340291;ENST00000484764;ENST00000396638	.	.	.	5.65	3.75	0.43078	.	0.386827	0.21813	N	0.068732	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-1.6268	11.2239	0.48871	0.0:0.0:0.645:0.355	.	.	.	.	X	249;247;249	.	ENSP00000340982:Q249X	Q	-	1	0	SPAG8	35801298	0.983000	0.35010	0.455000	0.27031	0.048000	0.14542	1.869000	0.39519	0.864000	0.35578	0.655000	0.94253	CAA	SPAG8	-	NULL	ENSG00000137098		0.542	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	92	0	G			35811298	-1	tier1	-	no_errors	ENST00000340291	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	0.965	A
SPATA31A3	727830	genome.wustl.edu	37	9	40702724	40702724	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:40702724C>T	ENST00000356699.5	+	4	410	c.381C>T	c.(379-381)ggC>ggT	p.G127G	RP11-395E19.5_ENST00000432614.1_lincRNA|SPATA31A3_ENST00000463536.1_3'UTR	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	127	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GTGAGGTGGGCGAAAGAGCAC	0.602																																																	0													9.0	9.0	9.0					9																	40702724		1119	2889	4008	SO:0001819	synonymous_variant	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.381C>T	9.37:g.40702724C>T				Silent	SNP	NULL	p.G127	ENST00000356699.5	37	c.381	CCDS47969.1	9																																																																																			SPATA31A3	-	NULL	ENSG00000147926		0.602	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A3	HGNC	protein_coding	OTTHUMT00000036919.1	-	0.00	145	0	C	NM_001083124		40702724	+1	tier1	-	no_errors	ENST00000356699	ensembl	human	known	74_37	silent	25.00	33	11	SNP	0.000	T
SPG20	23111	genome.wustl.edu	37	13	36909223	36909223	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:36909223G>A	ENST00000451493.1	-	2	962	c.745C>T	c.(745-747)Cga>Tga	p.R249*	SPG20_ENST00000355182.4_Nonsense_Mutation_p.R249*|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000438666.2_Nonsense_Mutation_p.R249*|SPG20_ENST00000494062.2_Nonsense_Mutation_p.R249*	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	249					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CTCACAATTCGAAGGTACCCA	0.403																																																	0													86.0	91.0	89.0					13																	36909223		2203	4300	6503	SO:0001587	stop_gained	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.745C>T	13.37:g.36909223G>A	ENSP00000414147:p.Arg249*		O60349|Q86Y67|Q9H1T2|Q9H1T3	Nonsense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.R249*	ENST00000451493.1	37	c.745	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	G	39	7.686858	0.98434	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	.	.	.	5.82	1.91	0.25777	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.5207	9.8275	0.40921	0.0626:0.0:0.5826:0.3548	.	.	.	.	X	249	.	ENSP00000347314:R249X	R	-	1	2	SPG20	35807223	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	4.976000	0.63785	0.327000	0.23409	0.650000	0.86243	CGA	SPG20	-	NULL	ENSG00000133104		0.403	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	-	0.00	67	0	G			36909223	-1	tier1	-	no_errors	ENST00000355182	ensembl	human	known	74_37	nonsense	33.96	35	18	SNP	1.000	A
SRBD1	55133	genome.wustl.edu	37	2	45826866	45826866	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:45826866G>A	ENST00000263736.4	-	4	432	c.370C>T	c.(370-372)Cca>Tca	p.P124S		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	124					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			ACTGTATGTGGCTGCGCTGCA	0.413																																																	0													287.0	263.0	271.0					2																	45826866		2203	4300	6503	SO:0001583	missense	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.370C>T	2.37:g.45826866G>A	ENSP00000263736:p.Pro124Ser		Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.P124S	ENST00000263736.4	37	c.370	CCDS1823.1	2	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.198463	0.00299	.	.	ENSG00000068784	ENST00000263736	T	0.21031	2.03	3.91	-0.658	0.11428	.	2.401150	0.02076	N	0.051984	T	0.08268	0.0206	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18209	-1.0344	10	0.22706	T	0.39	.	0.5811	0.00712	0.2932:0.3208:0.1358:0.2502	.	124	Q8N5C6	SRBD1_HUMAN	S	124	ENSP00000263736:P124S	ENSP00000263736:P124S	P	-	1	0	SRBD1	45680370	0.095000	0.21747	0.955000	0.39395	0.014000	0.08584	0.822000	0.27352	-0.004000	0.14419	-0.482000	0.04802	CCA	SRBD1	-	NULL	ENSG00000068784		0.413	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	-	0.00	47	0	G	NM_018079		45826866	-1	tier1	-	no_errors	ENST00000263736	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.004	A
SSTR5	6755	genome.wustl.edu	37	16	1129612	1129612	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr16:1129612C>T	ENST00000293897.4	+	1	832	c.744C>T	c.(742-744)cgC>cgT	p.R248R	SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Silent_p.R248R|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	248					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	AGGTGACGCGCATGGTGTTGG	0.672																																																	0													199.0	174.0	182.0					16																	1129612		2192	4298	6490	SO:0001819	synonymous_variant	0			D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.744C>T	16.37:g.1129612C>T			P34988|Q541E0|Q9UJI5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt_5,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.R248	ENST00000293897.4	37	c.744	CCDS10429.1	16																																																																																			SSTR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt	ENSG00000162009		0.672	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR5	HGNC	protein_coding	OTTHUMT00000420836.1	-	0.00	136	0	C			1129612	+1	tier1	-	no_errors	ENST00000293897	ensembl	human	known	74_37	silent	64.29	30	54	SNP	0.985	T
ST6GALNAC5	81849	genome.wustl.edu	37	1	77515986	77515986	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:77515986A>G	ENST00000477717.1	+	4	950	c.715A>G	c.(715-717)Aca>Gca	p.T239A		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	239					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						GTTTACAATGACAATTGCACT	0.443																																																	0													166.0	165.0	166.0					1																	77515986		2203	4300	6503	SO:0001583	missense	0				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.715A>G	1.37:g.77515986A>G	ENSP00000417583:p.Thr239Ala		B1AK82	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.T239A	ENST00000477717.1	37	c.715	CCDS673.1	1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.028248	0.75390	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.31247	1.5	6.17	5.04	0.67666	.	0.092672	0.64402	D	0.000001	T	0.09686	0.0238	N	0.20574	0.59	0.46061	D	0.998842	B	0.12013	0.005	B	0.16289	0.015	T	0.04930	-1.0917	10	0.52906	T	0.07	-21.2937	10.6685	0.45745	0.731:0.0:0.0:0.269	.	239	Q9BVH7	SIA7E_HUMAN	A	239;149	ENSP00000417583:T239A	ENSP00000406658:T149A	T	+	1	0	ST6GALNAC5	77288574	1.000000	0.71417	0.911000	0.35937	0.985000	0.73830	3.069000	0.50026	1.124000	0.41980	0.533000	0.62120	ACA	ST6GALNAC5	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000117069		0.443	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC5	HGNC	protein_coding	OTTHUMT00000026692.2		0.00	36	0	A	NM_030965		77515986	+1			no_errors	ENST00000477717	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.996	G
STAG1	10274	genome.wustl.edu	37	3	136141317	136141317	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:136141317G>T	ENST00000383202.2	-	19	2228	c.1972C>A	c.(1972-1974)Cga>Aga	p.R658R	STAG1_ENST00000434713.2_Silent_p.R432R|STAG1_ENST00000536929.1_Silent_p.R242R|STAG1_ENST00000236698.5_Silent_p.R658R	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	658					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AGCTGGCTTCGAGCTATGTCA	0.373																																																	0													132.0	130.0	131.0					3																	136141317		2203	4300	6503	SO:0001819	synonymous_variant	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1972C>A	3.37:g.136141317G>T			O00539|Q6P275	Silent	SNP	pfam_STAG,superfamily_ARM-type_fold	p.R658	ENST00000383202.2	37	c.1972	CCDS3090.1	3																																																																																			STAG1	-	superfamily_ARM-type_fold	ENSG00000118007		0.373	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1		0.00	42	0	G	NM_005862		136141317	-1			no_errors	ENST00000383202	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	T
STRIP2	57464	genome.wustl.edu	37	7	129125630	129125630	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:129125630C>T	ENST00000249344.2	+	21	2505	c.2465C>T	c.(2464-2466)tCa>tTa	p.S822L	RNU1-72P_ENST00000362976.1_RNA	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	822					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											GAGGTGTTTTCACAGCCCATC	0.488																																																	0													112.0	105.0	108.0					7																	129125630		2203	4300	6503	SO:0001583	missense	0			AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.2465C>T	7.37:g.129125630C>T	ENSP00000249344:p.Ser822Leu		Q8WUZ4	Missense_Mutation	SNP	pfam_DUF3402,pfam_N1221	p.S822L	ENST00000249344.2	37	c.2465	CCDS34752.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.421999	0.96111	.	.	ENSG00000128578	ENST00000249344	T	0.47177	0.85	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.68650	0.3024	M	0.67953	2.075	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.68337	-0.5435	10	0.62326	D	0.03	-9.3375	19.2409	0.93883	0.0:1.0:0.0:0.0	.	822	Q9ULQ0	FA40B_HUMAN	L	822	ENSP00000249344:S822L	ENSP00000249344:S822L	S	+	2	0	FAM40B	128912866	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.764000	0.85297	2.788000	0.95919	0.557000	0.71058	TCA	STRIP2	-	NULL	ENSG00000128578		0.488	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRIP2	HGNC	protein_coding	OTTHUMT00000349418.1	-	0.00	42	0	C	NM_001134336		129125630	+1	tier1	-	no_errors	ENST00000249344	ensembl	human	known	74_37	missense	43.75	18	14	SNP	1.000	T
SUN2	25777	genome.wustl.edu	37	22	39132347	39132347	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:39132347C>T	ENST00000405510.1	-	19	2437	c.2079G>A	c.(2077-2079)cgG>cgA	p.R693R	SUN2_ENST00000406622.1_Silent_p.R693R|RP3-508I15.20_ENST00000609428.1_RNA|SUN2_ENST00000411587.2_Silent_p.R682R|RP3-508I15.14_ENST00000416406.1_RNA|RP3-508I15.18_ENST00000420118.1_RNA|SUN2_ENST00000405018.1_Silent_p.R714R|SUN2_ENST00000216064.4_Silent_p.R693R|RP3-508I15.19_ENST00000418803.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	693	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						TAGTCAGGATCCGCAGCTCCA	0.597																																																	0													90.0	73.0	79.0					22																	39132347		2203	4300	6503	SO:0001819	synonymous_variant	0			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.2079G>A	22.37:g.39132347C>T			B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Silent	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.R693	ENST00000405510.1	37	c.2079	CCDS13978.1	22																																																																																			SUN2	-	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	ENSG00000100242		0.597	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN2	HGNC	protein_coding	OTTHUMT00000321057.1		0.00	37	0	C	XM_039332		39132347	-1			no_errors	ENST00000216064	ensembl	human	known	74_37	silent	8.33	22	2	SNP	0.987	T
SUPT20H	55578	genome.wustl.edu	37	13	37603914	37603914	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:37603914G>T	ENST00000350612.6	-	13	1201	c.981C>A	c.(979-981)gtC>gtA	p.V327V	SUPT20H_ENST00000464744.1_Silent_p.V328V|SUPT20H_ENST00000356185.3_Silent_p.V328V|SUPT20H_ENST00000475892.1_Silent_p.V327V|SUPT20H_ENST00000542180.1_Intron|SUPT20H_ENST00000360252.4_Silent_p.V328V	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	327					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GGGCTGGCCAGACTGTTGGCT	0.358																																																	0													128.0	120.0	122.0					13																	37603914		2203	4300	6503	SO:0001819	synonymous_variant	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.981C>A	13.37:g.37603914G>T			E7ER46|Q71RF3|Q9Y6A6	Silent	SNP	pfam_Spt20	p.V327	ENST00000350612.6	37	c.981	CCDS31959.1	13																																																																																			SUPT20H	-	NULL	ENSG00000102710		0.358	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	HGNC	protein_coding	OTTHUMT00000354766.1	-	0.00	59	0	G	NM_017569		37603914	-1	tier1	-	no_errors	ENST00000350612	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.979	T
SUPT6H	6830	genome.wustl.edu	37	17	27009801	27009801	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:27009801G>T	ENST00000314616.6	+	14	1937	c.1654G>T	c.(1654-1656)Gat>Tat	p.D552Y	SUPT6H_ENST00000347486.4_Missense_Mutation_p.D552Y	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	552	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GAACCTGCGGGATAGCTACCA	0.567																																																	0													75.0	72.0	73.0					17																	27009801		2203	4300	6503	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1654G>T	17.37:g.27009801G>T	ENSP00000319104:p.Asp552Tyr		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.D552Y	ENST00000314616.6	37	c.1654	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753666	0.89753	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	T;T	0.46819	0.86;0.86	5.95	5.95	0.96441	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73125	0.3547	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.75119	-0.3430	10	0.72032	D	0.01	-29.5644	20.3854	0.98941	0.0:0.0:1.0:0.0	.	552	Q7KZ85	SPT6H_HUMAN	Y	552	ENSP00000319104:D552Y;ENSP00000338143:D552Y	ENSP00000319104:D552Y	D	+	1	0	SUPT6H	24033928	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.359000	0.97115	2.825000	0.97269	0.655000	0.94253	GAT	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2		0.00	65	0	G	NM_003170		27009801	+1			no_errors	ENST00000314616	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
SURF6	6838	genome.wustl.edu	37	9	136199155	136199155	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:136199155G>T	ENST00000372022.4	-	5	901	c.636C>A	c.(634-636)agC>agA	p.S212R	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	212					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		GCTGCGCCTTGCTGGCCGGCT	0.642																																																	0													44.0	49.0	47.0					9																	136199155		2192	4272	6464	SO:0001583	missense	0			AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.636C>A	9.37:g.136199155G>T	ENSP00000361092:p.Ser212Arg		Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	pfam_Surf6	p.S212R	ENST00000372022.4	37	c.636	CCDS6962.1	9	.	.	.	.	.	.	.	.	.	.	G	7.866	0.727110	0.15439	.	.	ENSG00000148296	ENST00000372022	T	0.14144	2.53	4.42	2.51	0.30379	.	0.398652	0.28859	N	0.013914	T	0.16300	0.0392	M	0.72118	2.19	0.27462	N	0.95313	B	0.24576	0.106	B	0.32465	0.146	T	0.12656	-1.0539	10	0.25106	T	0.35	-17.182	7.8769	0.29599	0.2652:0.0:0.7348:0.0	.	212	O75683	SURF6_HUMAN	R	212	ENSP00000361092:S212R	ENSP00000361092:S212R	S	-	3	2	SURF6	135188976	0.952000	0.32445	0.936000	0.37596	0.179000	0.23085	1.900000	0.39828	1.060000	0.40578	-0.373000	0.07131	AGC	SURF6	-	pfam_Surf6	ENSG00000148296		0.642	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	HGNC	protein_coding	OTTHUMT00000054905.1	-	0.00	46	0	G	NM_006753		136199155	-1	tier1	-	no_errors	ENST00000372022	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.978	T
SYTL1	84958	genome.wustl.edu	37	1	27678010	27678010	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:27678010C>T	ENST00000543823.1	+	12	1769	c.1307C>T	c.(1306-1308)cCg>cTg	p.P436L	SYTL1_ENST00000318074.5_Missense_Mutation_p.P424L|SYTL1_ENST00000490170.1_3'UTR			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	436	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)			NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GACCTCCTGCCGCTGCGGGCA	0.667																																																	0													10.0	9.0	9.0					1																	27678010		1903	3622	5525	SO:0001583	missense	0			AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1307C>T	1.37:g.27678010C>T	ENSP00000440704:p.Pro436Leu		Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.P436L	ENST00000543823.1	37	c.1307	CCDS53286.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.97|16.97	3.267663|3.267663	0.59540|0.59540	.|.	.|.	ENSG00000142765|ENSG00000142765	ENST00000318074;ENST00000543823;ENST00000485269|ENST00000496001	T;T|.	0.69926|.	-0.44;-0.44|.	5.03|5.03	5.03|5.03	0.67393|0.67393	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.173290|.	0.52532|.	D|.	0.000079|.	T|T	0.59824|0.59824	0.2222|0.2222	L|L	0.37466|0.37466	1.105|1.105	0.80722|0.80722	D|D	1|1	B;P;B|.	0.45212|.	0.374;0.853;0.324|.	B;B;B|.	0.43536|.	0.252;0.423;0.115|.	T|T	0.54860|0.54860	-0.8230|-0.8230	10|5	0.02654|.	T|.	1|.	-20.1081|-20.1081	17.2968|17.2968	0.87172|0.87172	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	436;436;424|.	A8KAH3;Q8IYJ3;Q8IYJ3-2|.	.;SYTL1_HUMAN;.|.	L|C	424;436;189|284	ENSP00000316464:P424L;ENSP00000440704:P436L|.	ENSP00000316464:P424L|.	P|R	+|+	2|1	0|0	SYTL1|SYTL1	27550597|27550597	0.165000|0.165000	0.22948|0.22948	0.155000|0.155000	0.22561|0.22561	0.009000|0.009000	0.06853|0.06853	2.036000|2.036000	0.41165|0.41165	2.610000|2.610000	0.88304|0.88304	0.563000|0.563000	0.77884|0.77884	CCG|CGC	SYTL1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000142765		0.667	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL1	HGNC	protein_coding		-	0.00	106	0	C	NM_032872		27678010	+1	tier1	-	no_errors	ENST00000543823	ensembl	human	known	74_37	missense	10.71	75	9	SNP	0.858	T
SV2A	9900	genome.wustl.edu	37	1	149879320	149879320	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:149879320T>C	ENST00000369146.3	-	10	2100	c.1610A>G	c.(1609-1611)gAg>gGg	p.E537G	SV2A_ENST00000369145.1_Missense_Mutation_p.E537G	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	537					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TGTGACATCCTCAAAATAACA	0.502																																																	0													165.0	137.0	146.0					1																	149879320		2203	4300	6503	SO:0001583	missense	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1610A>G	1.37:g.149879320T>C	ENSP00000358142:p.Glu537Gly		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.E537G	ENST00000369146.3	37	c.1610	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.460894	0.84317	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.48522	0.81;0.81	4.72	4.72	0.59763	Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000002	T	0.58666	0.2138	M	0.85859	2.78	0.58432	D	0.999998	D	0.63880	0.993	D	0.68039	0.955	T	0.60806	-0.7190	10	0.24483	T	0.36	-22.4554	12.2071	0.54358	0.0:0.0:0.0:1.0	.	537	Q7L0J3	SV2A_HUMAN	G	537	ENSP00000358142:E537G;ENSP00000358141:E537G	ENSP00000358141:E537G	E	-	2	0	SV2A	148145944	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	7.819000	0.86621	2.002000	0.58637	0.374000	0.22700	GAG	SV2A	-	pfscan_MFS_dom,tigrfam_SV2	ENSG00000159164		0.502	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	-	0.00	61	0	T			149879320	-1	tier1	-	no_errors	ENST00000369146	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	C
TACO1	51204	genome.wustl.edu	37	17	61683719	61683719	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:61683719G>A	ENST00000258975.6	+	3	646	c.434G>A	c.(433-435)gGc>gAc	p.G145D		NM_016360.3	NP_057444.2	Q9BSH4	TACO1_HUMAN	translational activator of mitochondrially encoded cytochrome c oxidase I	145			G -> S (in dbSNP:rs35252424).		regulation of translation (GO:0006417)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)	4						GGCCCTGGTGGCTCTTCTCTG	0.458																																																	0													168.0	151.0	157.0					17																	61683719		2203	4300	6503	SO:0001583	missense	0			BC005049	CCDS11640.1	17q23.3	2009-06-26	2009-06-26	2009-06-26		ENSG00000136463			24316	protein-coding gene	gene with protein product		612958	"""coiled-coil domain containing 44"""	CCDC44		19503089	Standard	NM_016360		Approved		uc002jbd.3	Q9BSH4		ENST00000258975.6:c.434G>A	17.37:g.61683719G>A	ENSP00000258975:p.Gly145Asp		B2RD21|Q8N3N6|Q9UI60	Missense_Mutation	SNP	pfam_Transcrip_reg_TACO1-like	p.G145D	ENST00000258975.6	37	c.434	CCDS11640.1	17	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955192	0.92726	.	.	ENSG00000136463	ENST00000258975	T	0.60920	0.15	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.84151	0.5409	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88651	0.3182	10	0.87932	D	0	-22.7866	17.5894	0.87991	0.0:0.0:1.0:0.0	.	145	Q9BSH4	TACO1_HUMAN	D	145	ENSP00000258975:G145D	ENSP00000258975:G145D	G	+	2	0	TACO1	59037451	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.267000	0.89874	2.746000	0.94184	0.650000	0.86243	GGC	TACO1	-	pfam_Transcrip_reg_TACO1-like	ENSG00000136463		0.458	TACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACO1	HGNC	protein_coding	OTTHUMT00000443862.1	-	0.00	81	0	G	NM_016360		61683719	+1	tier1	-	no_errors	ENST00000258975	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	A
TBATA	219793	genome.wustl.edu	37	10	72532015	72532015	+	Intron	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:72532015C>T	ENST00000299290.1	-	10	1360				TBATA_ENST00000394982.2_5'UTR	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											gtctgtattcctccttgctgg	0.463																																																	0																																										SO:0001627	intron_variant	0			AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.970+254G>A	10.37:g.72532015C>T			A4QPA8|B2RPQ2|Q5T4G2	RNA	SNP	-	NULL	ENST00000299290.1	37	NULL	CCDS7308.1	10																																																																																			TBATA	-	-	ENSG00000166220		0.463	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBATA	HGNC	protein_coding	OTTHUMT00000048519.1	-	0.00	72	0	C	NM_152710		72532015	-1	tier1	-	no_errors	ENST00000394982	ensembl	human	known	74_37	rna	34.15	27	14	SNP	0.024	T
TBC1D14	57533	genome.wustl.edu	37	4	7012499	7012499	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:7012499C>T	ENST00000409757.4	+	11	1762	c.1638C>T	c.(1636-1638)gaC>gaT	p.D546D	TBC1D14_ENST00000448507.1_Silent_p.D546D|TBC1D14_ENST00000446947.2_Silent_p.D193D|TBC1D14_ENST00000451522.2_Silent_p.D266D|TBC1D14_ENST00000410031.1_Silent_p.D318D	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	546	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						TTAGAGTGGACCATGGCCTTG	0.423																																																	0													212.0	194.0	200.0					4																	7012499		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1638C>T	4.37:g.7012499C>T			B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.D546	ENST00000409757.4	37	c.1638	CCDS3394.2	4																																																																																			TBC1D14	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000132405		0.423	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	HGNC	protein_coding	OTTHUMT00000206981.3		0.00	114	0	C	NM_020773		7012499	+1			no_errors	ENST00000409757	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
TDP1	55775	genome.wustl.edu	37	14	90429605	90429605	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:90429605C>T	ENST00000335725.4	+	3	397	c.147C>T	c.(145-147)tcC>tcT	p.S49S	TDP1_ENST00000555565.1_Intron|TDP1_ENST00000393452.3_Silent_p.S49S|TDP1_ENST00000357382.3_5'UTR|TDP1_ENST00000393454.2_Silent_p.S49S|TDP1_ENST00000555880.1_Silent_p.S49S	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	49					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)	p.S49S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		ACACCTGTTCCGAGGCCCAGA	0.478								Repair of DNA-protein crosslinks																																									1	Substitution - coding silent(1)	large_intestine(1)											114.0	107.0	109.0					14																	90429605		2203	4300	6503	SO:0001819	synonymous_variant	0			AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.147C>T	14.37:g.90429605C>T			Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	pfam_Tyr-DNA_phospho	p.S49	ENST00000335725.4	37	c.147	CCDS9888.1	14																																																																																			TDP1	-	NULL	ENSG00000042088		0.478	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDP1	HGNC	protein_coding	OTTHUMT00000411239.1	-	0.00	41	0	C	NM_018319		90429605	+1	tier1	-	no_errors	ENST00000335725	ensembl	human	known	74_37	silent	65.91	15	29	SNP	0.166	T
TET3	200424	genome.wustl.edu	37	2	74327581	74327581	+	Silent	SNP	G	G	A	rs143683162	byFrequency	TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:74327581G>A	ENST00000409262.3	+	9	3261	c.3261G>A	c.(3259-3261)ccG>ccA	p.P1087P		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1087					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGGTGGAGCCGCAGAACCACT	0.602																																																	0													46.0	53.0	51.0					2																	74327581		2076	4203	6279	SO:0001819	synonymous_variant	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.3261G>A	2.37:g.74327581G>A			A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	NULL	p.P1087	ENST00000409262.3	37	c.3261	CCDS46339.1	2																																																																																			TET3	-	NULL	ENSG00000187605		0.602	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	-	0.00	44	0	G			74327581	+1	tier1	-	no_errors	ENST00000409262	ensembl	human	known	74_37	silent	30.00	28	12	SNP	0.041	A
THNSL2	55258	genome.wustl.edu	37	2	88474188	88474188	+	Missense_Mutation	SNP	G	G	T	rs376220295		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:88474188G>T	ENST00000324166.5	+	2	1945	c.254G>T	c.(253-255)cGt>cTt	p.R85L	THNSL2_ENST00000449349.1_Missense_Mutation_p.R53L|THNSL2_ENST00000377254.3_Missense_Mutation_p.R85L|THNSL2_ENST00000402102.1_Missense_Mutation_p.R85L|THNSL2_ENST00000358591.2_Missense_Mutation_p.R85L|THNSL2_ENST00000343544.4_Missense_Mutation_p.R85L	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	85					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						AGCAGATTCCGTCACAGAGAA	0.542																																																	0													180.0	143.0	156.0					2																	88474188		2203	4300	6503	SO:0001583	missense	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.254G>T	2.37:g.88474188G>T	ENSP00000327323:p.Arg85Leu		B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	p.R85L	ENST00000324166.5	37	c.254	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203121	0.58234	.	.	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000419759;ENST00000449349;ENST00000343544;ENST00000324166	T;T;T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97;2.97;2.97	5.79	4.0	0.46444	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (1);	0.179497	0.48286	D	0.000199	T	0.14830	0.0358	M	0.77486	2.375	0.37229	D	0.905607	B;B;B	0.30361	0.277;0.277;0.232	B;B;B	0.22601	0.04;0.024;0.039	T	0.04115	-1.0976	10	0.59425	D	0.04	.	11.6803	0.51453	0.1427:0.0:0.8573:0.0	.	85;53;85	Q86YJ6;C9JU10;Q86YJ6-2	THNS2_HUMAN;.;.	L	85;85;85;85;53;85;85	ENSP00000351402:R85L;ENSP00000366464:R85L;ENSP00000384475:R85L;ENSP00000391300:R85L;ENSP00000407553:R53L;ENSP00000339563:R85L;ENSP00000327323:R85L	ENSP00000327323:R85L	R	+	2	0	THNSL2	88255303	1.000000	0.71417	0.814000	0.32528	0.896000	0.52359	3.267000	0.51577	0.798000	0.33994	-0.291000	0.09656	CGT	THNSL2	-	superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	ENSG00000144115		0.542	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	-	0.00	71	0	G	NM_018271		88474188	+1	tier1	-	no_errors	ENST00000324166	ensembl	human	known	74_37	missense	7.25	64	5	SNP	0.987	T
TIGD2	166815	genome.wustl.edu	37	4	90035297	90035297	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:90035297G>A	ENST00000317005.2	+	1	1330	c.1172G>A	c.(1171-1173)gGc>gAc	p.G391D	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	391						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		CTTTTCCCTGGCAATGAAGAG	0.368																																																	0													87.0	89.0	88.0					4																	90035297		2203	4300	6503	SO:0001583	missense	0			AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.1172G>A	4.37:g.90035297G>A	ENSP00000317170:p.Gly391Asp			Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.G391D	ENST00000317005.2	37	c.1172	CCDS3633.1	4	.	.	.	.	.	.	.	.	.	.	G	1.263	-0.615352	0.03663	.	.	ENSG00000180346	ENST00000317005	T	0.20332	2.08	4.56	-2.47	0.06442	.	0.212782	0.23512	N	0.047384	T	0.11879	0.0289	L	0.43152	1.355	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.36456	-0.9747	10	0.11794	T	0.64	-1.0383	5.9363	0.19167	0.0861:0.5205:0.2611:0.1323	.	391	Q4W5G0	TIGD2_HUMAN	D	391	ENSP00000317170:G391D	ENSP00000317170:G391D	G	+	2	0	TIGD2	90254320	0.455000	0.25736	0.305000	0.25099	0.954000	0.61252	1.364000	0.34171	-0.451000	0.07097	0.460000	0.39030	GGC	TIGD2	-	NULL	ENSG00000180346		0.368	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD2	HGNC	protein_coding	OTTHUMT00000253545.2	-	0.00	24	0	G	NM_145715		90035297	+1	tier1	-	no_errors	ENST00000317005	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.014	A
TLN2	83660	genome.wustl.edu	37	15	63000913	63000913	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:63000913C>T	ENST00000561311.1	+	20	2615	c.2385C>T	c.(2383-2385)ggC>ggT	p.G795G	TLN2_ENST00000306829.6_Silent_p.G795G			Q9Y4G6	TLN2_HUMAN	talin 2	795					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCAGCCGAGGCGAGCCCATCG	0.622																																																	0													57.0	53.0	54.0					15																	63000913		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2385C>T	15.37:g.63000913C>T			A6NLB8	Silent	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.G795	ENST00000561311.1	37	c.2385	CCDS32261.1	15																																																																																			TLN2	-	NULL	ENSG00000171914		0.622	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2		0.00	22	0	C			63000913	+1			no_errors	ENST00000306829	ensembl	human	known	74_37	silent	12.50	14	2	SNP	0.268	T
TLN2	83660	genome.wustl.edu	37	15	63088482	63088482	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr15:63088482G>A	ENST00000561311.1	+	46	6270	c.6040G>A	c.(6040-6042)Gca>Aca	p.A2014T	TLN2_ENST00000306829.6_Missense_Mutation_p.A2014T			Q9Y4G6	TLN2_HUMAN	talin 2	2014					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TGAGACCTTCGCAGACCACAG	0.592																																																	0													59.0	56.0	57.0					15																	63088482		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6040G>A	15.37:g.63088482G>A	ENSP00000453508:p.Ala2014Thr		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.A2014T	ENST00000561311.1	37	c.6040	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453484	0.84209	.	.	ENSG00000171914	ENST00000306829	T	0.14144	2.53	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.34483	0.0899	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01323	-1.1385	10	0.40728	T	0.16	-14.0845	18.8729	0.92324	0.0:0.0:1.0:0.0	.	2014	Q9Y4G6	TLN2_HUMAN	T	2014	ENSP00000303476:A2014T	ENSP00000303476:A2014T	A	+	1	0	TLN2	60875535	1.000000	0.71417	0.959000	0.39883	0.428000	0.31595	9.813000	0.99286	2.522000	0.85027	0.655000	0.94253	GCA	TLN2	-	superfamily_Vinculin/catenin	ENSG00000171914		0.592	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	58	0	G			63088482	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	A
TMEM132C	92293	genome.wustl.edu	37	12	129181847	129181847	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:129181847T>G	ENST00000435159.2	+	8	2008	c.2008T>G	c.(2008-2010)Ttg>Gtg	p.L670V	TMEM132C_ENST00000315208.8_Missense_Mutation_p.L286V|TMEM132C_ENST00000537538.1_Missense_Mutation_p.L55V	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	670						integral component of membrane (GO:0016021)		p.L670L(1)|p.L286L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GGTGACAGACTTGGCCATCCA	0.552																																																	2	Substitution - coding silent(2)	prostate(2)											33.0	30.0	31.0					12																	129181847		692	1591	2283	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2008T>G	12.37:g.129181847T>G	ENSP00000410852:p.Leu670Val		Q69YX8	Missense_Mutation	SNP	NULL	p.L670V	ENST00000435159.2	37	c.2008		12	.	.	.	.	.	.	.	.	.	.	T	10.89	1.478075	0.26511	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.64438	-0.1;-0.1;-0.1	4.05	-4.39	0.03611	.	0.133081	0.32328	N	0.006252	T	0.69548	0.3123	M	0.88105	2.93	0.58432	D	0.999998	D	0.54047	0.964	P	0.56398	0.797	T	0.69098	-0.5235	10	0.66056	D	0.02	.	5.111	0.14809	0.1358:0.568:0.1367:0.1595	.	670	Q8N3T6	T132C_HUMAN	V	670;286;55	ENSP00000410852:L670V;ENSP00000324458:L286V;ENSP00000438477:L55V	ENSP00000324458:L286V	L	+	1	2	TMEM132C	127747800	0.998000	0.40836	0.207000	0.23584	0.087000	0.18053	0.575000	0.23729	-0.670000	0.05282	0.383000	0.25322	TTG	TMEM132C	-	NULL	ENSG00000181234		0.552	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	29	0	T	XM_044062		129181847	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.997	G
TP53	7157	genome.wustl.edu	37	17	7578401	7578402	+	In_Frame_Ins	INS	-	-	GCA	rs147002414		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:7578401_7578402insGCA	ENST00000269305.4	-	5	717_718	c.528_529insTGC	c.(526-531)tgcccc>tgcTGCccc	p.176_177insC	TP53_ENST00000445888.2_In_Frame_Ins_p.176_177insC|TP53_ENST00000359597.4_In_Frame_Ins_p.176_177insC|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_In_Frame_Ins_p.176_177insC|TP53_ENST00000455263.2_In_Frame_Ins_p.176_177insC|TP53_ENST00000420246.2_In_Frame_Ins_p.176_177insC	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).|P -> A (in a sporadic cancer; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> I (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|P -> S (in sporadic cancers; somatic mutation).|P -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176*(12)|p.C176W(11)|p.P177_C182delPHHERC(8)|p.0?(8)|p.P177S(8)|p.H178fs*69(5)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.C83*(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.C44*(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176F(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.P177fs*69(1)|p.R175_H178>X(1)|p.P177fs*4(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.P177I(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H178fs*3(1)|p.R174fs*3(1)|p.P177T(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCATGGTGGGGGCAGCGCCTCA	0.649		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	100	Deletion - Frameshift(26)|Deletion - In frame(23)|Substitution - Missense(22)|Substitution - Nonsense(16)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(2)	large_intestine(19)|breast(18)|upper_aerodigestive_tract(11)|oesophagus(9)|lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(5)|central_nervous_system(4)|bone(4)|stomach(2)|urinary_tract(2)|liver(2)|pancreas(2)|prostate(2)|thyroid(1)|soft_tissue(1)|biliary_tract(1)|endometrium(1)|skin(1)																																								SO:0001652	inframe_insertion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.526_528dupTGC	17.37:g.7578402_7578404dupGCA	ENSP00000269305:p.Cys176_Cys176dup		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.176in_frame_insC	ENST00000269305.4	37	c.529_528	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.649	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	33	0	-	NM_000546		7578402	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_ins	53.66	19	22	INS	1.000:0.998	GCA
TP53	7157	genome.wustl.edu	37	17	7577102	7577102	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr17:7577102C>A	ENST00000269305.4	-	8	1025	c.836G>T	c.(835-837)gGg>gTg	p.G279V	TP53_ENST00000445888.2_Missense_Mutation_p.G279V|TP53_ENST00000359597.4_Missense_Mutation_p.G279V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.G279V|TP53_ENST00000420246.2_Missense_Mutation_p.G279V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	279	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G279E(32)|p.0?(8)|p.G279V(4)|p.?(2)|p.G279fs*65(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.G279fs*26(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTCTCTCCCAGGACAGGC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(36)|Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	upper_aerodigestive_tract(16)|urinary_tract(8)|oesophagus(7)|breast(5)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|skin(4)|large_intestine(3)|central_nervous_system(3)|ovary(2)|stomach(1)|lung(1)|liver(1)											75.0	65.0	68.0					17																	7577102		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.836G>T	17.37:g.7577102C>A	ENSP00000269305:p.Gly279Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G279V	ENST00000269305.4	37	c.836	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526020	0.85600	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99864	0.9936	M	0.85710	2.77	0.80722	D	1	D;P;D;D	0.89917	1.0;0.892;1.0;1.0	D;P;D;D	0.97110	0.999;0.831;0.999;1.0	D	0.96506	0.9375	10	0.87932	D	0	-22.6503	11.5187	0.50539	0.0:0.9131:0.0:0.0869	.	279;279;279;279	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	279;279;279;279;279;268;147	ENSP00000352610:G279V;ENSP00000269305:G279V;ENSP00000398846:G279V;ENSP00000391127:G279V;ENSP00000391478:G279V;ENSP00000425104:G147V	ENSP00000269305:G279V	G	-	2	0	TP53	7517827	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.862000	0.69560	1.390000	0.46547	0.462000	0.41574	GGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	40	0	C	NM_000546		7577102	-1			no_errors	ENST00000269305	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	A
TRAK1	22906	genome.wustl.edu	37	3	42244054	42244054	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:42244054G>T	ENST00000327628.5	+	13	1954	c.1554G>T	c.(1552-1554)gaG>gaT	p.E518D	TRAK1_ENST00000396175.1_Missense_Mutation_p.E460D|TRAK1_ENST00000449246.1_Missense_Mutation_p.E444D|TRAK1_ENST00000341421.3_Missense_Mutation_p.E460D|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	518					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						TCTTTGAGGAGGAGCAAGAGA	0.677																																					GBM(44;195 884 22595 31865 41850)												0													35.0	43.0	40.0					3																	42244054		2203	4300	6503	SO:0001583	missense	0				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1554G>T	3.37:g.42244054G>T	ENSP00000328998:p.Glu518Asp		E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.E460D	ENST00000327628.5	37	c.1380	CCDS43072.1	3	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694552	0.48202	.	.	ENSG00000182606	ENST00000327628;ENST00000543338;ENST00000449246;ENST00000396175;ENST00000341421;ENST00000427771	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.95	5.07	0.68467	Trafficking kinesin-binding protein domain (1);	0.055444	0.64402	D	0.000001	T	0.26048	0.0635	N	0.10809	0.05	0.46149	D	0.99889	B;B;B;B;B;B	0.15719	0.011;0.011;0.014;0.011;0.004;0.008	B;B;B;B;B;B	0.21151	0.022;0.019;0.033;0.018;0.023;0.023	T	0.10776	-1.0615	10	0.36615	T	0.2	.	6.3765	0.21511	0.1393:0.0:0.704:0.1567	.	444;460;518;460;444;518	B7Z218;C9JC32;B7Z347;Q9UPV9-2;E9PDS2;Q9UPV9	.;.;.;.;.;TRAK1_HUMAN	D	518;518;444;460;460;236	ENSP00000328998:E518D;ENSP00000410717:E444D;ENSP00000379478:E460D;ENSP00000340702:E460D;ENSP00000413729:E236D	ENSP00000328998:E518D	E	+	3	2	TRAK1	42219058	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.551000	0.36233	2.824000	0.97209	0.655000	0.94253	GAG	TRAK1	-	pfam_Traffickng_kinesin-bd_prot_dom	ENSG00000182606		0.677	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	HGNC	protein_coding	OTTHUMT00000343413.1	-	0.00	68	0	G	NM_014965		42244054	+1	tier1	-	no_errors	ENST00000396175	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
TRAT1	50852	genome.wustl.edu	37	3	108549545	108549545	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:108549545G>T	ENST00000295756.6	+	2	266	c.36G>T	c.(34-36)tgG>tgT	p.W12C	TRAT1_ENST00000426646.1_Intron|TRAT1_ENST00000493604.1_3'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1	12					cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						TTTTCCTCTGGGGACTTCTAG	0.398																																																	0													194.0	190.0	192.0					3																	108549545		2203	4300	6503	SO:0001583	missense	0			AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.36G>T	3.37:g.108549545G>T	ENSP00000295756:p.Trp12Cys		Q9NZX5	Missense_Mutation	SNP	NULL	p.W12C	ENST00000295756.6	37	c.36	CCDS33813.1	3	.	.	.	.	.	.	.	.	.	.	G	16.32	3.088864	0.55968	.	.	ENSG00000163519	ENST00000295756	T	0.53640	0.61	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000018	T	0.66257	0.2771	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67461	-0.5665	10	0.62326	D	0.03	0.1058	14.225	0.65853	0.0:0.0:1.0:0.0	.	12	Q6PIZ9	TRAT1_HUMAN	C	12	ENSP00000295756:W12C	ENSP00000295756:W12C	W	+	3	0	TRAT1	110032235	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	4.984000	0.63838	2.732000	0.93576	0.591000	0.81541	TGG	TRAT1	-	NULL	ENSG00000163519		0.398	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAT1	HGNC	protein_coding	OTTHUMT00000353794.1	-	0.00	92	0	G	NM_016388		108549545	+1	tier1	-	no_errors	ENST00000295756	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
TP63	8626	genome.wustl.edu	37	3	189584487	189584487	+	Silent	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr3:189584487T>C	ENST00000264731.3	+	6	872	c.783T>C	c.(781-783)ccT>ccC	p.P261P	TP63_ENST00000456148.1_Silent_p.P167P|TP63_ENST00000382063.4_Silent_p.P176P|TP63_ENST00000392460.3_Silent_p.P261P|TP63_ENST00000392463.2_Silent_p.P167P|TP63_ENST00000449992.1_Silent_p.P82P|TP63_ENST00000354600.5_Silent_p.P167P|TP63_ENST00000392461.3_Silent_p.P167P|TP63_ENST00000440651.2_Silent_p.P261P|TP63_ENST00000437221.1_Silent_p.P167P|TP63_ENST00000418709.2_Silent_p.P261P|TP63_ENST00000320472.5_Silent_p.P261P	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	261					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTGCCCCTCCTAGTCATTTGA	0.423										HNSCC(45;0.13)																																							0													74.0	66.0	69.0					3																	189584487		2203	4300	6503	SO:0001819	synonymous_variant	0			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.783T>C	3.37:g.189584487T>C			O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.P261	ENST00000264731.3	37	c.783	CCDS3293.1	3																																																																																			TP63	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000073282		0.423	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	HGNC	protein_coding	OTTHUMT00000343865.1	-	0.00	74	0	T	NM_003722		189584487	+1	tier1	-	no_errors	ENST00000264731	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.991	C
TRPC3	7222	genome.wustl.edu	37	4	122800993	122800993	+	Silent	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:122800993A>T	ENST00000379645.3	-	12	2737	c.2664T>A	c.(2662-2664)cgT>cgA	p.R888R	TRPC3_ENST00000264811.5_Silent_p.R815R|TRPC3_ENST00000513531.1_Silent_p.R760R	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	803					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AAAGTTCATAACGAAGGCTGG	0.333																																																	0													136.0	128.0	131.0					4																	122800993		2203	4300	6503	SO:0001819	synonymous_variant	0			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.2664T>A	4.37:g.122800993A>T			A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R888	ENST00000379645.3	37	c.2664	CCDS47130.1	4																																																																																			TRPC3	-	superfamily_ARM-type_fold,tigrfam_TRP_channel	ENSG00000138741		0.333	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	-	0.00	49	0	A	NM_003305		122800993	-1	tier1	-	no_errors	ENST00000379645	ensembl	human	known	74_37	silent	13.04	20	3	SNP	0.911	T
TSC1	7248	genome.wustl.edu	37	9	135772688	135772688	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:135772688C>A	ENST00000298552.3	-	22	3079	c.2858G>T	c.(2857-2859)aGg>aTg	p.R953M	TSC1_ENST00000440111.2_Missense_Mutation_p.R953M|TSC1_ENST00000545250.1_Missense_Mutation_p.R902M	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	953					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTGGGTTATCCTTTTCTGAGC	0.423			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											115.0	120.0	118.0					9																	135772688		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2858G>T	9.37:g.135772688C>A	ENSP00000298552:p.Arg953Met		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.R953M	ENST00000298552.3	37	c.2858	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	C	19.49	3.836946	0.71373	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;T	0.82711	-1.64;-1.64;-1.45	5.61	3.76	0.43208	.	0.158927	0.64402	D	0.000020	D	0.85292	0.5663	M	0.63843	1.955	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.54706	0.759;0.759	D	0.84898	0.0840	10	0.72032	D	0.01	-8.7536	10.0893	0.42436	0.0:0.7789:0.0:0.2211	.	902;953	B7Z897;Q92574	.;TSC1_HUMAN	M	953;953;902	ENSP00000298552:R953M;ENSP00000394524:R953M;ENSP00000444017:R902M	ENSP00000298552:R953M	R	-	2	0	TSC1	134762509	0.996000	0.38824	0.978000	0.43139	0.993000	0.82548	1.545000	0.36169	0.712000	0.32039	0.650000	0.86243	AGG	TSC1	-	NULL	ENSG00000165699		0.423	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1		0.00	50	0	C			135772688	-1			no_errors	ENST00000298552	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	A
TTC21B	79809	genome.wustl.edu	37	2	166771920	166771920	+	Silent	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr2:166771920G>T	ENST00000243344.7	-	15	2066	c.1929C>A	c.(1927-1929)gcC>gcA	p.A643A		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	643					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						ATTCATGGATGGCATCTTGTA	0.383																																																	0													173.0	176.0	175.0					2																	166771920		2203	4300	6503	SO:0001819	synonymous_variant	0			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1929C>A	2.37:g.166771920G>T			A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A643	ENST00000243344.7	37	c.1929	CCDS33315.1	2																																																																																			TTC21B	-	NULL	ENSG00000123607		0.383	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	HGNC	protein_coding	OTTHUMT00000333770.1		0.00	58	0	G	NM_024753		166771920	-1			no_errors	ENST00000243344	ensembl	human	known	74_37	silent	5.33	71	4	SNP	1.000	T
CFAP46	54777	genome.wustl.edu	37	10	134738356	134738356	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr10:134738356G>A	ENST00000368586.5	-	11	1200	c.1100C>T	c.(1099-1101)gCg>gTg	p.A367V	TTC40_ENST00000368582.2_Missense_Mutation_p.A367V	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TCGCTGCAGCGCGACGTCTAG	0.687																																																	0																																										SO:0001583	missense	0																														ENST00000368586.5:c.1100C>T	10.37:g.134738356G>A	ENSP00000357575:p.Ala367Val			Missense_Mutation	SNP	NULL	p.A367V	ENST00000368586.5	37	c.1100	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	0.166	-1.076428	0.01903	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.54675	0.56;0.56	3.29	-3.66	0.04489	.	.	.	.	.	T	0.26702	0.0653	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30794	-0.9966	6	0.08179	T	0.78	.	10.2119	0.43145	0.7158:0.0:0.2842:0.0	.	.	.	.	V	367	ENSP00000357575:A367V;ENSP00000357571:A367V	ENSP00000357571:A367V	A	-	2	0	C10orf93	134588346	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.239000	0.08965	-1.066000	0.03164	-0.163000	0.13421	GCG	TTC40	-	NULL	ENSG00000171811		0.687	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	19	0	G			134738356	-1	tier1	-	no_errors	ENST00000368582	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.000	A
TYMS	7298	genome.wustl.edu	37	18	670755	670755	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:670755A>G	ENST00000323274.10	+	5	759	c.620A>G	c.(619-621)gAg>gGg	p.E207G	TYMS_ENST00000581920.1_3'UTR|TYMS_ENST00000323250.5_Missense_Mutation_p.E124G|TYMS_ENST00000323224.7_Missense_Mutation_p.E173G	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	207					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	GTGAACAGTGAGCTGTCCTGC	0.567																																																	0													174.0	142.0	153.0					18																	670755		2203	4300	6503	SO:0001583	missense	0			X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.620A>G	18.37:g.670755A>G	ENSP00000315644:p.Glu207Gly		Q8WYK3|Q8WYK4	Missense_Mutation	SNP	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease,prints_Thymidylate_synthase,tigrfam_Thymidylate_synthase	p.E207G	ENST00000323274.10	37	c.620	CCDS11821.1	18	.	.	.	.	.	.	.	.	.	.	A	32	5.141427	0.94560	.	.	ENSG00000176890	ENST00000323274;ENST00000323224;ENST00000323250	.	.	.	6.09	6.09	0.99107	Thymidylate synthase/dCMP hydroxymethylase domain (2);	0.000000	0.85682	D	0.000000	D	0.85729	0.5764	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.81914	0.995;0.981;0.966	D	0.88765	0.3260	9	0.87932	D	0	-7.2152	16.6542	0.85224	1.0:0.0:0.0:0.0	.	124;173;207	Q8WYK4;Q8WYK3;P04818	.;.;TYSY_HUMAN	G	207;173;124	.	ENSP00000314727:E173G	E	+	2	0	TYMS	660755	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	9.135000	0.94478	2.331000	0.79229	0.533000	0.62120	GAG	TYMS	-	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease,tigrfam_Thymidylate_synthase	ENSG00000176890		0.567	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYMS	HGNC	protein_coding	OTTHUMT00000254316.1		0.00	48	0	A	NM_001071		670755	+1			no_errors	ENST00000323274	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	G
UBAC1	10422	genome.wustl.edu	37	9	138830109	138830109	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:138830109G>A	ENST00000371756.3	-	9	1278	c.1061C>T	c.(1060-1062)cCg>cTg	p.P354L	UBAC1_ENST00000465873.1_5'Flank	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	354	STI1.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CTGCACCACCGGGTTATCCAG	0.612																																					NSCLC(78;973 1398 27381 29552 42415)												0													123.0	114.0	117.0					9																	138830109		2203	4300	6503	SO:0001583	missense	0			AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.1061C>T	9.37:g.138830109G>A	ENSP00000360821:p.Pro354Leu		O75500|Q9UMW7	Missense_Mutation	SNP	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,pfscan_UBA/transl_elong_EF1B_N_euk	p.P354L	ENST00000371756.3	37	c.1061	CCDS35177.1	9	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843710	0.91197	.	.	ENSG00000130560	ENST00000371756	T	0.46819	0.86	4.8	4.8	0.61643	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68988	-0.5264	10	0.87932	D	0	-25.5345	16.8501	0.85991	0.0:0.0:1.0:0.0	.	354	Q9BSL1	UBAC1_HUMAN	L	354	ENSP00000360821:P354L	ENSP00000360821:P354L	P	-	2	0	UBAC1	137969930	1.000000	0.71417	0.928000	0.36995	0.971000	0.66376	9.426000	0.97469	2.201000	0.70794	0.561000	0.74099	CCG	UBAC1	-	smart_STI1_HS-bd	ENSG00000130560		0.612	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAC1	HGNC	protein_coding	OTTHUMT00000055034.1	-	0.00	59	0	G	NM_016172		138830109	-1	tier1	-	no_errors	ENST00000371756	ensembl	human	known	74_37	missense	12.35	71	10	SNP	0.999	A
UBR4	23352	genome.wustl.edu	37	1	19505602	19505602	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr1:19505602T>C	ENST00000375254.3	-	18	2324	c.2297A>G	c.(2296-2298)cAt>cGt	p.H766R	UBR4_ENST00000375217.2_Missense_Mutation_p.H766R|UBR4_ENST00000375267.2_Missense_Mutation_p.H766R|UBR4_ENST00000375226.2_Missense_Mutation_p.H766R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	766					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACTGGCTTTATGTTGCCAGAT	0.502																																																	0													164.0	155.0	158.0					1																	19505602		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2297A>G	1.37:g.19505602T>C	ENSP00000364403:p.His766Arg		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.H766R	ENST00000375254.3	37	c.2297	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	T	11.34	1.611166	0.28712	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	N	0.04508	-0.205	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.10154	-1.0642	10	0.10111	T	0.7	.	12.9738	0.58527	0.0:0.0:0.0:1.0	.	766	Q5T4S7	UBR4_HUMAN	R	766	ENSP00000364403:H766R;ENSP00000364416:H766R;ENSP00000364365:H766R;ENSP00000364374:H766R	ENSP00000364365:H766R	H	-	2	0	UBR4	19378189	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	7.330000	0.79181	2.072000	0.62099	0.533000	0.62120	CAT	UBR4	-	NULL	ENSG00000127481		0.502	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	36	0	T	NM_020765		19505602	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	C
ULK1	8408	genome.wustl.edu	37	12	132402064	132402064	+	Missense_Mutation	SNP	C	C	T	rs540597298		TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr12:132402064C>T	ENST00000321867.4	+	22	2642	c.2291C>T	c.(2290-2292)aCg>aTg	p.T764M	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	764					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		AGCGGGAGCACGCCCCCCCAG	0.716													-|||	1	0.000199681	0.0	0.0014	5008	,	,		10961	0.0		0.0	False		,,,				2504	0.0																0													9.0	12.0	11.0					12																	132402064		2169	4262	6431	SO:0001583	missense	0			AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2291C>T	12.37:g.132402064C>T	ENSP00000324560:p.Thr764Met		Q9UQ28	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T764M	ENST00000321867.4	37	c.2291	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	c	18.89	3.720213	0.68844	.	.	ENSG00000177169	ENST00000321867;ENST00000541761	T;T	0.54866	0.55;0.55	4.65	4.65	0.58169	.	0.294485	0.33253	N	0.005111	T	0.68686	0.3028	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	P	0.59115	0.852	T	0.73833	-0.3858	10	0.66056	D	0.02	-23.8672	17.8905	0.88870	0.0:1.0:0.0:0.0	.	764	O75385	ULK1_HUMAN	M	764;112	ENSP00000324560:T764M;ENSP00000444298:T112M	ENSP00000324560:T764M	T	+	2	0	ULK1	130968017	1.000000	0.71417	0.908000	0.35775	0.317000	0.28152	7.217000	0.77982	2.277000	0.76020	0.424000	0.28305	ACG	ULK1	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2	ENSG00000177169		0.716	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	HGNC	protein_coding	OTTHUMT00000397769.3	-	0.00	99	0	C			132402064	+1	tier1	-	no_errors	ENST00000321867	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.999	T
UNC13B	10497	genome.wustl.edu	37	9	35398267	35398267	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:35398267G>T	ENST00000378495.3	+	30	3789	c.3567G>T	c.(3565-3567)gaG>gaT	p.E1189D	UNC13B_ENST00000481299.1_3'UTR|UNC13B_ENST00000378496.4_Missense_Mutation_p.E1189D|UNC13B_ENST00000396787.1_Missense_Mutation_p.E1201D	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1189					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.E1189D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			AAATGTTTGAGGCCATGGGAG	0.502																																																	1	Substitution - Missense(1)	endometrium(1)											129.0	103.0	112.0					9																	35398267		2203	4300	6503	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3567G>T	9.37:g.35398267G>T	ENSP00000367756:p.Glu1189Asp		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E1189D	ENST00000378495.3	37	c.3567	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801415	0.70567	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.78924	-1.22;-1.22;-1.22	5.73	1.74	0.24563	.	0.000000	0.85682	D	0.000000	D	0.84897	0.5574	M	0.89095	3.005	0.51482	D	0.999925	D;D	0.65815	0.995;0.982	P;P	0.56278	0.795;0.764	T	0.83166	-0.0096	10	0.52906	T	0.07	-25.2969	9.1445	0.36923	0.4732:0.0:0.5268:0.0	.	1189;1189	F8W8M9;O14795	.;UN13B_HUMAN	D	1201;1189;1189;776	ENSP00000380006:E1201D;ENSP00000367756:E1189D;ENSP00000367757:E1189D	ENSP00000367756:E1189D	E	+	3	2	UNC13B	35388267	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.603000	0.24149	0.045000	0.15804	0.563000	0.77884	GAG	UNC13B	-	NULL	ENSG00000198722		0.502	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	-	0.00	85	0	G	NM_006377		35398267	+1	tier1	-	no_errors	ENST00000378496	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.997	T
USP18	11274	genome.wustl.edu	37	22	18650040	18650040	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr22:18650040C>T	ENST00000215794.7	+	5	849	c.419C>T	c.(418-420)gCt>gTt	p.A140V		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	140	USP.				cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						CAACATGATGCTGCCCAACTG	0.473																																																	0													137.0	117.0	124.0					22																	18650040		2203	4298	6501	SO:0001583	missense	0			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.419C>T	22.37:g.18650040C>T	ENSP00000215794:p.Ala140Val		Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.A140V	ENST00000215794.7	37	c.419	CCDS13752.1	22	.	.	.	.	.	.	.	.	.	.	.	16.92	3.256696	0.59321	.	.	ENSG00000184979	ENST00000215794	T	0.10099	2.91	4.81	4.81	0.61882	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.057507	0.64402	D	0.000002	T	0.20495	0.0493	L	0.47716	1.5	0.33207	D	0.55292	D	0.89917	1.0	D	0.85130	0.997	T	0.01409	-1.1362	10	0.02654	T	1	.	13.2443	0.60014	0.0:1.0:0.0:0.0	.	140	Q9UMW8	UBP18_HUMAN	V	140	ENSP00000215794:A140V	ENSP00000215794:A140V	A	+	2	0	USP18	17030040	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	4.010000	0.57117	2.491000	0.84063	0.637000	0.83480	GCT	USP18	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000184979		0.473	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP18	HGNC	protein_coding	OTTHUMT00000316368.1	-	0.00	65	0	C			18650040	+1	tier1	-	no_errors	ENST00000215794	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
VCP	7415	genome.wustl.edu	37	9	35059646	35059647	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:35059646_35059647insT	ENST00000358901.6	-	14	2742_2743	c.1847_1848insA	c.(1846-1848)aatfs	p.N616fs		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	616					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.N616fs*63(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGATGAACACATTTTTTTTTGT	0.515																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1848dupA	9.37:g.35059655_35059655dupT	ENSP00000351777:p.Asn616fs		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Frame_Shift_Ins	INS	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.N616fs	ENST00000358901.6	37	c.1848_1847	CCDS6573.1	9																																																																																			VCP	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.515	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1		0.00	54	0	-	NM_007126		35059647	-1	tier1		no_errors	ENST00000358901	ensembl	human	known	74_37	frame_shift_ins	9.68	56	6	INS	1.000:1.000	T
VPS13A	23230	genome.wustl.edu	37	9	79973297	79973297	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr9:79973297G>T	ENST00000360280.3	+	57	8238	c.7978G>T	c.(7978-7980)Gta>Tta	p.V2660L	VPS13A_ENST00000357409.5_Missense_Mutation_p.V2660L|VPS13A_ENST00000376634.4_Missense_Mutation_p.V2660L|VPS13A_ENST00000376636.3_Missense_Mutation_p.V2621L	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2660					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ACATGGTGCTGTATTTCCCTT	0.323																																																	0													182.0	170.0	174.0					9																	79973297		2203	4300	6503	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.7978G>T	9.37:g.79973297G>T	ENSP00000353422:p.Val2660Leu		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.V2660L	ENST00000360280.3	37	c.7978	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140387	0.56936	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.92	-7.5	0.01351	.	0.399608	0.28883	N	0.013822	T	0.68751	0.3035	L	0.49126	1.545	0.80722	D	1	B;B;B;B	0.20459	0.02;0.011;0.045;0.018	B;B;B;B	0.31245	0.126;0.013;0.063;0.063	T	0.46992	-0.9151	9	.	.	.	.	16.6197	0.84927	0.3749:0.0:0.6251:0.0	.	2621;2660;2660;2660	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	L	2660;2621;2660;2660	ENSP00000365821:V2660L;ENSP00000365823:V2621L;ENSP00000353422:V2660L;ENSP00000349985:V2660L	.	V	+	1	0	VPS13A	79163117	0.999000	0.42202	0.603000	0.28903	0.985000	0.73830	0.878000	0.28126	-1.527000	0.01758	-0.781000	0.03364	GTA	VPS13A	-	NULL	ENSG00000197969		0.323	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	105	0	G	NM_015186		79973297	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.960	T
VWA8	23078	genome.wustl.edu	37	13	42263545	42263545	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr13:42263545A>T	ENST00000379310.3	-	34	4144	c.4076T>A	c.(4075-4077)aTt>aAt	p.I1359N	VWA8_ENST00000478987.1_5'Flank	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1359						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										ATCTGAGAGAATTCTGTTGGG	0.358																																																	0													109.0	99.0	102.0					13																	42263545		1821	4080	5901	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4076T>A	13.37:g.42263545A>T	ENSP00000368612:p.Ile1359Asn		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.I1359N	ENST00000379310.3	37	c.4076	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395914	0.83011	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.13420	2.59	4.98	4.98	0.66077	.	0.343360	0.27951	N	0.017199	T	0.19644	0.0472	L	0.54323	1.7	0.80722	D	1	P	0.44195	0.828	B	0.44085	0.44	T	0.01218	-1.1415	10	0.72032	D	0.01	.	14.9486	0.71054	1.0:0.0:0.0:0.0	.	1359	A3KMH1	K0564_HUMAN	N	1263;1359	ENSP00000368612:I1359N	ENSP00000251030:I1263N	I	-	2	0	KIAA0564	41161545	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.532000	0.90613	1.994000	0.58287	0.477000	0.44152	ATT	VWA8	-	NULL	ENSG00000102763		0.358	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	-	0.00	55	0	A	NM_015058		42263545	-1	tier1	-	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	T
WASF1	8936	genome.wustl.edu	37	6	110429852	110429852	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr6:110429852A>C	ENST00000392589.1	-	6	1137	c.301T>G	c.(301-303)Ttc>Gtc	p.F101V	WASF1_ENST00000392587.2_Missense_Mutation_p.F101V|WASF1_ENST00000359451.2_Missense_Mutation_p.F101V|WASF1_ENST00000392588.1_Missense_Mutation_p.F101V|WASF1_ENST00000392586.1_Missense_Mutation_p.F101V	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	101					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		GAACTTCGGAAAGCTTTCCTC	0.353																																																	0													79.0	73.0	75.0					6																	110429852		2203	4300	6503	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.301T>G	6.37:g.110429852A>C	ENSP00000376368:p.Phe101Val		E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.F101V	ENST00000392589.1	37	c.301	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	A	22.6	4.306481	0.81247	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938	T;T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.82019	0.4946	M	0.89095	3.005	0.58432	D	0.999999	D	0.65815	0.995	D	0.73708	0.981	D	0.85596	0.1249	10	0.72032	D	0.01	.	16.4534	0.84003	1.0:0.0:0.0:0.0	.	101	Q92558	WASF1_HUMAN	V	101	ENSP00000376365:F101V;ENSP00000376366:F101V;ENSP00000376368:F101V;ENSP00000376367:F101V;ENSP00000352425:F101V;ENSP00000407041:F101V;ENSP00000265601:F101V;ENSP00000357934:F101V	ENSP00000265601:F101V	F	-	1	0	WASF1	110536545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.285000	0.76669	0.477000	0.44152	TTC	WASF1	-	NULL	ENSG00000112290		0.353	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	-	0.00	58	0	A	NM_003931		110429852	-1	tier1	-	no_errors	ENST00000359451	ensembl	human	known	74_37	missense	20.83	38	10	SNP	1.000	C
WDR7	23335	genome.wustl.edu	37	18	54349962	54349962	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:54349962G>T	ENST00000254442.3	+	5	609	c.398G>T	c.(397-399)gGa>gTa	p.G133V	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.G133V	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	133					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TTATGCCACGGACATTACCCT	0.403																																																	0													175.0	160.0	165.0					18																	54349962		2203	4300	6503	SO:0001583	missense	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.398G>T	18.37:g.54349962G>T	ENSP00000254442:p.Gly133Val		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G133V	ENST00000254442.3	37	c.398	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625094	0.87560	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.64803	-0.12;-0.12	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.80076	0.4557	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.78314	0.991;0.731	T	0.83021	-0.0167	10	0.87932	D	0	.	18.0859	0.89457	0.0:0.0:1.0:0.0	.	133;133	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	V	133	ENSP00000254442:G133V;ENSP00000350187:G133V	ENSP00000254442:G133V	G	+	2	0	WDR7	52500960	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.680000	0.98651	2.451000	0.82905	0.563000	0.77884	GGA	WDR7	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000091157		0.403	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	-	0.00	95	0	G			54349962	+1	tier1	-	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
WFS1	7466	genome.wustl.edu	37	4	6293076	6293076	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr4:6293076G>A	ENST00000226760.1	+	5	783	c.613G>A	c.(613-615)Ggc>Agc	p.G205S	WFS1_ENST00000503569.1_Missense_Mutation_p.G205S	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	205					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		GGAGAATGTCGGCCAGGTCAA	0.652																																																	0													77.0	72.0	74.0					4																	6293076		2203	4300	6503	SO:0001583	missense	0			AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.613G>A	4.37:g.6293076G>A	ENSP00000226760:p.Gly205Ser		B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	NULL	p.G205S	ENST00000226760.1	37	c.613	CCDS3386.1	4	.	.	.	.	.	.	.	.	.	.	G	9.711	1.157211	0.21454	.	.	ENSG00000109501	ENST00000503569;ENST00000226760	D;D	0.92911	-3.13;-3.13	4.72	4.72	0.59763	.	0.176513	0.49305	D	0.000141	D	0.84447	0.5474	N	0.14661	0.345	0.34474	D	0.703119	B	0.20780	0.048	B	0.17722	0.019	T	0.82855	-0.0251	10	0.17832	T	0.49	-20.3476	16.6615	0.85242	0.0:0.0:1.0:0.0	.	205	O76024	WFS1_HUMAN	S	205	ENSP00000423337:G205S;ENSP00000226760:G205S	ENSP00000226760:G205S	G	+	1	0	WFS1	6343977	1.000000	0.71417	0.332000	0.25469	0.214000	0.24535	5.378000	0.66190	2.175000	0.68902	0.561000	0.74099	GGC	WFS1	-	NULL	ENSG00000109501		0.652	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFS1	HGNC	protein_coding	OTTHUMT00000206863.1	-	0.00	20	0	G			6293076	+1	tier1	-	no_errors	ENST00000226760	ensembl	human	known	74_37	missense	33.33	10	5	SNP	0.879	A
XAB2	56949	genome.wustl.edu	37	19	7685508	7685508	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:7685508G>T	ENST00000358368.4	-	15	2056	c.2019C>A	c.(2017-2019)gaC>gaA	p.D673E	XAB2_ENST00000534844.1_Missense_Mutation_p.D670E	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	673					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TGCACTCCATGTCTGCAAACC	0.677								Direct reversal of damage;Nucleotide excision repair (NER)																																									0													42.0	43.0	43.0					19																	7685508		2203	4300	6503	SO:0001583	missense	0			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.2019C>A	19.37:g.7685508G>T	ENSP00000351137:p.Asp673Glu		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D673E	ENST00000358368.4	37	c.2019	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.484268	0.01027	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.40756	1.02;1.02	4.31	-0.523	0.11924	Tetratricopeptide-like helical (1);	0.060287	0.64402	N	0.000006	T	0.19565	0.0470	N	0.25144	0.715	0.48511	D	0.999667	B	0.17268	0.021	B	0.14023	0.01	T	0.31420	-0.9944	10	0.02654	T	1	-33.9963	7.4156	0.27042	0.3025:0.1193:0.5782:0.0	.	673	Q9HCS7	SYF1_HUMAN	E	673;670	ENSP00000351137:D673E;ENSP00000438225:D670E	ENSP00000351137:D673E	D	-	3	2	XAB2	7591508	1.000000	0.71417	0.895000	0.35142	0.219000	0.24729	2.023000	0.41040	-0.120000	0.11809	-1.641000	0.00772	GAC	XAB2	-	NULL	ENSG00000076924		0.677	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1	-	0.00	47	0	G	NM_020196		7685508	-1	tier1	-	no_errors	ENST00000358368	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.998	T
ZBTB1	22890	genome.wustl.edu	37	14	64989787	64989787	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr14:64989787delA	ENST00000554015.1	+	4	1996	c.1565delA	c.(1564-1566)caafs	p.Q522fs	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Frame_Shift_Del_p.Q522fs|ZBTB1_ENST00000394712.2_Frame_Shift_Del_p.Q522fs			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	522					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AACAGTATCCAAAAAAAGCAG	0.378																																																	0													142.0	148.0	146.0					14																	64989787		2203	4300	6503	SO:0001589	frameshift_variant	0			AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1565delA	14.37:g.64989787delA	ENSP00000451000:p.Gln522fs		A8K6S8|Q86SW8	Frame_Shift_Del	DEL	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.K524fs	ENST00000554015.1	37	c.1565	CCDS45126.1	14																																																																																			ZBTB1	-	NULL	ENSG00000126804		0.378	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB1	HGNC	protein_coding	OTTHUMT00000411912.1		0.00	39	0	A			64989787	+1	tier1		no_errors	ENST00000394712	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.222	-
ZC3HAV1	56829	genome.wustl.edu	37	7	138763911	138763911	+	Intron	SNP	G	G	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr7:138763911G>C	ENST00000242351.5	-	4	1788				ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.C592W|ZC3HAV1_ENST00000471652.1_Intron	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GAACCTGGGTGCAGTTCTGCC	0.572																																																	0																																										SO:0001627	intron_variant	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1471+304C>G	7.37:g.138763911G>C			A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.C592W	ENST00000242351.5	37	c.1776	CCDS5851.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.61|10.61	1.397899|1.397899	0.25205|0.25205	.|.	.|.	ENSG00000105939|ENSG00000105939	ENST00000464606|ENST00000460845	T|.	0.07327|.	3.2|.	4.3|4.3	-3.99|-3.99	0.04069|0.04069	.|.	.|.	.|.	.|.	.|.	T|T	0.20618|0.20618	0.0496|0.0496	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.29852|0.29852	-0.9998|-0.9998	6|4	0.66056|.	D|.	0.02|.	.|.	4.428|4.428	0.11513|0.11513	0.2185:0.0:0.4699:0.3116|0.2185:0.0:0.4699:0.3116	.|.	.|.	.|.	.|.	W|D	592|35	ENSP00000418385:C592W|.	ENSP00000418385:C592W|.	C|H	-|-	3|1	2|0	ZC3HAV1|ZC3HAV1	138414451|138414451	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.035000|0.035000	0.12851|0.12851	-0.841000|-0.841000	0.04359|0.04359	-0.701000|-0.701000	0.05063|0.05063	0.609000|0.609000	0.83330|0.83330	TGC|CAC	ZC3HAV1	-	NULL	ENSG00000105939		0.572	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	-	0.00	71	0	G	NM_020119		138763911	-1	tier1	-	no_errors	ENST00000464606	ensembl	human	novel	74_37	missense	7.02	53	4	SNP	0.000	C
ZCCHC5	203430	genome.wustl.edu	37	X	77912710	77912710	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chrX:77912710T>G	ENST00000321110.1	-	2	1503	c.1208A>C	c.(1207-1209)aAa>aCa	p.K403T		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	403							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						AGAGGAACTTTTCCCTAATGG	0.512																																																	0													124.0	108.0	113.0					X																	77912710		2203	4300	6503	SO:0001583	missense	0			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.1208A>C	X.37:g.77912710T>G	ENSP00000316794:p.Lys403Thr		B2RMZ0|Q5JQE9	Missense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K403T	ENST00000321110.1	37	c.1208	CCDS14440.1	X	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.348215	0.00219	.	.	ENSG00000179300	ENST00000321110	T	0.20463	2.07	2.7	-2.18	0.07037	.	0.815849	0.09727	U	0.763581	T	0.10852	0.0265	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.34279	-0.9835	10	0.25106	T	0.35	.	4.3992	0.11377	0.1372:0.0:0.2755:0.5874	.	403	Q8N8U3	ZCHC5_HUMAN	T	403	ENSP00000316794:K403T	ENSP00000316794:K403T	K	-	2	0	ZCCHC5	77799366	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.158000	0.10070	-0.691000	0.05135	-0.527000	0.04329	AAA	ZCCHC5	-	NULL	ENSG00000179300		0.512	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC5	HGNC	protein_coding	OTTHUMT00000057319.1	-	0.00	33	0	T	NM_152694		77912710	-1	tier1	-	no_errors	ENST00000321110	ensembl	human	known	74_37	missense	55.56	16	20	SNP	0.000	G
ZFHX4	79776	genome.wustl.edu	37	8	77618065	77618065	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:77618065A>G	ENST00000521891.2	+	2	2190	c.1742A>G	c.(1741-1743)gAc>gGc	p.D581G	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D581G|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D581G|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D581G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCCGGGGAGACGAAGACAGT	0.572										HNSCC(33;0.089)																																							0													60.0	66.0	64.0					8																	77618065		2112	4227	6339	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1742A>G	8.37:g.77618065A>G	ENSP00000430497:p.Asp581Gly		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.D581G	ENST00000521891.2	37	c.1742	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	A	11.97	1.798471	0.31777	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53423	0.62;0.69;0.66;0.63	5.65	5.65	0.86999	.	0.000000	0.46442	U	0.000291	T	0.54319	0.1851	L	0.50333	1.59	0.58432	D	0.999995	P;P;P;P	0.44044	0.682;0.787;0.787;0.825	B;B;B;P	0.49829	0.202;0.367;0.367;0.623	T	0.52968	-0.8504	10	0.45353	T	0.12	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	581;581;581;581	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	G	581	ENSP00000430497:D581G;ENSP00000399605:D581G;ENSP00000050961:D581G;ENSP00000430848:D581G	ENSP00000050961:D581G	D	+	2	0	ZFHX4	77780620	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.662000	0.91130	2.371000	0.80710	0.533000	0.62120	GAC	ZFHX4	-	NULL	ENSG00000091656		0.572	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	34	0	A	NM_024721		77618065	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	32.35	23	11	SNP	1.000	G
ZFPM2	23414	genome.wustl.edu	37	8	106813368	106813368	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr8:106813368A>T	ENST00000407775.2	+	8	1308	c.1058A>T	c.(1057-1059)cAc>cTc	p.H353L	RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.H221L|ZFPM2_ENST00000520492.1_Missense_Mutation_p.H221L|ZFPM2_ENST00000378472.4_Missense_Mutation_p.H84L	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	353					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTTCACCAACACCTGTTCTCC	0.498																																																	0													203.0	196.0	198.0					8																	106813368		2030	4215	6245	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1058A>T	8.37:g.106813368A>T	ENSP00000384179:p.His353Leu		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H353L	ENST00000407775.2	37	c.1058	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	A	20.9	4.068957	0.76301	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.66	5.66	0.87406	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.76870	0.4048	M	0.93375	3.41	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.83569	0.0111	10	0.87932	D	0	.	16.1988	0.82053	1.0:0.0:0.0:0.0	.	353	Q8WW38	FOG2_HUMAN	L	353;221;221;84	ENSP00000384179:H353L;ENSP00000430757:H221L;ENSP00000428720:H221L;ENSP00000367733:H84L	ENSP00000367733:H84L	H	+	2	0	ZFPM2	106882544	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.284000	0.76573	0.528000	0.53228	CAC	ZFPM2	-	smart_Znf_C2H2-like	ENSG00000169946		0.498	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	-	0.00	63	0	A			106813368	+1	tier1	-	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	7.69	96	8	SNP	1.000	T
ZKSCAN2	342357	genome.wustl.edu	37	16	25258515	25258515	+	Silent	SNP	T	T	C			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr16:25258515T>C	ENST00000328086.7	-	5	1805	c.1002A>G	c.(1000-1002)gaA>gaG	p.E334E		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	334					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TCTTTTCATCTTCTAAACCCC	0.453																																																	0													111.0	104.0	106.0					16																	25258515		2197	4300	6497	SO:0001819	synonymous_variant	0			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1002A>G	16.37:g.25258515T>C			A1L3B4|Q6ZN77	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E334	ENST00000328086.7	37	c.1002	CCDS32410.1	16																																																																																			ZKSCAN2	-	NULL	ENSG00000155592		0.453	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	HGNC	protein_coding	OTTHUMT00000435739.1	-	0.00	50	0	T	NM_001012981		25258515	-1	tier1	-	no_errors	ENST00000328086	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	C
ZNF223	7766	genome.wustl.edu	37	19	44570564	44570564	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:44570564C>A	ENST00000434772.3	+	5	838	c.583C>A	c.(583-585)Cag>Aag	p.Q195K	ZNF223_ENST00000591793.1_Missense_Mutation_p.Q305K	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				TCATATTCATCAGAGAGTCCA	0.438																																																	0													143.0	145.0	144.0					19																	44570564		2203	4300	6503	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.583C>A	19.37:g.44570564C>A	ENSP00000401947:p.Gln195Lys		Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q305K	ENST00000434772.3	37	c.913	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841369	0.71488	.	.	ENSG00000178386	ENST00000434772	T	0.17528	2.27	2.46	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15262	0.0368	L	0.45352	1.415	0.80722	D	1	P	0.44044	0.825	B	0.43301	0.415	T	0.04427	-1.0952	9	0.40728	T	0.16	.	8.0151	0.30376	0.0:0.8652:0.0:0.1348	.	195	Q9UK11	ZN223_HUMAN	K	195	ENSP00000401947:Q195K	ENSP00000401947:Q195K	Q	+	1	0	ZNF223	49262404	0.000000	0.05858	0.072000	0.20136	0.978000	0.69477	0.386000	0.20702	0.352000	0.24053	0.313000	0.20887	CAG	ZNF223	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267022		0.438	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Uniprot_gn	protein_coding	OTTHUMT00000460469.2	-	0.00	116	0	C			44570564	+1	tier1	-	no_errors	ENST00000591793	ensembl	human	known	74_37	missense	51.09	45	47	SNP	0.974	A
ZNF236	7776	genome.wustl.edu	37	18	74607162	74607162	+	Silent	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr18:74607162C>T	ENST00000253159.8	+	10	1803	c.1605C>T	c.(1603-1605)atC>atT	p.I535I	ZNF236_ENST00000320610.9_Silent_p.I537I	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	535					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		ACACCGGCATCAAGGCGTTCA	0.612																																																	0													66.0	73.0	71.0					18																	74607162		2203	4298	6501	SO:0001819	synonymous_variant	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.1605C>T	18.37:g.74607162C>T			B2RTX9|Q9UL37	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I535	ENST00000253159.8	37	c.1605	CCDS42447.1	18																																																																																			ZNF236	-	pfscan_Znf_C2H2	ENSG00000130856		0.612	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1		0.00	33	0	C			74607162	+1			no_errors	ENST00000253159	ensembl	human	known	74_37	silent	11.76	60	8	SNP	1.000	T
ZNF43	7594	genome.wustl.edu	37	19	21992508	21992508	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:21992508T>G	ENST00000354959.4	-	4	500	c.331A>C	c.(331-333)Aat>Cat	p.N111H	ZNF43_ENST00000595461.1_Missense_Mutation_p.N105H|ZNF43_ENST00000598381.1_Missense_Mutation_p.N105H|ZNF43_ENST00000594012.1_Missense_Mutation_p.N105H	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AAATGTACATTTTTATGTTCA	0.363																																																	0													72.0	74.0	73.0					19																	21992508		2203	4295	6498	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.331A>C	19.37:g.21992508T>G	ENSP00000347045:p.Asn111His		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N111H	ENST00000354959.4	37	c.331	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	T	7.961	0.747008	0.15710	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.05513	3.43	0.916	-0.309	0.12769	.	.	.	.	.	T	0.22742	0.0549	M	0.92691	3.335	0.09310	N	1	D	0.71674	0.998	D	0.65573	0.936	T	0.08868	-1.0701	9	0.42905	T	0.14	.	2.6333	0.04951	0.0:0.4243:0.3067:0.2691	.	111	P17038	ZNF43_HUMAN	H	110;111	ENSP00000347045:N111H	ENSP00000347045:N111H	N	-	1	0	ZNF43	21784348	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	0.175000	0.16762	0.257000	0.21650	0.254000	0.18369	AAT	ZNF43	-	NULL	ENSG00000198521		0.363	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	-	0.00	97	0	T	NM_003423		21992508	-1	tier1	-	no_errors	ENST00000354959	ensembl	human	known	74_37	missense	53.33	28	32	SNP	0.000	G
ZNF681	148213	genome.wustl.edu	37	19	23927993	23927993	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:23927993C>A	ENST00000402377.3	-	4	500	c.359G>T	c.(358-360)tGc>tTc	p.C120F	ZNF681_ENST00000395385.3_Missense_Mutation_p.C51F	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTGCACTTTGCACTCATCCAC	0.323																																																	0													57.0	55.0	56.0					19																	23927993		2202	4298	6500	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.359G>T	19.37:g.23927993C>A	ENSP00000384000:p.Cys120Phe		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C120F	ENST00000402377.3	37	c.359	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	11.55	1.671386	0.29693	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.09255	3.22;3.0;5.93;6.16	1.23	1.23	0.21249	.	.	.	.	.	T	0.15219	0.0367	M	0.77616	2.38	0.09310	N	1	B	0.25272	0.122	B	0.27262	0.078	T	0.19516	-1.0303	9	0.66056	D	0.02	.	7.9364	0.29933	0.0:1.0:0.0:0.0	.	120	Q96N22	ZN681_HUMAN	F	120;51;51;51	ENSP00000384000:C120F;ENSP00000378783:C51F;ENSP00000433806:C51F;ENSP00000435824:C51F	ENSP00000378783:C51F	C	-	2	0	ZNF681	23719833	0.000000	0.05858	0.004000	0.12327	0.005000	0.04900	-0.210000	0.09345	0.630000	0.30394	0.306000	0.20318	TGC	ZNF681	-	NULL	ENSG00000196172		0.323	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	87	0	C	NM_138286		23927993	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	28.36	48	19	SNP	0.029	A
ZNF790	388536	genome.wustl.edu	37	19	37314262	37314262	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:37314262C>A	ENST00000356725.4	-	4	274	c.154G>T	c.(154-156)Gaa>Taa	p.E52*	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	52	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GAGAACGCTTCTGGCTGATAA	0.433																																																	0													50.0	46.0	47.0					19																	37314262		2203	4300	6503	SO:0001587	stop_gained	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.154G>T	19.37:g.37314262C>A	ENSP00000349161:p.Glu52*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E52*	ENST00000356725.4	37	c.154	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203156	0.58234	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288	.	.	.	3.58	1.1	0.20463	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	5.0148	0.14330	0.0:0.5477:0.323:0.1293	.	.	.	.	X	52	.	ENSP00000349161:E52X	E	-	1	0	ZNF790	42006102	0.000000	0.05858	0.788000	0.31933	0.516000	0.34256	-0.319000	0.08039	0.210000	0.20664	-0.384000	0.06662	GAA	ZNF790	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197863		0.433	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	-	0.00	36	0	C	NM_206894		37314262	-1	tier1	-	no_errors	ENST00000356725	ensembl	human	known	74_37	nonsense	21.43	33	9	SNP	0.401	A
ZNF420	147923	genome.wustl.edu	37	19	37621029	37621029	+	3'UTR	SNP	C	C	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:37621029C>T	ENST00000337995.3	+	0	3351				ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000586540.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000304239.7_Missense_Mutation_p.T501I	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			tccgtgcctacaatgtggaca	0.413																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.*1069C>T	19.37:g.37621029C>T			B2RDY6|Q96ML5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T501I	ENST00000337995.3	37	c.1502	CCDS12498.1	19	.	.	.	.	.	.	.	.	.	.	C	5.932	0.356024	0.11239	.	.	ENSG00000197050	ENST00000304239	T	0.07114	3.22	3.76	-4.71	0.03279	.	.	.	.	.	T	0.08044	0.0201	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.38373	-0.9664	6	0.87932	D	0	.	4.9187	0.13858	0.566:0.2508:0.0:0.1832	.	.	.	.	I	501	ENSP00000306102:T501I	ENSP00000306102:T501I	T	+	2	0	ZNF420	42312869	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	-0.206000	0.09398	-0.689000	0.05149	-0.302000	0.09304	ACA	ZNF420	-	NULL	ENSG00000197050		0.413	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	HGNC	protein_coding	OTTHUMT00000109587.3	-	0.00	83	0	C	NM_144689		37621029	+1	tier1	-	no_errors	ENST00000304239	ensembl	human	putative	74_37	missense	8.22	67	6	SNP	0.000	T
ZNF850	342892	genome.wustl.edu	37	19	37239924	37239924	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:37239924T>A	ENST00000591344.1	-	5	2176	c.2018A>T	c.(2017-2019)tAt>tTt	p.Y673F	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	673					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CGGACATTCATAGGGTTTCTC	0.433																																																	0																																										SO:0001583	missense	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.2018A>T	19.37:g.37239924T>A	ENSP00000464976:p.Tyr673Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y673F	ENST00000591344.1	37	c.2018	CCDS59379.1	19																																																																																			ZNF850	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267041		0.433	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1		0.00	111	0	T	XM_001720258		37239924	-1			no_errors	ENST00000591344	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.039	A
ZNF83	55769	genome.wustl.edu	37	19	53116987	53116987	+	Silent	SNP	T	T	A			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr19:53116987T>A	ENST00000597597.1	-	2	3084	c.831A>T	c.(829-831)gcA>gcT	p.A277A	ZNF83_ENST00000391789.4_Intron|ZNF83_ENST00000536937.1_Silent_p.A277A|ZNF83_ENST00000544146.1_Silent_p.A277A|ZNF83_ENST00000541777.2_Silent_p.A277A|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Silent_p.A277A|ZNF83_ENST00000301096.3_Silent_p.A277A|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000600714.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TCTGATGTTGTGCAAGGTGTG	0.403																																																	0													88.0	81.0	84.0					19																	53116987		2172	4215	6387	SO:0001819	synonymous_variant	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.831A>T	19.37:g.53116987T>A			A8MT75|Q3ZCX0|Q6PI08	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A277	ENST00000597597.1	37	c.831	CCDS12854.1	19																																																																																			ZNF83	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167766		0.403	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	-	0.00	58	0	T	NM_018300		53116987	-1	tier1	-	no_errors	ENST00000301096	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.000	A
ZNFX1	57169	genome.wustl.edu	37	20	47864088	47864088	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GM-01A-11D-A37C-09	TCGA-2H-A9GM-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a34b9ac2-6aea-403b-95a2-b8553832709f	4a408ed5-0855-434c-bb0e-55cd9b0f338b	g.chr20:47864088G>T	ENST00000396105.1	-	14	5719	c.5473C>A	c.(5473-5475)Ctg>Atg	p.L1825M	ZNFX1_ENST00000371752.1_Missense_Mutation_p.L1825M|ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000469991.1_5'Flank	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1825							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAGATGCCCAGGCCAGAGCAG	0.493																																																	0													98.0	93.0	95.0					20																	47864088		2203	4300	6503	SO:0001583	missense	0			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.5473C>A	20.37:g.47864088G>T	ENSP00000379412:p.Leu1825Met		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_Znf_NFX1	p.L1825M	ENST00000396105.1	37	c.5473	CCDS13417.1	20	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727219	0.69074	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	D;D	0.88896	-2.44;-2.44	6.04	1.35	0.21983	.	0.000000	0.64402	D	0.000004	D	0.91395	0.7285	L	0.53249	1.67	0.41548	D	0.988559	D	0.89917	1.0	D	0.73380	0.98	D	0.90234	0.4281	10	0.56958	D	0.05	-14.0597	11.724	0.51698	0.2916:0.0:0.7084:0.0	.	1825	Q9P2E3	ZNFX1_HUMAN	M	1825	ENSP00000360817:L1825M;ENSP00000379412:L1825M	ENSP00000360817:L1825M	L	-	1	2	ZNFX1	47297495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.034000	0.41145	0.424000	0.26061	0.563000	0.77884	CTG	ZNFX1	-	NULL	ENSG00000124201		0.493	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	-	0.00	43	0	G	NM_021035		47864088	-1	tier1	-	no_errors	ENST00000371752	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
