#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA3	21	genome.wustl.edu	37	16	2336804	2336804	+	Missense_Mutation	SNP	C	C	T	rs537267668		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:2336804C>T	ENST00000301732.5	-	22	3869	c.3169G>A	c.(3169-3171)Gtg>Atg	p.V1057M	ABCA3_ENST00000382381.3_Missense_Mutation_p.V999M	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1057					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	AGGTTGTCCACGACGGCCAGG	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		19190	0.0		0.0	False		,,,				2504	0.001																0													123.0	122.0	122.0					16																	2336804		2198	4300	6498	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3169G>A	16.37:g.2336804C>T	ENSP00000301732:p.Val1057Met		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V1057M	ENST00000301732.5	37	c.3169	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	10.91	1.483749	0.26598	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.87650	-2.28	4.6	2.63	0.31362	.	0.390642	0.27936	N	0.017254	D	0.84593	0.5506	M	0.69823	2.125	0.80722	D	1	B;B	0.34147	0.438;0.17	B;B	0.35073	0.149;0.195	T	0.82145	-0.0602	10	0.62326	D	0.03	.	8.4711	0.32986	0.1535:0.7645:0.0:0.082	.	1061;1057	Q4LE27;Q99758	.;ABCA3_HUMAN	M	1057;1061	ENSP00000301732:V1057M	ENSP00000301732:V1057M	V	-	1	0	ABCA3	2276805	1.000000	0.71417	0.322000	0.25334	0.215000	0.24574	5.546000	0.67243	0.676000	0.31285	0.555000	0.69702	GTG	ABCA3	-	NULL	ENSG00000167972		0.632	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	-	0.00	77	0	C	NM_001089		2336804	-1	tier1	-	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	15.38	55	10	SNP	0.999	T
ABCD2	225	genome.wustl.edu	37	12	39994435	39994435	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:39994435C>T	ENST00000308666.3	-	6	1719	c.1584G>A	c.(1582-1584)tgG>tgA	p.W528*		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	528	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CATACACAGGCCAGAGCCCAC	0.358																																																	0													86.0	95.0	92.0					12																	39994435		2203	4300	6503	SO:0001587	stop_gained	0			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1584G>A	12.37:g.39994435C>T	ENSP00000310688:p.Trp528*		B2RAM3|Q13210|Q2M3H9	Nonsense_Mutation	SNP	pfam_ABC_Peroxi_TM,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.W528*	ENST00000308666.3	37	c.1584	CCDS8734.1	12	.	.	.	.	.	.	.	.	.	.	C	40	8.289552	0.98745	.	.	ENSG00000173208	ENST00000308666	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.8568	19.712	0.96099	0.0:1.0:0.0:0.0	.	.	.	.	X	528	.	.	W	-	3	0	ABCD2	38280702	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.732000	0.84908	2.656000	0.90262	0.460000	0.39030	TGG	ABCD2	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000173208		0.358	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD2	HGNC	protein_coding	OTTHUMT00000403591.1	-	0.00	94	0	C	NM_005164		39994435	-1	tier1	-	no_errors	ENST00000308666	ensembl	human	known	74_37	nonsense	12.79	75	11	SNP	1.000	T
ACSBG1	23205	genome.wustl.edu	37	15	78526912	78526912	+	5'UTR	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:78526912G>A	ENST00000258873.4	-	0	137				ACSBG1_ENST00000560817.1_Intron|ACSBG1_ENST00000541759.1_5'Flank|ACSBG1_ENST00000558828.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1						long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GTGAGCAGTGGGGGTGGGCAT	0.542																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.-69C>T	15.37:g.78526912G>A			B2RB61|O75126|Q76N27|Q9HC26	RNA	SNP	-	NULL	ENST00000258873.4	37	NULL	CCDS10298.1	15																																																																																			ACSBG1	-	-	ENSG00000103740		0.542	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	-	0.00	48	0	G	NM_015162		78526912	-1	tier1	-	no_errors	ENST00000559713	ensembl	human	putative	74_37	rna	15.91	37	7	SNP	0.992	A
ACSM4	341392	genome.wustl.edu	37	12	7459218	7459218	+	Missense_Mutation	SNP	G	G	T	rs373040986		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:7459218G>T	ENST00000399422.4	+	2	339	c.291G>T	c.(289-291)ttG>ttT	p.L97F		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	97					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TGGGCTCCTTGTCCCGAAAAG	0.582																																																	0													71.0	81.0	78.0					12																	7459218		2097	4250	6347	SO:0001583	missense	0				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.291G>T	12.37:g.7459218G>T	ENSP00000382349:p.Leu97Phe		A8MTI6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.L97F	ENST00000399422.4	37	c.291	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613008	0.28712	.	.	ENSG00000215009	ENST00000399422	T	0.42131	0.98	4.89	1.47	0.22746	AMP-dependent synthetase/ligase (1);	0.261640	0.19284	N	0.118090	T	0.29652	0.0740	L	0.49455	1.56	0.35112	D	0.766221	B	0.22080	0.064	B	0.32724	0.151	T	0.14062	-1.0486	10	0.11485	T	0.65	-9.3803	0.7292	0.00954	0.2401:0.1837:0.3871:0.1891	.	97	P0C7M7	ACSM4_HUMAN	F	97	ENSP00000382349:L97F	ENSP00000382349:L97F	L	+	3	2	ACSM4	7350485	0.803000	0.28956	0.988000	0.46212	0.686000	0.39977	0.045000	0.14013	0.579000	0.29504	0.655000	0.94253	TTG	ACSM4	-	pfam_AMP-dep_Synth/Lig	ENSG00000215009		0.582	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	-	0.00	65	0	G	NM_001080454		7459218	+1	tier1	-	no_errors	ENST00000399422	ensembl	human	novel	74_37	missense	5.56	68	4	SNP	0.984	T
ACTR3B	57180	genome.wustl.edu	37	7	152549293	152549293	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:152549293C>T	ENST00000256001.8	+	10	1168	c.1034C>T	c.(1033-1035)gCt>gTt	p.A345V	ACTR3B_ENST00000377776.3_Intron|ACTR3B_ENST00000537264.1_Missense_Mutation_p.A257V|ACTR3B_ENST00000397282.2_Missense_Mutation_p.A257V	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	345						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.A345V(1)		breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		GTGGTGGATGCTAGGCTGAGG	0.602																																																	1	Substitution - Missense(1)	lung(1)											105.0	100.0	102.0					7																	152549293		2203	4300	6503	SO:0001583	missense	0				CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.1034C>T	7.37:g.152549293C>T	ENSP00000256001:p.Ala345Val		A8MTG1|B4DFW4|Q7Z526|Q96BT2	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.A345V	ENST00000256001.8	37	c.1034	CCDS5934.1	7	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140118	0.37825	.	.	ENSG00000133627	ENST00000256001;ENST00000397282;ENST00000537264	T;T;T	0.07021	3.23;3.23;3.23	5.35	5.35	0.76521	.	0.000000	0.56097	U	0.000026	T	0.17323	0.0416	M	0.82823	2.61	0.46981	D	0.999274	B	0.15930	0.015	B	0.16722	0.016	T	0.01879	-1.1255	10	0.46703	T	0.11	-8.6203	17.6707	0.88216	0.0:1.0:0.0:0.0	.	345	Q9P1U1	ARP3B_HUMAN	V	345;257;257	ENSP00000256001:A345V;ENSP00000380452:A257V;ENSP00000446157:A257V	ENSP00000256001:A345V	A	+	2	0	ACTR3B	152180226	1.000000	0.71417	0.902000	0.35471	0.169000	0.22640	5.490000	0.66881	2.491000	0.84063	0.557000	0.71058	GCT	ACTR3B	-	pfam_Actin-related,smart_Actin-related	ENSG00000133627		0.602	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR3B	HGNC	protein_coding	OTTHUMT00000322803.1	-	0.00	86	0	C	NM_020445		152549293	+1	tier1	-	no_errors	ENST00000256001	ensembl	human	known	74_37	missense	7.61	85	7	SNP	1.000	T
ADAM28	10863	genome.wustl.edu	37	8	24167440	24167440	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:24167440A>G	ENST00000265769.4	+	3	294	c.184A>G	c.(184-186)Aca>Gca	p.T62A	ADAM28_ENST00000540823.1_5'UTR|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000397649.3_5'UTR|ADAM28_ENST00000437154.2_Missense_Mutation_p.T62A|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	62					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GTATAAAATGACAATTAATGG	0.279																																					NSCLC(193;488 2149 22258 34798 40734)												0													51.0	61.0	58.0					8																	24167440		2192	4296	6488	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.184A>G	8.37:g.24167440A>G	ENSP00000265769:p.Thr62Ala		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.T62A	ENST00000265769.4	37	c.184	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	A	13.64	2.298105	0.40694	.	.	ENSG00000042980	ENST00000265769;ENST00000437154	T;T	0.06608	3.28;3.28	4.51	4.51	0.55191	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.08223	0.0205	L	0.60012	1.86	0.80722	D	1	B;B	0.20164	0.042;0.026	B;B	0.25506	0.061;0.015	T	0.14699	-1.0463	9	0.20046	T	0.44	.	10.5279	0.44960	1.0:0.0:0.0:0.0	.	62;62	Q9UKQ2;Q9UKQ2-2	ADA28_HUMAN;.	A	62	ENSP00000265769:T62A;ENSP00000393699:T62A	ENSP00000265769:T62A	T	+	1	0	ADAM28	24223385	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	2.409000	0.44583	2.251000	0.74343	0.528000	0.53228	ACA	ADAM28	-	pfam_Peptidase_M12B_N	ENSG00000042980		0.279	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	-	0.00	87	0	A	NM_021778		24167440	+1	tier1	-	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	G
ADAMTS1	9510	genome.wustl.edu	37	21	28214671	28214671	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:28214671A>G	ENST00000284984.3	-	2	1518	c.1064T>C	c.(1063-1065)cTt>cCt	p.L355P		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	355	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L355R(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		TCTGGTGAAAAGAATTGCTGT	0.488																																																	1	Substitution - Missense(1)	large_intestine(1)											80.0	56.0	64.0					21																	28214671		2203	4300	6503	SO:0001583	missense	0			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1064T>C	21.37:g.28214671A>G	ENSP00000284984:p.Leu355Pro		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS1,prints_Peptidase_M12B_ADAM-TS	p.L355P	ENST00000284984.3	37	c.1064	CCDS33524.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.28|18.28	3.589975|3.589975	0.66105|0.66105	.|.	.|.	ENSG00000154734|ENSG00000154734	ENST00000451462|ENST00000284984;ENST00000517777;ENST00000517452	.|T;T;T	.|0.79554	.|-1.28;-1.28;-1.28	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.|.	.|.	.|.	.|.	D|D	0.92867|0.92867	0.7731|0.7731	H|H	0.96489|0.96489	3.83|3.83	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.95002|0.95002	0.8144|0.8144	5|9	.|0.87932	.|D	.|0	.|.	15.3726|15.3726	0.74577|0.74577	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|355	.|Q9UHI8	.|ATS1_HUMAN	L|P	137|355;93;117	.|ENSP00000284984:L355P;ENSP00000429557:L93P;ENSP00000431065:L117P	.|ENSP00000284984:L355P	F|L	-|-	1|2	0|0	ADAMTS1|ADAMTS1	27136542|27136542	1.000000|1.000000	0.71417|0.71417	0.907000|0.907000	0.35723|0.35723	0.589000|0.589000	0.36550|0.36550	9.139000|9.139000	0.94554|0.94554	2.209000|2.209000	0.71365|0.71365	0.533000|0.533000	0.62120|0.62120	TTT|CTT	ADAMTS1	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000154734		0.488	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS1	HGNC	protein_coding	OTTHUMT00000171650.2	-	0.00	54	0	A			28214671	-1	tier1	-	no_errors	ENST00000284984	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.999	G
ADAMTS2	9509	genome.wustl.edu	37	5	178554969	178554969	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:178554969A>G	ENST00000251582.7	-	17	2709	c.2608T>C	c.(2608-2610)Tgt>Cgt	p.C870R		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	870	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CCTCCGCCACAGGGCTTGGAG	0.617																																																	0													143.0	125.0	131.0					5																	178554969		2203	4300	6503	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2608T>C	5.37:g.178554969A>G	ENSP00000251582:p.Cys870Arg			Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.C870R	ENST00000251582.7	37	c.2608	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963121	0.74016	.	.	ENSG00000087116	ENST00000251582	D	0.96491	-4.03	4.55	4.55	0.56014	.	0.104877	0.43747	D	0.000528	D	0.98661	0.9551	H	0.98769	4.325	0.80722	D	1	P	0.52577	0.954	P	0.57911	0.829	D	0.99297	1.0900	10	0.87932	D	0	.	13.3656	0.60682	1.0:0.0:0.0:0.0	.	870	O95450	ATS2_HUMAN	R	870	ENSP00000251582:C870R	ENSP00000251582:C870R	C	-	1	0	ADAMTS2	178487575	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.708000	0.91372	1.811000	0.52892	0.379000	0.24179	TGT	ADAMTS2	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000087116		0.617	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	55	0	A	NM_014244		178554969	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	G
ADRA1A	148	genome.wustl.edu	37	8	26627672	26627672	+	Missense_Mutation	SNP	T	T	G	rs2229126	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:26627672T>G	ENST00000380573.3	-	3	2418	c.1395A>C	c.(1393-1395)gaA>gaC	p.E465D	ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380582.3_Intron|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Intron|ADRA1A_ENST00000519229.1_Intron|ADRA1A_ENST00000354550.4_Intron|ADRA1A_ENST00000276393.4_Missense_Mutation_p.E465D			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TGTCCTAGACTTCCTCCCCGT	0.532																																																	0													197.0	195.0	196.0					8																	26627672		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000380573.3:c.1395A>C	8.37:g.26627672T>G	ENSP00000369947:p.Glu465Asp		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.E465D	ENST00000380573.3	37	c.1395	CCDS6054.1	8	.	.	.	.	.	.	.	.	.	.	T	10.14	1.267754	0.23136	.	.	ENSG00000120907	ENST00000276393;ENST00000380573	T;T	0.61742	0.08;0.08	5.85	2.11	0.27256	.	.	.	.	.	T	0.38852	0.1056	L	0.44542	1.39	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.27400	-1.0075	8	0.13470	T	0.59	.	0.2537	0.00209	0.3616:0.1964:0.1414:0.3006	.	465	P35348	ADA1A_HUMAN	D	465	ENSP00000276393:E465D;ENSP00000369947:E465D	ENSP00000276393:E465D	E	-	3	2	ADRA1A	26683589	0.997000	0.39634	1.000000	0.80357	0.976000	0.68499	0.246000	0.18160	0.444000	0.26612	-0.290000	0.09829	GAA	ADRA1A	-	NULL	ENSG00000120907		0.532	ADRA1A-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376208.1	-	0.00	61	0	T	NM_033303		26627672	-1	tier1	-	no_errors	ENST00000276393	ensembl	human	known	74_37	missense	31.15	42	19	SNP	0.997	G
AGAP7P	653268	genome.wustl.edu	37	10	51465015	51465015	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:51465015C>A	ENST00000374095.5	-	7	1566	c.1441G>T	c.(1441-1443)Ggt>Tgt	p.G481C		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		481	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						CGGTGGATACCTGAGCATTCA	0.532																																																	0													23.0	25.0	25.0					10																	51465015		1985	4157	6142	SO:0001583	missense	0																														ENST00000374095.5:c.1441G>T	10.37:g.51465015C>A	ENSP00000363208:p.Gly481Cys		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.G481C	ENST00000374095.5	37	c.1441	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	13.01	2.108542	0.37242	.	.	ENSG00000204169	ENST00000374095	T	0.54479	0.57	.	.	.	.	0.052594	0.85682	D	0.000000	T	0.79281	0.4419	H	0.99058	4.415	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.76528	-0.2926	9	0.87932	D	0	.	5.9763	0.19382	0.0:0.9994:0.0:6.0E-4	.	481	Q5VUJ5	AGAP7_HUMAN	C	481	ENSP00000363208:G481C	ENSP00000363208:G481C	G	-	1	0	AGAP7	51135021	0.992000	0.36948	0.024000	0.17045	0.024000	0.10985	5.227000	0.65305	0.172000	0.19760	0.175000	0.17021	GGT	AGAP7	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	ENSG00000204169		0.532	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	-	0.00	58	0	C			51465015	-1	tier1	-	no_errors	ENST00000374095	ensembl	human	known	74_37	missense	18.27	85	19	SNP	1.000	A
AGAP7P	653268	genome.wustl.edu	37	10	51483216	51483216	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:51483216G>C	ENST00000374095.5	-	2	375	c.250C>G	c.(250-252)Cca>Gca	p.P84A		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		84					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						CTTGCCTCTGGATTGGCAGAA	0.373																																																	0													8.0	9.0	9.0					10																	51483216		1592	3460	5052	SO:0001583	missense	0																														ENST00000374095.5:c.250C>G	10.37:g.51483216G>C	ENSP00000363208:p.Pro84Ala		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.P84A	ENST00000374095.5	37	c.250	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	11.18	1.564127	0.27915	.	.	ENSG00000204169	ENST00000374095	D	0.87334	-2.24	0.589	0.589	0.17452	.	0.530450	0.20252	N	0.096050	D	0.83257	0.5215	L	0.48218	1.51	0.20196	N	0.999921	P	0.40476	0.718	P	0.45428	0.48	T	0.75297	-0.3367	10	0.87932	D	0	.	7.0478	0.25055	1.0E-4:0.0:0.9999:0.0	.	84	Q5VUJ5	AGAP7_HUMAN	A	84	ENSP00000363208:P84A	ENSP00000363208:P84A	P	-	1	0	AGAP7	51153222	1.000000	0.71417	0.125000	0.21846	0.035000	0.12851	3.974000	0.56852	0.604000	0.29930	0.175000	0.17021	CCA	AGAP7	-	NULL	ENSG00000204169		0.373	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	-	0.00	138	0	G			51483216	-1	tier1	-	no_errors	ENST00000374095	ensembl	human	known	74_37	missense	10.78	182	22	SNP	0.993	C
AGPS	8540	genome.wustl.edu	37	2	178378595	178378595	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:178378595C>T	ENST00000264167.4	+	17	1802	c.1656C>T	c.(1654-1656)tgC>tgT	p.C552C	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	552					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			CAAGGGAATGCAAAGAGAAGG	0.284																																																	0													119.0	123.0	121.0					2																	178378595		2203	4299	6502	SO:0001819	synonymous_variant	0			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.1656C>T	2.37:g.178378595C>T			A5D8U9|Q2TU35	Silent	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.C552	ENST00000264167.4	37	c.1656	CCDS2275.1	2																																																																																			AGPS	-	pfam_FAD-linked_oxidase_C,superfamily_FAD-linked_Oxase-like_C	ENSG00000018510		0.284	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2		0.00	45	0	C			178378595	+1			no_errors	ENST00000264167	ensembl	human	known	74_37	silent	7.69	36	3	SNP	1.000	T
AKNAD1	254268	genome.wustl.edu	37	1	109391542	109391542	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:109391542T>C	ENST00000370001.3	-	4	1442	c.1174A>G	c.(1174-1176)Aag>Gag	p.K392E	AKNAD1_ENST00000369995.3_Missense_Mutation_p.K392E|AKNAD1_ENST00000369994.1_Missense_Mutation_p.K392E|AKNAD1_ENST00000357393.4_Missense_Mutation_p.K99E	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	392						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						ACTTTAGTCTTCAGTTGATCA	0.323																																																	0													78.0	85.0	83.0					1																	109391542		2203	4300	6503	SO:0001583	missense	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1174A>G	1.37:g.109391542T>C	ENSP00000359018:p.Lys392Glu		B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	pfam_TF_AT-hook	p.K392E	ENST00000370001.3	37	c.1174	CCDS791.2	1	.	.	.	.	.	.	.	.	.	.	T	16.57	3.160537	0.57368	.	.	ENSG00000162641	ENST00000370001;ENST00000357393;ENST00000369994;ENST00000369995	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.45	3.11	0.35812	.	0.508579	0.21435	N	0.074600	T	0.32436	0.0829	L	0.34521	1.04	0.27665	N	0.946943	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.11060	-1.0603	10	0.49607	T	0.09	-12.3967	7.101	0.25338	0.0:0.0723:0.2804:0.6473	.	99;392	B4DET8;Q5T1N1	.;AKND1_HUMAN	E	392;99;392;392	ENSP00000359018:K392E;ENSP00000349968:K99E;ENSP00000359011:K392E;ENSP00000359012:K392E	ENSP00000349968:K99E	K	-	1	0	AKNAD1	109193065	0.998000	0.40836	1.000000	0.80357	0.763000	0.43281	1.716000	0.37981	0.446000	0.26666	-0.313000	0.08912	AAG	AKNAD1	-	pfam_TF_AT-hook	ENSG00000162641		0.323	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	HGNC	protein_coding	OTTHUMT00000030923.2	-	0.00	85	0	T	NM_152763		109391542	-1	tier1	-	no_errors	ENST00000370001	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	C
AKT2	208	genome.wustl.edu	37	19	40742171	40742171	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:40742171G>A	ENST00000392038.2	-	10	1251	c.953C>T	c.(952-954)gCg>gTg	p.A318V	AKT2_ENST00000424901.1_Missense_Mutation_p.A318V|AKT2_ENST00000579047.1_Missense_Mutation_p.A256V|AKT2_ENST00000311278.6_Intron	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CACCTCAGGCGCCAGGTACTC	0.597			A		"""ovarian, pancreatic """																																			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0													60.0	63.0	62.0					19																	40742171		2203	4300	6503	SO:0001583	missense	0			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.953C>T	19.37:g.40742171G>A	ENSP00000375892:p.Ala318Val		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom	p.A318V	ENST00000392038.2	37	c.953	CCDS12552.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.500733	0.96371	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000391845	T;T	0.53640	0.61;0.61	5.7	4.67	0.58626	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046129	0.85682	N	0.000000	T	0.81158	0.4764	H	0.99379	4.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68192	0.956;0.94	D	0.88696	0.3212	10	0.87932	D	0	.	13.3883	0.60809	0.0771:0.0:0.9229:0.0	.	256;318	B4DG79;P31751	.;AKT2_HUMAN	V	318;219;318;138	ENSP00000375892:A318V;ENSP00000399532:A318V	ENSP00000375719:A219V	A	-	2	0	AKT2	45434011	1.000000	0.71417	0.967000	0.41034	0.903000	0.53119	9.776000	0.99001	1.416000	0.47057	0.655000	0.94253	GCG	AKT2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105221		0.597	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT2	HGNC	protein_coding	OTTHUMT00000268029.1	-	0.00	54	0	G	NM_001626		40742171	-1	tier1	-	no_errors	ENST00000392038	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	A
ALMS1	7840	genome.wustl.edu	37	2	73836724	73836724	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:73836724A>C	ENST00000264448.6	+	23	12600	c.12489A>C	c.(12487-12489)aaA>aaC	p.K4163N	ALMS1_ENST00000409009.1_Missense_Mutation_p.K4121N	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	4163	ALMS motif.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TGGGGAGAAAAGTTCCCTGGG	0.423																																																	0													125.0	121.0	122.0					2																	73836724		1837	4074	5911	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.12489A>C	2.37:g.73836724A>C	ENSP00000264448:p.Lys4163Asn		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.K4163N	ENST00000264448.6	37	c.12489	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	A	22.1	4.241807	0.79912	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.09350	2.99;2.99	5.34	5.34	0.76211	.	0.064020	0.64402	D	0.000010	T	0.22627	0.0546	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.00655	-1.1624	10	0.87932	D	0	.	11.6236	0.51132	1.0:0.0:0.0:0.0	.	4121;4163	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	N	4121;4163	ENSP00000386627:K4121N;ENSP00000264448:K4163N	ENSP00000264448:K4163N	K	+	3	2	ALMS1	73690232	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.524000	0.60552	2.242000	0.73789	0.482000	0.46254	AAA	ALMS1	-	NULL	ENSG00000116127		0.423	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	54	0	A	NM_015120		73836724	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	25.58	32	11	SNP	1.000	C
AMDHD1	144193	genome.wustl.edu	37	12	96350667	96350667	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:96350667G>A	ENST00000266736.2	+	4	620	c.514G>A	c.(514-516)Gtg>Atg	p.V172M		NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	172					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GATGCTGCGCGTGATTGAGCG	0.632																																																	0													98.0	100.0	100.0					12																	96350667		2203	4300	6503	SO:0001583	missense	0			AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.514G>A	12.37:g.96350667G>A	ENSP00000266736:p.Val172Met		A8K463|Q68CI8	Missense_Mutation	SNP	pfam_Amidohydro_1,pfam_Amidohydro_3,superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	p.V172M	ENST00000266736.2	37	c.514	CCDS9057.1	12	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003063	0.93287	.	.	ENSG00000139344	ENST00000266736	T	0.40756	1.02	5.57	5.57	0.84162	Metal-dependent hydrolase, composite domain (1);	0.053951	0.64402	D	0.000001	T	0.75939	0.3918	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.82870	-0.0243	10	0.87932	D	0	-1.7215	19.5469	0.95302	0.0:0.0:1.0:0.0	.	172	Q96NU7	HUTI_HUMAN	M	172	ENSP00000266736:V172M	ENSP00000266736:V172M	V	+	1	0	AMDHD1	94874798	1.000000	0.71417	0.922000	0.36590	0.842000	0.47809	9.440000	0.97547	2.632000	0.89209	0.491000	0.48974	GTG	AMDHD1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_HutI	ENSG00000139344		0.632	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD1	HGNC	protein_coding	OTTHUMT00000408640.1	-	0.00	50	0	G	NM_152435		96350667	+1	tier1	-	no_errors	ENST00000266736	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	A
ANAPC2	29882	genome.wustl.edu	37	9	140080911	140080912	+	Intron	DEL	CA	CA	-	rs148147354|rs372896343		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:140080911_140080912delCA	ENST00000323927.2	-	3	745				SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGCATGCAGcacacacacaca	0.624																																																	0																																										SO:0001627	intron_variant	0			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.741-103TG>-	9.37:g.140080921_140080922delCA			Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	RNA	DEL	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																			ANAPC2	-	-	ENSG00000176248		0.624	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	HGNC	protein_coding	OTTHUMT00000055315.1		0.00	21	0	CA	NM_013366		140080912	-1	tier1		no_errors	ENST00000495611	ensembl	human	known	74_37	rna	30.00	7	3	DEL	0.000:0.000	-
ANK3	288	genome.wustl.edu	37	10	61829130	61829130	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:61829130C>A	ENST00000280772.2	-	37	11700	c.11509G>T	c.(11509-11511)Gga>Tga	p.G3837*	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3837					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ACACAGTGTCCTTGTAGTACC	0.403																																																	0													262.0	259.0	260.0					10																	61829130		2203	4300	6503	SO:0001587	stop_gained	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.11509G>T	10.37:g.61829130C>A	ENSP00000280772:p.Gly3837*		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.G3837*	ENST00000280772.2	37	c.11509	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	53	20.099366	0.99927	.	.	ENSG00000151150	ENST00000280772	.	.	.	5.07	5.07	0.68467	.	0.000000	0.41097	D	0.000960	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	14.4204	0.67180	0.0:0.8525:0.1475:0.0	.	.	.	.	X	3837	.	ENSP00000280772:G3837X	G	-	1	0	ANK3	61499136	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.824000	0.39072	2.511000	0.84671	0.650000	0.86243	GGA	ANK3	-	NULL	ENSG00000151150		0.403	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	49	0	C	NM_020987		61829130	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	A
ANKRD30BP2	149992	genome.wustl.edu	37	21	14417502	14417502	+	RNA	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:14417502T>A	ENST00000507941.1	+	0	114				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		CACACCACTTTTATTGGCCAT	0.303																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14417502T>A				RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.303	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	-	0.00	245	0	T	NR_026916		14417502	+1	tier1	-	no_errors	ENST00000471407	ensembl	human	known	74_37	rna	9.14	179	18	SNP	0.235	A
ARHGAP24	83478	genome.wustl.edu	37	4	86916623	86916623	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:86916623G>T	ENST00000395184.1	+	9	2282	c.1816G>T	c.(1816-1818)Gac>Tac	p.D606Y	ARHGAP24_ENST00000395183.2_Missense_Mutation_p.D511Y|ARHGAP24_ENST00000264343.4_Missense_Mutation_p.D513Y	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	606					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		CCACCCCAGGGACTATGAAAG	0.552																																																	0													81.0	80.0	81.0					4																	86916623		2203	4300	6503	SO:0001583	missense	0			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.1816G>T	4.37:g.86916623G>T	ENSP00000378611:p.Asp606Tyr		Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.D606Y	ENST00000395184.1	37	c.1816	CCDS34025.1	4	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384498	0.82792	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.17691	2.61;2.27;2.26;2.26	5.73	5.73	0.89815	.	0.047424	0.85682	D	0.000000	T	0.34542	0.0901	L	0.57536	1.79	0.80722	D	1	D;P;D	0.56521	0.969;0.955;0.976	P;P;P	0.54312	0.563;0.748;0.656	T	0.01869	-1.1257	10	0.72032	D	0.01	.	19.8932	0.96939	0.0:0.0:1.0:0.0	.	511;513;606	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	Y	606;511;521;513	ENSP00000378611:D606Y;ENSP00000378610:D511Y;ENSP00000425589:D521Y;ENSP00000264343:D513Y	ENSP00000264343:D513Y	D	+	1	0	ARHGAP24	87135647	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	6.947000	0.75959	2.710000	0.92621	0.491000	0.48974	GAC	ARHGAP24	-	NULL	ENSG00000138639		0.552	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	HGNC	protein_coding	OTTHUMT00000252815.2	-	0.00	44	0	G	NM_031305		86916623	+1	tier1	-	no_errors	ENST00000395184	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
ARHGEF10	9639	genome.wustl.edu	37	8	1900950	1900950	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:1900950G>A	ENST00000398564.1	+	28	3552	c.3552G>A	c.(3550-3552)gtG>gtA	p.V1184V	ARHGEF10_ENST00000521927.1_3'UTR|ARHGEF10_ENST00000518288.1_Silent_p.V1183V|ARHGEF10_ENST00000349830.3_Silent_p.V1159V|ARHGEF10_ENST00000520359.1_Silent_p.V1121V|ARHGEF10_ENST00000262112.6_Silent_p.V1155V			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	1184					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GAGTCCTCGTGGCCCTGCCGG	0.637																																																	0													55.0	55.0	55.0					8																	1900950		2203	4300	6503	SO:0001819	synonymous_variant	0			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.3552G>A	8.37:g.1900950G>A			O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.V1184	ENST00000398564.1	37	c.3552		8																																																																																			ARHGEF10	-	NULL	ENSG00000104728		0.637	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding		-	0.00	137	0	G			1900950	+1	tier1	-	no_errors	ENST00000398564	ensembl	human	known	74_37	silent	6.50	185	13	SNP	0.931	A
ARID1A	8289	genome.wustl.edu	37	1	27100324	27100324	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:27100324C>T	ENST00000324856.7	+	17	4407	c.4036C>T	c.(4036-4038)Caa>Taa	p.Q1346*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1346*|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q963*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1346	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GTTCTCCACCCAAGGCACCCC	0.547			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													184.0	186.0	185.0					1																	27100324		2203	4300	6503	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4036C>T	1.37:g.27100324C>T	ENSP00000320485:p.Gln1346*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q1346*	ENST00000324856.7	37	c.4036	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.439036|9.439036	0.99171|0.99171	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.107643	.|0.64402	.|D	.|0.000003	T|.	0.75057|.	0.3798|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.72374|.	-0.4313|.	4|.	.|0.37606	.|T	.|0.19	-4.4331|-4.4331	19.5138|19.5138	0.95154|0.95154	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	242|1346;1346;963	.|.	.|ENSP00000320485:Q1346X	P|Q	+|+	2|1	0|0	ARID1A|ARID1A	26972911|26972911	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.308000|5.308000	0.65768|0.65768	2.625000|2.625000	0.88918|0.88918	0.650000|0.650000	0.86243|0.86243	CCA|CAA	ARID1A	-	NULL	ENSG00000117713		0.547	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	91	0	C	NM_139135		27100324	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	nonsense	20.00	52	13	SNP	1.000	T
ARPC2	10109	genome.wustl.edu	37	2	219114399	219114399	+	Intron	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:219114399C>T	ENST00000295685.10	+	9	1038				ARPC2_ENST00000477992.1_Intron|ARPC2_ENST00000315717.5_Intron	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		TCCAGAATTGCTCACCTTCCT	0.478																																																	0																																										SO:0001627	intron_variant	0			AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.778-145C>T	2.37:g.219114399C>T			Q92801|Q9P1D4	RNA	SNP	-	NULL	ENST00000295685.10	37	NULL	CCDS2410.1	2																																																																																			ARPC2	-	-	ENSG00000163466		0.478	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	HGNC	protein_coding	OTTHUMT00000256777.2	-	0.00	19	0	C	NM_005731		219114399	+1	tier1	-	no_errors	ENST00000487321	ensembl	human	putative	74_37	rna	29.41	12	5	SNP	0.000	T
ASIC2	40	genome.wustl.edu	37	17	31350878	31350878	+	Splice_Site	SNP	C	C	T	rs199653464		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:31350878C>T	ENST00000359872.6	-	6	1958		c.e6+1		ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Splice_Site	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	ACTAAACTTACGAGATATATT	0.438																																																	0													125.0	119.0	121.0					17																	31350878		2203	4300	6503	SO:0001630	splice_region_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.1196+1G>A	17.37:g.31350878C>T			E9PBX2|Q13553|Q6DJU1|Q8N3E2	Splice_Site	SNP	-	e6+1	ENST00000359872.6	37	c.1349+1	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710974	0.89112	.	.	ENSG00000108684	ENST00000225823;ENST00000359872	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9714	0.86301	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACCN1	28374991	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.763000	0.85283	1.316000	0.45131	0.453000	0.30009	.	ASIC2	-	-	ENSG00000108684		0.438	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	-	0.00	52	0	C	NM_183377, NM_001094	Intron	31350878	-1	tier1	rs199653464	no_errors	ENST00000225823	ensembl	human	known	74_37	splice_site	28.57	35	14	SNP	1.000	T
ASTN2	23245	genome.wustl.edu	37	9	119204735	119204735	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:119204735C>T	ENST00000313400.4	-	21	3695	c.3595G>A	c.(3595-3597)Gaa>Aaa	p.E1199K	ASTN2_ENST00000361477.3_Missense_Mutation_p.E251K|ASTN2_ENST00000373996.3_Missense_Mutation_p.E1195K|ASTN2_ENST00000288520.5_Missense_Mutation_p.E300K|ASTN2_ENST00000341734.4_Missense_Mutation_p.E251K|ASTN2_ENST00000361209.2_Missense_Mutation_p.E1148K			O75129	ASTN2_HUMAN	astrotactin 2	1199					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TACCTACCTTCTGCCTTGTTG	0.498																																																	0													197.0	168.0	178.0					9																	119204735		2203	4300	6503	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3595G>A	9.37:g.119204735C>T	ENSP00000314038:p.Glu1199Lys		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.E1199K	ENST00000313400.4	37	c.3595		9	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625055	0.87560	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.15487	2.83;2.83;2.42;2.44;2.65;2.85;2.44	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.30070	0.0753	N	0.19112	0.55	0.80722	D	1	D;D;P;D;P;D;D	0.69078	0.996;0.996;0.942;0.997;0.868;0.996;0.996	D;D;P;D;P;D;D	0.76071	0.981;0.981;0.487;0.98;0.491;0.981;0.987	T	0.10543	-1.0625	10	0.62326	D	0.03	.	19.2689	0.94000	0.0:1.0:0.0:0.0	.	251;251;1148;1199;1195;251;300	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	K	1199;1195;300;251;922;1148;251	ENSP00000314038:E1199K;ENSP00000363108:E1195K;ENSP00000288520:E300K;ENSP00000339925:E251K;ENSP00000363098:E922K;ENSP00000354504:E1148K;ENSP00000355116:E251K	ENSP00000288520:E300K	E	-	1	0	ASTN2	118244556	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.664000	0.83830	2.546000	0.85860	0.655000	0.94253	GAA	ASTN2	-	NULL	ENSG00000148219		0.498	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		-	0.00	52	0	C	NM_014010		119204735	-1	tier1	-	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
ASTN2	23245	genome.wustl.edu	37	9	120176829	120176829	+	Missense_Mutation	SNP	G	G	A	rs201301375		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:120176829G>A	ENST00000313400.4	-	1	488	c.388C>T	c.(388-390)Cgc>Tgc	p.R130C	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.R130C|ASTN2_ENST00000361209.2_Missense_Mutation_p.R130C			O75129	ASTN2_HUMAN	astrotactin 2	130					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACCGCGATGCGCCCCGGCAGC	0.726																																																	0								G	CYS/ARG	0,4406		0,0,2203	34.0	33.0	34.0		388	3.1	1.0	9		34	1,8597		0,1,4298	yes	missense	ASTN2	NM_014010.4	180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	130/1289	120176829	1,13003	2203	4299	6502	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.388C>T	9.37:g.120176829G>A	ENSP00000314038:p.Arg130Cys		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.R130C	ENST00000313400.4	37	c.388		9	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242695	0.39598	0.0	1.16E-4	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.11169	2.84;2.84;2.8	3.13	3.13	0.36017	.	0.109140	0.34067	N	0.004281	T	0.12774	0.0310	N	0.22421	0.69	0.47621	D	0.999471	D;D;D	0.76494	0.986;0.993;0.999	P;B;P	0.59012	0.648;0.348;0.85	T	0.07986	-1.0744	9	.	.	.	-16.7552	7.6695	0.28451	0.0:0.0:0.7477:0.2523	.	130;130;130	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	C	130	ENSP00000314038:R130C;ENSP00000363108:R130C;ENSP00000354504:R130C	.	R	-	1	0	ASTN2	119216650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.889000	0.28282	1.723000	0.51488	0.455000	0.32223	CGC	ASTN2	-	NULL	ENSG00000148219		0.726	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		-	0.00	67	0	G	NM_014010		120176829	-1	tier1	rs201301375	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	16.67	55	11	SNP	1.000	A
ASXL3	80816	genome.wustl.edu	37	18	31323952	31323952	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:31323952A>G	ENST00000269197.5	+	12	4140	c.4140A>G	c.(4138-4140)gaA>gaG	p.E1380E		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGGGAGTGAAGAACAGGCCA	0.507											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													95.0	98.0	97.0					18																	31323952		1980	4158	6138	SO:0001819	synonymous_variant	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4140A>G	18.37:g.31323952A>G		823	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	superfamily_Znf_FYVE_PHD	p.E1380	ENST00000269197.5	37	c.4140	CCDS45847.1	18																																																																																			ASXL3	-	NULL	ENSG00000141431		0.507	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	39	0	A			31323952	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	silent	27.59	21	8	SNP	0.966	G
ATAD2	29028	genome.wustl.edu	37	8	124357205	124357205	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:124357205T>C	ENST00000287394.5	-	19	2744	c.2637A>G	c.(2635-2637)acA>acG	p.T879T	ATAD2_ENST00000521903.1_Silent_p.T197T|RNU6-875P_ENST00000516488.1_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	879					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCTGTAATAATGTGGTAAATG	0.423																																																	0													195.0	177.0	183.0					8																	124357205		2203	4300	6503	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2637A>G	8.37:g.124357205T>C			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.T879	ENST00000287394.5	37	c.2637	CCDS6343.1	8																																																																																			ATAD2	-	superfamily_P-loop_NTPase	ENSG00000156802		0.423	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	0.00	43	0	T	NM_014109		124357205	-1	tier1	-	no_errors	ENST00000287394	ensembl	human	known	74_37	silent	11.39	70	9	SNP	0.996	C
ATG2B	55102	genome.wustl.edu	37	14	96756870	96756870	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:96756870C>T	ENST00000359933.4	-	40	6652	c.5759G>A	c.(5758-5760)cGc>cAc	p.R1920H	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1920					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TCTGACAATGCGGCCATCCTT	0.493																																																	0													116.0	97.0	103.0					14																	96756870		2203	4300	6503	SO:0001583	missense	0			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5759G>A	14.37:g.96756870C>T	ENSP00000353010:p.Arg1920His		Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.R1920H	ENST00000359933.4	37	c.5759	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910471	0.92107	.	.	ENSG00000066739	ENST00000359933	T	0.18810	2.19	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.50274	0.1606	M	0.78285	2.405	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54316	-0.8312	10	0.66056	D	0.02	.	18.7953	0.91991	0.0:1.0:0.0:0.0	.	1920	Q96BY7	ATG2B_HUMAN	H	1920	ENSP00000353010:R1920H	ENSP00000261834:R564H	R	-	2	0	ATG2B	95826623	1.000000	0.71417	0.923000	0.36655	0.566000	0.35808	7.148000	0.77389	2.503000	0.84419	0.655000	0.94253	CGC	ATG2B	-	NULL	ENSG00000066739		0.493	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1		0.00	41	0	C	NM_018036		96756870	-1			no_errors	ENST00000359933	ensembl	human	known	74_37	missense	10.00	26	3	SNP	1.000	T
ATP4A	495	genome.wustl.edu	37	19	36046578	36046578	+	Splice_Site	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:36046578T>G	ENST00000262623.3	-	13	2034	c.2006A>C	c.(2005-2007)aAg>aCg	p.K669T		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	669					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GGGGGCTTACTTGCGATTAAC	0.647																																																	0													94.0	93.0	93.0					19																	36046578		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2006+1A>C	19.37:g.36046578T>G			O00738	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.K669T	ENST00000262623.3	37	c.2006	CCDS12467.1	19	.	.	.	.	.	.	.	.	.	.	T	13.65	2.300319	0.40694	.	.	ENSG00000105675	ENST00000262623	D	0.93906	-3.31	4.97	3.9	0.45041	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.270919	0.24458	N	0.038346	D	0.87609	0.6220	L	0.35793	1.09	0.48452	D	0.999654	B	0.13594	0.008	B	0.27608	0.081	T	0.80564	-0.1326	9	.	.	.	.	5.9283	0.19124	0.0:0.1188:0.0:0.8812	.	669	P20648	ATP4A_HUMAN	T	669	ENSP00000262623:K669T	.	K	-	2	0	ATP4A	40738418	1.000000	0.71417	0.999000	0.59377	0.458000	0.32498	3.924000	0.56476	2.097000	0.63578	0.379000	0.24179	AAG	ATP4A	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000105675		0.647	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	-	0.00	49	0	T	NM_000704	Missense_Mutation	36046578	-1	tier1	-	no_errors	ENST00000262623	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	G
ATP6V1E1	529	genome.wustl.edu	37	22	18075498	18075498	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr22:18075498A>T	ENST00000253413.5	-	9	805	c.623T>A	c.(622-624)aTg>aAg	p.M208K	ATP6V1E1_ENST00000399796.2_Missense_Mutation_p.M178K|ATP6V1E1_ENST00000399798.2_Missense_Mutation_p.M186K	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	208					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		GACTTCTGGCATCATCTGTGG	0.453																																																	0													111.0	102.0	105.0					22																	18075498		2203	4300	6503	SO:0001583	missense	0			X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.623T>A	22.37:g.18075498A>T	ENSP00000253413:p.Met208Lys		A8MUE4|A8MUN4	Missense_Mutation	SNP	pfam_ATPase_V1/A1-cplx_esu	p.M208K	ENST00000253413.5	37	c.623	CCDS13745.1	22	.	.	.	.	.	.	.	.	.	.	A	13.38	2.219280	0.39201	.	.	ENSG00000131100	ENST00000253413;ENST00000399796;ENST00000399798	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	L	0.57536	1.79	0.80722	D	1	B;P;B	0.40731	0.154;0.728;0.154	B;P;B	0.45794	0.309;0.493;0.371	T	0.66677	-0.5863	9	0.87932	D	0	-22.7598	13.7019	0.62613	1.0:0.0:0.0:0.0	.	186;178;208	A8MUE4;A8MUN4;P36543	.;.;VATE1_HUMAN	K	208;178;186	.	ENSP00000253413:M208K	M	-	2	0	ATP6V1E1	16455498	1.000000	0.71417	1.000000	0.80357	0.130000	0.20726	7.889000	0.87307	2.127000	0.65507	0.528000	0.53228	ATG	ATP6V1E1	-	pfam_ATPase_V1/A1-cplx_esu	ENSG00000131100		0.453	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1E1	HGNC	protein_coding	OTTHUMT00000131790.3		0.00	67	0	A	NM_001696		18075498	-1			no_errors	ENST00000253413	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
ATP9B	374868	genome.wustl.edu	37	18	77097384	77097384	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:77097384G>A	ENST00000426216.2	+	19	2235	c.2218G>A	c.(2218-2220)Gtg>Atg	p.V740M	ATP9B_ENST00000543761.1_Missense_Mutation_p.V61M|RP11-800A18.4_ENST00000592906.1_RNA|ATP9B_ENST00000307671.7_Missense_Mutation_p.V740M	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	740					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CCTCACCGGCGTGGAGGACCA	0.647																																																	0													105.0	91.0	95.0					18																	77097384		2203	4300	6503	SO:0001583	missense	0			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.2218G>A	18.37:g.77097384G>A	ENSP00000398076:p.Val740Met		O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V740M	ENST00000426216.2	37	c.2218	CCDS12014.1	18	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092445	0.76756	.	.	ENSG00000166377	ENST00000426216;ENST00000307671;ENST00000543761	T;T;D	0.99080	-0.28;-0.28;-5.4	5.36	5.36	0.76844	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.99566	0.9844	H	0.95917	3.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	D	0.97960	1.0337	10	0.87932	D	0	.	19.1091	0.93310	0.0:0.0:1.0:0.0	.	61;740;740	F5H8J1;O43861;O43861-2	.;ATP9B_HUMAN;.	M	740;740;61	ENSP00000398076:V740M;ENSP00000304500:V740M;ENSP00000442015:V61M	ENSP00000304500:V740M	V	+	1	0	ATP9B	75198372	1.000000	0.71417	0.940000	0.37924	0.370000	0.29829	9.113000	0.94321	2.512000	0.84698	0.655000	0.94253	GTG	ATP9B	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000166377		0.647	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	HGNC	protein_coding	OTTHUMT00000256402.3	-	0.00	46	0	G	NM_198531		77097384	+1	tier1	-	no_errors	ENST00000426216	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	A
BAI3	577	genome.wustl.edu	37	6	69728321	69728321	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:69728321A>C	ENST00000370598.1	+	13	2858	c.2037A>C	c.(2035-2037)gaA>gaC	p.E679D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	679					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AGGTGATTGAAGATTTTATAC	0.318																																																	0													136.0	144.0	141.0					6																	69728321		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2037A>C	6.37:g.69728321A>C	ENSP00000359630:p.Glu679Asp		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.E679D	ENST00000370598.1	37	c.2037	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	A	25.9	4.680948	0.88542	.	.	ENSG00000135298	ENST00000370598	T	0.39056	1.1	6.08	6.08	0.98989	Domain of unknown function DUF3497 (1);	0.109200	0.64402	D	0.000011	T	0.57330	0.2046	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61997	-0.6947	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	679	O60242	BAI3_HUMAN	D	679	ENSP00000359630:E679D	ENSP00000359630:E679D	E	+	3	2	BAI3	69785042	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.906000	0.63293	2.333000	0.79357	0.482000	0.46254	GAA	BAI3	-	pfam_DUF3497	ENSG00000135298		0.318	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	73	0	A			69728321	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	25.35	53	18	SNP	1.000	C
BBS9	27241	genome.wustl.edu	37	7	33313529	33313529	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:33313529T>G	ENST00000242067.6	+	9	1498	c.977T>G	c.(976-978)cTt>cGt	p.L326R	BBS9_ENST00000355070.2_Missense_Mutation_p.L326R|BBS9_ENST00000354265.4_Missense_Mutation_p.L326R|BBS9_ENST00000350941.3_Missense_Mutation_p.L326R|BBS9_ENST00000425508.2_Missense_Mutation_p.L281R|BBS9_ENST00000396127.2_Missense_Mutation_p.L326R	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	326					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GCCACCCAACTTCCCCACATT	0.358									Bardet-Biedl syndrome																																								0													76.0	73.0	74.0					7																	33313529		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.977T>G	7.37:g.33313529T>G	ENSP00000242067:p.Leu326Arg		E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.L326R	ENST00000242067.6	37	c.977	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	T	24.5	4.542774	0.85917	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000537775	D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.92401	0.7588	M	0.81802	2.56	0.52099	D	0.999948	D;D;D;D;D	0.89917	0.997;0.992;0.992;0.992;1.0	D;D;D;D;D	0.80764	0.945;0.956;0.956;0.956;0.994	D	0.93416	0.6773	10	0.87932	D	0	-18.778	15.7289	0.77788	0.0:0.0:0.0:1.0	.	326;326;326;326;326	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	R	326;326;326;326;326;326;326;281;204	ENSP00000242067:L326R;ENSP00000313122:L326R;ENSP00000379433:L326R;ENSP00000347182:L326R;ENSP00000346214:L326R;ENSP00000405151:L281R	ENSP00000242067:L326R	L	+	2	0	BBS9	33280054	1.000000	0.71417	0.903000	0.35520	0.992000	0.81027	7.277000	0.78572	2.129000	0.65627	0.397000	0.26171	CTT	BBS9	-	NULL	ENSG00000122507		0.358	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	-	0.00	58	0	T			33313529	+1	tier1	-	no_errors	ENST00000242067	ensembl	human	known	74_37	missense	47.76	35	32	SNP	1.000	G
BCAR1	9564	genome.wustl.edu	37	16	75269147	75269147	+	Missense_Mutation	SNP	G	G	T	rs201978090		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:75269147G>T	ENST00000162330.5	-	5	1776	c.1650C>A	c.(1648-1650)gaC>gaA	p.D550E	BCAR1_ENST00000393422.2_Missense_Mutation_p.D568E|BCAR1_ENST00000542031.2_Missense_Mutation_p.D548E|BCAR1_ENST00000535626.2_Missense_Mutation_p.D402E|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000420641.3_Missense_Mutation_p.D568E|BCAR1_ENST00000538440.2_Missense_Mutation_p.D550E|BCAR1_ENST00000393420.6_Missense_Mutation_p.D568E|BCAR1_ENST00000418647.3_Missense_Mutation_p.D596E|BCAR1_ENST00000546196.1_Missense_Mutation_p.D521E	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	550	Ser-rich.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TCTGGTGCACGTCCTCCATCT	0.667																																																	0													34.0	35.0	35.0					16																	75269147		2198	4300	6498	SO:0001583	missense	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.1650C>A	16.37:g.75269147G>T	ENSP00000162330:p.Asp550Glu		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.D596E	ENST00000162330.5	37	c.1788	CCDS10915.1	16	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725025	0.30593	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71	4.65	-8.76	0.00830	Serine rich protein interaction (1);	0.120319	0.53938	N	0.000046	T	0.14270	0.0345	L	0.48642	1.525	0.25477	N	0.987777	B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.11329	0.006;0.002;0.006;0.002;0.003;0.006;0.001;0.006;0.002	T	0.04509	-1.0946	10	0.46703	T	0.11	-10.8756	5.7973	0.18394	0.6226:0.0916:0.1939:0.0919	.	568;402;596;548;568;568;550;550;340	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	E	550;568;568;550;596;402;568;548;521	ENSP00000162330:D550E;ENSP00000377074:D568E;ENSP00000392708:D568E;ENSP00000443841:D550E;ENSP00000391669:D596E;ENSP00000440370:D402E;ENSP00000377072:D568E;ENSP00000440415:D548E;ENSP00000442161:D521E	ENSP00000162330:D550E	D	-	3	2	BCAR1	73826648	0.000000	0.05858	0.278000	0.24718	0.788000	0.44548	-2.237000	0.01200	-1.859000	0.01156	-0.252000	0.11476	GAC	BCAR1	-	pfam_Serine_rich	ENSG00000050820		0.667	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1		0.00	59	0	G	NM_014567		75269147	-1			no_errors	ENST00000418647	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.364	T
BCHE	590	genome.wustl.edu	37	3	165547720	165547720	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:165547720C>A	ENST00000264381.3	-	2	1268	c.1102G>T	c.(1102-1104)Gat>Tat	p.D368Y	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	368					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CTATTGTTATCTTTGCTGAAG	0.338																																																	0													26.0	28.0	28.0					3																	165547720		2199	4293	6492	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1102G>T	3.37:g.165547720C>A	ENSP00000264381:p.Asp368Tyr		A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.D368Y	ENST00000264381.3	37	c.1102	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433582	0.43224	.	.	ENSG00000114200	ENST00000264381	D	0.95137	-3.62	5.55	5.55	0.83447	Carboxylesterase, type B (1);	0.099352	0.64402	D	0.000002	D	0.96956	0.9006	M	0.74467	2.265	0.80722	D	1	D	0.71674	0.998	D	0.68039	0.955	D	0.97332	0.9951	10	0.87932	D	0	.	18.4902	0.90844	0.0:1.0:0.0:0.0	.	368	P06276	CHLE_HUMAN	Y	368	ENSP00000264381:D368Y	ENSP00000264381:D368Y	D	-	1	0	BCHE	167030414	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	2.063000	0.41423	2.617000	0.88574	0.655000	0.94253	GAT	BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.338	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	67	0	C			165547720	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	missense	29.17	51	21	SNP	1.000	A
BCHE	590	genome.wustl.edu	37	3	165548322	165548322	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:165548322A>C	ENST00000264381.3	-	2	666	c.500T>G	c.(499-501)gTt>gGt	p.V167G	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	167					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CACTACAATAACTCTTTCAAC	0.418																																																	0													55.0	57.0	56.0					3																	165548322		2203	4300	6503	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.500T>G	3.37:g.165548322A>C	ENSP00000264381:p.Val167Gly		A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.V167G	ENST00000264381.3	37	c.500	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	A	18.61	3.661223	0.67700	.	.	ENSG00000114200	ENST00000264381	T	0.78003	-1.14	5.62	5.62	0.85841	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.92273	0.7549	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94797	0.7967	10	0.87932	D	0	.	15.005	0.71504	1.0:0.0:0.0:0.0	.	167	P06276	CHLE_HUMAN	G	167	ENSP00000264381:V167G	ENSP00000264381:V167G	V	-	2	0	BCHE	167031016	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.194000	0.94962	2.139000	0.66308	0.533000	0.62120	GTT	BCHE	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Cholinesterase	ENSG00000114200		0.418	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	40	0	A			165548322	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	C
BCL11B	64919	genome.wustl.edu	37	14	99641903	99641903	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:99641903C>T	ENST00000357195.3	-	4	1279	c.1270G>A	c.(1270-1272)Gcc>Acc	p.A424T	BCL11B_ENST00000443726.2_Missense_Mutation_p.A230T|BCL11B_ENST00000345514.2_Missense_Mutation_p.A353T	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	424					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		TTGCTCTTGGCTGGCGGCTGC	0.677			T	TLX3	T-ALL																																			Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0													16.0	18.0	17.0					14																	99641903		2190	4287	6477	SO:0001583	missense	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1270G>A	14.37:g.99641903C>T	ENSP00000349723:p.Ala424Thr		Q9H162	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A424T	ENST00000357195.3	37	c.1270	CCDS9950.1	14	.	.	.	.	.	.	.	.	.	.	C	8.227	0.803813	0.16467	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.01172	5.23;5.23;5.23	4.2	1.23	0.21249	.	1.008340	0.07981	N	0.985505	T	0.01061	0.0035	N	0.14661	0.345	0.28463	N	0.915791	P;P	0.38711	0.613;0.643	B;B	0.42188	0.284;0.379	T	0.49173	-0.8967	10	0.13470	T	0.59	-3.8444	6.9576	0.24580	0.0:0.6944:0.1432:0.1623	.	353;424	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	T	424;353;230	ENSP00000349723:A424T;ENSP00000280435:A353T;ENSP00000387419:A230T	ENSP00000280435:A353T	A	-	1	0	BCL11B	98711656	0.927000	0.31430	0.032000	0.17829	0.775000	0.43874	1.703000	0.37846	0.020000	0.15106	0.561000	0.74099	GCC	BCL11B	-	NULL	ENSG00000127152		0.677	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	-	0.00	33	0	C	NM_138576		99641903	-1	tier1	-	no_errors	ENST00000357195	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.481	T
BICC1	80114	genome.wustl.edu	37	10	60566769	60566769	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:60566769T>G	ENST00000373886.3	+	17	2231	c.2227T>G	c.(2227-2229)Tta>Gta	p.L743V	BICC1_ENST00000263103.1_Missense_Mutation_p.L369V	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	743					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CAAAGCTATGTTAAAGAAACC	0.383																																																	0													68.0	66.0	66.0					10																	60566769		2203	4300	6503	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2227T>G	10.37:g.60566769T>G	ENSP00000362993:p.Leu743Val			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.L743V	ENST00000373886.3	37	c.2227	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	T	11.65	1.703046	0.30232	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.47177	1.7;0.85	5.58	4.43	0.53597	.	0.172233	0.43747	D	0.000522	T	0.59783	0.2219	L	0.56769	1.78	0.51482	D	0.999921	D;D	0.76494	0.999;0.996	D;P	0.63793	0.918;0.754	T	0.59516	-0.7440	10	0.42905	T	0.14	-8.5436	11.7663	0.51933	0.0:0.0702:0.0:0.9298	.	663;743	E7EU62;Q9H694	.;BICC1_HUMAN	V	743;369	ENSP00000362993:L743V;ENSP00000263103:L369V	ENSP00000263103:L369V	L	+	1	2	BICC1	60236775	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.211000	0.32382	2.127000	0.65507	0.533000	0.62120	TTA	BICC1	-	NULL	ENSG00000122870		0.383	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	63	0	T	NM_025044		60566769	+1	tier1	-	no_errors	ENST00000373886	ensembl	human	known	74_37	missense	34.33	44	23	SNP	1.000	G
BNC2	54796	genome.wustl.edu	37	9	16435643	16435643	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:16435643A>C	ENST00000380672.4	-	6	2606	c.2549T>G	c.(2548-2550)cTt>cGt	p.L850R	BNC2_ENST00000545497.1_Missense_Mutation_p.L755R|BNC2_ENST00000380667.2_Missense_Mutation_p.L783R|BNC2_ENST00000380666.2_Missense_Mutation_p.L850R	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CCTGTAGTGAAGTTTCACACT	0.483																																																	0													70.0	67.0	68.0					9																	16435643		2203	4300	6503	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2549T>G	9.37:g.16435643A>C	ENSP00000370047:p.Leu850Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L850R	ENST00000380672.4	37	c.2549	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781316	0.70222	.	.	ENSG00000173068	ENST00000380672;ENST00000411752;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000380666;ENST00000540340	T;T;T;T;T;T	0.59906	1.67;0.23;0.23;1.67;1.67;1.67	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	N	0.16266	0.395	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.997;0.998;0.998;0.999;0.999;0.999	T	0.64491	-0.6395	10	0.38643	T	0.18	-12.3418	16.3766	0.83401	1.0:0.0:0.0:0.0	.	755;783;850;850;807;850;755;615	F5H586;B1APH0;Q6ZN30-2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;BNC2_HUMAN;.;.	R	850;243;807;783;755;850;850	ENSP00000370047:L850R;ENSP00000392212:L243R;ENSP00000408370:L807R;ENSP00000370042:L783R;ENSP00000444640:L755R;ENSP00000370041:L850R	ENSP00000370041:L850R	L	-	2	0	BNC2	16425643	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.263000	0.75096	0.533000	0.62120	CTT	BNC2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173068		0.483	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	-	0.00	63	0	A	NM_017637		16435643	-1	tier1	-	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	C
BOD1L1	259282	genome.wustl.edu	37	4	13602954	13602954	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:13602954C>A	ENST00000040738.5	-	10	5705	c.5570G>T	c.(5569-5571)aGc>aTc	p.S1857I		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1857						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGCGCCTGTGCTAGTCACAAT	0.473																																																	0													138.0	136.0	137.0					4																	13602954		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5570G>T	4.37:g.13602954C>A	ENSP00000040738:p.Ser1857Ile		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.S1857I	ENST00000040738.5	37	c.5570	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100488	0.76983	.	.	ENSG00000038219	ENST00000040738	T	0.17854	2.25	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000003	T	0.21962	0.0529	L	0.34521	1.04	0.45183	D	0.998194	D	0.54047	0.964	P	0.48425	0.577	T	0.01920	-1.1247	10	0.87932	D	0	-1.118	17.9523	0.89057	0.0:1.0:0.0:0.0	.	1857	Q8NFC6	BOD1L_HUMAN	I	1857	ENSP00000040738:S1857I	ENSP00000040738:S1857I	S	-	2	0	BOD1L	13212052	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.064000	0.64338	2.239000	0.73571	0.561000	0.74099	AGC	BOD1L1	-	NULL	ENSG00000038219		0.473	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1		0.00	29	0	C	NM_148894		13602954	-1			no_errors	ENST00000040738	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
BTBD1	53339	genome.wustl.edu	37	15	83687549	83687549	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:83687549A>T	ENST00000261721.4	-	7	1402	c.1200T>A	c.(1198-1200)tgT>tgA	p.C400*	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.V371E	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	400					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		CTGTCCCATCACAACTAAAGC	0.393																																																	0													174.0	143.0	154.0					15																	83687549		2203	4300	6503	SO:0001587	stop_gained	0			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.1200T>A	15.37:g.83687549A>T	ENSP00000261721:p.Cys400*		A6NMI8|Q9BX71|Q9NWN4	Nonsense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.C400*	ENST00000261721.4	37	c.1200	CCDS10322.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	36|36	5.744497|5.744497	0.96882|0.96882	.|.	.|.	ENSG00000064726|ENSG00000064726	ENST00000261721|ENST00000379403	.|T	.|0.76968	.|-1.06	5.23|5.23	0.226|0.226	0.15353|0.15353	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.68375	.|0.2994	.|.	.|.	.|.	0.27835|0.27835	N|N	0.94132|0.94132	.|P	.|0.46706	.|0.883	.|B	.|0.39419	.|0.299	.|T	.|0.61048	.|-0.7141	.|8	0.22109|0.87932	T|D	0.4|0	-16.3576|-16.3576	9.261|9.261	0.37612|0.37612	0.7227:0.0:0.2773:0.0|0.7227:0.0:0.2773:0.0	.|.	.|371	.|A6NMI8	.|.	X|E	400|371	.|ENSP00000368713:V371E	ENSP00000261721:C400X|ENSP00000368713:V371E	C|V	-|-	3|2	2|0	BTBD1|BTBD1	81478553|81478553	0.990000|0.990000	0.36364|0.36364	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	0.443000|0.443000	0.21644|0.21644	0.026000|0.026000	0.15269|0.15269	0.460000|0.460000	0.39030|0.39030	TGT|GTG	BTBD1	-	pfam_PHR	ENSG00000064726		0.393	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD1	HGNC	protein_coding	OTTHUMT00000304008.1		0.00	79	0	A			83687549	-1			no_errors	ENST00000261721	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	1.000	T
BZRAP1	9256	genome.wustl.edu	37	17	56393449	56393449	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:56393449A>C	ENST00000343736.4	-	16	2196	c.2033T>G	c.(2032-2034)cTt>cGt	p.L678R	BZRAP1_ENST00000355701.3_Missense_Mutation_p.L678R|BZRAP1_ENST00000268893.6_Missense_Mutation_p.L618R			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	678	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGTCAGCGGAAGCTCTGCTTC	0.517																																																	0													179.0	159.0	166.0					17																	56393449		2203	4300	6503	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2033T>G	17.37:g.56393449A>C	ENSP00000345824:p.Leu678Arg		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.L678R	ENST00000343736.4	37	c.2033	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	A	23.6	4.441518	0.83993	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.65549	-0.16;-0.16;-0.16	5.69	4.6	0.57074	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	D	0.86924	0.6050	H	0.99156	4.45	0.58432	D	0.999997	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.89788	0.3966	10	0.87932	D	0	.	11.1742	0.48590	0.9273:0.0:0.0726:0.0	.	678;618;678	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	R	678;678;618	ENSP00000347929:L678R;ENSP00000345824:L678R;ENSP00000268893:L618R	ENSP00000268893:L618R	L	-	2	0	BZRAP1	53748448	1.000000	0.71417	0.903000	0.35520	0.998000	0.95712	9.335000	0.96500	0.956000	0.37904	0.533000	0.62120	CTT	BZRAP1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000005379		0.517	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	-	0.00	44	0	A	NM_004758		56393449	-1	tier1	-	no_errors	ENST00000355701	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.996	C
C11orf85	283129	genome.wustl.edu	37	11	64707232	64707232	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:64707232C>T	ENST00000301896.5	-	10	627	c.554G>A	c.(553-555)aGt>aAt	p.S185N	C11orf85_ENST00000536065.1_Silent_p.E100E|C11orf85_ENST00000530444.1_Silent_p.E128E|C11orf85_ENST00000432175.1_Missense_Mutation_p.S185N	NM_001037225.1	NP_001032302.1	Q3KP22	CK085_HUMAN	chromosome 11 open reading frame 85	185										breast(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	7						TGTGTCCCCACTCAGAATCTG	0.537																																																	0													64.0	62.0	63.0					11																	64707232		2201	4297	6498	SO:0001583	missense	0			AK093130, BC033501	CCDS31603.1, CCDS73316.1	11q13.1	2012-08-10			ENSG00000168070	ENSG00000168070			27441	protein-coding gene	gene with protein product						14702039	Standard	XM_005273918		Approved		uc001ocb.1	Q3KP22		ENST00000301896.5:c.554G>A	11.37:g.64707232C>T	ENSP00000301896:p.Ser185Asn		B3KS99	Missense_Mutation	SNP	NULL	p.S185N	ENST00000301896.5	37	c.554	CCDS31603.1	11	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878104	0.33162	.	.	ENSG00000168070	ENST00000301896;ENST00000432175	.	.	.	3.61	1.74	0.24563	.	1.934640	0.02681	N	0.109682	T	0.37019	0.0988	L	0.44542	1.39	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.17198	-1.0377	9	0.37606	T	0.19	-13.0988	5.9172	0.19061	0.0:0.7731:0.0:0.2269	.	185	Q3KP22	CK085_HUMAN	N	185	.	ENSP00000301896:S185N	S	-	2	0	C11orf85	64463808	0.000000	0.05858	0.013000	0.15412	0.209000	0.24338	0.054000	0.14205	0.516000	0.28340	0.563000	0.77884	AGT	C11orf85	-	NULL	ENSG00000168070		0.537	C11orf85-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf85	HGNC	protein_coding	OTTHUMT00000385477.1	-	0.00	39	0	C	NM_001037225		64707232	-1	tier1	-	no_errors	ENST00000301896	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.020	T
C2CD2	25966	genome.wustl.edu	37	21	43327823	43327823	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:43327823C>T	ENST00000380486.3	-	9	1330	c.1089G>A	c.(1087-1089)acG>acA	p.T363T	C2CD2_ENST00000329623.7_Silent_p.T208T	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	363						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CGCTGGTCAGCGTGAAGCTCT	0.647																																																	0													26.0	30.0	29.0					21																	43327823		2203	4300	6503	SO:0001819	synonymous_variant	0			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.1089G>A	21.37:g.43327823C>T			Q5R2V7|Q6AHX8|Q9NSE6	Silent	SNP	pfam_C2_dom,superfamily_C2_dom	p.T363	ENST00000380486.3	37	c.1089	CCDS42933.1	21																																																																																			C2CD2	-	superfamily_C2_dom	ENSG00000157617		0.647	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	HGNC	protein_coding	OTTHUMT00000195228.2	-	0.00	81	0	C	NM_015500		43327823	-1	tier1	-	no_errors	ENST00000380486	ensembl	human	known	74_37	silent	11.11	40	5	SNP	0.000	T
C2CD3	26005	genome.wustl.edu	37	11	73844510	73844510	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:73844510G>T	ENST00000334126.7	-	6	1274	c.1048C>A	c.(1048-1050)Cat>Aat	p.H350N	C2CD3_ENST00000539061.1_Missense_Mutation_p.H350N|C2CD3_ENST00000313663.7_Missense_Mutation_p.H350N			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	350					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					ATAGGAGGATGAACTTGGTCC	0.393																																																	0													140.0	125.0	130.0					11																	73844510		2200	4293	6493	SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1048C>A	11.37:g.73844510G>T	ENSP00000334379:p.His350Asn		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.H350N	ENST00000334126.7	37	c.1048		11	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490668	0.26686	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000289350;ENST00000539061	T;T	0.09630	2.96;2.97	5.79	4.86	0.63082	.	0.511109	0.19865	N	0.104339	T	0.10465	0.0256	L	0.51422	1.61	0.24593	N	0.993816	P;B	0.36086	0.536;0.316	B;B	0.32211	0.099;0.142	T	0.18272	-1.0342	10	0.10636	T	0.68	-1.5179	14.651	0.68797	0.0:0.1452:0.8548:0.0	.	350;350	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	N	350	ENSP00000334379:H350N;ENSP00000323339:H350N	ENSP00000289350:H350N	H	-	1	0	C2CD3	73522158	1.000000	0.71417	1.000000	0.80357	0.412000	0.31113	3.103000	0.50298	1.393000	0.46605	0.655000	0.94253	CAT	C2CD3	-	NULL	ENSG00000168014		0.393	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding			0.00	69	0	G	NM_015531		73844510	-1			no_errors	ENST00000334126	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
C2CD2L	9854	genome.wustl.edu	37	11	118982311	118982311	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:118982311G>A	ENST00000528586.1	+	3	305	c.235G>A	c.(235-237)Gag>Aag	p.E79K	C2CD2L_ENST00000336702.3_Missense_Mutation_p.E331K			O14523	C2C2L_HUMAN	C2CD2-like	331						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						GGCTGGATCCGAGGTGGAGTG	0.572																																																	0													59.0	55.0	57.0					11																	118982311		2200	4295	6495	SO:0001583	missense	0			AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.235G>A	11.37:g.118982311G>A	ENSP00000433600:p.Glu79Lys		Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	superfamily_C2_dom	p.E331K	ENST00000528586.1	37	c.991		11	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700654	0.68501	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.39787	1.06;1.06	5.54	5.54	0.83059	C2 calcium/lipid-binding domain, CaLB (1);	0.535950	0.20847	N	0.084583	T	0.36991	0.0987	L	0.27053	0.805	0.34816	D	0.738224	D;D	0.65815	0.995;0.995	P;P	0.45449	0.481;0.481	T	0.48536	-0.9027	10	0.42905	T	0.14	-32.0913	16.6359	0.85059	0.0:0.0:1.0:0.0	.	331;331	O14523;O14523-2	C2C2L_HUMAN;.	K	331;79	ENSP00000338885:E331K;ENSP00000433600:E79K	ENSP00000338885:E331K	E	+	1	0	C2CD2L	118487521	0.994000	0.37717	0.955000	0.39395	0.712000	0.41017	2.538000	0.45710	2.606000	0.88127	0.655000	0.94253	GAG	C2CD2L	-	superfamily_C2_dom	ENSG00000172375		0.572	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	C2CD2L	HGNC	protein_coding	OTTHUMT00000388199.2		0.00	14	0	G	NM_014807		118982311	+1			no_errors	ENST00000336702	ensembl	human	known	74_37	missense	28.57	5	2	SNP	0.954	A
C3	718	genome.wustl.edu	37	19	6712611	6712611	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:6712611G>A	ENST00000245907.6	-	10	1119	c.1027C>T	c.(1027-1029)Cgc>Tgc	p.R343C		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	343					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ATCCCGCTGCGCTCTGCCTGC	0.577																																																	0													206.0	179.0	188.0					19																	6712611		2203	4300	6503	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1027C>T	19.37:g.6712611G>A	ENSP00000245907:p.Arg343Cys		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.R343C	ENST00000245907.6	37	c.1027	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652208	0.47362	.	.	ENSG00000125730	ENST00000245907	T	0.33654	1.4	5.13	-1.73	0.08081	.	1.455980	0.03434	N	0.208227	T	0.52256	0.1723	M	0.80847	2.515	0.09310	N	0.999992	D	0.76494	0.999	P	0.58266	0.836	T	0.44967	-0.9293	10	0.37606	T	0.19	.	4.2673	0.10769	0.2459:0.0:0.2074:0.5467	.	343	P01024	CO3_HUMAN	C	343	ENSP00000245907:R343C	ENSP00000245907:R343C	R	-	1	0	C3	6663611	0.000000	0.05858	0.024000	0.17045	0.662000	0.39071	-0.145000	0.10265	0.143000	0.18926	0.561000	0.74099	CGC	C3	-	NULL	ENSG00000125730		0.577	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	-	0.00	32	0	G	NM_000064		6712611	-1	tier1	-	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.003	A
C7orf26	79034	genome.wustl.edu	37	7	6639485	6639485	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:6639485G>A	ENST00000344417.5	+	4	873	c.606G>A	c.(604-606)ttG>ttA	p.L202L	C7orf26_ENST00000472693.1_3'UTR|C7orf26_ENST00000359073.5_Silent_p.L183L	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	202										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CTATGGACTTGCTTGAAATGA	0.478																																																	0													178.0	166.0	170.0					7																	6639485		2203	4300	6503	SO:0001819	synonymous_variant	0			BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.606G>A	7.37:g.6639485G>A			Q9BQ43	Silent	SNP	NULL	p.L202	ENST00000344417.5	37	c.606	CCDS5353.1	7																																																																																			C7orf26	-	NULL	ENSG00000146576		0.478	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf26	HGNC	protein_coding	OTTHUMT00000246844.2	-	0.00	68	0	G	NM_024067		6639485	+1	tier1	-	no_errors	ENST00000344417	ensembl	human	known	74_37	silent	5.61	101	6	SNP	1.000	A
C9orf85	138241	genome.wustl.edu	37	9	74586497	74586497	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:74586497T>C	ENST00000377031.3	+	3	476	c.286T>C	c.(286-288)Tgc>Cgc	p.C96R	C9orf85_ENST00000486911.2_Intron|C9orf85_ENST00000334731.2_Missense_Mutation_p.C96R			Q96MD7	CI085_HUMAN	chromosome 9 open reading frame 85	96										kidney(2)|large_intestine(1)|lung(4)	7						ACTTGAAGTTTGCGCAAAATG	0.303																																																	0													147.0	135.0	139.0					9																	74586497		2203	4300	6503	SO:0001583	missense	0			BC010179	CCDS6639.1	9q21.2	2012-03-16			ENSG00000155621	ENSG00000155621			28784	protein-coding gene	gene with protein product						12477932	Standard	NM_182505		Approved	MGC61599	uc004ain.3	Q96MD7	OTTHUMG00000020002	ENST00000377031.3:c.286T>C	9.37:g.74586497T>C	ENSP00000366230:p.Cys96Arg		Q5W0N1|Q5W0N3|Q6PJW9|Q86U95	Missense_Mutation	SNP	pfam_DUF2039	p.C96R	ENST00000377031.3	37	c.286		9	.	.	.	.	.	.	.	.	.	.	T	19.53	3.845893	0.71603	.	.	ENSG00000155621	ENST00000334731;ENST00000377031	T	0.15952	2.38	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.49355	0.1552	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60255	-0.7299	10	0.87932	D	0	-11.8948	14.072	0.64865	0.0:0.0:0.0:1.0	.	96	Q96MD7-1	.	R	96	ENSP00000366230:C96R	ENSP00000334289:C96R	C	+	1	0	C9orf85	73776317	1.000000	0.71417	0.999000	0.59377	0.751000	0.42716	7.064000	0.76721	1.970000	0.57323	0.482000	0.46254	TGC	C9orf85	-	pfam_DUF2039	ENSG00000155621		0.303	C9orf85-003	KNOWN	basic	protein_coding	C9orf85	HGNC	protein_coding	OTTHUMT00000052628.2	-	0.00	92	0	T	NM_182505		74586497	+1	tier1	-	no_errors	ENST00000377031	ensembl	human	known	74_37	missense	17.50	99	21	SNP	1.000	C
CA10	56934	genome.wustl.edu	37	17	50212244	50212244	+	Intron	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:50212244T>C	ENST00000285273.4	-	2	1173				CA10_ENST00000340813.6_Missense_Mutation_p.E25G|CA10_ENST00000451037.2_Intron|CA10_ENST00000570565.1_Intron|CA10_ENST00000442502.2_Intron	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	ctcaccattctccctcacccc	0.567																																																	0													117.0	101.0	106.0					17																	50212244		876	1991	2867	SO:0001627	intron_variant	0			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.61+22841A>G	17.37:g.50212244T>C			B2R7J0|B4DGL6	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.E25G	ENST00000285273.4	37	c.74	CCDS32684.1	17	.	.	.	.	.	.	.	.	.	.	T	9.940	1.217238	0.22373	.	.	ENSG00000154975	ENST00000340813	T	0.70164	-0.46	3.11	1.98	0.26296	.	7.625830	0.00357	N	0.000021	T	0.48978	0.1530	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.28808	-1.0032	8	.	.	.	.	3.3991	0.07316	0.0:0.2886:0.0:0.7114	.	25	Q68D28	.	G	25	ENSP00000340363:E25G	.	E	-	2	0	CA10	47567243	0.000000	0.05858	0.001000	0.08648	0.091000	0.18340	-0.078000	0.11375	0.581000	0.29539	0.460000	0.39030	GAG	CA10	-	NULL	ENSG00000154975		0.567	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	HGNC	protein_coding	OTTHUMT00000437480.1	-	0.00	60	0	T	NM_020178		50212244	-1	tier1	-	no_errors	ENST00000340813	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.001	C
CA4	762	genome.wustl.edu	37	17	58236636	58236636	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:58236636G>T	ENST00000300900.4	+	8	889	c.790G>T	c.(790-792)Gtg>Ttg	p.V264L		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	264					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	GGAACAGACAGTGAGCATGAA	0.652																																																	0													35.0	23.0	27.0					17																	58236636		2203	4300	6503	SO:0001583	missense	0			L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.790G>T	17.37:g.58236636G>T	ENSP00000300900:p.Val264Leu		B4DQA4|Q6FHI7	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.V264L	ENST00000300900.4	37	c.790	CCDS11624.1	17	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.518525	0.00967	.	.	ENSG00000167434	ENST00000300900	T	0.67865	-0.29	3.3	-2.85	0.05734	Carbonic anhydrase, alpha-class, catalytic domain (4);	1.196780	0.06060	N	0.658164	T	0.32285	0.0824	N	0.02708	-0.52	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22208	-1.0223	10	0.07030	T	0.85	.	3.6236	0.08105	0.1598:0.2584:0.4741:0.1077	.	264	P22748	CAH4_HUMAN	L	264	ENSP00000300900:V264L	ENSP00000300900:V264L	V	+	1	0	CA4	55591418	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.709000	0.00819	-0.510000	0.06523	-1.183000	0.01708	GTG	CA4	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000167434		0.652	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA4	HGNC	protein_coding	OTTHUMT00000449189.1	-	0.00	95	0	G	NM_000717		58236636	+1	tier1	-	no_errors	ENST00000300900	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.000	T
CA6	765	genome.wustl.edu	37	1	9027846	9027846	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:9027846G>A	ENST00000377443.2	+	6	704	c.700G>A	c.(700-702)Gca>Aca	p.A234T	CA6_ENST00000476083.1_3'UTR|CA6_ENST00000377436.3_Missense_Mutation_p.A234T|CA6_ENST00000377442.2_Missense_Mutation_p.A174T	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	234					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.A234T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	GTTTGTGCTGGCAGATTTTGT	0.527																																																	1	Substitution - Missense(1)	endometrium(1)											158.0	121.0	134.0					1																	9027846		2203	4300	6503	SO:0001583	missense	0			M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.700G>A	1.37:g.9027846G>A	ENSP00000366662:p.Ala234Thr		E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.A234T	ENST00000377443.2	37	c.700	CCDS30578.1	1	.	.	.	.	.	.	.	.	.	.	G	9.292	1.050776	0.19827	.	.	ENSG00000131686	ENST00000377443;ENST00000377436;ENST00000377442	T;T;T	0.67698	-0.28;-0.28;-0.28	5.01	0.879	0.19155	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.651311	0.14760	N	0.300067	T	0.44540	0.1298	N	0.21142	0.635	0.09310	N	1	P;P	0.50528	0.936;0.936	B;B	0.42771	0.301;0.397	T	0.31392	-0.9945	10	0.27082	T	0.32	.	1.7683	0.03007	0.1911:0.2045:0.4591:0.1452	.	174;234	E7EMQ1;P23280	.;CAH6_HUMAN	T	234;234;174	ENSP00000366662:A234T;ENSP00000366654:A234T;ENSP00000366661:A174T	ENSP00000366654:A234T	A	+	1	0	CA6	8950433	0.003000	0.15002	0.000000	0.03702	0.091000	0.18340	1.044000	0.30329	-0.034000	0.13713	0.561000	0.74099	GCA	CA6	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000131686		0.527	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CA6	HGNC	protein_coding	OTTHUMT00000004911.1		0.00	44	0	G			9027846	+1			no_errors	ENST00000377443	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.000	A
CACNA2D3	55799	genome.wustl.edu	37	3	54930780	54930780	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:54930780T>G	ENST00000474759.1	+	26	2299	c.2251T>G	c.(2251-2253)Ttc>Gtc	p.F751V	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.F657V|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.F751V|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.F751V|CACNA2D3-AS1_ENST00000471265.1_RNA	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	751						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TTCAAGGGACTTCCTGAAAGC	0.507																																																	0													127.0	129.0	128.0					3																	54930780		1987	4157	6144	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2251T>G	3.37:g.54930780T>G	ENSP00000419101:p.Phe751Val		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.F751V	ENST00000474759.1	37	c.2251	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	T	18.28	3.589945	0.66105	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	5.69	4.51	0.55191	.	0.168435	0.53938	D	0.000043	T	0.18045	0.0433	M	0.68317	2.08	0.46416	D	0.999039	D	0.58268	0.982	P	0.56127	0.792	T	0.07009	-1.0795	10	0.17369	T	0.5	.	11.6328	0.51185	0.0:0.0:0.1487:0.8512	.	751	Q8IZS8	CA2D3_HUMAN	V	751;751;751;657;657	ENSP00000389506:F751V;ENSP00000419101:F751V;ENSP00000288197:F751V;ENSP00000417279:F657V	ENSP00000288197:F751V	F	+	1	0	CACNA2D3	54905820	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	5.654000	0.67974	1.065000	0.40693	0.533000	0.62120	TTC	CACNA2D3	-	NULL	ENSG00000157445		0.507	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	62	0	T			54930780	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	20.97	49	13	SNP	1.000	G
CAMKK2	10645	genome.wustl.edu	37	12	121706470	121706470	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:121706470T>G	ENST00000324774.5	-	5	1424	c.596A>C	c.(595-597)aAg>aCg	p.K199T	CAMKK2_ENST00000412367.2_Missense_Mutation_p.K199T|CAMKK2_ENST00000404169.3_Missense_Mutation_p.K199T|CAMKK2_ENST00000392473.2_Missense_Mutation_p.K199T|CAMKK2_ENST00000535524.1_Intron|CAMKK2_ENST00000347034.2_Missense_Mutation_p.K199T|CAMKK2_ENST00000402834.4_Missense_Mutation_p.K199T|CAMKK2_ENST00000446440.2_Missense_Mutation_p.K199T|CAMKK2_ENST00000392474.2_Missense_Mutation_p.K199T|CAMKK2_ENST00000538733.1_Missense_Mutation_p.K199T|CAMKK2_ENST00000337174.3_Missense_Mutation_p.K199T	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GATCAGCTTCTTTTTGGACAG	0.562																																																	0													136.0	131.0	133.0					12																	121706470		2203	4300	6503	SO:0001583	missense	0			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.596A>C	12.37:g.121706470T>G	ENSP00000312741:p.Lys199Thr		A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K199T	ENST00000324774.5	37	c.596	CCDS9216.1	12	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775597	0.70107	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	4.99	4.99	0.66335	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053435	0.64402	D	0.000001	T	0.71333	0.3327	L	0.28274	0.84	0.53005	D	0.999969	B;D;D;B;D;D;D	0.76494	0.371;0.991;0.997;0.109;0.999;0.998;0.996	B;P;D;B;D;D;D	0.74023	0.295;0.907;0.962;0.099;0.979;0.982;0.944	T	0.75227	-0.3392	10	0.72032	D	0.01	0.0532	13.897	0.63778	0.0:0.0:0.0:1.0	.	199;199;199;199;199;199;199	Q96RR4-6;Q96RR4-2;Q96RR4-7;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;KKCC2_HUMAN;.	T	199;199;199;199;199;199;199;182;199;199	ENSP00000376266:K199T;ENSP00000321230:K199T;ENSP00000445944:K199T;ENSP00000336634:K199T;ENSP00000312741:K199T;ENSP00000388368:K199T;ENSP00000384600:K199T;ENSP00000388273:K199T;ENSP00000376265:K199T	ENSP00000312741:K199T	K	-	2	0	CAMKK2	120190853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.435000	0.59941	2.040000	0.60383	0.456000	0.33151	AAG	CAMKK2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000110931		0.562	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	HGNC	protein_coding	OTTHUMT00000402563.1	-	0.00	72	0	T	NM_172226		121706470	-1	tier1	-	no_errors	ENST00000324774	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	G
CAMTA1	23261	genome.wustl.edu	37	1	7811262	7811262	+	Missense_Mutation	SNP	G	G	A	rs372219946		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:7811262G>A	ENST00000303635.7	+	20	4900	c.4693G>A	c.(4693-4695)Gca>Aca	p.A1565T	CAMTA1_ENST00000439411.2_Missense_Mutation_p.A1551T|CAMTA1_ENST00000476864.1_Missense_Mutation_p.A129T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1565	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCTGCAGTACGCACTTTATAA	0.488			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0								G	THR/ALA	0,4406		0,0,2203	192.0	206.0	201.0		4693	5.7	1.0	1		201	1,8599	1.2+/-3.3	0,1,4299	no	missense	CAMTA1	NM_015215.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1565/1674	7811262	1,13005	2203	4300	6503	SO:0001583	missense	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.4693G>A	1.37:g.7811262G>A	ENSP00000306522:p.Ala1565Thr		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A1565T	ENST00000303635.7	37	c.4693	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.579315	0.96565	0.0	1.16E-4	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646;ENST00000476864	T;T;T	0.71817	-0.6;-0.6;-0.6	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.82231	0.4992	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.999;0.999	T	0.81236	-0.1024	10	0.48119	T	0.1	-9.2898	19.7272	0.96168	0.0:0.0:1.0:0.0	.	608;528;1565	B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;CMTA1_HUMAN	T	1565;1551;608;528;129	ENSP00000306522:A1565T;ENSP00000402561:A1551T;ENSP00000452319:A129T	ENSP00000306522:A1565T	A	+	1	0	CAMTA1	7733849	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.646000	0.89796	0.655000	0.94253	GCA	CAMTA1	-	superfamily_P-loop_NTPase	ENSG00000171735		0.488	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	-	0.00	43	0	G	NM_015215		7811262	+1	tier1	-	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	A
CFAP58	159686	genome.wustl.edu	37	10	106209896	106209896	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:106209896T>C	ENST00000369704.3	+	17	2578	c.2444T>C	c.(2443-2445)cTt>cCt	p.L815P		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		815						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GTAGAGAAACTTACCAATGAG	0.323																																																	0													77.0	81.0	80.0					10																	106209896		2203	4300	6503	SO:0001583	missense	0																														ENST00000369704.3:c.2444T>C	10.37:g.106209896T>C	ENSP00000358718:p.Leu815Pro		D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.L815P	ENST00000369704.3	37	c.2444	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	T	19.13	3.768587	0.69878	.	.	ENSG00000120051	ENST00000369704	T	0.52754	0.65	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.74741	0.3756	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80027	-0.1554	10	0.59425	D	0.04	-7.5288	16.0745	0.80960	0.0:0.0:0.0:1.0	.	815	Q5T655	CC147_HUMAN	P	815	ENSP00000358718:L815P	ENSP00000358718:L815P	L	+	2	0	CCDC147	106199886	1.000000	0.71417	0.946000	0.38457	0.658000	0.38924	6.719000	0.74718	2.201000	0.70794	0.528000	0.53228	CTT	CCDC147	-	NULL	ENSG00000120051		0.323	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	-	0.00	44	0	T			106209896	+1	tier1	-	no_errors	ENST00000369704	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	C
CCDC57	284001	genome.wustl.edu	37	17	80141648	80141648	+	Splice_Site	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:80141648A>T	ENST00000389641.4	-	8	1248		c.e8+1		CCDC57_ENST00000392343.3_Splice_Site|CCDC57_ENST00000392347.1_Splice_Site|CCDC57_ENST00000327026.3_Splice_Site			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GGGGACAGTTACCTTTCAATG	0.517																																																	0													65.0	63.0	64.0					17																	80141648		1984	4137	6121	SO:0001630	splice_region_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.1211+1T>A	17.37:g.80141648A>T			A6NP51|A8MQC7|Q8IWG2|Q8TER3	Splice_Site	SNP	-	e7+2	ENST00000389641.4	37	c.1211+2		17	.	.	.	.	.	.	.	.	.	.	A	28.0	4.879657	0.91740	.	.	ENSG00000176155	ENST00000389641;ENST00000392347;ENST00000392343	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9186	0.47150	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC57	77734937	1.000000	0.71417	0.622000	0.29159	0.969000	0.65631	5.432000	0.66514	1.883000	0.54544	0.377000	0.23210	.	CCDC57	-	-	ENSG00000176155		0.517	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	-	0.00	64	0	A	NM_198082	Intron	80141648	-1	tier1	-	no_errors	ENST00000389641	ensembl	human	known	74_37	splice_site	10.20	44	5	SNP	0.945	T
CCDC85A	114800	genome.wustl.edu	37	2	56420200	56420200	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:56420200A>G	ENST00000407595.2	+	2	1367	c.865A>G	c.(865-867)Agc>Ggc	p.S289G	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	289	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GTGCAAGGGCAGCCCCGAACA	0.632																																																	0													60.0	76.0	71.0					2																	56420200		2054	4193	6247	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.865A>G	2.37:g.56420200A>G	ENSP00000384040:p.Ser289Gly			Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.S289G	ENST00000407595.2	37	c.865	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	A	11.61	1.690598	0.29962	.	.	ENSG00000055813	ENST00000407595	T	0.46451	0.87	5.35	4.21	0.49690	.	0.132116	0.64402	D	0.000002	T	0.27278	0.0669	L	0.28400	0.85	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.07908	-1.0748	10	0.20519	T	0.43	-32.1278	8.5259	0.33304	0.8196:0.0:0.1804:0.0	.	289	Q96PX6	CC85A_HUMAN	G	289	ENSP00000384040:S289G	ENSP00000384040:S289G	S	+	1	0	CCDC85A	56273704	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.504000	0.53347	2.028000	0.59812	0.482000	0.46254	AGC	CCDC85A	-	NULL	ENSG00000055813		0.632	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	-	0.00	77	0	A			56420200	+1	tier1	-	no_errors	ENST00000407595	ensembl	human	known	74_37	missense	19.05	51	12	SNP	1.000	G
CCM2	83605	genome.wustl.edu	37	7	45067378	45067378	+	Intron	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:45067378G>T	ENST00000258781.6	+	2	179				CCM2_ENST00000544363.1_Intron|CCM2_ENST00000541586.1_Intron|CCM2_ENST00000381112.3_Silent_p.G25G|CCM2_ENST00000474617.1_5'UTR|CCM2_ENST00000475551.1_5'UTR|CCM2_ENST00000461377.1_Intron	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2						blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						TTCACACAGGGTATTCCATGG	0.458																																																	0													67.0	70.0	69.0					7																	45067378		2203	4300	6503	SO:0001627	intron_variant	0			BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.31-10474G>T	7.37:g.45067378G>T			A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Silent	SNP	pfscan_PTB/PI_dom	p.G25	ENST00000258781.6	37	c.75	CCDS5500.1	7																																																																																			CCM2	-	NULL	ENSG00000136280		0.458	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCM2	HGNC	protein_coding	OTTHUMT00000251348.1	-	0.00	32	0	G	NM_031443		45067378	+1	tier1	-	no_errors	ENST00000381112	ensembl	human	known	74_37	silent	7.55	49	4	SNP	0.000	T
CCND3	896	genome.wustl.edu	37	6	41908691	41908691	+	Intron	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:41908691C>G	ENST00000372991.4	-	2	397				CCND3_ENST00000511642.1_Intron|CCND3_ENST00000372988.4_Intron|CCND3_ENST00000414200.2_Intron|CCND3_ENST00000372987.4_Splice_Site_p.R16P|CCND3_ENST00000511686.1_Intron|CCND3_ENST00000510503.1_Intron|CCND3_ENST00000415497.2_Intron	NM_001760.3	NP_001751.1	P30281	CCND3_HUMAN	cyclin D3						cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(13)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	20	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCACACACCCGAGGGGAAGG	0.682			T	IGH@	MM																																			Dom	yes		6	6p21	896	cyclin D3		L	0													88.0	94.0	92.0					6																	41908691		876	1991	2867	SO:0001627	intron_variant	0				CCDS4863.1, CCDS47425.1, CCDS47426.1, CCDS47427.1, CCDS75452.1	6p21	2008-08-26			ENSG00000112576	ENSG00000112576			1585	protein-coding gene	gene with protein product		123834				1386335	Standard	NM_001136125		Approved		uc003orn.3	P30281	OTTHUMG00000014690	ENST00000372991.4:c.199-368G>C	6.37:g.41908691C>G			B2RD63|B3KQ22|E9PAS4|E9PB36|Q5T8J0|Q6FG62|Q96F49	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like	p.R16P	ENST00000372991.4	37	c.47	CCDS4863.1	6	.	.	.	.	.	.	.	.	.	.	c	18.98	3.737324	0.69304	.	.	ENSG00000112576	ENST00000372987;ENST00000514588	T;T	0.12039	2.72;2.72	3.64	2.73	0.32206	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.80722	D	1	P	0.50710	0.938	D	0.65140	0.932	T	0.01242	-1.1408	8	0.87932	D	0	.	8.0045	0.30317	0.2428:0.7572:0.0:0.0	.	16	Q5T8J1	.	P	16	ENSP00000362078:R16P;ENSP00000420991:R16P	ENSP00000362078:R16P	R	-	2	0	CCND3	42016669	0.998000	0.40836	0.989000	0.46669	0.929000	0.56500	1.546000	0.36179	0.688000	0.31529	0.561000	0.74099	CGG	CCND3	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000112576		0.682	CCND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND3	HGNC	protein_coding	OTTHUMT00000040540.2	-	0.00	41	0	C	NM_001760		41908691	-1	tier1	-	no_errors	ENST00000372987	ensembl	human	putative	74_37	missense	19.23	21	5	SNP	0.962	G
CCSER1	401145	genome.wustl.edu	37	4	91234154	91234154	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:91234154A>G	ENST00000509176.1	+	3	1753	c.1465A>G	c.(1465-1467)Aga>Gga	p.R489G	CCSER1_ENST00000432775.2_Missense_Mutation_p.R489G|CCSER1_ENST00000333691.8_Missense_Mutation_p.R489G	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	489																	TAATAGTTTAAGAAAGCAAAG	0.368																																																	0													35.0	36.0	36.0					4																	91234154		1835	4078	5913	SO:0001583	missense	0				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1465A>G	4.37:g.91234154A>G	ENSP00000425040:p.Arg489Gly		Q4W5M0|Q86V57	Missense_Mutation	SNP	NULL	p.R489G	ENST00000509176.1	37	c.1465	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	A	15.24	2.774291	0.49786	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.50548	1.27;0.74;1.27	4.55	0.133	0.14766	.	0.067754	0.56097	D	0.000026	T	0.55847	0.1946	L	0.43152	1.355	0.27951	N	0.93714	D;D;D	0.64830	0.988;0.994;0.982	P;D;P	0.65773	0.853;0.938;0.873	T	0.57100	-0.7869	10	0.66056	D	0.02	-21.2045	13.8956	0.63770	0.5186:0.4814:0.0:0.0	.	489;489;489	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	G	489	ENSP00000425040:R489G;ENSP00000389283:R489G;ENSP00000329482:R489G	ENSP00000329482:R489G	R	+	1	2	FAM190A	91453177	0.468000	0.25839	0.916000	0.36221	0.760000	0.43138	0.535000	0.23114	0.279000	0.22186	0.482000	0.46254	AGA	CCSER1	-	NULL	ENSG00000184305		0.368	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	HGNC	protein_coding	OTTHUMT00000363109.3	-	0.00	64	0	A	NM_001145065		91234154	+1	tier1	-	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	34.88	28	15	SNP	0.987	G
CD163L1	283316	genome.wustl.edu	37	12	7528130	7528130	+	Missense_Mutation	SNP	G	G	T	rs183250040		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:7528130G>T	ENST00000313599.3	-	11	2805	c.2748C>A	c.(2746-2748)aaC>aaA	p.N916K	CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000416109.2_Missense_Mutation_p.N926K|CD163L1_ENST00000396630.1_Missense_Mutation_p.N916K			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	916	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.N916N(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						GTCCAAGCACGTTGATCTCCA	0.527																																																	1	Substitution - coding silent(1)	urinary_tract(1)											70.0	61.0	64.0					12																	7528130		2203	4300	6503	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2748C>A	12.37:g.7528130G>T	ENSP00000315945:p.Asn916Lys		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.N916K	ENST00000313599.3	37	c.2748	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.918866	0.00498	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.26957	1.7;1.7;1.7	2.66	-3.39	0.04868	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.711930	0.11795	N	0.528708	T	0.08802	0.0218	N	0.11560	0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24693	-1.0153	10	0.27785	T	0.31	.	0.1789	0.00121	0.3416:0.2427:0.1718:0.2439	.	926;916	E7EVK4;Q9NR16	.;C163B_HUMAN	K	916;926;916	ENSP00000315945:N916K;ENSP00000393474:N926K;ENSP00000379871:N916K	ENSP00000315945:N916K	N	-	3	2	CD163L1	7419397	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-3.968000	0.00323	-0.911000	0.03843	-0.397000	0.06425	AAC	CD163L1	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177675		0.527	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1		0.00	62	0	G	NM_174941		7528130	-1			no_errors	ENST00000313599	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.000	T
CDH11	1009	genome.wustl.edu	37	16	65026864	65026864	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:65026864G>A	ENST00000268603.4	-	5	1212	c.597C>T	c.(595-597)taC>taT	p.Y199Y	CDH11_ENST00000566827.1_Silent_p.Y73Y|CDH11_ENST00000394156.3_Silent_p.Y199Y	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	199	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGAGGATACTGTACACTAACT	0.428			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													179.0	143.0	155.0					16																	65026864		2203	4300	6503	SO:0001819	synonymous_variant	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.597C>T	16.37:g.65026864G>A			A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y199	ENST00000268603.4	37	c.597	CCDS10803.1	16																																																																																			CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140937		0.428	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	67	0	G	NM_033664		65026864	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.999	A
CDH7	1005	genome.wustl.edu	37	18	63526247	63526247	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:63526247G>A	ENST00000397968.2	+	9	1885	c.1459G>A	c.(1459-1461)Gag>Aag	p.E487K	CDH7_ENST00000323011.3_Missense_Mutation_p.E487K|CDH7_ENST00000536984.2_Missense_Mutation_p.E487K	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	487	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CATGGACTATGAGACCACCGT	0.428																																																	0													82.0	79.0	80.0					18																	63526247		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1459G>A	18.37:g.63526247G>A	ENSP00000381058:p.Glu487Lys		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E487K	ENST00000397968.2	37	c.1459	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.549950	0.96501	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.52295	0.67;0.67;0.67	5.32	5.32	0.75619	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.74703	0.3751	M	0.90650	3.135	0.80722	D	1	D;P	0.67145	0.996;0.925	D;P	0.65874	0.939;0.572	T	0.80466	-0.1370	10	0.87932	D	0	.	19.347	0.94367	0.0:0.0:1.0:0.0	.	487;487	F5H5X9;Q9ULB5	.;CADH7_HUMAN	K	487	ENSP00000319166:E487K;ENSP00000443030:E487K;ENSP00000381058:E487K	ENSP00000319166:E487K	E	+	1	0	CDH7	61677227	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.666000	0.98612	2.648000	0.89879	0.467000	0.42956	GAG	CDH7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000081138		0.428	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2		0.00	32	0	G	NM_033646		63526247	+1			no_errors	ENST00000323011	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
CFHR5	81494	genome.wustl.edu	37	1	196965228	196965228	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:196965228T>C	ENST00000256785.4	+	6	976	c.867T>C	c.(865-867)caT>caC	p.H289H	CFHR5_ENST00000367414.5_Silent_p.H313H			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	289	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						CCTATCAACATGGAGTTTCAG	0.378																																																	0													146.0	139.0	141.0					1																	196965228		2203	4300	6503	SO:0001819	synonymous_variant	0			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.867T>C	1.37:g.196965228T>C			Q2NKK2	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.H313	ENST00000256785.4	37	c.939	CCDS1387.1	1																																																																																			CFHR5	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000134389		0.378	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	HGNC	protein_coding	OTTHUMT00000088814.2	-	0.00	51	0	T	NM_030787		196965228	+1	tier1	-	no_errors	ENST00000367414	ensembl	human	known	74_37	silent	40.00	30	20	SNP	0.959	C
CHAC1	79094	genome.wustl.edu	37	15	41247939	41247939	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:41247939C>G	ENST00000446533.3	+	3	1071	c.762C>G	c.(760-762)ttC>ttG	p.F254L	CHAC1_ENST00000444189.2_Missense_Mutation_p.F209L|CHAC1_ENST00000487220.1_Missense_Mutation_p.F27L	NM_001142776.1|NM_024111.3	NP_001136248.1|NP_077016.2	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator homolog 1 (E. coli)	254					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein processing (GO:0010955)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|trans-Golgi network (GO:0005802)	Notch binding (GO:0005112)			endometrium(1)|large_intestine(1)|skin(1)	3		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		TGCCCTGCTTCTGCCCCACCG	0.657																																																	0													28.0	26.0	27.0					15																	41247939		2202	4300	6502	SO:0001583	missense	0			BC019625	CCDS10070.2, CCDS45233.1	15q15.1	2013-09-12	2006-09-12		ENSG00000128965	ENSG00000128965			28680	protein-coding gene	gene with protein product	"""gamma-GCT acting on glutathione homolog 1"""	614587	"""ChaC, cation transport regulator-like 1 (E. coli)"""			23070364	Standard	NM_024111		Approved	MGC4504	uc001znh.2	Q9BUX1	OTTHUMG00000130208	ENST00000446533.3:c.762C>G	15.37:g.41247939C>G	ENSP00000398105:p.Phe254Leu		Q0VIA0	Missense_Mutation	SNP	pfam_ChaC	p.F254L	ENST00000446533.3	37	c.762	CCDS10070.2	15	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723836	0.30593	.	.	ENSG00000128965	ENST00000446533;ENST00000444189	T	0.41065	1.01	5.66	3.77	0.43336	.	0.321128	0.34580	N	0.003859	T	0.18383	0.0441	N	0.14661	0.345	0.24090	N	0.995913	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.20240	-1.0281	10	0.09338	T	0.73	-9.4761	2.4946	0.04618	0.1362:0.4902:0.2093:0.1643	.	209;254	Q9BUX1-2;Q9BUX1	.;CHAC1_HUMAN	L	254;209	ENSP00000398105:F254L	ENSP00000395466:F209L	F	+	3	2	CHAC1	39035231	0.885000	0.30320	1.000000	0.80357	0.879000	0.50718	-0.064000	0.11636	0.724000	0.32296	0.462000	0.41574	TTC	CHAC1	-	NULL	ENSG00000128965		0.657	CHAC1-001	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	CHAC1	HGNC	protein_coding	OTTHUMT00000252526.3	-	0.00	26	0	C	NM_024111		41247939	+1	tier1	-	no_errors	ENST00000446533	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.997	G
CHD7	55636	genome.wustl.edu	37	8	61655225	61655225	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:61655225C>T	ENST00000423902.2	+	2	1713	c.1234C>T	c.(1234-1236)Caa>Taa	p.Q412*	CHD7_ENST00000524602.1_Nonsense_Mutation_p.Q412*|CHD7_ENST00000525508.1_Nonsense_Mutation_p.Q412*	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	412	Pro-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TCCTCCTCCACAAGTCAGGCC	0.532																																																	0													116.0	116.0	116.0					8																	61655225		2043	4187	6230	SO:0001587	stop_gained	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.1234C>T	8.37:g.61655225C>T	ENSP00000392028:p.Gln412*		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q412*	ENST00000423902.2	37	c.1234	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	42	9.623058	0.99221	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	.	.	.	5.54	5.54	0.83059	.	0.000000	0.39834	N	0.001247	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6451	19.486	0.95028	0.0:1.0:0.0:0.0	.	.	.	.	X	412	.	ENSP00000307304:Q412X	Q	+	1	0	CHD7	61817779	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	6.553000	0.73918	2.628000	0.89032	0.563000	0.77884	CAA	CHD7	-	NULL	ENSG00000171316		0.532	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2		0.00	52	0	C	XM_098762		61655225	+1			no_errors	ENST00000423902	ensembl	human	known	74_37	nonsense	6.38	44	3	SNP	1.000	T
CHRM2	1129	genome.wustl.edu	37	7	136700565	136700565	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:136700565A>G	ENST00000445907.2	+	3	1481	c.953A>G	c.(952-954)gAg>gGg	p.E318G	hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.E318G|CHRM2_ENST00000401861.1_Missense_Mutation_p.E318G|CHRM2_ENST00000453373.1_Missense_Mutation_p.E318G|CHRM2_ENST00000402486.3_Missense_Mutation_p.E318G|CHRM2_ENST00000320658.5_Missense_Mutation_p.E318G|hsa-mir-490_ENST00000597642.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	318					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TCCAAAGATGAGAACTCTAAG	0.468																																																	0													97.0	99.0	98.0					7																	136700565		2203	4300	6503	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.953A>G	7.37:g.136700565A>G	ENSP00000399745:p.Glu318Gly		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.E318G	ENST00000445907.2	37	c.953	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	A	6.986	0.551949	0.13374	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.180851	0.37012	N	0.002300	T	0.35828	0.0945	N	0.04508	-0.205	0.36960	D	0.893275	B	0.02656	0.0	B	0.09377	0.004	T	0.33033	-0.9884	10	0.23302	T	0.38	-5.9838	15.427	0.75061	1.0:0.0:0.0:0.0	.	318	P08172	ACM2_HUMAN	G	318	ENSP00000399745:E318G;ENSP00000415386:E318G;ENSP00000319984:E318G;ENSP00000380733:E318G;ENSP00000384937:E318G;ENSP00000384401:E318G	ENSP00000319984:E318G	E	+	2	0	CHRM2	136351105	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.169000	0.58223	2.055000	0.61198	0.533000	0.62120	GAG	CHRM2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt	ENSG00000181072		0.468	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	-	0.00	43	0	A			136700565	+1	tier1	-	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	31.82	30	14	SNP	1.000	G
CHRNG	1146	genome.wustl.edu	37	2	233410318	233410318	+	Silent	SNP	G	G	A	rs375174291	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:233410318G>A	ENST00000389494.3	+	12	1467	c.1446G>A	c.(1444-1446)tcG>tcA	p.S482S	CHRNG_ENST00000389492.3_Silent_p.S430S	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	482					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	CCATGCTCTCGCTCTTCATCT	0.642													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18476	0.0		0.0	False		,,,				2504	0.001																0								G		0,4406		0,0,2203	126.0	97.0	107.0		1446	-9.1	0.1	2		107	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CHRNG	NM_005199.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		482/518	233410318	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.1446G>A	2.37:g.233410318G>A			B3KWM8|Q14DU4|Q53RG2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.S482	ENST00000389494.3	37	c.1446	CCDS33400.1	2																																																																																			CHRNG	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000196811		0.642	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNG	HGNC	protein_coding	OTTHUMT00000330743.1	-	0.00	32	0	G	NM_005199		233410318	+1	tier1	-	no_errors	ENST00000389494	ensembl	human	known	74_37	silent	13.89	31	5	SNP	0.000	A
CHSY3	337876	genome.wustl.edu	37	5	129520837	129520837	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:129520837A>G	ENST00000305031.4	+	3	2360	c.2002A>G	c.(2002-2004)Agc>Ggc	p.S668G		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	668					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CCAAGACTCCAGCAAGCATAT	0.428																																																	0													66.0	65.0	65.0					5																	129520837		2203	4300	6503	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2002A>G	5.37:g.129520837A>G	ENSP00000302629:p.Ser668Gly		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.S668G	ENST00000305031.4	37	c.2002	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	A	1.025	-0.683699	0.03353	.	.	ENSG00000198108	ENST00000305031	T	0.15603	2.41	4.12	0.448	0.16614	.	1.059530	0.07314	N	0.876439	T	0.10465	0.0256	N	0.16903	0.455	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40961	-0.9535	9	.	.	.	-0.6488	8.6462	0.34007	0.7761:0.0:0.2239:0.0	.	668	Q70JA7	CHSS3_HUMAN	G	668	ENSP00000302629:S668G	.	S	+	1	0	CHSY3	129548736	0.010000	0.17322	0.008000	0.14137	0.765000	0.43378	2.205000	0.42770	0.068000	0.16574	0.528000	0.53228	AGC	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.428	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	-	0.00	48	0	A	NM_175856		129520837	+1	tier1	-	no_errors	ENST00000305031	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.049	G
CLCC1	23155	genome.wustl.edu	37	1	109486176	109486176	+	Missense_Mutation	SNP	C	C	T	rs141116625		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:109486176C>T	ENST00000369971.2	-	6	752	c.623G>A	c.(622-624)cGt>cAt	p.R208H	CLCC1_ENST00000369976.1_Missense_Mutation_p.R208H|CLCC1_ENST00000369968.2_Intron|CLCC1_ENST00000369969.2_Intron|CLCC1_ENST00000415331.1_Missense_Mutation_p.R158H|CLCC1_ENST00000302500.4_Intron|CLCC1_ENST00000369970.3_Missense_Mutation_p.R158H|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000482889.1_5'UTR|CLCC1_ENST00000356970.2_Missense_Mutation_p.R208H|CLCC1_ENST00000348264.2_Intron	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	208						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		AGTGTACCAACGTACATATGT	0.398																																																	0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	108.0	112.0	111.0		623,473	3.3	0.3	1	dbSNP_134	111	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CLCC1	NM_001048210.1,NM_015127.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	208/552,158/502	109486176	1,13005	2203	4300	6503	SO:0001583	missense	0			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.623G>A	1.37:g.109486176C>T	ENSP00000358988:p.Arg208His		O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	pfam_Chloride_chnl_CLIC-like	p.R208H	ENST00000369971.2	37	c.623	CCDS41362.1	1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590579	0.28357	0.0	1.16E-4	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369976;ENST00000369970	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.26	3.33	0.38152	.	0.490044	0.24433	N	0.038570	T	0.09069	0.0224	N	0.22421	0.69	0.09310	N	0.999997	B;B	0.22211	0.031;0.066	B;B	0.14578	0.009;0.011	T	0.28554	-1.0040	10	0.12103	T	0.63	-9.989	3.0495	0.06165	0.1262:0.4806:0.2383:0.1549	.	158;208	Q96S66-2;Q96S66	.;CLCC1_HUMAN	H	208;208;158;208;158	ENSP00000349456:R208H;ENSP00000358988:R208H;ENSP00000411591:R158H;ENSP00000358993:R208H;ENSP00000358987:R158H	ENSP00000349456:R208H	R	-	2	0	CLCC1	109287699	0.000000	0.05858	0.282000	0.24776	0.922000	0.55478	0.639000	0.24690	0.663000	0.31027	0.591000	0.81541	CGT	CLCC1	-	pfam_Chloride_chnl_CLIC-like	ENSG00000121940		0.398	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCC1	HGNC	protein_coding	OTTHUMT00000032405.1	-	0.00	50	0	C	NM_015127		109486176	-1	tier1	rs141116625	no_errors	ENST00000356970	ensembl	human	known	74_37	missense	40.00	18	12	SNP	0.057	T
CLEC4G	339390	genome.wustl.edu	37	19	7795643	7795643	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:7795643C>T	ENST00000328853.5	-	5	454	c.386G>A	c.(385-387)cGc>cAc	p.R129H	CLEC4G_ENST00000598081.1_5'Flank	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	129						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						GCCCTCACCGCGCTCACGCAG	0.751																																					Esophageal Squamous(146;540 1807 3349 19438 30853)												0													2.0	3.0	3.0					19																	7795643		1536	2920	4456	SO:0001583	missense	0			AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.386G>A	19.37:g.7795643C>T	ENSP00000327599:p.Arg129His			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.R129H	ENST00000328853.5	37	c.386	CCDS12185.1	19	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857133	0.32791	.	.	ENSG00000182566	ENST00000328853;ENST00000381308	T	0.01059	5.39	4.03	-0.56	0.11789	.	0.625996	0.13361	N	0.393632	T	0.00815	0.0027	N	0.17082	0.46	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.47129	-0.9141	10	0.62326	D	0.03	.	3.6024	0.08030	0.0:0.4833:0.1911:0.3256	.	129	Q6UXB4	CLC4G_HUMAN	H	129;13	ENSP00000327599:R129H	ENSP00000327599:R129H	R	-	2	0	CLEC4G	7701643	0.007000	0.16637	0.142000	0.22268	0.004000	0.04260	0.079000	0.14782	0.123000	0.18342	-0.755000	0.03482	CGC	CLEC4G	-	NULL	ENSG00000182566		0.751	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4G	HGNC	protein_coding	OTTHUMT00000461989.1	-	0.00	19	0	C	NM_198492		7795643	-1	tier1	-	no_errors	ENST00000328853	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.024	T
CLEC9A	283420	genome.wustl.edu	37	12	10194075	10194075	+	5'UTR	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:10194075A>G	ENST00000355819.1	+	0	307				CLEC9A_ENST00000544751.1_3'UTR	NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						GTGACTATAAACGCAGCCCCT	0.423																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.-307A>G	12.37:g.10194075A>G			B0ZBM2	RNA	SNP	-	NULL	ENST00000355819.1	37	NULL	CCDS8611.1	12																																																																																			CLEC9A	-	-	ENSG00000197992		0.423	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CLEC9A	HGNC	protein_coding	OTTHUMT00000399564.1	-	0.00	54	0	A	NM_207345		10194075	+1	tier1	-	no_errors	ENST00000544751	ensembl	human	known	74_37	rna	16.67	45	9	SNP	0.990	G
CLEC7A	64581	genome.wustl.edu	37	12	10280446	10280446	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:10280446T>A	ENST00000304084.8	-	2	258		c.e2-2		CLEC7A_ENST00000298523.5_Splice_Site|CLEC7A_ENST00000525605.1_Splice_Site|CLEC7A_ENST00000533022.1_Splice_Site|CLEC7A_ENST00000353231.5_Splice_Site|CLEC7A_ENST00000396484.2_Intron|CLEC7A_ENST00000310002.4_Splice_Site	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A						carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						CACACGATCCTGAGGAGCCAG	0.493																																																	0													29.0	24.0	26.0					12																	10280446		2201	4292	6493	SO:0001630	splice_region_variant	0			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.104-2A>T	12.37:g.10280446T>A			B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Splice_Site	SNP	-	e2-2	ENST00000304084.8	37	c.104-2	CCDS41753.1	12	.	.	.	.	.	.	.	.	.	.	T	10.85	1.466493	0.26335	.	.	ENSG00000172243	ENST00000353231;ENST00000298523;ENST00000304084;ENST00000533022;ENST00000310002;ENST00000525605	.	.	.	4.1	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999988	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7703	0.40585	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLEC7A	10171713	0.627000	0.27129	0.183000	0.23137	0.063000	0.16089	3.492000	0.53259	2.070000	0.61991	0.482000	0.46254	.	CLEC7A	-	-	ENSG00000172243		0.493	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	HGNC	protein_coding	OTTHUMT00000390772.1	-	0.00	31	0	T	NM_197954	Intron	10280446	-1	tier1	-	no_errors	ENST00000304084	ensembl	human	known	74_37	splice_site	45.83	13	11	SNP	0.222	A
CNTN1	1272	genome.wustl.edu	37	12	41327548	41327548	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:41327548delA	ENST00000551295.2	+	9	970	c.853delA	c.(853-855)actfs	p.T285fs	CNTN1_ENST00000347616.1_Frame_Shift_Del_p.T285fs|CNTN1_ENST00000348761.2_Frame_Shift_Del_p.T274fs|CNTN1_ENST00000547849.1_Frame_Shift_Del_p.T285fs|CNTN1_ENST00000547702.1_Frame_Shift_Del_p.T285fs|CNTN1_ENST00000360099.3_Frame_Shift_Del_p.T285fs	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	285	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATGCCAAGCACTGCTGAGAT	0.408																																																	0													98.0	98.0	98.0					12																	41327548		2203	4299	6502	SO:0001589	frameshift_variant	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.853delA	12.37:g.41327548delA	ENSP00000447006:p.Thr285fs		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T285fs	ENST00000551295.2	37	c.853	CCDS8737.1	12																																																																																			CNTN1	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000018236		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2		0.00	39	0	A	NM_001843		41327548	+1	tier1		no_errors	ENST00000347616	ensembl	human	known	74_37	frame_shift_del	14.29	36	6	DEL	0.993	-
CNTN6	27255	genome.wustl.edu	37	3	1367550	1367550	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:1367550A>T	ENST00000446702.2	+	9	1625	c.998A>T	c.(997-999)gAc>gTc	p.D333V	CNTN6_ENST00000350110.2_Missense_Mutation_p.D333V|CNTN6_ENST00000539053.1_Missense_Mutation_p.D261V			Q9UQ52	CNTN6_HUMAN	contactin 6	333	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TCTATCTATGACAACTTGCTC	0.413																																																	0													126.0	117.0	120.0					3																	1367550		2203	4300	6503	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.998A>T	3.37:g.1367550A>T	ENSP00000407822:p.Asp333Val		Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D333V	ENST00000446702.2	37	c.998	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	A	19.55	3.849072	0.71603	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	D;D;D	0.83075	-1.68;-1.68;-1.68	5.26	5.26	0.73747	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.64402	D	0.000018	D	0.88633	0.6489	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89585	0.3823	10	0.72032	D	0.01	.	13.7736	0.63039	1.0:0.0:0.0:0.0	.	333	Q9UQ52	CNTN6_HUMAN	V	333;261;333	ENSP00000407822:D333V;ENSP00000442791:D261V;ENSP00000341882:D333V	ENSP00000341882:D333V	D	+	2	0	CNTN6	1342550	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	4.462000	0.60121	1.993000	0.58246	0.528000	0.53228	GAC	CNTN6	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000134115		0.413	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	43	0	A	NM_014461		1367550	+1	tier1	-	no_errors	ENST00000350110	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	T
CNTNAP4	85445	genome.wustl.edu	37	16	76486645	76486645	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:76486645T>G	ENST00000476707.1	+	7	1460	c.1321T>G	c.(1321-1323)Tta>Gta	p.L441V	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.L365V|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.L437V|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.L389V			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	438	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GCCAGGAAAATTACCCAGTGA	0.418																																																	0													36.0	37.0	37.0					16																	76486645		2198	4300	6498	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1321T>G	16.37:g.76486645T>G	ENSP00000417628:p.Leu441Val		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.L437V	ENST00000476707.1	37	c.1309		16	.	.	.	.	.	.	.	.	.	.	T	9.918	1.211273	0.22289	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.34	3.05	0.35203	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.363850	0.05871	N	0.624653	T	0.63593	0.2524	.	.	.	0.20563	N	0.999888	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.11329	0.004;0.006;0.006;0.004	T	0.49943	-0.8885	9	0.28530	T	0.3	.	4.0462	0.09774	0.0:0.2546:0.2983:0.4471	.	365;441;413;438	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	V	437;389;365;441	ENSP00000306893:L437V;ENSP00000439733:L389V;ENSP00000418741:L365V;ENSP00000417628:L441V	ENSP00000306893:L437V	L	+	1	2	CNTNAP4	75044146	0.000000	0.05858	0.998000	0.56505	0.998000	0.95712	-0.380000	0.07427	1.053000	0.40415	0.533000	0.62120	TTA	CNTNAP4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000152910		0.418	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	-	0.00	58	0	T	NM_033401		76486645	+1	tier1	-	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	40.00	39	26	SNP	0.972	G
COIL	8161	genome.wustl.edu	37	17	55027375	55027375	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:55027375G>A	ENST00000240316.4	-	2	1262	c.1228C>T	c.(1228-1230)Cgg>Tgg	p.R410W		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	410	2 X 4 AA repeats of S-L-P-A.|Required for interaction with SMN.					Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					CGCATGCCCCGTCCCTTAGCT	0.522																																																	0													83.0	84.0	84.0					17																	55027375		2203	4300	6503	SO:0001583	missense	0			U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.1228C>T	17.37:g.55027375G>A	ENSP00000240316:p.Arg410Trp		B2R931	Missense_Mutation	SNP	NULL	p.R410W	ENST00000240316.4	37	c.1228	CCDS11592.1	17	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804404	0.50315	.	.	ENSG00000121058	ENST00000240316	.	.	.	5.75	4.78	0.61160	.	0.195815	0.42964	D	0.000634	T	0.76673	0.4020	M	0.68952	2.095	0.41080	D	0.985518	D	0.89917	1.0	D	0.91635	0.999	T	0.79451	-0.1798	9	0.66056	D	0.02	-15.3334	13.799	0.63188	0.0:0.0:0.723:0.277	.	410	P38432	COIL_HUMAN	W	410	.	ENSP00000240316:R410W	R	-	1	2	COIL	52382374	0.998000	0.40836	0.998000	0.56505	0.231000	0.25187	2.999000	0.49473	1.426000	0.47256	-0.261000	0.10672	CGG	COIL	-	NULL	ENSG00000121058		0.522	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COIL	HGNC	protein_coding	OTTHUMT00000440618.1	-	0.00	71	0	G			55027375	-1	tier1	-	no_errors	ENST00000240316	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.994	A
COL12A1	1303	genome.wustl.edu	37	6	75841699	75841699	+	Missense_Mutation	SNP	C	C	T	rs199747984		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:75841699C>T	ENST00000322507.8	-	35	6203	c.5894G>A	c.(5893-5895)cGc>cAc	p.R1965H	COL12A1_ENST00000416123.2_Missense_Mutation_p.R1965H|COL12A1_ENST00000483888.2_Missense_Mutation_p.R1965H|COL12A1_ENST00000345356.6_Missense_Mutation_p.R801H	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1965	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.R1965H(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ATACACAACGCGATATTGCAG	0.468																																																	1	Substitution - Missense(1)	large_intestine(1)											136.0	133.0	134.0					6																	75841699		2022	4182	6204	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5894G>A	6.37:g.75841699C>T	ENSP00000325146:p.Arg1965His		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R1965H	ENST00000322507.8	37	c.5894	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405176	0.62288	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.165364	0.39341	N	0.001394	T	0.72558	0.3475	M	0.82517	2.595	0.43756	D	0.996268	D;D	0.89917	1.0;1.0	D;D	0.72075	0.949;0.976	T	0.74520	-0.3638	10	0.56958	D	0.05	.	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	801;1965	Q99715-2;Q99715	.;COCA1_HUMAN	H	1965;1965;801;1965;1965	ENSP00000325146:R1965H;ENSP00000305147:R801H;ENSP00000412864:R1965H;ENSP00000421216:R1965H	ENSP00000325146:R1965H	R	-	2	0	COL12A1	75898419	0.998000	0.40836	0.593000	0.28771	0.014000	0.08584	4.695000	0.61767	2.941000	0.99782	0.655000	0.94253	CGC	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.468	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	54	0	C	NM_004370		75841699	-1	tier1	rs199747984	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	30.77	35	16	SNP	0.878	T
COL6A1	1291	genome.wustl.edu	37	21	47412126	47412126	+	Missense_Mutation	SNP	G	G	A	rs575394639		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:47412126G>A	ENST00000361866.3	+	17	1345	c.1231G>A	c.(1231-1233)Gac>Aac	p.D411N		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	411	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		AGAGGCGGGCGACGAGGTGAG	0.632													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13478	0.0		0.0	False		,,,				2504	0.0																0													52.0	60.0	57.0					21																	47412126		2200	4300	6500	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1231G>A	21.37:g.47412126G>A	ENSP00000355180:p.Asp411Asn		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D411N	ENST00000361866.3	37	c.1231	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497725	0.44455	.	.	ENSG00000142156	ENST00000361866;ENST00000538397	D	0.90504	-2.68	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.92014	0.7470	L	0.38531	1.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89583	0.3822	10	0.18710	T	0.47	-12.3784	16.2255	0.82286	0.0:0.0:1.0:0.0	.	411	P12109	CO6A1_HUMAN	N	411	ENSP00000355180:D411N	ENSP00000355180:D411N	D	+	1	0	COL6A1	46236554	1.000000	0.71417	0.895000	0.35142	0.064000	0.16182	4.314000	0.59166	2.162000	0.67917	0.467000	0.42956	GAC	COL6A1	-	pfam_Collagen	ENSG00000142156		0.632	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	-	0.00	137	0	G	NM_001848		47412126	+1	tier1	-	no_errors	ENST00000361866	ensembl	human	known	74_37	missense	7.45	87	7	SNP	1.000	A
COL6A5	256076	genome.wustl.edu	37	3	130103862	130103862	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:130103862A>C	ENST00000432398.2	+	5	2010	c.1516A>C	c.(1516-1518)Aga>Cga	p.R506R	COL6A5_ENST00000265379.6_Silent_p.R506R	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	506	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TATTGACTTAAGAAAGGCTAT	0.353																																																	0													89.0	79.0	82.0					3																	130103862		692	1591	2283	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1516A>C	3.37:g.130103862A>C			A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R506	ENST00000432398.2	37	c.1516		3																																																																																			COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.353	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	41	0	A	NM_153264		130103862	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	silent	37.50	24	15	SNP	0.000	C
COL9A2	1298	genome.wustl.edu	37	1	40782877	40782877	+	5'UTR	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:40782877G>A	ENST00000372748.3	-	0	89					NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CATGGCTGGCGGCGAGACCAA	0.706																																																	0													12.0	15.0	14.0					1																	40782877		2145	4239	6384	SO:0001623	5_prime_UTR_variant	0			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.-8C>T	1.37:g.40782877G>A			B2RMP9	RNA	SNP	-	NULL	ENST00000372748.3	37	NULL	CCDS450.1	1																																																																																			COL9A2	-	-	ENSG00000049089		0.706	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	HGNC	protein_coding	OTTHUMT00000015764.3	-	0.00	58	0	G	NM_001852		40782877	-1	tier1	-	no_errors	ENST00000495948	ensembl	human	putative	74_37	rna	16.36	46	9	SNP	0.001	A
COPA	1314	genome.wustl.edu	37	1	160264608	160264608	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:160264608G>T	ENST00000241704.7	-	24	2745	c.2516C>A	c.(2515-2517)aCt>aAt	p.T839N	COPA_ENST00000368069.3_Missense_Mutation_p.T848N	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	839					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGTACCAACAGTGTCAATGTC	0.507																																																	0													157.0	134.0	142.0					1																	160264608		2203	4300	6503	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.2516C>A	1.37:g.160264608G>T	ENSP00000241704:p.Thr839Asn		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T848N	ENST00000241704.7	37	c.2543	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068037	0.36470	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.42513	0.97;0.97	5.93	5.93	0.95920	Coatomer, alpha subunit, C-terminal (1);	0.102199	0.64402	D	0.000002	T	0.17704	0.0425	N	0.22421	0.69	0.43003	D	0.994529	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.05305	-1.0893	10	0.19147	T	0.46	-19.9134	17.8477	0.88736	0.0:0.0:1.0:0.0	.	839;848	P53621;P53621-2	COPA_HUMAN;.	N	848;839	ENSP00000357048:T848N;ENSP00000241704:T839N	ENSP00000241704:T839N	T	-	2	0	COPA	158531232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.165000	0.64959	2.826000	0.97356	0.655000	0.94253	ACT	COPA	-	pfam_Coatomer_asu_C,pirsf_Coatomer_asu	ENSG00000122218		0.507	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	72	0	G	NM_004371		160264608	-1			no_errors	ENST00000368069	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
COPB1	1315	genome.wustl.edu	37	11	14510127	14510127	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:14510127G>T	ENST00000249923.3	-	6	910	c.610C>A	c.(610-612)Cga>Aga	p.R204R	COPB1_ENST00000439561.2_Silent_p.R204R	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	204					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TCCAAAGCTCGATCCTAAAAA	0.294																																																	0													46.0	47.0	46.0					11																	14510127		2200	4290	6490	SO:0001819	synonymous_variant	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.610C>A	11.37:g.14510127G>T			D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Silent	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.R204	ENST00000249923.3	37	c.610	CCDS7815.1	11																																																																																			COPB1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	ENSG00000129083		0.294	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1		0.00	93	0	G	NM_016451		14510127	-1			no_errors	ENST00000249923	ensembl	human	known	74_37	silent	5.00	57	3	SNP	1.000	T
CPXM2	119587	genome.wustl.edu	37	10	125506303	125506303	+	Nonsense_Mutation	SNP	G	G	A	rs139450310	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:125506303G>A	ENST00000241305.3	-	14	2402	c.2248C>T	c.(2248-2250)Cag>Tag	p.Q750*	CPXM2_ENST00000368854.3_Intron	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	750			Q -> R (in dbSNP:rs7088479). {ECO:0000269|PubMed:12975309, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CGTCTCTTCTGCCCCCGCAGC	0.577													G|||	3	0.000599042	0.0015	0.0014	5008	,	,		17373	0.0		0.0	False		,,,				2504	0.0																0								G	stop/GLN	2,4404	2.1+/-5.4	0,2,2201	52.0	56.0	55.0		2248	0.8	0.0	10	dbSNP_134	55	0,8600		0,0,4300	no	stop-gained	CPXM2	NM_198148.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		750/757	125506303	2,13004	2203	4300	6503	SO:0001587	stop_gained	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.2248C>T	10.37:g.125506303G>A	ENSP00000241305:p.Gln750*		B4E3Q2	Nonsense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.Q750*	ENST00000241305.3	37	c.2248	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018041	0.75275	4.54E-4	0.0	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	.	.	.	5.24	0.796	0.18648	.	1.153700	0.06213	N	0.685429	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-35.2708	8.8417	0.35146	0.075:0.0:0.4508:0.4742	.	.	.	.	X	750;583;725	.	ENSP00000241305:Q750X	Q	-	1	0	CPXM2	125496293	0.916000	0.31088	0.003000	0.11579	0.090000	0.18270	1.348000	0.33987	0.314000	0.23086	-1.047000	0.02352	CAG	CPXM2	-	NULL	ENSG00000121898		0.577	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	-	0.00	53	0	G	NM_198148		125506303	-1	tier1	rs139450310	no_errors	ENST00000241305	ensembl	human	known	74_37	nonsense	18.87	43	10	SNP	0.001	A
CRMP1	1400	genome.wustl.edu	37	4	5823276	5823276	+	3'UTR	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:5823276G>T	ENST00000397890.2	-	0	2144				CRMP1_ENST00000511535.1_5'UTR|EVC_ENST00000382674.2_Intron|CRMP1_ENST00000324989.7_3'UTR|CRMP1_ENST00000512574.1_3'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1						axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		GGTGGATTCAGCATGAACACA	0.473											OREG0016065	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001624	3_prime_UTR_variant	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.*211C>A	4.37:g.5823276G>T		629	A0EJG6|Q13024|Q4W5F1|Q96TC8	RNA	SNP	-	NULL	ENST00000397890.2	37	NULL	CCDS43207.1	4																																																																																			CRMP1	-	-	ENSG00000072832		0.473	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	-	0.00	30	0	G	NM_001313		5823276	-1	tier1	-	no_errors	ENST00000511535	ensembl	human	known	74_37	rna	7.14	51	4	SNP	0.004	T
CRMP1	1400	genome.wustl.edu	37	4	5837646	5837646	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:5837646T>C	ENST00000397890.2	-	11	1491	c.1277A>G	c.(1276-1278)aAg>aGg	p.K426R	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Missense_Mutation_p.K540R|CRMP1_ENST00000512574.1_Missense_Mutation_p.K424R	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	426					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.K540R(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		ACTTACCGACTTGTGACTTTT	0.448																																																	1	Substitution - Missense(1)	endometrium(1)											127.0	118.0	121.0					4																	5837646		2203	4300	6503	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1277A>G	4.37:g.5837646T>C	ENSP00000380987:p.Lys426Arg		A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.K540R	ENST00000397890.2	37	c.1619	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	T	15.49	2.850483	0.51270	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	T;T;T	0.73363	-0.74;-0.74;-0.74	4.33	4.33	0.51752	Metal-dependent hydrolase, composite domain (1);	0.168004	0.52532	D	0.000067	T	0.62780	0.2456	L	0.27053	0.805	0.42521	D	0.993002	B;B;B;B	0.12013	0.001;0.0;0.0;0.005	B;B;B;B	0.15052	0.002;0.0;0.001;0.012	T	0.63492	-0.6625	10	0.66056	D	0.02	-29.5855	13.1172	0.59307	0.0:0.0:0.0:1.0	.	540;424;426;363	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	R	540;426;426;424	ENSP00000321606:K540R;ENSP00000380987:K426R;ENSP00000425742:K424R	ENSP00000321606:K540R	K	-	2	0	CRMP1	5888547	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.481000	0.60250	1.957000	0.56846	0.416000	0.27883	AAG	CRMP1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.448	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	-	0.00	88	0	T	NM_001313		5837646	-1	tier1	-	no_errors	ENST00000324989	ensembl	human	known	74_37	missense	13.79	100	16	SNP	1.000	C
CRTAC1	55118	genome.wustl.edu	37	10	99696050	99696050	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:99696050G>A	ENST00000370597.3	-	3	653	c.298C>T	c.(298-300)Cgc>Tgc	p.R100C	CRTAC1_ENST00000298819.4_Missense_Mutation_p.R100C|CRTAC1_ENST00000370591.2_Missense_Mutation_p.R100C	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	100						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GGTGAGCTGCGCTCATCGACC	0.637																																																	0													65.0	54.0	58.0					10																	99696050		2203	4300	6503	SO:0001583	missense	0			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.298C>T	10.37:g.99696050G>A	ENSP00000359629:p.Arg100Cys		B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	pfam_FG-GAP,pfam_UnbV_ASPIC,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom	p.R100C	ENST00000370597.3	37	c.298	CCDS31266.1	10	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292528	0.59976	.	.	ENSG00000095713	ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T	0.76316	-1.01;1.28;-0.16;-0.17	4.76	3.75	0.43078	.	0.058751	0.64402	D	0.000002	T	0.81786	0.4896	L	0.54323	1.7	0.58432	D	0.999998	D;D	0.89917	0.998;1.0	P;P	0.57679	0.731;0.825	T	0.81788	-0.0772	10	0.38643	T	0.18	-18.3388	15.5548	0.76184	0.0:0.0:0.8523:0.1477	.	100;100	Q9NQ79-2;Q9NQ79	.;CRAC1_HUMAN	C	100;100;92;100	ENSP00000359629:R100C;ENSP00000298819:R100C;ENSP00000310810:R92C;ENSP00000359623:R100C	ENSP00000298819:R100C	R	-	1	0	CRTAC1	99686040	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	2.993000	0.49425	2.204000	0.70986	0.313000	0.20887	CGC	CRTAC1	-	NULL	ENSG00000095713		0.637	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	CRTAC1	HGNC	protein_coding	OTTHUMT00000049754.1	-	0.00	130	0	G	NM_018058		99696050	-1	tier1	-	no_errors	ENST00000370597	ensembl	human	known	74_37	missense	18.60	68	16	SNP	1.000	A
CSF1R	1436	genome.wustl.edu	37	5	149447806	149447808	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:149447806_149447808delAGC	ENST00000286301.3	-	11	1887_1889	c.1596_1598delGCT	c.(1594-1599)ctgctc>ctc	p.532_533LL>L	CSF1R_ENST00000515239.1_5'Flank	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	532					cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	Tagcagcaggagcagcagcagca	0.596																																																	0																																										SO:0001651	inframe_deletion	0			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1596_1598delGCT	5.37:g.149447815_149447817delAGC	ENSP00000286301:p.Leu537del		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	In_Frame_Del	DEL	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L536in_frame_del	ENST00000286301.3	37	c.1598_1596	CCDS4302.1	5																																																																																			CSF1R	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000182578		0.596	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	HGNC	protein_coding	OTTHUMT00000252329.2		0.00	47	0	AGC	NM_005211		149447808	-1	tier1		no_errors	ENST00000286301	ensembl	human	known	74_37	in_frame_del	10.00	27	3	DEL	0.921:0.978:0.978	-
CSMD2	114784	genome.wustl.edu	37	1	34042990	34042990	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:34042990G>A	ENST00000373381.4	-	49	7658	c.7482C>T	c.(7480-7482)aaC>aaT	p.N2494N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2496	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGTAGCCGGCGTTGCAGCCAA	0.647																																																	0													57.0	60.0	59.0					1																	34042990		2203	4300	6503	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7482C>T	1.37:g.34042990G>A			B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.N2494	ENST00000373381.4	37	c.7482		1																																																																																			CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.647	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	72	0	G	NM_052896		34042990	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	silent	9.59	66	7	SNP	0.003	A
CTSD	1509	genome.wustl.edu	37	11	1775327	1775327	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:1775327C>T	ENST00000236671.2	-	7	1001	c.869G>A	c.(868-870)tGt>tAt	p.C290Y	RP11-295K3.1_ENST00000427721.1_Missense_Mutation_p.V161M	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	290					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AATGGCCTCACAGCCCTCCTT	0.697																																																	0													52.0	39.0	44.0					11																	1775327		2202	4299	6501	SO:0001583	missense	0			M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.869G>A	11.37:g.1775327C>T	ENSP00000236671:p.Cys290Tyr		Q6IB57	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.C290Y	ENST00000236671.2	37	c.869	CCDS7725.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	24.3|24.3	4.515357|4.515357	0.85389|0.85389	.|.	.|.	ENSG00000117984|ENSG00000250644	ENST00000236671;ENST00000429746;ENST00000438213|ENST00000427721	T;T;T|.	0.58940|.	0.3;0.3;0.3|.	4.25|4.25	4.25|4.25	0.50352|0.50352	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86247|0.86247	0.5887|0.5887	M|M	0.93375|0.93375	3.41|3.41	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.90409|0.90409	0.4408|0.4408	10|5	0.87932|.	D|.	0|.	.|.	17.2119|17.2119	0.86932|0.86932	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	290|.	P07339|.	CATD_HUMAN|.	Y|M	290;67;275|161	ENSP00000236671:C290Y;ENSP00000402586:C67Y;ENSP00000415036:C275Y|.	ENSP00000236671:C290Y|.	C|V	-|-	2|1	0|0	CTSD|RP11-295K3.1	1731903|1731903	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.867000|0.867000	0.49689|0.49689	5.503000|5.503000	0.66962|0.66962	2.378000|2.378000	0.81104|0.81104	0.462000|0.462000	0.41574|0.41574	TGT|GTG	CTSD	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom	ENSG00000117984		0.697	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSD	HGNC	protein_coding	OTTHUMT00000104272.5	-	0.00	69	0	C	NM_001909		1775327	-1	tier1	-	no_errors	ENST00000236671	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
CXCL14	9547	genome.wustl.edu	37	5	134910319	134910319	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:134910319T>C	ENST00000337225.5	-	3	727	c.263A>G	c.(262-264)aAg>aGg	p.K88R	CXCL14_ENST00000512158.1_Missense_Mutation_p.K76R|CTC-321K16.1_ENST00000509372.1_RNA	NM_004887.4	NP_004878.2	O95715	CXL14_HUMAN	chemokine (C-X-C motif) ligand 14	88					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inner ear development (GO:0048839)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	chemokine activity (GO:0008009)			large_intestine(2)|lung(2)|prostate(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTCTGCAGCTTGGGGTGCAG	0.597																																																	0													175.0	133.0	147.0					5																	134910319		2203	4300	6503	SO:0001583	missense	0			AF073957	CCDS4188.1	5q31	2010-04-30	2002-08-22	2002-08-23	ENSG00000145824	ENSG00000145824			10640	protein-coding gene	gene with protein product	"""breast and kidney"""	604186	"""small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK)"""	SCYB14		10049774	Standard	NM_004887		Approved	BRAK, NJAC, bolekine, Kec, MIP-2g, BMAC, KS1	uc003lay.3	O95715	OTTHUMG00000129139	ENST00000337225.5:c.263A>G	5.37:g.134910319T>C	ENSP00000337065:p.Lys88Arg		B3KQU8|Q6UW97|Q86U69|Q9BTR1|Q9NS21	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	p.K88R	ENST00000337225.5	37	c.263	CCDS4188.1	5	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083918	0.55861	.	.	ENSG00000145824	ENST00000337225;ENST00000512158	T;T	0.05580	3.42;3.42	5.59	5.59	0.84812	Chemokine interleukin-8-like domain (2);	0.148681	0.64402	D	0.000013	T	0.10723	0.0262	L	0.56769	1.78	0.48288	D	0.999625	P	0.47484	0.896	P	0.44394	0.448	T	0.11891	-1.0569	10	0.30854	T	0.27	-1.4611	14.3199	0.66479	0.0:0.0:0.0:1.0	.	88	O95715	CXL14_HUMAN	R	88;76	ENSP00000337065:K88R;ENSP00000423783:K76R	ENSP00000337065:K88R	K	-	2	0	CXCL14	134938218	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.972000	0.56838	2.128000	0.65567	0.379000	0.24179	AAG	CXCL14	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	ENSG00000145824		0.597	CXCL14-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL14	HGNC	protein_coding		-	0.00	87	0	T	NM_004887		134910319	-1	tier1	-	no_errors	ENST00000337225	ensembl	human	known	74_37	missense	14.75	52	9	SNP	1.000	C
CYLC2	1539	genome.wustl.edu	37	9	105767725	105767725	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:105767725A>C	ENST00000374798.3	+	5	882	c.812A>C	c.(811-813)aAg>aCg	p.K271T	CYLC2_ENST00000487798.1_Missense_Mutation_p.K271T	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	271	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AAAAAAGGTAAGAAAGATAAG	0.398																																																	0													107.0	102.0	104.0					9																	105767725		2203	4300	6503	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.812A>C	9.37:g.105767725A>C	ENSP00000420256:p.Lys271Thr		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.K271T	ENST00000374798.3	37	c.812	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	A	8.444	0.851465	0.17034	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.26660	1.72;1.72	4.6	3.45	0.39498	.	0.587434	0.14028	N	0.346363	T	0.25568	0.0622	N	0.24115	0.695	0.09310	N	1	D	0.59357	0.985	P	0.58130	0.833	T	0.08186	-1.0734	10	0.15952	T	0.53	0.0796	7.2095	0.25925	0.899:0.0:0.101:0.0	.	271	Q14093	CYLC2_HUMAN	T	271	ENSP00000420256:K271T;ENSP00000417674:K271T	ENSP00000420256:K271T	K	+	2	0	CYLC2	104807546	0.008000	0.16893	0.009000	0.14445	0.108000	0.19459	2.146000	0.42216	0.890000	0.36211	0.477000	0.44152	AAG	CYLC2	-	NULL	ENSG00000155833		0.398	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	-	0.00	26	0	A	NM_001340		105767725	+1	tier1	-	no_errors	ENST00000374798	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.017	C
CYP26B1	56603	genome.wustl.edu	37	2	72359392	72359392	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:72359392C>T	ENST00000001146.2	-	6	1706	c.1503G>A	c.(1501-1503)ctG>ctA	p.L501L	CYP26B1_ENST00000412253.1_Silent_p.L310L|CYP26B1_ENST00000546307.1_Silent_p.L426L	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	501					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CCGTCTCCGGCAGGATCTCGT	0.647																																																	0													38.0	33.0	35.0					2																	72359392		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1503G>A	2.37:g.72359392C>T			B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B,prints_Cyt_P450	p.L501	ENST00000001146.2	37	c.1503	CCDS1919.1	2																																																																																			CYP26B1	-	NULL	ENSG00000003137		0.647	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP26B1	HGNC	protein_coding	OTTHUMT00000251969.1	-	0.00	90	0	C	NM_019885		72359392	-1	tier1	-	no_errors	ENST00000001146	ensembl	human	known	74_37	silent	12.50	56	8	SNP	1.000	T
CYP4F2	8529	genome.wustl.edu	37	19	15990622	15990622	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:15990622G>A	ENST00000221700.6	-	10	1296	c.1201C>T	c.(1201-1203)Cat>Tat	p.H401Y		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGGGTGACATGGCGGGAGATG	0.637																																																	0													86.0	91.0	89.0					19																	15990622		2203	4300	6503	SO:0001583	missense	0			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1201C>T	19.37:g.15990622G>A	ENSP00000221700:p.His401Tyr			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.H401Y	ENST00000221700.6	37	c.1201	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.315916	0.00018	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	T	0.67523	-0.27	2.78	-1.63	0.08345	.	2587.430000	0.01449	U	0.015395	T	0.32912	0.0845	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45249	-0.9274	10	0.02654	T	1	.	3.7977	0.08746	0.2984:0.0:0.5029:0.1986	.	401	P78329	CP4F2_HUMAN	Y	401;252	ENSP00000221700:H401Y	ENSP00000221700:H401Y	H	-	1	0	CYP4F2	15851622	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.940000	0.03929	-0.504000	0.06577	-0.339000	0.08088	CAT	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000186115		0.637	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	-	0.00	131	0	G	NM_001082		15990622	-1	tier1	-	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	7.29	89	7	SNP	0.048	A
CYP2A13	1553	genome.wustl.edu	37	19	41597814	41597814	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:41597814G>A	ENST00000330436.3	+	5	831		c.e5+1			NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CATGCAGGAGGTACATCCCAG	0.587																																																	0													99.0	78.0	85.0					19																	41597814		2203	4300	6503	SO:0001630	splice_region_variant	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.831+1G>A	19.37:g.41597814G>A			Q53YR8|Q6R569|Q6R570|Q9H2X2	Splice_Site	SNP	-	e5+1	ENST00000330436.3	37	c.831+1	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	9.745	1.165981	0.21538	.	.	ENSG00000197838	ENST00000330436	.	.	.	4.49	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6279	0.62178	0.0:0.1572:0.8428:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP2A13	46289654	1.000000	0.71417	0.986000	0.45419	0.059000	0.15707	6.883000	0.75595	1.125000	0.41998	-0.196000	0.12772	.	CYP2A13	-	-	ENSG00000197838		0.587	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	-	0.00	91	0	G	NM_000766	Intron	41597814	+1	tier1	-	no_errors	ENST00000330436	ensembl	human	known	74_37	splice_site	9.48	105	11	SNP	1.000	A
DAOA	267012	genome.wustl.edu	37	13	106142220	106142220	+	Intron	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:106142220C>A	ENST00000375936.3	+	4	327				DAOA-AS1_ENST00000448407.1_RNA|DAOA_ENST00000329625.5_Intron	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator						negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					ttcacaagacctggccaactg	0.483																																																	0													81.0	87.0	85.0					13																	106142220		2192	4296	6488	SO:0001627	intron_variant	0			AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.282-30C>A	13.37:g.106142220C>A			A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Silent	SNP	NULL	p.T56	ENST00000375936.3	37	c.168	CCDS41905.1	13																																																																																			DAOA	-	NULL	ENSG00000182346		0.483	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DAOA	HGNC	protein_coding	OTTHUMT00000099040.2	-	0.00	49	0	C	NM_172370		106142220	+1	tier1	-	no_errors	ENST00000595812	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.000	A
ACKR1	2532	genome.wustl.edu	37	1	159176207	159176207	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:159176207T>G	ENST00000368122.2	+	2	1657	c.978T>G	c.(976-978)tcT>tcG	p.S326S	DARC_ENST00000537147.1_Silent_p.S326S|DARC_ENST00000368121.2_Silent_p.S328S|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		326			S -> F (in dbSNP:rs17851570). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.6}.		chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					AAGGATGGTCTTCTCATCTGG	0.537																																																	0													214.0	231.0	226.0					1																	159176207		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000368122.2:c.978T>G	1.37:g.159176207T>G			A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Silent	SNP	prints_Duffy_chemokine_rcpt	p.S328	ENST00000368122.2	37	c.984	CCDS1183.1	1																																																																																			DARC	-	NULL	ENSG00000213088		0.537	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	HGNC	protein_coding	OTTHUMT00000090338.2	-	0.00	80	0	T			159176207	+1	tier1	-	no_errors	ENST00000368121	ensembl	human	known	74_37	silent	28.75	57	23	SNP	0.023	G
DCHS2	54798	genome.wustl.edu	37	4	155254028	155254028	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:155254028A>C	ENST00000357232.4	-	9	1834	c.1835T>G	c.(1834-1836)cTt>cGt	p.L612R	DCHS2_ENST00000339452.1_Missense_Mutation_p.L1111R|DCHS2_ENST00000507542.1_5'Flank	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	612	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGGGGGCCAAGTGGGTGCGC	0.537																																																	0													62.0	62.0	62.0					4																	155254028		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1835T>G	4.37:g.155254028A>C	ENSP00000349768:p.Leu612Arg		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L612R	ENST00000357232.4	37	c.1835	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	A	8.515	0.867460	0.17250	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.61274	0.12;0.77	5.06	-0.814	0.10846	Cadherin (3);Cadherin-like (1);	0.801566	0.10573	N	0.658939	T	0.32763	0.0840	N	0.21583	0.68	0.09310	N	1	B;B	0.30686	0.29;0.021	B;B	0.31614	0.133;0.016	T	0.21690	-1.0238	10	0.08837	T	0.75	.	2.5971	0.04856	0.3985:0.3538:0.1335:0.1142	.	1111;612	E9PC11;Q6V1P9	.;PCD23_HUMAN	R	612;1111;1111	ENSP00000349768:L612R;ENSP00000345062:L1111R	ENSP00000345062:L1111R	L	-	2	0	DCHS2	155473478	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.290000	0.18975	-0.270000	0.09285	-1.156000	0.01807	CTT	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.537	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	19	0	A	NM_001142552		155254028	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.000	C
DDI1	414301	genome.wustl.edu	37	11	103908222	103908222	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:103908222A>T	ENST00000302259.3	+	1	915	c.672A>T	c.(670-672)gaA>gaT	p.E224D	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	224							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AAAACATTGAAGAAAACATGA	0.478																																																	0													105.0	118.0	113.0					11																	103908222		2202	4299	6501	SO:0001583	missense	0				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.672A>T	11.37:g.103908222A>T	ENSP00000302805:p.Glu224Asp		Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	pfam_Peptidase_aspartic_DDI1-type,pfam_Ubiquitin_dom,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.E224D	ENST00000302259.3	37	c.672	CCDS31660.1	11	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112073	0.56398	.	.	ENSG00000170967	ENST00000302259	T	0.43688	0.94	5.02	2.97	0.34412	Peptidase aspartic, eukaryotic predicted (1);	0.000000	0.85682	D	0.000000	T	0.36082	0.0954	N	0.11927	0.2	0.40256	D	0.978128	D	0.89917	1.0	D	0.91635	0.999	T	0.32214	-0.9915	10	0.14656	T	0.56	-29.9827	4.6124	0.12409	0.4823:0.0:0.5177:0.0	.	224	Q8WTU0	DDI1_HUMAN	D	224	ENSP00000302805:E224D	ENSP00000302805:E224D	E	+	3	2	DDI1	103413432	1.000000	0.71417	0.999000	0.59377	0.694000	0.40290	1.505000	0.35736	0.645000	0.30675	0.533000	0.62120	GAA	DDI1	-	pfam_Peptidase_aspartic_DDI1-type	ENSG00000170967		0.478	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI1	HGNC	protein_coding	OTTHUMT00000387326.1	-	0.00	37	0	A	NM_001001711		103908222	+1	tier1	-	no_errors	ENST00000302259	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	T
DDX1	1653	genome.wustl.edu	37	2	15746352	15746352	+	Missense_Mutation	SNP	G	G	A	rs144722775		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:15746352G>A	ENST00000381341.2	+	13	1170	c.781G>A	c.(781-783)Gca>Aca	p.A261T	DDX1_ENST00000233084.3_Missense_Mutation_p.A261T			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	261	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TCTTTCCAAGGCACCGGATGG	0.373																																																	0													79.0	73.0	75.0					2																	15746352		2203	4300	6503	SO:0001583	missense	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.781G>A	2.37:g.15746352G>A	ENSP00000370745:p.Ala261Thr		B4DME8|B4DPN6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_ConA-like_lec_gl_sf,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A261T	ENST00000381341.2	37	c.781	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.126364	0.94429	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.46819	0.86;0.86	5.56	5.56	0.83823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	L	0.58810	1.83	0.80722	D	1	D	0.71674	0.998	D	0.71870	0.975	T	0.57447	-0.7810	10	0.22706	T	0.39	-18.6489	19.5245	0.95199	0.0:0.0:1.0:0.0	.	261	Q92499	DDX1_HUMAN	T	261;261;245	ENSP00000370745:A261T;ENSP00000233084:A261T	ENSP00000233084:A261T	A	+	1	0	DDX1	15663803	1.000000	0.71417	0.998000	0.56505	0.817000	0.46193	9.711000	0.98735	2.608000	0.88229	0.655000	0.94253	GCA	DDX1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000079785		0.373	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2	-	0.00	53	0	G	NM_004939		15746352	+1	tier1	-	no_errors	ENST00000233084	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
DFFB	1677	genome.wustl.edu	37	1	3784594	3784594	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:3784594C>T	ENST00000378209.3	+	4	810	c.487C>T	c.(487-489)Cgg>Tgg	p.R163W	DFFB_ENST00000338895.3_Missense_Mutation_p.R163W	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	163					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CTGTGAGAGCCGGATCCGGAG	0.582																																																	0													165.0	178.0	173.0					1																	3784594		2203	4300	6503	SO:0001583	missense	0				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.487C>T	1.37:g.3784594C>T	ENSP00000367454:p.Arg163Trp		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_Apoptosis_DFF40,pfam_CIDE-N_dom,smart_CIDE-N_dom,pfscan_CIDE-N_dom	p.R163W	ENST00000378209.3	37	c.487	CCDS52.1	1	.	.	.	.	.	.	.	.	.	.	c	21.6	4.168206	0.78339	.	.	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000339350;ENST00000378206	T;T	0.57595	0.39;0.39	5.1	4.12	0.48240	Apoptosis, DNA fragmentation factor 40kDa (1);	0.000000	0.85682	D	0.000000	T	0.72953	0.3525	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.77027	-0.2740	10	0.87932	D	0	-41.6973	10.0579	0.42257	0.3235:0.6765:0.0:0.0	.	187;99;163	B4DZS0;Q5SR21;O76075	.;.;DFFB_HUMAN	W	163;163;99;99	ENSP00000367454:R163W;ENSP00000339524:R163W	ENSP00000339524:R163W	R	+	1	2	DFFB	3774454	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.641000	0.37197	2.355000	0.79922	0.550000	0.68814	CGG	DFFB	-	pfam_Apoptosis_DFF40	ENSG00000169598		0.582	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFFB	HGNC	protein_coding	OTTHUMT00000009821.2	-	0.00	104	0	C	NM_001282669		3784594	+1	tier1	-	no_errors	ENST00000378209	ensembl	human	known	74_37	missense	15.38	77	14	SNP	1.000	T
DGKI	9162	genome.wustl.edu	37	7	137237262	137237262	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:137237262A>C	ENST00000288490.5	-	20	2000	c.2000T>G	c.(1999-2001)gTc>gGc	p.V667G	DGKI_ENST00000453654.2_Missense_Mutation_p.V367G|DGKI_ENST00000446122.1_Missense_Mutation_p.V667G|DGKI_ENST00000424189.2_Missense_Mutation_p.V667G	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	667					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TAGAAGCATGACTTCTCGACA	0.498																																																	0													131.0	127.0	128.0					7																	137237262		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2000T>G	7.37:g.137237262A>C	ENSP00000288490:p.Val667Gly		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V667G	ENST00000288490.5	37	c.2000	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563616	0.86335	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.35789	1.29;1.29;1.29	5.44	5.44	0.79542	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.66829	0.2829	M	0.90650	3.135	0.80722	D	1	D;D	0.67145	0.986;0.996	D;D	0.70016	0.936;0.967	T	0.75147	-0.3420	10	0.87932	D	0	.	15.804	0.78477	1.0:0.0:0.0:0.0	.	367;667	E9PFX6;O75912	.;DGKI_HUMAN	G	367;615;667;667;667	ENSP00000392161:V367G;ENSP00000288490:V667G;ENSP00000399131:V667G	ENSP00000288490:V667G	V	-	2	0	DGKI	136887802	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.488000	0.81441	2.193000	0.70182	0.533000	0.62120	GTC	DGKI	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000157680		0.498	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	45	0	A	NM_004717		137237262	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	C
DGKI	9162	genome.wustl.edu	37	7	137339488	137339488	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:137339488G>T	ENST00000288490.5	-	5	728	c.728C>A	c.(727-729)tCa>tAa	p.S243*	DGKI_ENST00000453654.2_5'UTR|DGKI_ENST00000446122.1_Nonsense_Mutation_p.S243*|DGKI_ENST00000424189.2_Nonsense_Mutation_p.S243*	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	243					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TTCTCTTGGTGACCTTGAGCC	0.328																																																	0													115.0	104.0	108.0					7																	137339488		2203	4300	6503	SO:0001587	stop_gained	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.728C>A	7.37:g.137339488G>T	ENSP00000288490:p.Ser243*		A4D1Q9|Q9NZ49	Nonsense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S243*	ENST00000288490.5	37	c.728	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.665024	0.98419	.	.	ENSG00000157680	ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	.	.	.	5.85	5.85	0.93711	.	0.055383	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	17.0943	0.86630	0.0:0.0:1.0:0.0	.	.	.	.	X	191;243;243;243	.	ENSP00000288490:S243X	S	-	2	0	DGKI	136990028	0.994000	0.37717	0.997000	0.53966	0.987000	0.75469	1.746000	0.38288	2.771000	0.95319	0.561000	0.74099	TCA	DGKI	-	NULL	ENSG00000157680		0.328	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	41	0	G	NM_004717		137339488	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	1.000	T
DHX9	1660	genome.wustl.edu	37	1	182822528	182822528	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:182822528G>T	ENST00000367549.3	+	5	562	c.452G>T	c.(451-453)aGa>aTa	p.R151I		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	151	Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TACTACTCAAGAAAGGAAGAA	0.463																																					Colon(69;210 1162 3697 13559 39565)												0													57.0	60.0	59.0					1																	182822528		1904	4116	6020	SO:0001583	missense	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.452G>T	1.37:g.182822528G>T	ENSP00000356520:p.Arg151Ile		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.R151I	ENST00000367549.3	37	c.452	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151517	0.38021	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.04194	3.68	5.52	1.32	0.21799	.	0.426666	0.23272	N	0.050008	T	0.05090	0.0136	L	0.60455	1.87	0.50039	D	0.999848	B	0.06786	0.001	B	0.09377	0.004	T	0.35475	-0.9787	10	0.32370	T	0.25	.	4.6264	0.12481	0.2537:0.0:0.5964:0.1498	.	151	Q08211	DHX9_HUMAN	I	151	ENSP00000356520:R151I	ENSP00000356520:R151I	R	+	2	0	DHX9	181089151	0.815000	0.29118	0.982000	0.44146	0.992000	0.81027	-0.017000	0.12590	-0.018000	0.14079	-0.355000	0.07637	AGA	DHX9	-	NULL	ENSG00000135829		0.463	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2		0.00	46	0	G	NM_030588		182822528	+1			no_errors	ENST00000367549	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.964	T
DNHD1	144132	genome.wustl.edu	37	11	6578354	6578354	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:6578354C>T	ENST00000527990.2	+	23	7829	c.7829C>T	c.(7828-7830)tCc>tTc	p.S2610F	DNHD1_ENST00000254579.6_Missense_Mutation_p.S2610F			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2610					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		AGAACAGGCTCCCGAGGTTTT	0.587																																																	0													61.0	54.0	56.0					11																	6578354		692	1591	2283	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.7829C>T	11.37:g.6578354C>T	ENSP00000436180:p.Ser2610Phe		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.S2610F	ENST00000527990.2	37	c.7829	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389323	0.25118	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210	T;T	0.28666	1.6;1.6	5.46	3.56	0.40772	.	.	.	.	.	T	0.24236	0.0587	N	0.08118	0	0.09310	N	1	D;D	0.56035	0.974;0.958	P;P	0.51866	0.621;0.682	T	0.06427	-1.0827	9	0.66056	D	0.02	.	9.4004	0.38428	0.0:0.7729:0.0:0.2271	.	2610;357	Q96M86;E9PHZ7	DNHD1_HUMAN;.	F	2610;2610;357	ENSP00000254579:S2610F;ENSP00000436180:S2610F	ENSP00000254579:S2610F	S	+	2	0	DNHD1	6534930	0.008000	0.16893	0.009000	0.14445	0.265000	0.26407	2.230000	0.42999	1.547000	0.49401	0.650000	0.86243	TCC	DNHD1	-	NULL	ENSG00000179532		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	-	0.00	28	0	C	NM_144666		6578354	+1	tier1	-	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	32.00	17	8	SNP	0.001	T
DNHD1	144132	genome.wustl.edu	37	11	6578614	6578616	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:6578614_6578616delGAG	ENST00000527990.2	+	23	8089_8091	c.8089_8091delGAG	c.(8089-8091)gagdel	p.E2703del	DNHD1_ENST00000254579.6_In_Frame_Del_p.E2703del			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2703	Glu-rich.				microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCAGGAGAGTgaggaggaggagg	0.576																																																	0																																										SO:0001651	inframe_deletion	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.8089_8091delGAG	11.37:g.6578623_6578625delGAG	ENSP00000436180:p.Glu2703del		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	In_Frame_Del	DEL	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.E2700in_frame_del	ENST00000527990.2	37	c.8089_8091	CCDS44532.1	11																																																																																			DNHD1	-	NULL	ENSG00000179532		0.576	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2		0.00	29	0	GAG	NM_144666		6578616	+1	tier1		no_errors	ENST00000254579	ensembl	human	known	74_37	in_frame_del	18.75	13	3	DEL	0.006:0.004:0.000	-
DOCK3	1795	genome.wustl.edu	37	3	50816175	50816175	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:50816175T>C	ENST00000266037.9	+	2	130	c.107T>C	c.(106-108)cTt>cCt	p.L36P		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	36	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTCCAGATTCTTGAAAAATGT	0.353																																																	0													101.0	87.0	92.0					3																	50816175		1833	4079	5912	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.107T>C	3.37:g.50816175T>C	ENSP00000266037:p.Leu36Pro		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.L36P	ENST00000266037.9	37	c.107	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	N	19.29	3.798436	0.70567	.	.	ENSG00000088538	ENST00000266037	T	0.10382	2.88	5.4	5.4	0.78164	Src homology-3 domain (3);Variant SH3 (1);	0.085498	0.47852	D	0.000217	T	0.45054	0.1323	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59931	-0.7361	10	0.72032	D	0.01	.	13.2449	0.60018	0.0:0.0:0.0:1.0	.	36	Q8IZD9	DOCK3_HUMAN	P	36	ENSP00000266037:L36P	ENSP00000266037:L36P	L	+	2	0	DOCK3	50791179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.557000	0.67313	2.175000	0.68902	0.533000	0.62120	CTT	DOCK3	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000088538		0.353	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5		0.00	53	0	T	NM_004947		50816175	+1			no_errors	ENST00000266037	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
DOCK4	9732	genome.wustl.edu	37	7	111644111	111644111	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:111644111T>G	ENST00000437633.1	-	2	369	c.113A>C	c.(112-114)aAg>aCg	p.K38T	DOCK4_ENST00000428084.1_Missense_Mutation_p.K38T|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	38	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				ACCATCACACTTCTCCAGGAT	0.393																																																	0													109.0	100.0	103.0					7																	111644111		1912	4135	6047	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.113A>C	7.37:g.111644111T>G	ENSP00000404179:p.Lys38Thr		O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.K38T	ENST00000437633.1	37	c.113	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.05|13.05	2.120086|2.120086	0.37436|0.37436	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000445943	T;T|.	0.08370|.	3.1;3.1|.	5.93|5.93	5.93|5.93	0.95920|0.95920	Src homology-3 domain (3);Variant SH3 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72170|0.72170	0.3427|0.3427	M|M	0.71206|0.71206	2.165|2.165	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.996;0.996;0.996|.	D;D;D|.	0.69824|.	0.93;0.966;0.966|.	T|T	0.72567|0.72567	-0.4254|-0.4254	10|5	0.33940|.	T|.	0.23|.	.|.	12.7674|12.7674	0.57399|0.57399	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	38;38;38|.	A4D0S8;Q149N5;Q8N1I0|.	.;.;DOCK4_HUMAN|.	T|R	26;38;38;26;37|26	ENSP00000410746:K38T;ENSP00000404179:K38T|.	ENSP00000345432:K26T|.	K|S	-|-	2|1	0|0	DOCK4|DOCK4	111431347|111431347	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	6.995000|6.995000	0.76257|0.76257	2.270000|2.270000	0.75569|0.75569	0.460000|0.460000	0.39030|0.39030	AAG|AGT	DOCK4	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000128512		0.393	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	-	0.00	46	0	T	NM_014705		111644111	-1	tier1	-	no_errors	ENST00000428084	ensembl	human	known	74_37	missense	37.50	35	21	SNP	1.000	G
DOPEY2	9980	genome.wustl.edu	37	21	37609579	37609579	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:37609579delG	ENST00000399151.3	+	16	2727	c.2642delG	c.(2641-2643)tggfs	p.W881fs		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	881					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CGTGTGCTTTGGAATCAGCTG	0.587																																																	0													102.0	87.0	92.0					21																	37609579		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2642delG	21.37:g.37609579delG	ENSP00000382104:p.Trp881fs		D3DSG5|Q6PJQ7|Q9UEZ3	Frame_Shift_Del	DEL	pfam_Dopey_N	p.W881fs	ENST00000399151.3	37	c.2642	CCDS13643.1	21																																																																																			DOPEY2	-	NULL	ENSG00000142197		0.587	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1		0.00	42	0	G	NM_005128		37609579	+1	tier1		no_errors	ENST00000399151	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
DSG3	1830	genome.wustl.edu	37	18	29055707	29055707	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:29055707G>T	ENST00000257189.4	+	16	2567	c.2484G>T	c.(2482-2484)gtG>gtT	p.V828V		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	828					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTTCTCCTGTGGGCTCCGTGG	0.473																																																	0													128.0	120.0	123.0					18																	29055707		2203	4300	6503	SO:0001819	synonymous_variant	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2484G>T	18.37:g.29055707G>T			A8K2V2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.V828	ENST00000257189.4	37	c.2484	CCDS11898.1	18																																																																																			DSG3	-	pfam_Cadherin_cytoplasmic-dom,prints_Desmoglein,prints_Desmosomal_cadherin	ENSG00000134757		0.473	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1		0.00	54	0	G	NM_001944		29055707	+1			no_errors	ENST00000257189	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.003	T
DUSP22	56940	genome.wustl.edu	37	6	350907	350907	+	3'UTR	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:350907T>G	ENST00000344450.5	+	0	1037				DUSP22_ENST00000604971.1_3'UTR|DUSP22_ENST00000419235.2_3'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		ACCCACAGAGTTTAGGCTGGT	0.393																																																	0													75.0	73.0	73.0					6																	350907		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.*39T>G	6.37:g.350907T>G			B4DK56|Q59GW2|Q5VWR2|Q96AR1	RNA	SNP	-	NULL	ENST00000344450.5	37	NULL	CCDS4468.1	6																																																																																			DUSP22	-	-	ENSG00000112679		0.393	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	HGNC	protein_coding	OTTHUMT00000039621.1	-	0.00	111	0	T	NM_020185		350907	+1	tier1	-	no_errors	ENST00000604988	ensembl	human	known	74_37	rna	17.76	88	19	SNP	0.006	G
EBAG9	9166	genome.wustl.edu	37	8	110567089	110567089	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:110567089G>T	ENST00000337573.5	+	4	594	c.294G>T	c.(292-294)atG>atT	p.M98I	EBAG9_ENST00000529502.1_3'UTR|EBAG9_ENST00000531677.1_Missense_Mutation_p.M98I|EBAG9_ENST00000395785.2_Missense_Mutation_p.M98I	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9	98					regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)	p.M98I(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			TTAAGGACATGACACCAACTA	0.348																																																	1	Substitution - Missense(1)	large_intestine(1)											123.0	113.0	117.0					8																	110567089		2203	4300	6503	SO:0001583	missense	0			AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.294G>T	8.37:g.110567089G>T	ENSP00000337675:p.Met98Ile		A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Missense_Mutation	SNP	pirsf_Cancer-assoc_antigen_RCAS1	p.M98I	ENST00000337573.5	37	c.294	CCDS6313.1	8	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907214	0.92107	.	.	ENSG00000147654	ENST00000395785;ENST00000529931;ENST00000337573;ENST00000530629;ENST00000531677	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.82412	0.5031	M	0.79475	2.455	0.80722	D	1	D	0.53745	0.962	D	0.66716	0.946	D	0.83818	0.0245	9	0.87932	D	0	7.8429	18.8249	0.92114	0.0:0.0:1.0:0.0	.	98	O00559	RCAS1_HUMAN	I	98;1;98;98;98	.	ENSP00000337675:M98I	M	+	3	0	EBAG9	110636265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.770000	0.95276	0.655000	0.94253	ATG	EBAG9	-	pirsf_Cancer-assoc_antigen_RCAS1	ENSG00000147654		0.348	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBAG9	HGNC	protein_coding	OTTHUMT00000383536.1		0.00	35	0	G	NM_004215		110567089	+1			no_errors	ENST00000337573	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
EGF	1950	genome.wustl.edu	37	4	110904673	110904673	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:110904673C>A	ENST00000265171.5	+	16	2912	c.2467C>A	c.(2467-2469)Cta>Ata	p.L823I	EGF_ENST00000509793.1_Missense_Mutation_p.L781I|EGF_ENST00000503392.1_Missense_Mutation_p.L823I	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	823					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TCAACACATGCTAGTGGCTGA	0.378																																																	0													111.0	102.0	105.0					4																	110904673		2203	4300	6503	SO:0001583	missense	0			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2467C>A	4.37:g.110904673C>A	ENSP00000265171:p.Leu823Ile		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.L823I	ENST00000265171.5	37	c.2467	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286588	0.23478	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.88354	-2.37;-2.28;-1.94	5.44	4.59	0.56863	.	0.367903	0.27375	N	0.019642	D	0.85847	0.5792	L	0.60012	1.86	0.34884	D	0.744886	B;B;B	0.33940	0.307;0.433;0.307	B;B;B	0.40009	0.168;0.316;0.168	D	0.84685	0.0719	10	0.25751	T	0.34	.	6.2901	0.21054	0.0:0.7634:0.0:0.2366	.	823;781;823	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	I	781;823;823	ENSP00000424316:L781I;ENSP00000265171:L823I;ENSP00000421384:L823I	ENSP00000265171:L823I	L	+	1	2	EGF	111124122	0.022000	0.18835	0.285000	0.24819	0.037000	0.13140	0.313000	0.19415	2.558000	0.86282	0.655000	0.94253	CTA	EGF	-	pirsf_Pro-epidermal_GF	ENSG00000138798		0.378	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	-	0.00	46	0	C			110904673	+1	tier1	-	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.518	A
ELAVL4	1996	genome.wustl.edu	37	1	50572048	50572048	+	5'Flank	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:50572048A>C	ENST00000371823.4	+	0	0				ELAVL4_ENST00000357083.4_Silent_p.R15R|ELAVL4_ENST00000371827.1_Intron|ELAVL4_ENST00000371824.1_5'Flank|ELAVL4_ENST00000448907.2_Intron	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4						mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TAATGAGTCAAGAAACTGCTC	0.453																																																	0													90.0	84.0	86.0					1																	50572048		1568	3582	5150	SO:0001631	upstream_gene_variant	0			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877		1.37:g.50572048A>C	Exception_encountered		B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,prints_Hud_Sxl_RNA,pfscan_RRM_dom,tigrfam_ELAD_HUD_SF	p.R15	ENST00000371823.4	37	c.43	CCDS553.1	1																																																																																			ELAVL4	-	NULL	ENSG00000162374		0.453	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	ELAVL4	HGNC	protein_coding	OTTHUMT00000021712.1	-	0.00	45	0	A	NM_021952		50572048	+1	tier1	-	no_errors	ENST00000357083	ensembl	human	known	74_37	silent	15.62	27	5	SNP	1.000	C
ELMO1	9844	genome.wustl.edu	37	7	37251073	37251073	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:37251073T>C	ENST00000310758.4	-	13	1651	c.1004A>G	c.(1003-1005)gAg>gGg	p.E335G	ELMO1_ENST00000442504.1_Missense_Mutation_p.E335G|ELMO1_ENST00000448602.1_Missense_Mutation_p.E335G	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	335	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						AGGTTCAGACTCAGCATCAAA	0.433																																																	0													169.0	130.0	143.0					7																	37251073		2203	4300	6503	SO:0001583	missense	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1004A>G	7.37:g.37251073T>C	ENSP00000312185:p.Glu335Gly		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.E335G	ENST00000310758.4	37	c.1004	CCDS5449.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.2|28.2	4.897246|4.897246	0.91962|0.91962	.|.	.|.	ENSG00000155849|ENSG00000155849	ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602;ENST00000424212|ENST00000433246	T;T;T;T|.	0.38077|.	2.32;2.32;2.32;1.16|.	4.9|4.9	4.9|4.9	0.64082|0.64082	Engulfment/cell motility, ELMO (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69602|0.69602	0.3129|0.3129	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	P|.	0.45768|.	0.866|.	P|.	0.48873|.	0.593|.	T|T	0.68659|0.68659	-0.5350|-0.5350	10|5	0.66056|.	D|.	0.02|.	.|.	15.2288|15.2288	0.73372|0.73372	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	335|.	Q92556|.	ELMO1_HUMAN|.	G|G	335;239;335;335;76|115	ENSP00000312185:E335G;ENSP00000406952:E335G;ENSP00000394458:E335G;ENSP00000395933:E76G|.	ENSP00000312185:E335G|.	E|S	-|-	2|1	0|0	ELMO1|ELMO1	37217598|37217598	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.921000|0.921000	0.55340|0.55340	7.997000|7.997000	0.88414|0.88414	2.142000|2.142000	0.66516|0.66516	0.402000|0.402000	0.26972|0.26972	GAG|AGT	ELMO1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000155849		0.433	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	62	0	T	NM_130442		37251073	-1	tier1	-	no_errors	ENST00000310758	ensembl	human	known	74_37	missense	42.86	52	39	SNP	1.000	C
EML6	400954	genome.wustl.edu	37	2	55155514	55155514	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:55155514T>C	ENST00000356458.6	+	26	4260	c.3740T>C	c.(3739-3741)cTg>cCg	p.L1247P		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1247						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GTGAGGTGGCTGCACAATGAC	0.567																																																	0													80.0	74.0	76.0					2																	55155514		692	1591	2283	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.3740T>C	2.37:g.55155514T>C	ENSP00000348842:p.Leu1247Pro		A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1247P	ENST00000356458.6	37	c.3740	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	T	17.53	3.411790	0.62399	.	.	ENSG00000214595	ENST00000356458	T	0.04917	3.53	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.09730	0.0239	L	0.52126	1.63	0.80722	D	1	B	0.33379	0.41	B	0.34489	0.184	T	0.04840	-1.0923	9	0.52906	T	0.07	.	16.1924	0.82000	0.0:0.0:0.0:1.0	.	1247	Q6ZMW3	EMAL6_HUMAN	P	1247	ENSP00000348842:L1247P	ENSP00000348842:L1247P	L	+	2	0	EML6	55009018	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.748000	0.68697	2.287000	0.76781	0.482000	0.46254	CTG	EML6	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat	ENSG00000214595		0.567	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3		0.00	20	0	T	XM_001725002		55155514	+1			no_errors	ENST00000356458	ensembl	human	novel	74_37	missense	12.50	28	4	SNP	1.000	C
SNORA25	684959	genome.wustl.edu	37	3	32079062	32079062	+	RNA	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:32079062C>A	ENST00000364831.1	+	0	45									small nucleolar RNA, H/ACA box 25																		ACCAAGAGCTCTTAACACTGC	0.343																																																	0																																												0			AJ609461		11q21	2013-09-05			ENSG00000207112	ENSG00000207112		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32615	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_003028		Approved	ACA25	uc021orm.1				3.37:g.32079062C>A				RNA	SNP	-	NULL	ENST00000364831.1	37	NULL		3																																																																																			SNORA25	-	-	ENSG00000201701		0.343	SNORA25.8-201	NOVEL	basic	snoRNA	ENSG00000201701	RFAM	snoRNA		-	0.00	32	0	C	NR_003028		32079062	+1	tier1	-	no_errors	ENST00000364831	ensembl	human	novel	74_37	rna	11.11	32	4	SNP	0.486	A
LOC101927209	101927209	genome.wustl.edu	37	1	142713417	142713417	+	lincRNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:142713417T>G	ENST00000610091.1	-	0	2241																											CTCATTCTTATCTTCTACTTC	0.313																																																	0																																												0																															1.37:g.142713417T>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.313	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	126	0	T			142713417	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	27.97	103	40	SNP	0.133	G
LOC102724710	102724710	genome.wustl.edu	37	8	93647645	93647645	+	lincRNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:93647645T>G	ENST00000523284.1	-	0	272				AC091096.1_ENST00000408245.1_RNA																							tgggacatacttgtactaaaa	0.289																																																	0																																												0																															8.37:g.93647645T>G				RNA	SNP	-	NULL	ENST00000523284.1	37	NULL		8																																																																																			AC091096.1	-	-	ENSG00000221172		0.289	RP11-587H10.2-001	KNOWN	basic	lincRNA	ENSG00000221172	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000377512.1	-	0.00	72	0	T			93647645	+1	tier1	-	no_errors	ENST00000408245	ensembl	human	novel	74_37	rna	12.33	64	9	SNP	0.000	G
DCDC1	341019	genome.wustl.edu	37	11	31227354	31227354	+	Intron	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:31227354A>C	ENST00000597505.1	-	7	1221				AL162614.1_ENST00000408702.1_RNA			P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					tttcaatataagtatgtccca	0.284																																																	0																																										SO:0001627	intron_variant	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1221+35642T>G	11.37:g.31227354A>C			A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000597505.1	37	NULL		11																																																																																			AL162614.1	-	-	ENSG00000221629		0.284	DCDC1-010	PUTATIVE	basic	protein_coding	ENSG00000221629	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000463167.1	-	0.00	122	0	A	NM_181807		31227354	+1	tier1	-	no_errors	ENST00000408702	ensembl	human	novel	74_37	rna	21.43	87	24	SNP	0.081	C
AC027238.1	0	genome.wustl.edu	37	8	122199002	122199002	+	RNA	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:122199002G>T	ENST00000408717.1	-	0	130																											GAATGTGGAAGACACTGAATG	0.383																																																	0																																												0																															8.37:g.122199002G>T				RNA	SNP	-	NULL	ENST00000408717.1	37	NULL		8																																																																																			AC027238.1	-	-	ENSG00000221644		0.383	AC027238.1-201	NOVEL	basic	miRNA	ENSG00000221644	Clone_based_ensembl_gene	miRNA		-	0.00	53	0	G			122199002	-1	tier1	-	no_errors	ENST00000408717	ensembl	human	novel	74_37	rna	7.02	53	4	SNP	0.000	T
AGBL4	84871	genome.wustl.edu	37	1	50447936	50447936	+	Intron	SNP	G	G	A	rs551764089		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:50447936G>A	ENST00000371839.1	-	1	151				AL645730.1_ENST00000408819.1_RNA|AGBL4_ENST00000371836.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ccagggctgcgctccacagag	0.592																																																	0																																										SO:0001627	intron_variant	0			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.34+41498C>T	1.37:g.50447936G>A			B3KT26|B4DG37	RNA	SNP	-	NULL	ENST00000371839.1	37	NULL	CCDS44137.1	1																																																																																			AL645730.1	-	-	ENSG00000221746		0.592	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221746	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000021346.4	-	0.00	38	0	G	NM_032785		50447936	+1	tier1	-	no_errors	ENST00000408819	ensembl	human	novel	74_37	rna	16.67	25	5	SNP	0.118	A
LOC730100	730100	genome.wustl.edu	37	2	51662340	51662340	+	lincRNA	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:51662340A>C	ENST00000440698.1	+	0	694				AC007402.1_ENST00000410760.1_RNA																							cttttgcaccaacctaatagc	0.328																																																	0																																												0																															2.37:g.51662340A>C				RNA	SNP	-	NULL	ENST00000440698.1	37	NULL		2																																																																																			AC007402.1	-	-	ENSG00000222692		0.328	AC007682.1-001	KNOWN	mRNA_start_NF|basic	lincRNA	ENSG00000222692	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000291399.3	-	0.00	37	0	A			51662340	-1	tier1	-	no_errors	ENST00000410760	ensembl	human	novel	74_37	rna	11.76	30	4	SNP	0.083	C
AP001347.6	0	genome.wustl.edu	37	21	15399751	15399751	+	RNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:15399751C>T	ENST00000428809.1	+	0	10				AP001347.6_ENST00000448463.1_RNA|AP001347.6_ENST00000432621.1_RNA																							GAATCTGGCGCGGCCTTTGTC	0.637																																																	0																																												0																															21.37:g.15399751C>T				RNA	SNP	-	NULL	ENST00000428809.1	37	NULL		21																																																																																			AP001347.6	-	-	ENSG00000224905		0.637	AP001347.6-001	KNOWN	basic	antisense	ENSG00000224905	Clone_based_vega_gene	antisense	OTTHUMT00000157812.1		0.00	37	0	C			15399751	+1			no_errors	ENST00000428809	ensembl	human	known	74_37	rna	17.86	22	5	SNP	0.003	T
FBXO18	84893	genome.wustl.edu	37	10	5978919	5978919	+	Intron	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:5978919G>A	ENST00000362091.4	+	21	3076				FBXO18_ENST00000397269.3_Intron|FBXO18_ENST00000379999.5_Intron|RP11-536K7.3_ENST00000397264.4_RNA	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GGTGCTGTGGGAGGTGTTACT	0.483																																																	0																																										SO:0001627	intron_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2962-154G>A	10.37:g.5978919G>A			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	-	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			RP11-536K7.3	-	-	ENSG00000232807		0.483	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232807	Clone_based_vega_gene	protein_coding	OTTHUMT00000046596.1	-	0.00	40	0	G	NM_032807		5978919	-1	tier1	-	no_errors	ENST00000397264	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.000	A
RP11-255H23.4	0	genome.wustl.edu	37	19	24014802	24014802	+	lincRNA	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:24014802T>C	ENST00000599944.1	-	0	150				RP11-255H23.2_ENST00000471224.1_RNA																							AACCTTTAATTGGTCCTCAAT	0.323																																																	0																																												0																															19.37:g.24014802T>C				RNA	SNP	-	NULL	ENST00000599944.1	37	NULL		19																																																																																			RP11-255H23.2	-	-	ENSG00000233836		0.323	RP11-255H23.4-001	KNOWN	basic	lincRNA	ENSG00000233836	Clone_based_vega_gene	lincRNA	OTTHUMT00000466442.1	-	0.00	20	0	T			24014802	+1	tier1	-	no_errors	ENST00000471224	ensembl	human	known	74_37	rna	17.02	39	8	SNP	0.000	C
CUBNP1	728064	genome.wustl.edu	37	10	43199458	43199458	+	lincRNA	SNP	A	A	C	rs7899278	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:43199458A>C	ENST00000439913.1	+	0	1522																											ACTAACCAGAAGTATGATAGT	0.408																																																	0																																												0																															10.37:g.43199458A>C				RNA	SNP	-	NULL	ENST00000439913.1	37	NULL		10																																																																																			AL022344.5	-	-	ENSG00000234864		0.408	AL022344.5-001	KNOWN	basic	lincRNA	ENSG00000234864	Clone_based_vega_gene	lincRNA	OTTHUMT00000047688.1	-	0.00	141	0	A			43199458	+1	tier1	-	no_errors	ENST00000439913	ensembl	human	known	74_37	rna	27.45	111	42	SNP	0.997	C
MMP16	4325	genome.wustl.edu	37	8	89339272	89339272	+	Intron	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:89339272C>T	ENST00000286614.6	-	1	414				RP11-586K2.1_ENST00000521433.1_RNA|RP11-586K2.1_ENST00000523254.1_RNA|RP11-586K2.1_ENST00000520849.1_RNA|MMP16_ENST00000544227.1_Intron	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)						chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GCCCAGGCAGCGGGGGGAGGA	0.537																																																	0													71.0	66.0	67.0					8																	89339272		2203	4300	6503	SO:0001627	intron_variant	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.132+31G>A	8.37:g.89339272C>T			B2RAN7|Q14824|Q52H48	RNA	SNP	-	NULL	ENST00000286614.6	37	NULL	CCDS6246.1	8																																																																																			RP11-586K2.1	-	-	ENSG00000253553		0.537	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253553	Clone_based_vega_gene	protein_coding	OTTHUMT00000375304.2	-	0.00	37	0	C	NM_005941		89339272	+1	tier1	-	no_errors	ENST00000523254	ensembl	human	known	74_37	rna	15.15	28	5	SNP	0.005	T
RP11-281O15.4	0	genome.wustl.edu	37	5	178396539	178396539	+	RNA	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:178396539T>A	ENST00000519491.1	+	0	149																											AGGGACAGACTTGGCCACCTG	0.527																																																	0																																												0																															5.37:g.178396539T>A				RNA	SNP	-	NULL	ENST00000519491.1	37	NULL		5	.	.	.	.	.	.	.	.	.	.	T	3.780	-0.045927	0.07452	.	.	ENSG00000113262	ENST00000319065	.	.	.	2.04	-2.46	0.06461	.	.	.	.	.	T	0.26085	0.0636	.	.	.	0.09310	N	1.0	.	.	.	.	.	.	T	0.36768	-0.9734	4	0.87932	D	0	.	0.1518	0.00094	0.2388:0.167:0.2434:0.3508	.	.	.	.	M	986	.	ENSP00000325675:K986M	K	-	2	0	GRM6	178329145	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.044000	0.12023	-0.582000	0.05929	-0.509000	0.04479	AAG	RP11-281O15.4	-	-	ENSG00000254035		0.527	RP11-281O15.4-001	KNOWN	basic|exp_conf	antisense	ENSG00000254035	Clone_based_vega_gene	antisense	OTTHUMT00000374376.1	-	0.00	101	0	T			178396539	+1	tier1	-	no_errors	ENST00000519491	ensembl	human	known	74_37	rna	24.44	34	11	SNP	0.000	A
CHMP1B	57132	genome.wustl.edu	37	18	11852337	11852338	+	3'UTR	DNP	GC	GC	AT			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:11852337_11852338GC>AT	ENST00000526991.2	+	0	943_944				RP11-78A19.3_ENST00000586474.1_RNA|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000535121.1_Intron|GNAL_ENST00000269162.5_Intron|GNAL_ENST00000334049.6_Intron	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B						cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						TATTTTTATAGCAGCCTTTTAA	0.361																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	Exception_encountered	18.37:g.11852337_11852338delinsAT			Q96E89|Q9HD41	RNA	SNP	-	NULL	ENST00000526991.2	37	NULL	CCDS54180.1	18																																																																																			RP11-78A19.3	-	-	ENSG00000267165		0.361	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267165	Clone_based_vega_gene	protein_coding	OTTHUMT00000386375.2	-	0.00	59	0	G|C	NM_020412		11852337|11852338	-1	tier1	-	no_errors	ENST00000586474	ensembl	human	known	74_37	rna	23.91	35	11	SNP	1.000	A|T
EPHA3	2042	genome.wustl.edu	37	3	89448604	89448604	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:89448604A>G	ENST00000336596.2	+	7	1793	c.1568A>G	c.(1567-1569)aAg>aGg	p.K523R	EPHA3_ENST00000452448.2_Missense_Mutation_p.K523R|EPHA3_ENST00000494014.1_Missense_Mutation_p.K523R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	523	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AACAGCCGCAAGTTTGAGTTT	0.458										TSP Lung(6;0.00050)																																							0													106.0	99.0	101.0					3																	89448604		2203	4300	6503	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1568A>G	3.37:g.89448604A>G	ENSP00000337451:p.Lys523Arg		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.K523R	ENST00000336596.2	37	c.1568	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	A	11.18	1.562784	0.27915	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.53423	0.62;0.62;0.62	5.53	5.53	0.82687	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.151132	0.64402	D	0.000010	T	0.33498	0.0865	N	0.14661	0.345	0.44181	D	0.996997	P;B	0.35433	0.501;0.356	B;B	0.36922	0.081;0.236	T	0.14811	-1.0459	9	.	.	.	.	15.6643	0.77213	1.0:0.0:0.0:0.0	.	523;523	P29320;P29320-2	EPHA3_HUMAN;.	R	523	ENSP00000337451:K523R;ENSP00000399926:K523R;ENSP00000419190:K523R	.	K	+	2	0	EPHA3	89531294	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.023000	0.57211	2.107000	0.64212	0.460000	0.39030	AAG	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000044524		0.458	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	-	0.00	40	0	A	NM_005233		89448604	+1	tier1	-	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	G
EPHB6	2051	genome.wustl.edu	37	7	142567600	142567600	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:142567600C>A	ENST00000392957.2	+	17	3275	c.2488C>A	c.(2488-2490)Cca>Aca	p.P830T	EPHB6_ENST00000442129.1_Missense_Mutation_p.P830T|EPHB6_ENST00000411471.2_Missense_Mutation_p.P553T	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	830	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CTGGGCAGCCCCAGAGGTCAT	0.448																																																	0													103.0	91.0	95.0					7																	142567600		2203	4300	6503	SO:0001583	missense	0			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2488C>A	7.37:g.142567600C>A	ENSP00000376684:p.Pro830Thr		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P830T	ENST00000392957.2	37	c.2488	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916067	0.92178	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	D;D;D	0.89875	-2.58;-2.58;-2.58	5.69	5.69	0.88448	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46442	D	0.000300	D	0.97065	0.9041	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.98358	1.0547	10	0.87932	D	0	.	18.8176	0.92084	0.0:1.0:0.0:0.0	.	830;553	O15197;O15197-2	EPHB6_HUMAN;.	T	830;830;553	ENSP00000376684:P830T;ENSP00000410789:P830T;ENSP00000409061:P553T	ENSP00000376684:P830T	P	+	1	0	EPHB6	142277722	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.676000	0.84012	2.682000	0.91365	0.563000	0.77884	CCA	EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000106123		0.448	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1	-	0.00	47	0	C			142567600	+1	tier1	-	no_errors	ENST00000392957	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	A
ERO1LB	56605	genome.wustl.edu	37	1	236390006	236390006	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:236390006A>C	ENST00000354619.5	-	11	947	c.746T>G	c.(745-747)cTt>cGt	p.L249R		NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	249					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TCCCGATATAAGCTTATAGAA	0.318																																																	0													73.0	79.0	77.0					1																	236390006		2199	4296	6495	SO:0001583	missense	0			AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.746T>G	1.37:g.236390006A>C	ENSP00000346635:p.Leu249Arg		B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	pfam_Ero1,pirsf_Ero1	p.L249R	ENST00000354619.5	37	c.746	CCDS31064.1	1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423775	0.83667	.	.	ENSG00000086619	ENST00000354619	T	0.61392	0.11	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.82296	0.5006	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.87058	0.2151	10	0.87932	D	0	-18.0048	16.3547	0.83232	1.0:0.0:0.0:0.0	.	249	Q86YB8	ERO1B_HUMAN	R	249	ENSP00000346635:L249R	ENSP00000346635:L249R	L	-	2	0	ERO1LB	234456629	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.858000	0.92256	2.263000	0.75096	0.472000	0.43445	CTT	ERO1LB	-	pfam_Ero1,pirsf_Ero1	ENSG00000086619		0.318	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1LB	HGNC	protein_coding	OTTHUMT00000096371.1	-	0.00	53	0	A	NM_019891		236390006	-1	tier1	-	no_errors	ENST00000354619	ensembl	human	known	74_37	missense	20.27	58	15	SNP	1.000	C
EYA2	2139	genome.wustl.edu	37	20	45725790	45725790	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:45725790G>A	ENST00000327619.5	+	9	1245	c.871G>A	c.(871-873)Gca>Aca	p.A291T	EYA2_ENST00000357410.3_Missense_Mutation_p.A291T|EYA2_ENST00000317304.6_Missense_Mutation_p.A291T	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	291					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				GGGGACATTTGCATCCAGATA	0.418																																					Pancreas(120;56 1725 18501 25218 43520)												0													251.0	233.0	239.0					20																	45725790		2203	4300	6503	SO:0001583	missense	0				CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.871G>A	20.37:g.45725790G>A	ENSP00000333640:p.Ala291Thr		Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.A291T	ENST00000327619.5	37	c.871	CCDS13403.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.437750	0.96168	.	.	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304;ENST00000458636	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	5.91	5.91	0.95273	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.051347	0.85682	D	0.000000	D	0.92573	0.7641	M	0.85945	2.785	0.80722	D	1	D;D;D;D	0.76494	0.999;0.984;0.996;0.996	D;P;P;P	0.83275	0.996;0.781;0.799;0.799	D	0.92794	0.6251	10	0.87932	D	0	0.4562	20.2985	0.98592	0.0:0.0:1.0:0.0	.	291;291;291;291	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	T	291;291;291;291;162	ENSP00000333640:A291T;ENSP00000349986:A291T;ENSP00000321590:A291T;ENSP00000395427:A162T	ENSP00000321590:A291T	A	+	1	0	EYA2	45159197	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	8.904000	0.92590	2.793000	0.96121	0.655000	0.94253	GCA	EYA2	-	pfam_HAD-like_dom,tigrfam_EYA	ENSG00000064655		0.418	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA2	HGNC	protein_coding	OTTHUMT00000080326.2	-	0.00	65	0	G	NM_005244		45725790	+1	tier1	-	no_errors	ENST00000327619	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
EYS	346007	genome.wustl.edu	37	6	65301485	65301485	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:65301485A>C	ENST00000370621.3	-	26	4801	c.4275T>G	c.(4273-4275)acT>acG	p.T1425T	EYS_ENST00000370616.2_Silent_p.T1425T|EYS_ENST00000503581.1_Silent_p.T1425T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1425					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TAATTACTGAAGTCGTTGGGG	0.398																																																	0													61.0	57.0	58.0					6																	65301485		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4275T>G	6.37:g.65301485A>C			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1425	ENST00000370621.3	37	c.4275		6																																																																																			EYS	-	NULL	ENSG00000188107		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	39	0	A	XM_294050		65301485	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.997	C
FAM178B	51252	genome.wustl.edu	37	2	97652055	97652055	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:97652055C>T	ENST00000417561.3	-	4	377	c.378G>A	c.(376-378)ccG>ccA	p.P126P	FAM178B_ENST00000490605.2_5'UTR|FAM178B_ENST00000327896.3_5'UTR			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	126										large_intestine(1)|ovary(1)	2						CCACATAGGGCGGGAAGGGCA	0.652																																																	0																																										SO:0001819	synonymous_variant	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.378G>A	2.37:g.97652055C>T			A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	NULL	p.P126	ENST00000417561.3	37	c.378		2																																																																																			FAM178B	-	NULL	ENSG00000168754		0.652	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding		-	0.00	35	0	C	NM_016490		97652055	-1	tier1	-	no_errors	ENST00000417561	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.001	T
FAM181A	90050	genome.wustl.edu	37	14	94394744	94394744	+	Missense_Mutation	SNP	G	G	A	rs144265486		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:94394744G>A	ENST00000267594.5	+	3	606	c.299G>A	c.(298-300)cGc>cAc	p.R100H	FAM181A_ENST00000556222.1_Missense_Mutation_p.R38H|FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Missense_Mutation_p.R38H|FAM181A_ENST00000557719.1_Missense_Mutation_p.R38H	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	100										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GTGGACCATCGCAAGTACCTG	0.612																																																	0								G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	50.0	46.0	48.0		113,113,113,113,299	4.7	1.0	14	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	FAM181A	NM_001207071.1,NM_001207072.1,NM_001207073.1,NM_001207074.1,NM_138344.4	29,29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	38/293,38/293,38/293,38/293,100/355	94394744	1,13005	2203	4300	6503	SO:0001583	missense	0			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.299G>A	14.37:g.94394744G>A	ENSP00000267594:p.Arg100His		B2RD39|Q96GY1	Missense_Mutation	SNP	NULL	p.R100H	ENST00000267594.5	37	c.299	CCDS9914.1	14	.	.	.	.	.	.	.	.	.	.	G	31	5.061840	0.93846	0.0	1.16E-4	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000554404;ENST00000557000	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	4.65	4.65	0.58169	.	0.000000	0.53938	D	0.000046	D	0.84701	0.5530	M	0.64404	1.975	0.54753	D	0.999982	D	0.89917	1.0	D	0.91635	0.999	D	0.86860	0.2029	10	0.87932	D	0	-33.6334	17.5352	0.87829	0.0:0.0:1.0:0.0	.	100	Q8N9Y4	F181A_HUMAN	H	38;100;38;38;89	ENSP00000451802:R38H;ENSP00000267594:R100H;ENSP00000451678:R38H;ENSP00000452393:R38H	ENSP00000267594:R100H	R	+	2	0	FAM181A	93464497	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.841000	0.99482	2.148000	0.66965	0.491000	0.48974	CGC	FAM181A	-	NULL	ENSG00000140067		0.612	FAM181A-001	KNOWN	basic|CCDS	protein_coding	FAM181A	HGNC	protein_coding	OTTHUMT00000412840.1	-	0.00	67	0	G	NM_138344		94394744	+1	tier1	rs144265486	no_errors	ENST00000267594	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
FAM21FP	100288690	genome.wustl.edu	37	10	46214794	46214794	+	IGR	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:46214794T>G								ZFAND4 (46566 upstream) : FAM21FP (6929 downstream)																							CCTGGGGGGCTTCCGTGAAGA	0.488																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.46214794T>G				RNA	SNP	-	NULL		37	NULL		10																																																																																			FAM21FP	-	-	ENSG00000237840	0	0.488					FAM21FP	HGNC			-	0.00	83	0	T			46214794	-1	tier1	-	no_errors	ENST00000608251	ensembl	human	known	74_37	rna	13.68	82	13	SNP	0.127	G
FAM83D	81610	genome.wustl.edu	37	20	37555323	37555325	+	In_Frame_Del	DEL	GCG	GCG	-	rs570408132	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:37555323_37555325delGCG	ENST00000217429.4	+	1	369_371	c.328_330delGCG	c.(328-330)gcgdel	p.A116del		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	86					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				AGAGGAGGGCgcggcggcggcgg	0.719														78	0.0155751	0.056	0.0029	5008	,	,		15546	0.0		0.0	False		,,,				2504	0.002																0										14,115,1361		5,0,4,42,31,663						2.4	1.0			2	250,104,3726		71,1,107,26,51,1784	no	codingComplex	FAM83D	NM_030919.2		76,1,111,68,82,2447	A1A1,A1A2,A1R,A2A2,A2R,RR		8.6765,8.6577,8.6715				264,219,5087				SO:0001651	inframe_deletion	0			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.328_330delGCG	20.37:g.37555332_37555334delGCG	ENSP00000217429:p.Ala116del		B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	In_Frame_Del	DEL	pfam_DUF1669	p.A113in_frame_del	ENST00000217429.4	37	c.328_330	CCDS42872.1	20																																																																																			FAM83D	-	pfam_DUF1669	ENSG00000101447		0.719	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83D	HGNC	protein_coding	OTTHUMT00000079211.1		0.00	8	0	GCG			37555325	+1	tier1		no_errors	ENST00000217429	ensembl	human	known	74_37	in_frame_del	33.33	6	3	DEL	0.991:0.983:0.979	-
FASTKD5	60493	genome.wustl.edu	37	20	3128913	3128913	+	Nonsense_Mutation	SNP	A	A	T	rs371948260		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:3128913A>T	ENST00000380266.3	-	2	1125	c.804T>A	c.(802-804)taT>taA	p.Y268*	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000217173.2_Intron|UBOX5_ENST00000348031.2_Intron	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	268					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						GCAAATTAAGATAACTAGAAA	0.388																																																	0													50.0	53.0	52.0					20																	3128913		2201	4300	6501	SO:0001587	stop_gained	0			BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.804T>A	20.37:g.3128913A>T	ENSP00000369618:p.Tyr268*		Q96JN3|Q9H5D1|Q9H8Y3	Nonsense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.Y268*	ENST00000380266.3	37	c.804	CCDS13048.1	20	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633496	0.67015	.	.	ENSG00000215251	ENST00000380266	.	.	.	5.77	-5.09	0.02920	.	0.080371	0.51477	D	0.000087	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.68	14.8968	0.70649	0.4732:0.0:0.5268:0.0	.	.	.	.	X	268	.	ENSP00000369618:Y268X	Y	-	3	2	FASTKD5	3076913	0.006000	0.16342	0.967000	0.41034	0.222000	0.24845	-0.942000	0.03921	-0.778000	0.04566	0.377000	0.23210	TAT	FASTKD5	-	NULL	ENSG00000215251		0.388	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD5	HGNC	protein_coding	OTTHUMT00000077701.2	-	0.00	33	0	A	NM_021826		3128913	-1	tier1	-	no_errors	ENST00000380266	ensembl	human	known	74_37	nonsense	40.00	24	16	SNP	0.825	T
FAT2	2196	genome.wustl.edu	37	5	150901022	150901022	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:150901022T>C	ENST00000261800.5	-	18	11144	c.11132A>G	c.(11131-11133)gAg>gGg	p.E3711G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3711					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACTGAATGCTCCATCTCCTT	0.557																																																	0													80.0	79.0	79.0					5																	150901022		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.11132A>G	5.37:g.150901022T>C	ENSP00000261800:p.Glu3711Gly		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.E3711G	ENST00000261800.5	37	c.11132	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421138	0.83559	.	.	ENSG00000086570	ENST00000261800	T	0.74315	-0.83	5.76	4.58	0.56647	.	0.111959	0.41605	D	0.000846	T	0.80899	0.4712	M	0.62723	1.935	0.53688	D	0.999975	D;D	0.65815	0.995;0.995	P;P	0.57425	0.82;0.82	T	0.82129	-0.0610	10	0.72032	D	0.01	.	13.082	0.59119	0.0:0.0:0.1342:0.8658	.	3711;902	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	G	3711	ENSP00000261800:E3711G	ENSP00000261800:E3711G	E	-	2	0	FAT2	150881215	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	5.206000	0.65192	0.990000	0.38787	0.459000	0.35465	GAG	FAT2	-	NULL	ENSG00000086570		0.557	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	58	0	T	NM_001447		150901022	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	C
FAT3	120114	genome.wustl.edu	37	11	92534684	92534684	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:92534684A>G	ENST00000298047.6	+	9	8522	c.8505A>G	c.(8503-8505)caA>caG	p.Q2835Q	FAT3_ENST00000409404.2_Silent_p.Q2835Q|FAT3_ENST00000525166.1_Silent_p.Q2685Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2835	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AACTCACACAAGTGAGAGCTA	0.443										TCGA Ovarian(4;0.039)																																							0													48.0	49.0	49.0					11																	92534684		1922	4133	6055	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8505A>G	11.37:g.92534684A>G			B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Q2835	ENST00000298047.6	37	c.8505		11																																																																																			FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.443	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	47	0	A	NM_001008781		92534684	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	silent	33.33	24	12	SNP	0.983	G
FAT4	79633	genome.wustl.edu	37	4	126328260	126328260	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:126328260G>T	ENST00000394329.3	+	3	5546	c.5533G>T	c.(5533-5535)Gtg>Ttg	p.V1845L	FAT4_ENST00000335110.5_Missense_Mutation_p.V143L	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1845	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V1845L(4)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCCAGACCCGTGTACTCTTT	0.408																																																	4	Substitution - Missense(4)	lung(4)											133.0	130.0	131.0					4																	126328260		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5533G>T	4.37:g.126328260G>T	ENSP00000377862:p.Val1845Leu		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V1845L	ENST00000394329.3	37	c.5533	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	9.548	1.115053	0.20795	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01767	4.65;4.65	5.41	4.58	0.56647	Cadherin (2);Cadherin-like (1);	0.000000	0.31233	U	0.008019	T	0.01061	0.0035	N	0.05534	-0.03	0.27910	N	0.938631	B;B	0.26809	0.16;0.029	B;B	0.24006	0.05;0.022	T	0.44345	-0.9334	10	0.08179	T	0.78	.	10.3915	0.44171	0.07:0.0:0.7963:0.1337	.	143;1845	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	L	1845;143	ENSP00000377862:V1845L;ENSP00000335169:V143L	ENSP00000335169:V143L	V	+	1	0	FAT4	126547710	1.000000	0.71417	0.981000	0.43875	0.185000	0.23345	4.823000	0.62694	1.422000	0.47177	-0.127000	0.14921	GTG	FAT4	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2		0.00	39	0	G	NM_024582		126328260	+1			no_errors	ENST00000394329	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.949	T
FBN1	2200	genome.wustl.edu	37	15	48784701	48784701	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:48784701A>T	ENST00000316623.5	-	24	3266	c.2811T>A	c.(2809-2811)tgT>tgA	p.C937*		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	937	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTCCACTGGGACACTGACACT	0.348																																																	0													80.0	79.0	79.0					15																	48784701		2198	4296	6494	SO:0001587	stop_gained	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2811T>A	15.37:g.48784701A>T	ENSP00000325527:p.Cys937*		B2RUU0|D2JYH6|Q15972|Q75N87	Nonsense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C937*	ENST00000316623.5	37	c.2811	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	A	44	10.863676	0.99480	.	.	ENSG00000166147	ENST00000316623	.	.	.	6.17	-3.83	0.04269	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8911	0.79299	0.3836:0.0:0.6164:0.0	.	.	.	.	X	937	.	ENSP00000325527:C937X	C	-	3	2	FBN1	46571993	0.996000	0.38824	0.980000	0.43619	0.985000	0.73830	0.426000	0.21363	-0.514000	0.06488	-0.263000	0.10527	TGT	FBN1	-	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.348	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	64	0	A			48784701	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	nonsense	14.55	47	8	SNP	0.969	T
FBXL13	222235	genome.wustl.edu	37	7	102604101	102604101	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:102604101G>T	ENST00000313221.4	-	8	1029	c.603C>A	c.(601-603)tcC>tcA	p.S201S	FBXL13_ENST00000455112.2_Silent_p.S201S|FBXL13_ENST00000379308.3_Silent_p.S201S|FBXL13_ENST00000379305.3_Silent_p.S201S|FBXL13_ENST00000393772.2_Silent_p.S201S|FBXL13_ENST00000456695.1_Silent_p.S201S|FBXL13_ENST00000379306.3_Silent_p.S201S|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000436908.1_Silent_p.S201S	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	201										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						TTTTCACTGAGGAAAAATCAA	0.323																																																	0													53.0	57.0	56.0					7																	102604101		2203	4300	6503	SO:0001819	synonymous_variant	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.603C>A	7.37:g.102604101G>T			C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Silent	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.S201	ENST00000313221.4	37	c.603	CCDS5726.1	7																																																																																			FBXL13	-	NULL	ENSG00000161040		0.323	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1	-	0.00	82	0	G	NM_145032		102604101	-1	tier1	-	no_errors	ENST00000313221	ensembl	human	known	74_37	silent	17.46	52	11	SNP	0.007	T
FCRL3	115352	genome.wustl.edu	37	1	157667003	157667003	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:157667003A>G	ENST00000368184.3	-	6	1062	c.771T>C	c.(769-771)tcT>tcC	p.S257S	FCRL3_ENST00000368186.5_Silent_p.S257S|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	257	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CACACCAGTAAGACCCTGAGT	0.532																																																	0													113.0	103.0	107.0					1																	157667003		2203	4300	6503	SO:0001819	synonymous_variant	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.771T>C	1.37:g.157667003A>G			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S257	ENST00000368184.3	37	c.771	CCDS1167.1	1																																																																																			FCRL3	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000160856		0.532	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	-	0.00	74	0	A	NM_052939		157667003	-1	tier1	-	no_errors	ENST00000492769	ensembl	human	known	74_37	silent	31.58	26	12	SNP	0.067	G
FERD3L	222894	genome.wustl.edu	37	7	19184940	19184940	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:19184940A>C	ENST00000275461.3	-	1	104	c.46T>G	c.(46-48)Ttc>Gtc	p.F16V	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	16					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						TCTGCGACGAAGTCCAGCACC	0.682																																																	0													34.0	33.0	34.0					7																	19184940		2203	4299	6502	SO:0001583	missense	0			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.46T>G	7.37:g.19184940A>C	ENSP00000275461:p.Phe16Val		Q495K0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.F16V	ENST00000275461.3	37	c.46	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	A	20.8	4.053147	0.75960	.	.	ENSG00000146618	ENST00000275461	D	0.97731	-4.51	5.66	4.49	0.54785	.	0.212557	0.33040	N	0.005349	D	0.93749	0.8002	L	0.29908	0.895	0.38481	D	0.947737	P	0.49185	0.92	B	0.42386	0.386	D	0.91334	0.5092	10	0.36615	T	0.2	-1.0911	5.9939	0.19483	0.7784:0.0:0.0756:0.146	.	16	Q96RJ6	FER3L_HUMAN	V	16	ENSP00000275461:F16V	ENSP00000275461:F16V	F	-	1	0	FERD3L	19151465	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.832000	0.62759	0.961000	0.38030	0.528000	0.53228	TTC	FERD3L	-	NULL	ENSG00000146618		0.682	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1		0.00	74	0	A			19184940	-1			no_errors	ENST00000275461	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	C
FERD3L	222894	genome.wustl.edu	37	7	19184962	19184962	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:19184962G>A	ENST00000275461.3	-	1	82	c.24C>T	c.(22-24)tgC>tgT	p.C8C	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	8					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						TAGTGTCCACGCAGCTCTCCG	0.657																																																	0													29.0	29.0	29.0					7																	19184962		2203	4299	6502	SO:0001819	synonymous_variant	0			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.24C>T	7.37:g.19184962G>A			Q495K0	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.C8	ENST00000275461.3	37	c.24	CCDS5368.1	7																																																																																			FERD3L	-	NULL	ENSG00000146618		0.657	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	-	0.00	75	0	G			19184962	-1	tier1	-	no_errors	ENST00000275461	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	A
FGB	2244	genome.wustl.edu	37	4	155487151	155487151	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:155487151G>A	ENST00000302068.4	+	2	369	c.306G>A	c.(304-306)ctG>ctA	p.L102L	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Intron	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	102			Missing (in New York-1). {ECO:0000269|PubMed:3156856}.		blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	ACCCAGACCTGGTGGGTGCAC	0.522																																					NSCLC(106;1133 1613 21870 46110 52656)												0													32.0	29.0	30.0					4																	155487151		2202	4299	6501	SO:0001630	splice_region_variant	0				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.306+1G>A	4.37:g.155487151G>A			A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Silent	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.L102	ENST00000302068.4	37	c.306	CCDS3786.1	4																																																																																			FGB	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171564		0.522	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	HGNC	protein_coding	OTTHUMT00000317595.1	-	0.00	61	0	G	NM_005141	Silent	155487151	+1	tier1	-	no_errors	ENST00000302068	ensembl	human	known	74_37	silent	16.28	36	7	SNP	1.000	A
FGF23	8074	genome.wustl.edu	37	12	4479908	4479908	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:4479908C>T	ENST00000237837.1	-	3	502	c.357G>A	c.(355-357)acG>acA	p.T119T		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	119					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			CGTTTTCCAGCGTCTGGTGTT	0.607																																																	0													103.0	100.0	101.0					12																	4479908		2203	4300	6503	SO:0001819	synonymous_variant	0			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.357G>A	12.37:g.4479908C>T			Q4V758	Silent	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.T119	ENST00000237837.1	37	c.357	CCDS8526.1	12																																																																																			FGF23	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	ENSG00000118972		0.607	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	HGNC	protein_coding	OTTHUMT00000398936.1		0.00	38	0	C			4479908	-1			no_errors	ENST00000237837	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.014	T
FHAD1	114827	genome.wustl.edu	37	1	15627918	15627918	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:15627918T>C	ENST00000375998.4	+	5	896	c.896T>C	c.(895-897)aTc>aCc	p.I299T	FHAD1_ENST00000417793.1_Missense_Mutation_p.I299T|FHAD1_ENST00000375999.3_Missense_Mutation_p.I299T|FHAD1_ENST00000358897.4_Missense_Mutation_p.I299T			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	299										skin(1)|stomach(1)	2						CAGAAAGAGATCCAGAGCTTG	0.562																																																	0													36.0	35.0	35.0					1																	15627918		692	1591	2283	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.896T>C	1.37:g.15627918T>C	ENSP00000365166:p.Ile299Thr		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.I299T	ENST00000375998.4	37	c.896		1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.735038	0.48939	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998	T;T;T;T	0.58358	0.37;0.37;0.34;0.37	5.45	5.45	0.79879	.	0.000000	0.45867	D	0.000334	T	0.66509	0.2796	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.65755	-0.6091	10	0.39692	T	0.17	-25.2146	11.9187	0.52779	0.0:0.0:0.0:1.0	.	299	B1AJZ9	FHAD1_HUMAN	T	299	ENSP00000351770:I299T;ENSP00000407615:I299T;ENSP00000365167:I299T;ENSP00000365166:I299T	ENSP00000351770:I299T	I	+	2	0	FHAD1	15500505	1.000000	0.71417	0.992000	0.48379	0.302000	0.27658	4.421000	0.59848	2.080000	0.62538	0.528000	0.53228	ATC	FHAD1	-	NULL	ENSG00000142621		0.562	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	-	0.00	24	0	T	NM_052929		15627918	+1	tier1	-	no_errors	ENST00000375999	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.997	C
FIGN	55137	genome.wustl.edu	37	2	164467533	164467533	+	Missense_Mutation	SNP	G	G	A	rs576789489		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:164467533G>A	ENST00000333129.3	-	3	1123	c.809C>T	c.(808-810)cCg>cTg	p.P270L	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	270	Pro-rich.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CGCTGAAGGCGGAGGCGGTGC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		13847	0.0		0.001	False		,,,				2504	0.0																0													36.0	40.0	39.0					2																	164467533		2014	4164	6178	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.809C>T	2.37:g.164467533G>A	ENSP00000333836:p.Pro270Leu		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P270L	ENST00000333129.3	37	c.809	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304192	0.23736	.	.	ENSG00000182263	ENST00000333129	T	0.50813	0.73	6.07	6.07	0.98685	.	0.202893	0.43110	D	0.000601	T	0.67979	0.2951	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.65183	-0.6230	10	0.54805	T	0.06	-14.0811	20.6512	0.99593	0.0:0.0:1.0:0.0	.	270	Q5HY92	FIGN_HUMAN	L	270	ENSP00000333836:P270L	ENSP00000333836:P270L	P	-	2	0	FIGN	164175779	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	7.744000	0.85034	2.882000	0.98803	0.655000	0.94253	CCG	FIGN	-	NULL	ENSG00000182263		0.592	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	-	0.00	38	0	G	NM_018086		164467533	-1	tier1	-	no_errors	ENST00000333129	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
FILIP1	27145	genome.wustl.edu	37	6	76023058	76023058	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:76023058T>G	ENST00000237172.7	-	5	2820	c.2490A>C	c.(2488-2490)gaA>gaC	p.E830D	FILIP1_ENST00000370020.1_Missense_Mutation_p.E731D|FILIP1_ENST00000393004.2_Missense_Mutation_p.E830D|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	830										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TATGATTTTCTTCCTGGAAGG	0.463																																																	0													143.0	157.0	153.0					6																	76023058		2203	4300	6503	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2490A>C	6.37:g.76023058T>G	ENSP00000237172:p.Glu830Asp		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.E830D	ENST00000237172.7	37	c.2490	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362025	0.41902	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.20881	2.04;2.04;2.06	5.66	0.0734	0.14390	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	L	0.54323	1.7	0.50632	D	0.999887	D;D;D	0.76494	0.999;0.995;0.997	D;D;D	0.78314	0.991;0.93;0.968	T	0.07751	-1.0756	10	0.15499	T	0.54	-26.0741	10.3095	0.43699	0.0:0.7042:0.0:0.2958	.	830;830;830	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	D	830;830;731	ENSP00000376728:E830D;ENSP00000237172:E830D;ENSP00000359037:E731D	ENSP00000237172:E830D	E	-	3	2	FILIP1	76079778	0.330000	0.24705	0.999000	0.59377	0.992000	0.81027	-0.291000	0.08343	0.023000	0.15187	0.460000	0.39030	GAA	FILIP1	-	NULL	ENSG00000118407		0.463	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	-	0.00	66	0	T	XM_029179		76023058	-1	tier1	-	no_errors	ENST00000237172	ensembl	human	known	74_37	missense	16.90	59	12	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152280788	152280788	+	Missense_Mutation	SNP	T	T	G	rs66954353	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:152280788T>G	ENST00000368799.1	-	3	6609	c.6574A>C	c.(6574-6576)Aaa>Caa	p.K2192Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2192	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCATATGTTTTTCTGCTTGCA	0.532									Ichthyosis																																								0								G	GLN/LYS	1049,3357		0,1049,1154	476.0	402.0	427.0		6574	2.0	0.0	1	dbSNP_130	427	819,7781		4,811,3485	yes	missense	FLG	NM_002016.1	53	4,1860,4639	GG,GT,TT		9.5233,23.8084,14.3626	benign	2192/4062	152280788	1868,11138	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6574A>C	1.37:g.152280788T>G	ENSP00000357789:p.Lys2192Gln		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.K2192Q	ENST00000368799.1	37	c.6574	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	g	5.601	0.295698	0.10622	0.238084	0.095233	ENSG00000143631	ENST00000368799	T	0.01725	4.67	2.99	1.99	0.26369	.	.	.	.	.	T	0.00144	0.0004	N	0.00146	-1.995	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13548	-1.0505	8	0.15066	T	0.55	.	5.49	0.16771	0.0:0.2239:0.546:0.2301	.	2192	P20930	FILA_HUMAN	Q	2192	ENSP00000357789:K2192Q	ENSP00000357789:K2192Q	K	-	1	0	FLG	150547412	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	0.245000	0.18142	-0.043000	0.13513	-0.332000	0.08345	AAA	FLG	-	NULL	ENSG00000143631		0.532	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	170	0	T	NM_002016		152280788	-1	tier1	rs66954353	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	30.77	116	52	SNP	0.001	G
FLG	2312	genome.wustl.edu	37	1	152280795	152280795	+	Silent	SNP	T	T	G	rs148841847		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:152280795T>G	ENST00000368799.1	-	3	6602	c.6567A>C	c.(6565-6567)gcA>gcC	p.A2189A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2189	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTTCTGCTTGCACTTCTGG	0.527									Ichthyosis																																								0								T		0,4406		0,0,2203	473.0	401.0	425.0		6567	-4.2	0.0	1	dbSNP_134	425	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FLG	NM_002016.1		0,1,6502	GG,GT,TT		0.0116,0.0,0.0077		2189/4062	152280795	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6567A>C	1.37:g.152280795T>G			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.A2189	ENST00000368799.1	37	c.6567	CCDS30860.1	1																																																																																			FLG	-	NULL	ENSG00000143631		0.527	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	163	0	T	NM_002016		152280795	-1	tier1	rs148841847	no_errors	ENST00000368799	ensembl	human	known	74_37	silent	32.37	117	56	SNP	0.000	G
FLT1	2321	genome.wustl.edu	37	13	28880827	28880827	+	Missense_Mutation	SNP	G	G	A	rs368266056		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:28880827G>A	ENST00000282397.4	-	29	4054	c.3803C>T	c.(3802-3804)tCg>tTg	p.S1268L	FLT1_ENST00000543394.1_Missense_Mutation_p.S291L|FLT1_ENST00000540678.1_Missense_Mutation_p.S486L	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1268					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATCTTGAGCGAGGCCTTGGG	0.532																																																	0													92.0	86.0	88.0					13																	28880827		2203	4300	6503	SO:0001583	missense	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3803C>T	13.37:g.28880827G>A	ENSP00000282397:p.Ser1268Leu		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.S1268L	ENST00000282397.4	37	c.3803	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849954	0.32699	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	T;T;T	0.77358	-0.87;-1.07;-1.09	5.53	3.79	0.43588	.	0.385353	0.25065	N	0.033417	T	0.64778	0.2629	L	0.38175	1.15	0.20489	N	0.999893	B	0.28880	0.226	B	0.20184	0.028	T	0.54814	-0.8237	10	0.34782	T	0.22	.	9.8174	0.40860	0.1642:0.0:0.8358:0.0	.	1268	P17948	VGFR1_HUMAN	L	1268;291;486	ENSP00000282397:S1268L;ENSP00000437841:S291L;ENSP00000443311:S486L	ENSP00000282397:S1268L	S	-	2	0	FLT1	27778827	0.973000	0.33851	0.331000	0.25455	0.179000	0.23085	4.821000	0.62679	1.342000	0.45619	-0.142000	0.14014	TCG	FLT1	-	NULL	ENSG00000102755		0.532	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	-	0.00	67	0	G			28880827	-1	tier1	-	no_errors	ENST00000282397	ensembl	human	known	74_37	missense	45.07	39	32	SNP	0.096	A
FLT4	2324	genome.wustl.edu	37	5	180048197	180048197	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:180048197G>A	ENST00000261937.6	-	14	2154	c.2076C>T	c.(2074-2076)agC>agT	p.S692S	FLT4_ENST00000393347.3_Silent_p.S692S|FLT4_ENST00000502649.1_Silent_p.S692S|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	692	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGCGAGTCGCTCACGTTCA	0.632																																					Colon(97;1075 1466 27033 27547 35871)												0													32.0	34.0	34.0					5																	180048197		2203	4298	6501	SO:0001819	synonymous_variant	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2076C>T	5.37:g.180048197G>A			A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.S692	ENST00000261937.6	37	c.2076	CCDS4457.1	5																																																																																			FLT4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000037280		0.632	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4		0.00	94	0	G			180048197	-1			no_errors	ENST00000261937	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.976	A
FMN2	56776	genome.wustl.edu	37	1	240458167	240458167	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:240458167A>G	ENST00000319653.9	+	8	4429	c.4199A>G	c.(4198-4200)cAa>cGa	p.Q1400R	FMN2_ENST00000545751.1_Intron	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1400	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GAGACCCTTCAAGCTCTCTAT	0.353																																																	0													137.0	137.0	137.0					1																	240458167		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4199A>G	1.37:g.240458167A>G	ENSP00000318884:p.Gln1400Arg		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.Q1400R	ENST00000319653.9	37	c.4199	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.194847	0.78902	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000537355	T;T	0.18810	2.19;2.19	5.27	5.27	0.74061	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000013	T	0.44912	0.1316	M	0.67625	2.065	0.80722	D	1	B;D;P	0.76494	0.01;0.999;0.939	B;D;P	0.83275	0.012;0.996;0.906	T	0.42949	-0.9421	10	0.87932	D	0	.	14.0505	0.64732	1.0:0.0:0.0:0.0	.	46;29;1400	F5H2C1;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	R	1400;46;27	ENSP00000318884:Q1400R;ENSP00000388922:Q46R	ENSP00000318884:Q1400R	Q	+	2	0	FMN2	238524790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.622000	0.83099	2.133000	0.65898	0.528000	0.53228	CAA	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.353	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	79	0	A	XM_371352		240458167	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	16.98	44	9	SNP	1.000	G
FOCAD	54914	genome.wustl.edu	37	9	20789347	20789347	+	Intron	SNP	C	C	G	rs368542428		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:20789347C>G	ENST00000380249.1	+	13	1561				SNORA30_ENST00000365319.1_RNA|FOCAD_ENST00000338382.6_Intron	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CTTTATTTTTCAGCTCTCCTA	0.363																																																	0													146.0	138.0	141.0					9																	20789347		2203	4300	6503	SO:0001627	intron_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.1198-3C>G	9.37:g.20789347C>G			D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	RNA	SNP	-	NULL	ENST00000380249.1	37	NULL	CCDS34993.1	9																																																																																			FOCAD	-	-	ENSG00000188352		0.363	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	-	0.00	59	0	C	NM_017794		20789347	+1	tier1	-	no_errors	ENST00000603492	ensembl	human	known	74_37	rna	9.09	50	5	SNP	1.000	G
FOLH1	2346	genome.wustl.edu	37	11	49192783	49192783	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:49192783T>G	ENST00000256999.2	-	11	1532	c.1272A>C	c.(1270-1272)gaA>gaC	p.E424D	FOLH1_ENST00000340334.7_Missense_Mutation_p.E409D|FOLH1_ENST00000533034.1_Missense_Mutation_p.E409D|FOLH1_ENST00000356696.3_Missense_Mutation_p.E424D|FOLH1_ENST00000343844.4_Missense_Mutation_p.E116D|FOLH1_ENST00000525629.1_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	424	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GACCAAATTCTTCTGCATCCC	0.323																																																	0													33.0	35.0	34.0					11																	49192783		2191	4273	6464	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1272A>C	11.37:g.49192783T>G	ENSP00000256999:p.Glu424Asp		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.E424D	ENST00000256999.2	37	c.1272	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	T	17.63	3.437748	0.62955	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034;ENST00000389724	D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62	4.21	3.06	0.35304	Peptidase M28 (1);	0.000000	0.64402	D	0.000018	D	0.96052	0.8714	H	0.97659	4.05	0.58432	D	0.999991	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.996;0.999	D	0.93472	0.6820	10	0.87932	D	0	.	4.2694	0.10778	0.0:0.1063:0.2077:0.686	.	409;409;424;424	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	D	424;424;409;116;409;427	ENSP00000256999:E424D;ENSP00000349129:E424D;ENSP00000344131:E409D;ENSP00000344086:E116D;ENSP00000431463:E409D	ENSP00000256999:E424D	E	-	3	2	FOLH1	49149359	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.227000	0.17795	0.628000	0.30357	0.496000	0.49642	GAA	FOLH1	-	pfam_Peptidase_M28	ENSG00000086205		0.323	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	208	0	T	NM_004476		49192783	-1	tier1	-	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	20.25	130	33	SNP	1.000	G
FUT9	10690	genome.wustl.edu	37	6	96651507	96651507	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:96651507G>T	ENST00000302103.5	+	3	802	c.476G>T	c.(475-477)cGc>cTc	p.R159L		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	159					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.R159H(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		CTGACTTACCGCCGTGATTCA	0.458																																					Melanoma(98;1369 1476 6592 22940 26587)												1	Substitution - Missense(1)	large_intestine(1)											69.0	65.0	66.0					6																	96651507		2203	4300	6503	SO:0001583	missense	0			AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.476G>T	6.37:g.96651507G>T	ENSP00000302599:p.Arg159Leu		Q5T0W4	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.R159L	ENST00000302103.5	37	c.476	CCDS5033.1	6	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368946	0.61624	.	.	ENSG00000172461	ENST00000302103	T	0.39787	1.06	5.3	5.3	0.74995	.	0.050188	0.85682	D	0.000000	T	0.66790	0.2825	M	0.88842	2.985	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.72789	-0.4187	10	0.66056	D	0.02	-11.0367	18.3049	0.90177	0.0:0.0:1.0:0.0	.	159	Q9Y231	FUT9_HUMAN	L	159	ENSP00000302599:R159L	ENSP00000302599:R159L	R	+	2	0	FUT9	96758228	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	7.499000	0.81566	2.643000	0.89663	0.655000	0.94253	CGC	FUT9	-	pfam_Glyco_trans_10	ENSG00000172461		0.458	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT9	HGNC	protein_coding	OTTHUMT00000041554.2		0.00	38	0	G	NM_006581		96651507	+1			no_errors	ENST00000302103	ensembl	human	known	74_37	missense	5.00	37	2	SNP	1.000	T
GALNT15	117248	genome.wustl.edu	37	3	16237303	16237303	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:16237303A>C	ENST00000339732.5	+	2	1079	c.576A>C	c.(574-576)acA>acC	p.T192T	GALNT15_ENST00000437509.1_Silent_p.T192T	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	192	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GCCTGCCCACAGCCAGCGTCA	0.597																																																	0													94.0	71.0	79.0					3																	16237303		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.576A>C	3.37:g.16237303A>C			A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.T192	ENST00000339732.5	37	c.576	CCDS33711.1	3																																																																																			GALNT15	-	NULL	ENSG00000131386		0.597	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT15	HGNC	protein_coding	OTTHUMT00000346483.2	-	0.00	33	0	A	NM_054110		16237303	+1	tier1	-	no_errors	ENST00000339732	ensembl	human	known	74_37	silent	38.64	27	17	SNP	0.063	C
GALNT15	117248	genome.wustl.edu	37	3	16237358	16237358	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:16237358G>A	ENST00000339732.5	+	2	1134	c.631G>A	c.(631-633)Gta>Ata	p.V211I	GALNT15_ENST00000437509.1_Missense_Mutation_p.V211I	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	211	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CCTGCGGACTGTACACAGCAT	0.612																																																	0													103.0	77.0	86.0					3																	16237358		2203	4300	6503	SO:0001583	missense	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.631G>A	3.37:g.16237358G>A	ENSP00000344260:p.Val211Ile		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V211I	ENST00000339732.5	37	c.631	CCDS33711.1	3	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227139	0.79576	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.56611	0.45;0.45	4.88	4.01	0.46588	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000001	T	0.54255	0.1847	L	0.31578	0.945	0.48341	D	0.999633	D	0.52996	0.957	P	0.57324	0.818	T	0.52102	-0.8620	10	0.38643	T	0.18	.	13.0615	0.59010	0.0778:0.0:0.9222:0.0	.	211	Q8N3T1	GLTL2_HUMAN	I	211	ENSP00000344260:V211I;ENSP00000395873:V211I	ENSP00000344260:V211I	V	+	1	0	GALNTL2	16212362	1.000000	0.71417	0.741000	0.31004	0.934000	0.57294	3.455000	0.52993	1.057000	0.40506	0.555000	0.69702	GTA	GALNT15	-	pfam_Glyco_trans_2	ENSG00000131386		0.612	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT15	HGNC	protein_coding	OTTHUMT00000346483.2	-	0.00	46	0	G	NM_054110		16237358	+1	tier1	-	no_errors	ENST00000339732	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.999	A
GBE1	2632	genome.wustl.edu	37	3	81586214	81586214	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:81586214A>C	ENST00000429644.2	-	13	2294	c.1651T>G	c.(1651-1653)Ttc>Gtc	p.F551V	GBE1_ENST00000489715.1_Missense_Mutation_p.F510V	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	551					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TTTCTTGGGAAGTCTAACCAT	0.338									Glycogen Storage Disease, type IV																																								0													64.0	63.0	63.0					3																	81586214		1847	4104	5951	SO:0001583	missense	0	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1651T>G	3.37:g.81586214A>C	ENSP00000410833:p.Phe551Val		B3KWV3|Q96EN0	Missense_Mutation	SNP	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.F551V	ENST00000429644.2	37	c.1651	CCDS54612.1	3	.	.	.	.	.	.	.	.	.	.	A	22.1	4.247777	0.80024	.	.	ENSG00000114480	ENST00000429644;ENST00000264326;ENST00000489715;ENST00000536832	D;D	0.93247	-3.19;-3.19	5.3	5.3	0.74995	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98273	0.9428	H	0.99074	4.42	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99777	1.1026	10	0.87932	D	0	-21.3026	15.5267	0.75915	1.0:0.0:0.0:0.0	.	510;551	E9PGM4;Q04446	.;GLGB_HUMAN	V	551;602;510;314	ENSP00000410833:F551V;ENSP00000419638:F510V	ENSP00000264326:F602V	F	-	1	0	GBE1	81668904	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.910000	0.92685	2.132000	0.65825	0.528000	0.53228	TTC	GBE1	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000114480		0.338	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	HGNC	protein_coding	OTTHUMT00000352760.2	-	0.00	39	0	A			81586214	-1	tier1	-	no_errors	ENST00000429644	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	C
GBF1	8729	genome.wustl.edu	37	10	104126909	104126909	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:104126909T>C	ENST00000369983.3	+	20	2758	c.2498T>C	c.(2497-2499)cTt>cCt	p.L833P		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	833	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GTCATCATGCTTAATACTGAC	0.493																																																	0													204.0	177.0	186.0					10																	104126909		2203	4300	6503	SO:0001583	missense	0			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2498T>C	10.37:g.104126909T>C	ENSP00000359000:p.Leu833Pro		Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.L833P	ENST00000369983.3	37	c.2498	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	T	25.7	4.663710	0.88251	.	.	ENSG00000107862	ENST00000369983	D	0.81821	-1.54	5.37	5.37	0.77165	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.127702	0.56097	D	0.000040	D	0.93595	0.7955	H	0.97852	4.09	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.95885	0.8902	10	0.87932	D	0	-11.9486	15.3623	0.74487	0.0:0.0:0.0:1.0	.	833;833;833	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	P	833	ENSP00000359000:L833P	ENSP00000359000:L833P	L	+	2	0	GBF1	104116899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.029000	0.59856	0.460000	0.39030	CTT	GBF1	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000107862		0.493	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1		0.00	60	0	T			104126909	+1			no_errors	ENST00000369983	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	C
GCM2	9247	genome.wustl.edu	37	6	10875152	10875152	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:10875152T>A	ENST00000379491.4	-	5	744	c.597A>T	c.(595-597)caA>caT	p.Q199H	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	199					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CACTGCTGTCTTGATTTTCTT	0.418																																																	0													89.0	85.0	87.0					6																	10875152		2203	4300	6503	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.597A>T	6.37:g.10875152T>A	ENSP00000368805:p.Gln199His		D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.Q199H	ENST00000379491.4	37	c.597	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	T	9.171	1.021034	0.19433	.	.	ENSG00000124827	ENST00000379491	T	0.68903	-0.36	5.72	2.11	0.27256	.	0.591630	0.19001	N	0.125359	T	0.25975	0.0633	L	0.28694	0.88	0.80722	D	1	B	0.18741	0.03	B	0.15052	0.012	T	0.08269	-1.0730	10	0.18710	T	0.47	-3.4057	3.8263	0.08855	0.2459:0.2491:0.0:0.505	.	199	O75603	GCM2_HUMAN	H	199	ENSP00000368805:Q199H	ENSP00000368805:Q199H	Q	-	3	2	GCM2	10983138	1.000000	0.71417	0.109000	0.21407	0.324000	0.28378	0.696000	0.25541	0.134000	0.18681	0.482000	0.46254	CAA	GCM2	-	NULL	ENSG00000124827		0.418	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1		0.00	25	0	T			10875152	-1			no_errors	ENST00000379491	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.985	A
GHRHR	2692	genome.wustl.edu	37	7	31016045	31016045	+	Splice_Site	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:31016045C>T	ENST00000326139.2	+	11	1022	c.976C>T	c.(976-978)Cgt>Tgt	p.R326C	GHRHR_ENST00000409316.1_Splice_Site_p.A92V|GHRHR_ENST00000461424.1_3'UTR|GHRHR_ENST00000409904.3_Splice_Site_p.R262C	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	326					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	TTCCTGCAGGCGTCTCTCCAA	0.512																																																	0													78.0	65.0	69.0					7																	31016045		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.975-1C>T	7.37:g.31016045C>T			Q99863	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GHRH_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt_1	p.R326C	ENST00000326139.2	37	c.976	CCDS5432.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	29.4|29.4	5.007022|5.007022	0.93287|0.93287	.|.	.|.	ENSG00000106128|ENSG00000106128	ENST00000409233;ENST00000409316|ENST00000326139;ENST00000409904	.|T;T	.|0.45276	.|0.9;0.9	4.93|4.93	3.0|3.0	0.34707|0.34707	.|GPCR, family 2-like (1);	.|.	.|.	.|.	.|.	T|T	0.67021|0.67021	0.2849|0.2849	M|M	0.90309|0.90309	3.105|3.105	0.80722|0.80722	D|D	1|1	P|D;D	0.50710|0.89917	0.938|1.0;1.0	P|D;D	0.46510|0.78314	0.519|0.976;0.991	T|T	0.69595|0.69595	-0.5103|-0.5103	8|9	0.44086|0.87932	T|D	0.13|0	.|.	9.964|9.964	0.41712|0.41712	0.3684:0.6316:0.0:0.0|0.3684:0.6316:0.0:0.0	.|.	92|262;326	Q9HB43|Q9HB45;Q02643	.|.;GHRHR_HUMAN	V|C	113;92|326;262	.|ENSP00000320180:R326C;ENSP00000387113:R262C	ENSP00000386919:A113V|ENSP00000320180:R326C	A|R	+|+	2|1	0|0	GHRHR|GHRHR	30982570|30982570	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.969000|0.969000	0.65631|0.65631	2.518000|2.518000	0.45537|0.45537	0.411000|0.411000	0.25702|0.25702	0.546000|0.546000	0.68486|0.68486	GCG|CGT	GHRHR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000106128		0.512	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	HGNC	protein_coding	OTTHUMT00000327967.2	-	0.00	36	0	C		Missense_Mutation	31016045	+1	tier1	-	no_errors	ENST00000326139	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	T
GMEB1	10691	genome.wustl.edu	37	1	29018137	29018137	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:29018137T>G	ENST00000294409.2	+	4	372	c.282T>G	c.(280-282)gcT>gcG	p.A94A	GMEB1_ENST00000361872.4_Silent_p.A84A|GMEB1_ENST00000373816.1_Silent_p.A84A|GMEB1_ENST00000480454.1_3'UTR|SCARNA24_ENST00000516968.1_RNA	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	94	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAAATTGCTTACCCCATAA	0.383																																																	0													129.0	117.0	121.0					1																	29018137		2203	4300	6503	SO:0001819	synonymous_variant	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.282T>G	1.37:g.29018137T>G			B1AT48|Q9NWH1|Q9UKD0	Silent	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_SAND_dom	p.A94	ENST00000294409.2	37	c.282	CCDS327.1	1																																																																																			GMEB1	-	pfam_SAND_dom,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_SAND_dom	ENSG00000162419		0.383	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	-	0.00	69	0	T	NM_006582		29018137	+1	tier1	-	no_errors	ENST00000294409	ensembl	human	known	74_37	silent	31.82	45	21	SNP	1.000	G
GMIP	51291	genome.wustl.edu	37	19	19745634	19745634	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:19745634G>C	ENST00000203556.4	-	17	1991	c.1854C>G	c.(1852-1854)gaC>gaG	p.D618E	GMIP_ENST00000445806.2_Missense_Mutation_p.D589E|GMIP_ENST00000587238.1_Missense_Mutation_p.D592E|GMIP_ENST00000586269.1_5'UTR	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	618	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CACTCGAGACGTCATGAGGCG	0.637																																																	0													58.0	56.0	57.0					19																	19745634		2202	4299	6501	SO:0001583	missense	0			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1854C>G	19.37:g.19745634G>C	ENSP00000203556:p.Asp618Glu		A0AVN9|B7ZLZ0	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.D618E	ENST00000203556.4	37	c.1854	CCDS12408.1	19	.	.	.	.	.	.	.	.	.	.	G	16.39	3.108648	0.56291	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.19806	2.12;2.12	5.07	-4.66	0.03329	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.42821	D	0.000646	T	0.48926	0.1527	M	0.93283	3.4	0.42829	D	0.994011	D;D;D	0.89917	1.0;0.992;1.0	D;D;D	0.97110	1.0;0.991;1.0	T	0.59402	-0.7461	10	0.30854	T	0.27	-19.0899	14.3598	0.66764	0.3494:0.0:0.6506:0.0	.	589;592;618	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	E	618;589	ENSP00000203556:D618E;ENSP00000397075:D589E	ENSP00000203556:D618E	D	-	3	2	GMIP	19606634	0.149000	0.22717	0.048000	0.18961	0.841000	0.47740	-0.307000	0.08167	-1.047000	0.03242	-1.267000	0.01435	GAC	GMIP	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000089639		0.637	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	HGNC	protein_coding	OTTHUMT00000460551.1	-	0.00	59	0	G	NM_016573		19745634	-1	tier1	-	no_errors	ENST00000203556	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.747	C
GML	2765	genome.wustl.edu	37	8	143927913	143927913	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:143927913A>C	ENST00000220940.1	+	4	374	c.284A>C	c.(283-285)aAa>aCa	p.K95T		NM_002066.2	NP_002057.1	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule like	95	UPAR/Ly6.				apoptotic process (GO:0006915)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of cell proliferation (GO:0008285)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(1)|large_intestine(6)|lung(8)	18	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AAAATCTTCAAAACTAATAGC	0.388																																																	0													61.0	65.0	64.0					8																	143927913		2203	4300	6503	SO:0001583	missense	0			D84290	CCDS6391.1	8q24.3	2014-05-14	2012-11-02						4375	protein-coding gene	gene with protein product		602370	"""GPI anchored molecule like protein"", ""glycosylphosphatidylinositol anchored molecule like protein"""			8934543, 9169150	Standard	NM_002066		Approved	LY6DL	uc003yxg.3	Q99445		ENST00000220940.1:c.284A>C	8.37:g.143927913A>C	ENSP00000220940:p.Lys95Thr		A0AVF6|O00686|O00731	Missense_Mutation	SNP	smart_LY6_UPA_recep-like	p.K95T	ENST00000220940.1	37	c.284	CCDS6391.1	8	.	.	.	.	.	.	.	.	.	.	N	6.127	0.391625	0.11581	.	.	ENSG00000104499	ENST00000220940	T	0.51071	0.72	3.11	-6.22	0.02058	Ly-6 antigen / uPA receptor -like (1);	2.260040	0.02147	N	0.057693	T	0.35278	0.0926	L	0.40543	1.245	0.09310	N	1	B	0.18013	0.025	B	0.16289	0.015	T	0.18272	-1.0342	10	0.23302	T	0.38	-45.2417	7.5104	0.27571	0.4008:0.4426:0.1566:0.0	.	95	Q99445	GML_HUMAN	T	95	ENSP00000220940:K95T	ENSP00000220940:K95T	K	+	2	0	GML	143924915	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.662000	0.05305	-3.001000	0.00276	0.455000	0.32223	AAA	GML	-	smart_LY6_UPA_recep-like	ENSG00000104499		0.388	GML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GML	HGNC	protein_coding	OTTHUMT00000379659.1	-	0.00	75	0	A	NM_002066		143927913	+1	tier1	-	no_errors	ENST00000220940	ensembl	human	known	74_37	missense	16.18	57	11	SNP	0.000	C
GNAS	2778	genome.wustl.edu	37	20	57467182	57467182	+	Intron	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:57467182C>T	ENST00000371085.3	+	1	563				GNAS_ENST00000354359.7_Intron|GNAS_ENST00000371081.1_Intron|GNAS_ENST00000464624.2_Intron|GNAS_ENST00000306090.10_Intron|GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000371095.3_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000265620.7_Intron	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTCAGTGtctctctcttgctc	0.701			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										SO:0001627	intron_variant	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.139+262C>T	20.37:g.57467182C>T			A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	RNA	SNP	-	NULL	ENST00000371085.3	37	NULL	CCDS13472.1	20																																																																																			GNAS	-	-	ENSG00000087460		0.701	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	17	0	C	NM_000516		57467182	+1	tier1	-	no_errors	ENST00000476935	ensembl	human	known	74_37	rna	21.88	25	7	SNP	0.004	T
GOLGA8M	653720	genome.wustl.edu	37	15	28953521	28953521	+	Splice_Site	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:28953521T>G	ENST00000563027.1	-	5	347	c.348A>C	c.(346-348)gaA>gaC	p.E116D	GOLGA8M_ENST00000563213.1_5'Flank|GOLGA8M_ENST00000340249.3_5'UTR					golgin A8 family, member M																		ATCACGTTACTTCTTCCAGCT	0.522																																																	0																																										SO:0001630	splice_region_variant	0				CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000563027.1:c.348+1A>C	15.37:g.28953521T>G				Missense_Mutation	SNP	NULL	p.E116D	ENST00000563027.1	37	c.348		15																																																																																			GOLGA8M	-	NULL	ENSG00000188626		0.522	GOLGA8M-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8M	HGNC	protein_coding	OTTHUMT00000431777.1	-	0.00	90	0	T		Missense_Mutation	28953521	-1	tier1	-	no_errors	ENST00000563027	ensembl	human	novel	74_37	missense	12.50	77	11	SNP	0.994	G
GPR37	2861	genome.wustl.edu	37	7	124386619	124386619	+	Missense_Mutation	SNP	C	C	T	rs199987277		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:124386619C>T	ENST00000303921.2	-	2	2452	c.1802G>A	c.(1801-1803)cGt>cAt	p.R601H		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	601					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.R601P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GGACATTTCACGGCGTATGGT	0.438																																																	1	Substitution - Missense(1)	lung(1)						C	HIS/ARG	0,4406		0,0,2203	175.0	158.0	164.0		1802	5.3	0.7	7		164	5,8595	4.3+/-15.6	0,5,4295	yes	missense	GPR37	NM_005302.2	29	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	probably-damaging	601/614	124386619	5,13001	2203	4300	6503	SO:0001583	missense	0				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1802G>A	7.37:g.124386619C>T	ENSP00000306449:p.Arg601His		A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_orph,prints_GPCR_Rhodpsn	p.R601H	ENST00000303921.2	37	c.1802	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	C	19.18	3.776835	0.70107	0.0	5.81E-4	ENSG00000170775	ENST00000303921	T	0.75704	-0.96	5.35	5.35	0.76521	.	0.000000	0.52532	D	0.000079	D	0.83801	0.5333	L	0.54323	1.7	0.41002	D	0.984934	D	0.89917	1.0	D	0.73380	0.98	D	0.85751	0.1343	10	0.87932	D	0	-16.3522	18.0541	0.89358	0.0:1.0:0.0:0.0	.	601	O15354	GPR37_HUMAN	H	601	ENSP00000306449:R601H	ENSP00000306449:R601H	R	-	2	0	GPR37	124173855	0.551000	0.26497	0.670000	0.29842	0.876000	0.50452	4.308000	0.59129	2.489000	0.83994	0.655000	0.94253	CGT	GPR37	-	NULL	ENSG00000170775		0.438	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1		0.00	34	0	C	NM_005302		124386619	-1			no_errors	ENST00000303921	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.707	T
GRIN2A	2903	genome.wustl.edu	37	16	9858168	9858168	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:9858168T>G	ENST00000396573.2	-	14	3542	c.3233A>C	c.(3232-3234)aAg>aCg	p.K1078T	GRIN2A_ENST00000330684.3_Missense_Mutation_p.K1078T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.K1078T|GRIN2A_ENST00000404927.2_Missense_Mutation_p.K1078T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.K1078T|GRIN2A_ENST00000535259.1_Missense_Mutation_p.K921T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1078					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTTGTGGTTCTTACTGTTGTC	0.493																																																	0													127.0	118.0	121.0					16																	9858168		2197	4300	6497	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3233A>C	16.37:g.9858168T>G	ENSP00000379818:p.Lys1078Thr		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K1078T	ENST00000396573.2	37	c.3233	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	T	17.50	3.404810	0.62288	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.16597	2.33;2.34;2.36;2.33;2.33	5.28	5.28	0.74379	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.092966	0.85682	D	0.000000	T	0.40839	0.1133	M	0.74258	2.255	0.58432	D	0.999998	D;D;P	0.67145	0.995;0.996;0.945	D;D;P	0.68353	0.928;0.957;0.821	T	0.24512	-1.0158	9	.	.	.	.	14.4152	0.67145	0.0:0.0:0.0:1.0	.	921;1078;1078	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	1078;1078;921;1078;1078	ENSP00000379818:K1078T;ENSP00000385872:K1078T;ENSP00000441572:K921T;ENSP00000332549:K1078T;ENSP00000379820:K1078T	.	K	-	2	0	GRIN2A	9765669	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.437000	0.80417	1.998000	0.58463	0.533000	0.62120	AAG	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.493	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	-	0.00	73	0	T			9858168	-1	tier1	-	no_errors	ENST00000330684	ensembl	human	known	74_37	missense	35.59	38	21	SNP	1.000	G
GSR	2936	genome.wustl.edu	37	8	30550496	30550496	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:30550496T>A	ENST00000221130.5	-	8	962	c.872A>T	c.(871-873)aAg>aTg	p.K291M	GSR_ENST00000414019.1_Missense_Mutation_p.K248M|GSR_ENST00000546342.1_Intron|GSR_ENST00000541648.1_Missense_Mutation_p.K291M|GSR_ENST00000537535.1_Intron	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	291					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	CTGGGAGAACTTCAGCACCTC	0.512																																																	0													143.0	122.0	130.0					8																	30550496		2203	4300	6503	SO:0001583	missense	0				CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.872A>T	8.37:g.30550496T>A	ENSP00000221130:p.Lys291Met		C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Glutathione_Rdtase_euk/bac	p.K291M	ENST00000221130.5	37	c.872	CCDS34877.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.88|18.88	3.716712|3.716712	0.68844|0.68844	.|.	.|.	ENSG00000104687|ENSG00000104687	ENST00000520888|ENST00000221130;ENST00000414019;ENST00000541648	.|T;T;T	.|0.57107	.|0.42;0.42;0.42	5.11|5.11	2.7|2.7	0.31948|0.31948	.|Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	.|0.090924	.|0.85682	.|D	.|0.000000	T|T	0.57242|0.57242	0.2040|0.2040	L|L	0.45744|0.45744	1.44|1.44	0.80722|0.80722	D|D	1|1	.|P	.|0.51057	.|0.941	.|P	.|0.60415	.|0.874	T|T	0.56414|0.56414	-0.7983|-0.7983	5|10	.|0.62326	.|D	.|0.03	-32.6716|-32.6716	6.9383|6.9383	0.24478|0.24478	0.0:0.1898:0.0:0.8102|0.0:0.1898:0.0:0.8102	.|.	.|291	.|P00390	.|GSHR_HUMAN	D|M	244|291;248;291	.|ENSP00000221130:K291M;ENSP00000390065:K248M;ENSP00000444559:K291M	.|ENSP00000221130:K291M	E|K	-|-	3|2	2|0	GSR|GSR	30670038|30670038	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.975000|0.975000	0.68041|0.68041	1.059000|1.059000	0.30517|0.30517	0.805000|0.805000	0.34159|0.34159	0.460000|0.460000	0.39030|0.39030	GAA|AAG	GSR	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,tigrfam_Glutathione_Rdtase_euk/bac	ENSG00000104687		0.512	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSR	HGNC	protein_coding	OTTHUMT00000376519.1	-	0.00	41	0	T			30550496	-1	tier1	-	no_errors	ENST00000221130	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
GVINP1	387751	genome.wustl.edu	37	11	6736880	6736880	+	RNA	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:6736880T>C	ENST00000526769.3	-	0	6324					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TGGAGGTTGCTCCTTGACAGG	0.418																																																	0																																												0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6736880T>C			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	-	0.00	27	0	T	NR_003945		6736880	-1	tier1	-	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	15.79	32	6	SNP	0.783	C
GZMA	3001	genome.wustl.edu	37	5	54403673	54403673	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:54403673G>T	ENST00000274306.6	+	3	302	c.267G>T	c.(265-267)gaG>gaT	p.E89D		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	89	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CCAGGGAAGAGCCAACAAAAC	0.418																																																	0													126.0	122.0	124.0					5																	54403673		2203	4300	6503	SO:0001583	missense	0				CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.267G>T	5.37:g.54403673G>T	ENSP00000274306:p.Glu89Asp		A4PHN1|Q6IB36	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.E89D	ENST00000274306.6	37	c.267	CCDS3965.1	5	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029875	0.35797	.	.	ENSG00000145649	ENST00000274306	T	0.42513	0.97	6.03	3.33	0.38152	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.154345	0.56097	D	0.000022	T	0.50718	0.1632	L	0.45051	1.395	0.29371	N	0.86401	D	0.69078	0.997	D	0.68039	0.955	T	0.48592	-0.9022	10	0.62326	D	0.03	.	8.8123	0.34974	0.3529:0.0:0.6471:0.0	.	89	P12544	GRAA_HUMAN	D	89	ENSP00000274306:E89D	ENSP00000274306:E89D	E	+	3	2	GZMA	54439430	0.190000	0.23276	0.652000	0.29579	0.003000	0.03518	0.354000	0.20146	0.449000	0.26747	-0.136000	0.14681	GAG	GZMA	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000145649		0.418	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMA	HGNC	protein_coding	OTTHUMT00000214100.2	-	0.00	56	0	G	NM_006144		54403673	+1	tier1	-	no_errors	ENST00000274306	ensembl	human	known	74_37	missense	18.33	49	11	SNP	0.374	T
HADH	3033	genome.wustl.edu	37	4	108935634	108935634	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:108935634C>A	ENST00000309522.3	+	3	458	c.309C>A	c.(307-309)agC>agA	p.S103R	HADH_ENST00000603302.1_Missense_Mutation_p.S103R|HADH_ENST00000403312.1_Missense_Mutation_p.S162R|HADH_ENST00000454409.2_Missense_Mutation_p.S107R|HADH_ENST00000505878.1_Missense_Mutation_p.S107R	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	432					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		TAGCGACCAGCACGGATGCAG	0.522																																																	0													158.0	144.0	149.0					4																	108935634		2203	4300	6503	SO:0001583	missense	0			X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.309C>A	4.37:g.108935634C>A	ENSP00000312288:p.Ser103Arg		B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,pfam_AlaDH/PNT_NAD(H)-bd,pfam_UDP-Glc/GDP-Man_DH_N,superfamily_6-PGluconate_DH_C-like	p.S162R	ENST00000309522.3	37	c.486	CCDS3678.1	4	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223965	0.39300	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	T;T;T	0.77358	-1.09;-1.09;-1.09	5.84	4.99	0.66335	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.270861	0.45361	D	0.000375	D	0.83188	0.5200	M	0.82323	2.585	0.80722	D	1	D;D;P	0.56521	0.971;0.976;0.753	P;P;B	0.48901	0.556;0.594;0.272	D	0.86432	0.1761	10	0.87932	D	0	-22.4974	15.2366	0.73436	0.0:0.932:0.0:0.068	.	162;107;103	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	R	103;103;107;107	ENSP00000312288:S103R;ENSP00000425952:S107R;ENSP00000395167:S107R	ENSP00000312288:S103R	S	+	3	2	HADH	109155083	1.000000	0.71417	0.998000	0.56505	0.047000	0.14425	1.912000	0.39946	2.760000	0.94817	0.655000	0.94253	AGC	HADH	-	pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_AlaDH/PNT_NAD(H)-bd,pfam_UDP-Glc/GDP-Man_DH_N	ENSG00000138796		0.522	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADH	HGNC	protein_coding	OTTHUMT00000254750.2	-	0.00	73	0	C	NM_005327		108935634	+1	tier1	-	no_errors	ENST00000403312	ensembl	human	known	74_37	missense	23.33	46	14	SNP	1.000	A
HAS1	3036	genome.wustl.edu	37	19	52219540	52219540	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:52219540T>C	ENST00000222115.1	-	4	1064	c.1030A>G	c.(1030-1032)Aac>Gac	p.N344D	HAS1_ENST00000601714.1_Missense_Mutation_p.N351D|HAS1_ENST00000540069.2_Missense_Mutation_p.N343D|HAS1_ENST00000594621.1_Intron	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	344					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGCATGCGGTTGGTGAGGTGC	0.522																																					NSCLC(132;636 2450 45807 47979)												0													110.0	101.0	104.0					19																	52219540		2203	4300	6503	SO:0001583	missense	0			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1030A>G	19.37:g.52219540T>C	ENSP00000222115:p.Asn344Asp		Q14470|Q9NS49	Missense_Mutation	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.N351D	ENST00000222115.1	37	c.1051	CCDS12838.1	19	.	.	.	.	.	.	.	.	.	.	t	18.91	3.724193	0.68959	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.42513	0.97;0.97	3.35	3.35	0.38373	.	0.000000	0.85682	U	0.000000	T	0.68842	0.3045	M	0.93763	3.455	0.52099	D	0.99994	D;D;D	0.76494	0.991;0.999;0.999	P;D;D	0.71870	0.906;0.975;0.975	T	0.75022	-0.3464	10	0.66056	D	0.02	-16.4827	10.0341	0.42118	0.0:0.0:0.0:1.0	.	343;344;343	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	D	343;344	ENSP00000445021:N343D;ENSP00000222115:N344D	ENSP00000222115:N344D	N	-	1	0	HAS1	56911352	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	7.831000	0.86748	1.315000	0.45114	0.139000	0.15985	AAC	HAS1	-	pfam_Chitin_synth_fng	ENSG00000105509		0.522	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HAS1	HGNC	protein_coding	OTTHUMT00000466953.1	-	0.00	46	0	T	NM_001523		52219540	-1	tier1	-	no_errors	ENST00000601714	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	C
HCCAT5	283902	genome.wustl.edu	37	16	73127474	73127474	+	lincRNA	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:73127474C>A	ENST00000569990.2	+	0	880					NR_027756.1				hepatocellular carcinoma associated transcript 5 (non-protein coding)																		GCCTTGTCTTCATCTTGGGCT	0.562																																																	0													49.0	52.0	51.0					16																	73127474		2003	4158	6161			0					16q22.3	2014-06-20			ENSG00000260880	ENSG00000260880		"""Long non-coding RNAs"""	48612	non-coding RNA	RNA, long non-coding	"""hepatoma associated gene"""	615613				20130911, 23314567	Standard	NR_027756		Approved	HTA, FJ222407			OTTHUMG00000172964		16.37:g.73127474C>A				RNA	SNP	-	NULL	ENST00000569990.2	37	NULL		16																																																																																			HCCAT5	-	-	ENSG00000260880		0.562	HCCAT5-001	KNOWN	basic	lincRNA	HCCAT5	HGNC	lincRNA	OTTHUMT00000440524.1	-	0.00	80	0	C	NR_027756		73127474	+1	tier1	-	no_errors	ENST00000569990	ensembl	human	known	74_37	rna	20.93	34	9	SNP	0.993	A
HECTD3	79654	genome.wustl.edu	37	1	45475895	45475895	+	Missense_Mutation	SNP	C	C	T	rs113744661		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:45475895C>T	ENST00000372172.4	-	3	672	c.601G>A	c.(601-603)Gca>Aca	p.A201T	UROD_ENST00000246337.4_5'Flank|HECTD3_ENST00000372168.3_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	201					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A201T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					ACAGCTTCTGCGTATGCCTCT	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18511	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	THR/ALA	3,4185		0,3,2091	132.0	135.0	134.0		601	1.8	0.2	1	dbSNP_132	134	0,8442		0,0,4221	no	missense	HECTD3	NM_024602.5	58	0,3,6312	TT,TC,CC		0.0,0.0716,0.0238	benign	201/862	45475895	3,12627	2094	4221	6315	SO:0001583	missense	0			BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.601G>A	1.37:g.45475895C>T	ENSP00000361245:p.Ala201Thr		B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	pfam_HECT,pfam_APC_su10/DOC_dom,superfamily_HECT,superfamily_Galactose-bd-like,smart_HECT,pfscan_HECT	p.A201T	ENST00000372172.4	37	c.601	CCDS41318.1	1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454256	0.26161	7.16E-4	0.0	ENSG00000126107	ENST00000372172	T	0.58506	0.33	4.13	1.82	0.25136	Galactose-binding domain-like (1);	0.651897	0.14941	N	0.289528	T	0.28134	0.0694	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03898	-1.0994	10	0.19590	T	0.45	.	6.5283	0.22312	0.0:0.472:0.0:0.528	.	201	Q5T447	HECD3_HUMAN	T	201	ENSP00000361245:A201T	ENSP00000361245:A201T	A	-	1	0	HECTD3	45248482	0.906000	0.30813	0.200000	0.23457	0.885000	0.51271	0.579000	0.23788	0.275000	0.22094	-0.302000	0.09304	GCA	HECTD3	-	superfamily_Galactose-bd-like	ENSG00000126107		0.587	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD3	HGNC	protein_coding	OTTHUMT00000023734.1		0.00	26	0	C	NM_024602		45475895	-1			no_errors	ENST00000372172	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.965	T
HECW2	57520	genome.wustl.edu	37	2	197171869	197171869	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:197171869G>T	ENST00000260983.3	-	12	2856	c.2674C>A	c.(2674-2676)Cac>Aac	p.H892N	HECW2_ENST00000409111.1_Missense_Mutation_p.H536N	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	892	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CTGGCTTGGTGAAAGTCAGCT	0.413																																																	0													123.0	108.0	113.0					2																	197171869		2203	4300	6503	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2674C>A	2.37:g.197171869G>T	ENSP00000260983:p.His892Asn		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.H892N	ENST00000260983.3	37	c.2674	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960896	0.34565	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	D;D	0.83591	-1.74;-1.74	5.39	5.39	0.77823	.	0.443718	0.26824	N	0.022311	T	0.70386	0.3218	N	0.22421	0.69	0.41772	D	0.989773	P	0.39250	0.665	B	0.33042	0.157	T	0.72956	-0.4134	10	0.44086	T	0.13	.	12.6262	0.56630	0.075:0.0:0.925:0.0	.	892	Q9P2P5	HECW2_HUMAN	N	536;892	ENSP00000386775:H536N;ENSP00000260983:H892N	ENSP00000260983:H892N	H	-	1	0	HECW2	196880114	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.874000	0.63064	2.809000	0.96659	0.555000	0.69702	CAC	HECW2	-	NULL	ENSG00000138411		0.413	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	-	0.00	84	0	G	NM_020760		197171869	-1	tier1	-	no_errors	ENST00000260983	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
HEPHL1	341208	genome.wustl.edu	37	11	93844876	93844876	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:93844876A>G	ENST00000315765.9	+	20	3304	c.3296A>G	c.(3295-3297)cAg>cGg	p.Q1099R		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1099					copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GGCAAAGAGCAGCTCTATTTC	0.463																																																	0													63.0	62.0	62.0					11																	93844876		1871	4109	5980	SO:0001583	missense	0			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3296A>G	11.37:g.93844876A>G	ENSP00000313699:p.Gln1099Arg		Q3C1W7	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.Q1099R	ENST00000315765.9	37	c.3296	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	A	5.805	0.332774	0.11013	.	.	ENSG00000181333	ENST00000315765	D	0.99186	-5.53	5.44	1.83	0.25207	.	.	.	.	.	D	0.94082	0.8103	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.87967	0.2734	9	0.17832	T	0.49	-17.7128	1.0631	0.01604	0.5243:0.1467:0.166:0.163	.	1099	Q6MZM0	HPHL1_HUMAN	R	1099	ENSP00000313699:Q1099R	ENSP00000313699:Q1099R	Q	+	2	0	HEPHL1	93484524	0.002000	0.14202	0.147000	0.22382	0.452000	0.32318	1.247000	0.32815	0.338000	0.23692	0.533000	0.62120	CAG	HEPHL1	-	NULL	ENSG00000181333		0.463	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	HGNC	protein_coding	OTTHUMT00000396103.2		0.00	51	0	A	XM_291947		93844876	+1			no_errors	ENST00000315765	ensembl	human	known	74_37	missense	11.63	38	5	SNP	0.014	G
HHATL	57467	genome.wustl.edu	37	3	42740347	42740347	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:42740347G>T	ENST00000441594.1	-	5	597	c.336C>A	c.(334-336)ggC>ggA	p.G112G	HHATL_ENST00000310417.5_Silent_p.G112G	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	112					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		GGCCCATTGTGCCCATCACAG	0.607																																																	0													74.0	75.0	75.0					3																	42740347		2203	4300	6503	SO:0001819	synonymous_variant	0			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.336C>A	3.37:g.42740347G>T			Q8TBG3|Q9ULP7	Silent	SNP	pfam_MBOAT_fam	p.G112	ENST00000441594.1	37	c.336	CCDS2704.1	3																																																																																			HHATL	-	NULL	ENSG00000010282		0.607	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HHATL	HGNC	protein_coding	OTTHUMT00000343627.1	-	0.00	23	0	G	NM_020707		42740347	-1	tier1	-	no_errors	ENST00000310417	ensembl	human	known	74_37	silent	26.67	11	4	SNP	1.000	T
HLCS	3141	genome.wustl.edu	37	21	38139568	38139568	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:38139568C>T	ENST00000399120.1	-	8	2700	c.1470G>A	c.(1468-1470)ccG>ccA	p.P490P	HLCS_ENST00000336648.4_Silent_p.P490P	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	490	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)	p.P490P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CCATTTCCTGCGGTGTCTGAA	0.547																																																	1	Substitution - coding silent(1)	endometrium(1)											109.0	92.0	98.0					21																	38139568		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1470G>A	21.37:g.38139568C>T			B2RAH1|D3DSG6|Q99451	Silent	SNP	pfam_BPL_LipA_LipB,pfam_BPL_C,tigrfam_Biotin_CoA_COase_ligase	p.P490	ENST00000399120.1	37	c.1470	CCDS13647.1	21																																																																																			HLCS	-	pfam_BPL_LipA_LipB,tigrfam_Biotin_CoA_COase_ligase	ENSG00000159267		0.547	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HLCS	HGNC	protein_coding	OTTHUMT00000194687.2	-	0.00	41	0	C			38139568	-1	tier1	-	no_errors	ENST00000336648	ensembl	human	known	74_37	silent	11.63	38	5	SNP	0.022	T
HMGN5	79366	genome.wustl.edu	37	X	80371811	80371811	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:80371811T>G	ENST00000358130.2	-	6	487	c.159A>C	c.(157-159)gaA>gaC	p.E53D	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	53					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						CTATGTTTTCTTCCATCATAT	0.328																																																	0													135.0	102.0	113.0					X																	80371811		2202	4298	6500	SO:0001583	missense	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.159A>C	X.37:g.80371811T>G	ENSP00000350848:p.Glu53Asp		Q5JSL1	Missense_Mutation	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.E53D	ENST00000358130.2	37	c.159	CCDS14448.1	X	.	.	.	.	.	.	.	.	.	.	T	11.38	1.623058	0.28889	.	.	ENSG00000198157	ENST00000358130;ENST00000447319;ENST00000373250;ENST00000430960;ENST00000436386;ENST00000451455	.	.	.	4.67	2.27	0.28462	.	0.224693	0.22560	N	0.058477	T	0.36826	0.0981	N	0.17764	0.52	0.09310	N	1	D	0.61697	0.99	D	0.65233	0.933	T	0.10989	-1.0606	9	0.52906	T	0.07	.	7.0022	0.24815	0.0:0.2913:0.0:0.7087	.	53	P82970	HMGN5_HUMAN	D	53;33;43;53;53;53	.	ENSP00000350848:E53D	E	-	3	2	HMGN5	80258467	0.849000	0.29639	0.005000	0.12908	0.018000	0.09664	0.342000	0.19926	0.241000	0.21283	0.441000	0.28932	GAA	HMGN5	-	pfam_HMGN_fam,smart_HMGN_fam	ENSG00000198157		0.328	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1	-	0.00	35	0	T	NM_030763		80371811	-1	tier1	-	no_errors	ENST00000358130	ensembl	human	known	74_37	missense	28.57	30	12	SNP	0.024	G
HNRNPDL	9987	genome.wustl.edu	37	4	83350579	83350579	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:83350579G>T	ENST00000295470.5	-	1	440	c.265C>A	c.(265-267)Cat>Aat	p.H89N	HNRNPDL_ENST00000349655.4_5'UTR|HNRNPDL_ENST00000502762.1_Missense_Mutation_p.H89N|HNRNPDL_ENST00000514511.1_5'Flank|HNRNPDL_ENST00000602300.1_5'UTR|ENOPH1_ENST00000273920.3_5'Flank|ENOPH1_ENST00000509635.1_5'Flank	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	89					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										GATTTAAAATGGCGGCGGAAG	0.711																																																	0													23.0	29.0	27.0					4																	83350579		2198	4297	6495	SO:0001583	missense	0			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.265C>A	4.37:g.83350579G>T	ENSP00000295470:p.His89Asn		Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H89N	ENST00000295470.5	37	c.265	CCDS3593.1	4	.	.	.	.	.	.	.	.	.	.	g	18.04	3.535250	0.64972	.	.	ENSG00000152795	ENST00000295470;ENST00000502762	T;T	0.66280	-0.2;-0.2	5.35	4.45	0.53987	.	0.290799	0.24796	N	0.035523	T	0.42063	0.1186	N	0.08118	0	0.80722	D	1	B	0.24186	0.099	B	0.24006	0.05	T	0.36187	-0.9758	10	0.37606	T	0.19	.	13.5028	0.61467	0.0:0.1565:0.8435:0.0	.	89	O14979	HNRDL_HUMAN	N	89	ENSP00000295470:H89N;ENSP00000422040:H89N	ENSP00000295470:H89N	H	-	1	0	HNRPDL	83569603	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	4.399000	0.59703	2.500000	0.84329	0.585000	0.79938	CAT	HNRNPDL	-	NULL	ENSG00000152795		0.711	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPDL	HGNC	protein_coding	OTTHUMT00000252644.1		0.00	70	0	G	NM_005463		83350579	-1			no_errors	ENST00000295470	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
HOMER1	9456	genome.wustl.edu	37	5	78746889	78746889	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:78746889T>G	ENST00000334082.6	-	3	1660	c.218A>C	c.(217-219)aAg>aCg	p.K73T	HOMER1_ENST00000508576.1_Missense_Mutation_p.K73T|HOMER1_ENST00000535690.1_Intron|HOMER1_ENST00000282260.6_Missense_Mutation_p.K73T	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	73	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		CTGGCCAAACTTCTGAGATGT	0.373																																																	0													114.0	107.0	110.0					5																	78746889		1830	4087	5917	SO:0001583	missense	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.218A>C	5.37:g.78746889T>G	ENSP00000334382:p.Lys73Thr		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.K73T	ENST00000334082.6	37	c.218	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582886	0.65992	.	.	ENSG00000152413	ENST00000334082;ENST00000508576;ENST00000282260	D;D;D	0.98666	-5.06;-5.06;-5.06	5.78	5.78	0.91487	EVH1 (3);Pleckstrin homology-type (1);	0.044570	0.85682	D	0.000000	D	0.98757	0.9582	L	0.52905	1.665	0.80722	D	1	P;P;D	0.89917	0.834;0.702;1.0	P;P;D	0.80764	0.743;0.669;0.994	D	0.99908	1.1189	10	0.87932	D	0	-5.3916	16.3971	0.83610	0.0:0.0:0.0:1.0	.	73;73;73	Q86YM7-2;Q86YM7-3;Q86YM7	.;.;HOME1_HUMAN	T	73	ENSP00000334382:K73T;ENSP00000426651:K73T;ENSP00000282260:K73T	ENSP00000282260:K73T	K	-	2	0	HOMER1	78782645	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.330000	0.79161	0.533000	0.62120	AAG	HOMER1	-	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	ENSG00000152413		0.373	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1	-	0.00	106	0	T	NM_004272		78746889	-1	tier1	-	no_errors	ENST00000334082	ensembl	human	known	74_37	missense	24.00	57	18	SNP	1.000	G
HS3ST1	9957	genome.wustl.edu	37	4	11401402	11401402	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:11401402C>T	ENST00000002596.5	-	2	1402	c.228G>A	c.(226-228)ctG>ctA	p.L76L		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	76					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						CGTCGGGGTGCAGGCTGAGCA	0.657																																																	0													57.0	48.0	51.0					4																	11401402		2203	4300	6503	SO:0001819	synonymous_variant	0			AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.228G>A	4.37:g.11401402C>T			B3KUA6|Q6PEY8	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L76	ENST00000002596.5	37	c.228	CCDS3408.1	4																																																																																			HS3ST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000002587		0.657	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	HGNC	protein_coding	OTTHUMT00000207073.3	-	0.00	44	0	C	NM_005114		11401402	-1	tier1	-	no_errors	ENST00000002596	ensembl	human	known	74_37	silent	23.08	30	9	SNP	1.000	T
HTR1F	3355	genome.wustl.edu	37	3	88039930	88039930	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:88039930T>G	ENST00000319595.4	+	1	85	c.31T>G	c.(31-33)Ttg>Gtg	p.L11V		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	11					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TGATCAAAACTTGACCTCAGA	0.368																																																	0													93.0	96.0	95.0					3																	88039930		2203	4300	6503	SO:0001583	missense	0			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.31T>G	3.37:g.88039930T>G	ENSP00000322924:p.Leu11Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_5HT1F_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.L11V	ENST00000319595.4	37	c.31	CCDS2920.1	3	.	.	.	.	.	.	.	.	.	.	T	2.966	-0.213470	0.06140	.	.	ENSG00000179097	ENST00000319595	T	0.37915	1.17	5.96	3.46	0.39613	.	0.714517	0.12707	N	0.445880	T	0.16342	0.0393	N	0.08118	0	0.27297	N	0.957683	B	0.09022	0.002	B	0.08055	0.003	T	0.26292	-1.0107	10	0.13853	T	0.58	.	6.3939	0.21601	0.1399:0.0772:0.0:0.7829	.	11	P30939	5HT1F_HUMAN	V	11	ENSP00000322924:L11V	ENSP00000322924:L11V	L	+	1	2	HTR1F	88122620	0.136000	0.22515	1.000000	0.80357	0.263000	0.26337	0.486000	0.22340	1.078000	0.41014	-0.359000	0.07587	TTG	HTR1F	-	prints_5HT1F_rcpt	ENSG00000179097		0.368	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1F	HGNC	protein_coding	OTTHUMT00000352890.1	-	0.00	45	0	T	NM_000866		88039930	+1	tier1	-	no_errors	ENST00000319595	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	G
IDO2	169355	genome.wustl.edu	37	8	39840171	39840171	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:39840171G>A	ENST00000389060.4	+	4	316	c.316G>A	c.(316-318)Gtc>Atc	p.V106I	IDO2_ENST00000502986.2_Splice_Site_p.V119I|IDO2_ENST00000343295.4_3'UTR|RP11-44K6.3_ENST00000517623.1_RNA			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	106					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						TATCTGAAAGGTCCTGCCAAG	0.463																																																	0													60.0	59.0	59.0					8																	39840171		1871	4097	5968	SO:0001630	splice_region_variant	0			AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.316-1G>A	8.37:g.39840171G>A			A4UD41	Missense_Mutation	SNP	pfam_Indolamine_dOase	p.V119I	ENST00000389060.4	37	c.355		8	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415721	0.25552	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	T;T	0.46451	0.87;0.87	5.81	1.97	0.26223	.	0.340620	0.31747	N	0.007123	T	0.27489	0.0675	L	0.41356	1.27	0.27908	N	0.938731	B	0.18310	0.027	B	0.17433	0.018	T	0.15378	-1.0439	9	.	.	.	.	4.4771	0.11748	0.2473:0.0:0.5978:0.1549	.	119	F5H5G0	.	I	119;106	ENSP00000443432:V119I;ENSP00000426447:V106I	.	V	+	1	0	IDO2	39959328	1.000000	0.71417	0.720000	0.30636	0.367000	0.29736	1.480000	0.35464	0.078000	0.16900	0.467000	0.42956	GTC	IDO2	-	pfam_Indolamine_dOase	ENSG00000188676		0.463	IDO2-004	KNOWN	basic|appris_principal	protein_coding	IDO2	HGNC	protein_coding	OTTHUMT00000372742.1	-	0.00	50	0	G	NM_194294	Missense_Mutation	39840171	+1	tier1	-	no_errors	ENST00000502986	ensembl	human	known	74_37	missense	10.64	42	5	SNP	0.964	A
IGSF10	285313	genome.wustl.edu	37	3	151160934	151160934	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:151160934A>C	ENST00000282466.3	-	5	5800	c.5801T>G	c.(5800-5802)aTg>aGg	p.M1934R	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1934					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCGCTCTTCCATTGTAAGCAT	0.468																																																	0													121.0	124.0	123.0					3																	151160934		2203	4300	6503	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5801T>G	3.37:g.151160934A>C	ENSP00000282466:p.Met1934Arg		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.M1934R	ENST00000282466.3	37	c.5801	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	A	9.670	1.146380	0.21288	.	.	ENSG00000152580	ENST00000489791;ENST00000282466;ENST00000544042	T;T	0.27256	1.81;1.68	5.24	4.08	0.47627	Immunoglobulin-like fold (1);	1.132120	0.06802	N	0.788838	T	0.26448	0.0646	N	0.24115	0.695	0.09310	N	1	P	0.38745	0.645	B	0.43838	0.433	T	0.36407	-0.9749	10	0.87932	D	0	.	10.7553	0.46232	0.9252:0.0:0.0748:0.0	.	1934	Q6WRI0	IGS10_HUMAN	R	2;1934;561	ENSP00000417627:M2R;ENSP00000282466:M1934R	ENSP00000282466:M1934R	M	-	2	0	IGSF10	152643624	0.993000	0.37304	0.010000	0.14722	0.032000	0.12392	7.463000	0.80869	0.857000	0.35407	0.482000	0.46254	ATG	IGSF10	-	smart_Ig_sub	ENSG00000152580		0.468	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	-	0.00	57	0	A	NM_178822		151160934	-1	tier1	-	no_errors	ENST00000282466	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.132	C
IKZF5	64376	genome.wustl.edu	37	10	124755553	124755553	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:124755553G>T	ENST00000368886.5	-	4	593	c.273C>A	c.(271-273)agC>agA	p.S91R	IKZF5_ENST00000479103.1_5'Flank|PSTK_ENST00000497219.1_Intron	NM_001271840.1	NP_001258769.1	Q9H5V7	IKZF5_HUMAN	IKAROS family zinc finger 5 (Pegasus)	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|lung(3)|prostate(1)	6		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)		CTGTTCCTTTGCTGGCATAGT	0.473																																																	0													159.0	158.0	158.0					10																	124755553		1900	4116	6016	SO:0001583	missense	0			AF230808	CCDS41574.1	10q26	2011-05-31	2006-08-25	2006-08-25	ENSG00000095574	ENSG00000095574		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	14283	protein-coding gene	gene with protein product		606238	"""zinc finger protein, subfamily 1A, 5"", ""zinc finger protein, subfamily 1A, 5 (Pegasus)"""	ZNFN1A5		10978333	Standard	NM_001271840		Approved	Pegasus, FLJ22973	uc021qaj.2	Q9H5V7	OTTHUMG00000019192	ENST00000368886.5:c.273C>A	10.37:g.124755553G>T	ENSP00000357881:p.Ser91Arg		B3KVH7|D3DRE7|Q9H2T0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S91R	ENST00000368886.5	37	c.273	CCDS41574.1	10	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361816	0.82353	.	.	ENSG00000095574	ENST00000368886	T	0.01599	4.74	5.87	2.98	0.34508	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.040995	0.85682	D	0.000000	T	0.01222	0.0040	N	0.14661	0.345	0.53005	D	0.999962	P	0.42827	0.791	B	0.32677	0.15	T	0.70817	-0.4769	10	0.54805	T	0.06	-15.7347	11.4531	0.50164	0.1971:0.0:0.8029:0.0	.	91	Q9H5V7	IKZF5_HUMAN	R	91	ENSP00000357881:S91R	ENSP00000357881:S91R	S	-	3	2	IKZF5	124745543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.804000	0.55568	0.922000	0.37019	0.655000	0.94253	AGC	IKZF5	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000095574		0.473	IKZF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF5	HGNC	protein_coding	OTTHUMT00000050820.2	-	0.00	122	0	G	NM_022466		124755553	-1	tier1	-	no_errors	ENST00000368886	ensembl	human	known	74_37	missense	23.42	85	26	SNP	1.000	T
IL12RB2	3595	genome.wustl.edu	37	1	67793957	67793957	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:67793957T>A	ENST00000262345.1	+	5	1194	c.554T>A	c.(553-555)aTc>aAc	p.I185N	IL12RB2_ENST00000544434.1_Missense_Mutation_p.I185N|IL12RB2_ENST00000541374.1_Missense_Mutation_p.I185N|IL12RB2_ENST00000371000.1_Missense_Mutation_p.I185N	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	185	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.		I -> V (in dbSNP:rs2307146).		cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						GACTTTGGAATCAACCTCACC	0.408																																																	0													217.0	203.0	208.0					1																	67793957		2203	4300	6503	SO:0001583	missense	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.554T>A	1.37:g.67793957T>A	ENSP00000262345:p.Ile185Asn		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.I185N	ENST00000262345.1	37	c.554	CCDS638.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.18|16.18	3.051691|3.051691	0.55218|0.55218	.|.	.|.	ENSG00000081985|ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434|ENST00000441640	D;D;D;D|.	0.83163|.	-1.69;-1.69;-1.69;-1.69|.	5.35|5.35	4.22|4.22	0.49857|0.49857	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	0.434355|.	0.27096|.	N|.	0.020949|.	T|T	0.46014|0.46014	0.1371|0.1371	M|M	0.75264|0.75264	2.295|2.295	0.32965|0.32965	D|D	0.521533|0.521533	D;D;D;D|.	0.71674|.	0.98;0.998;0.985;0.997|.	P;P;P;D|.	0.69479|.	0.543;0.904;0.864;0.964|.	T|T	0.50171|0.50171	-0.8859|-0.8859	10|5	0.59425|.	D|.	0.04|.	-10.2024|-10.2024	7.7348|7.7348	0.28808|0.28808	0.0:0.0952:0.0:0.9048|0.0:0.0952:0.0:0.9048	.|.	185;185;185;185|.	B4DGA4;F5H7L6;Q99665-2;Q99665|.	.;.;.;I12R2_HUMAN|.	N|K	185|52	ENSP00000262345:I185N;ENSP00000360039:I185N;ENSP00000445276:I185N;ENSP00000442443:I185N|.	ENSP00000262345:I185N|.	I|N	+|+	2|3	0|2	IL12RB2|IL12RB2	67566545|67566545	0.882000|0.882000	0.30256|0.30256	0.611000|0.611000	0.29010|0.29010	0.822000|0.822000	0.46500|0.46500	1.073000|1.073000	0.30691|0.30691	0.874000|0.874000	0.35823|0.35823	0.459000|0.459000	0.35465|0.35465	ATC|AAT	IL12RB2	-	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081985		0.408	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	-	0.00	67	0	T	NM_001559		67793957	+1	tier1	-	no_errors	ENST00000262345	ensembl	human	known	74_37	missense	13.95	37	6	SNP	0.674	A
IL20	50604	genome.wustl.edu	37	1	207039974	207039974	+	Missense_Mutation	SNP	G	G	A	rs369436616		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:207039974G>A	ENST00000367098.1	+	4	734	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	IL20_ENST00000391930.2_Missense_Mutation_p.R124Q|IL20_ENST00000367096.3_Missense_Mutation_p.R124Q			Q9UHF5	IL17B_HUMAN	interleukin 20	0					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)|urinary_tract(1)	9	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		AAGGACCTCCGGCTCTGTGTG	0.478																																																	0								G	GLN/ARG	0,4406		0,0,2203	138.0	139.0	138.0		371	2.4	1.0	1		138	2,8598	2.2+/-6.3	0,2,4298	no	missense	IL20	NM_018724.3	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	124/177	207039974	2,13004	2203	4300	6503	SO:0001583	missense	0			AF224266	CCDS1470.1	1q32	2008-02-05			ENSG00000162891	ENSG00000162891		"""Interleukins and interleukin receptors"""	6002	protein-coding gene	gene with protein product		605619				11163236	Standard	NM_018724		Approved	ZCYTO10, IL10D, IL-20	uc001her.3	Q9NYY1	OTTHUMG00000036456	ENST00000367098.1:c.371G>A	1.37:g.207039974G>A	ENSP00000356065:p.Arg124Gln		Q14CE5	Missense_Mutation	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-20,prints_IL-24	p.R124Q	ENST00000367098.1	37	c.371	CCDS1470.1	1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826918	0.32329	0.0	2.33E-4	ENSG00000162891	ENST00000367098;ENST00000367096;ENST00000391930	T;T;T	0.71698	-0.59;-0.59;2.28	5.06	2.42	0.29668	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.310366	0.31472	N	0.007599	T	0.51041	0.1651	L	0.38953	1.18	0.31138	N	0.706913	B;B	0.32203	0.36;0.233	B;B	0.22386	0.039;0.029	T	0.48614	-0.9020	10	0.30854	T	0.27	-0.036	5.3377	0.15967	0.165:0.1852:0.6498:0.0	.	124;124	Q2THG6;Q9NYY1	.;IL20_HUMAN	Q	124	ENSP00000356065:R124Q;ENSP00000356063:R124Q;ENSP00000375796:R124Q	ENSP00000356063:R124Q	R	+	2	0	IL20	205106597	0.000000	0.05858	0.968000	0.41197	0.998000	0.95712	0.634000	0.24614	0.304000	0.22809	0.655000	0.94253	CGG	IL20	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam	ENSG00000162891		0.478	IL20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20	HGNC	protein_coding	OTTHUMT00000088676.1	-	0.00	24	0	G	NM_018724		207039974	+1	tier1	-	no_errors	ENST00000367096	ensembl	human	known	74_37	missense	13.64	38	6	SNP	0.995	A
IL7	3574	genome.wustl.edu	37	8	79652243	79652243	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:79652243A>G	ENST00000263851.4	-	3	822	c.222T>C	c.(220-222)gcT>gcC	p.A74A	IL7_ENST00000520269.1_Silent_p.A74A|IL7_ENST00000519833.1_5'UTR|IL7_ENST00000541183.1_Silent_p.A23A	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7	74					bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)			endometrium(2)|large_intestine(2)|lung(1)	5						TTACCTTATTAGCATCACAGA	0.259																																																	0													42.0	44.0	43.0					8																	79652243		2188	4277	6465	SO:0001819	synonymous_variant	0			J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.222T>C	8.37:g.79652243A>G			A0N0L3|Q5FBY5|Q5FBY9	Silent	SNP	pfam_IL-7/IL-9_fam,smart_IL-7,pirsf_IL-7,prints_IL-7	p.A74	ENST00000263851.4	37	c.222	CCDS6224.1	8																																																																																			IL7	-	pfam_IL-7/IL-9_fam,smart_IL-7,pirsf_IL-7,prints_IL-7	ENSG00000104432		0.259	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7	HGNC	protein_coding	OTTHUMT00000379429.1	-	0.00	28	0	A			79652243	-1	tier1	-	no_errors	ENST00000263851	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	G
INSL6	11172	genome.wustl.edu	37	9	5185504	5185504	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:5185504G>T	ENST00000381641.3	-	1	164	c.99C>A	c.(97-99)tgC>tgA	p.C33*		NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	33					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.C33C(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		AGTACCTGCCGCACAGCTTCC	0.562																																																	1	Substitution - coding silent(1)	endometrium(1)											58.0	53.0	54.0					9																	5185504		2203	4300	6503	SO:0001587	stop_gained	0			AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.99C>A	9.37:g.5185504G>T	ENSP00000371054:p.Cys33*		A0AVS0|Q9NS16	Nonsense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,pirsf_Insulin-like_pep_6	p.C33*	ENST00000381641.3	37	c.99	CCDS6458.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.077521	0.94000	.	.	ENSG00000120210	ENST00000381641	.	.	.	4.35	2.53	0.30540	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.4892	6.7614	0.23542	0.2084:0.0:0.7916:0.0	.	.	.	.	X	33	.	ENSP00000371054:C33X	C	-	3	2	INSL6	5175504	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	0.859000	0.27858	0.802000	0.34089	0.650000	0.86243	TGC	INSL6	-	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,pirsf_Insulin-like_pep_6	ENSG00000120210		0.562	INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL6	HGNC	protein_coding	OTTHUMT00000051608.3		0.00	84	0	G	NM_007179		5185504	-1			no_errors	ENST00000381641	ensembl	human	known	74_37	nonsense	5.77	49	3	SNP	1.000	T
ITGB6	3694	genome.wustl.edu	37	2	161051888	161051888	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:161051888G>T	ENST00000283249.2	-	4	822	c.585C>A	c.(583-585)aaC>aaA	p.N195K	ITGB6_ENST00000428609.2_Missense_Mutation_p.N153K|ITGB6_ENST00000409872.1_Missense_Mutation_p.N195K|ITGB6_ENST00000409967.2_Missense_Mutation_p.N195K|ITGB6_ENST00000485635.1_5'UTR	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	195	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						ACCTGCAAGGGTTGGCAATTT	0.443																																																	0													93.0	99.0	97.0					2																	161051888		2203	4300	6503	SO:0001583	missense	0				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.585C>A	2.37:g.161051888G>T	ENSP00000283249:p.Asn195Lys		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.N195K	ENST00000283249.2	37	c.585	CCDS2212.1	2	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678628	0.68042	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.98012	-4.66;-4.66;-4.66;-4.66	6.05	5.17	0.71159	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.97548	0.9197	M	0.78285	2.405	0.58432	D	0.999997	D;D	0.57899	0.981;0.981	P;P	0.50440	0.641;0.641	D	0.97226	0.9881	10	0.59425	D	0.04	.	12.0675	0.53596	0.1371:0.0:0.8629:0.0	.	153;195	E9PEE8;P18564	.;ITB6_HUMAN	K	195;153;195;195	ENSP00000283249:N195K;ENSP00000408024:N153K;ENSP00000386828:N195K;ENSP00000386367:N195K	ENSP00000283249:N195K	N	-	3	2	ITGB6	160760134	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.261000	0.32980	1.565000	0.49641	0.650000	0.86243	AAC	ITGB6	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000115221		0.443	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	HGNC	protein_coding	OTTHUMT00000255036.1	-	0.00	54	0	G	NM_000888		161051888	-1	tier1	-	no_errors	ENST00000283249	ensembl	human	known	74_37	missense	12.96	47	7	SNP	1.000	T
IVL	3713	genome.wustl.edu	37	1	152883590	152883590	+	Missense_Mutation	SNP	A	A	C	rs543706373		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:152883590A>C	ENST00000368764.3	+	2	1381	c.1317A>C	c.(1315-1317)caA>caC	p.Q439H	IVL_ENST00000392667.2_Missense_Mutation_p.Q293H			P07476	INVO_HUMAN	involucrin	439	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGAGGGACAACTGAAGCATC	0.637																																																	0													23.0	26.0	25.0					1																	152883590		2170	4256	6426	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1317A>C	1.37:g.152883590A>C	ENSP00000357753:p.Gln439His		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q439H	ENST00000368764.3	37	c.1317	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	a	11.35	1.614173	0.28712	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.12039	2.96;2.72	3.19	-6.39	0.01951	.	.	.	.	.	T	0.02342	0.0072	L	0.36672	1.1	0.09310	N	1	B	0.17268	0.021	B	0.16289	0.015	T	0.42565	-0.9444	9	0.44086	T	0.13	0.5998	3.7891	0.08713	0.1103:0.3135:0.432:0.1442	.	439	P07476	INVO_HUMAN	H	439;293	ENSP00000357753:Q439H;ENSP00000376435:Q293H	ENSP00000357753:Q439H	Q	+	3	2	IVL	151150214	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.355000	0.02612	-1.584000	0.01636	-1.229000	0.01577	CAA	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.637	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	128	0	A	NM_005547		152883590	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	25.47	120	41	SNP	0.000	C
JAKMIP2	9832	genome.wustl.edu	37	5	147021269	147021269	+	Splice_Site	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:147021269A>G	ENST00000265272.5	-	8	1749		c.e8+1		JAKMIP2_ENST00000333010.6_Splice_Site|JAKMIP2_ENST00000507386.1_Splice_Site	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2							Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTCTTATTACCTTAATTGG	0.403																																																	0													187.0	173.0	178.0					5																	147021269		2203	4299	6502	SO:0001630	splice_region_variant	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1281+1T>C	5.37:g.147021269A>G			A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Splice_Site	SNP	-	e7+2	ENST00000265272.5	37	c.1281+2	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193157	0.78902	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1533	0.81636	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JAKMIP2	147001462	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.856000	0.86956	2.279000	0.76181	0.533000	0.62120	.	JAKMIP2	-	-	ENSG00000176049		0.403	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	87	0	A	NM_014790	Intron	147021269	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	splice_site	10.42	43	5	SNP	1.000	G
KANK1	23189	genome.wustl.edu	37	9	730245	730245	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:730245T>C	ENST00000382303.1	+	8	3545	c.2893T>C	c.(2893-2895)Tat>Cat	p.Y965H	KANK1_ENST00000382297.2_Missense_Mutation_p.Y965H|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.Y807H	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	965					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CGCTGGCCTCTATGGTAACTT	0.498																																																	0													52.0	48.0	50.0					9																	730245		2203	4300	6503	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2893T>C	9.37:g.730245T>C	ENSP00000371740:p.Tyr965His		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Y965H	ENST00000382303.1	37	c.2893	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	T	12.34	1.907762	0.33721	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.16597	2.33;2.33;2.33	5.91	4.78	0.61160	.	0.129385	0.35772	N	0.002999	T	0.30479	0.0766	L	0.54323	1.7	0.80722	D	1	D;B	0.71674	0.998;0.007	P;B	0.60345	0.873;0.01	T	0.01409	-1.1362	10	0.42905	T	0.14	-4.6498	10.705	0.45950	0.0:0.0721:0.0:0.9279	.	965;965	Q5W0W1;Q14678	.;KANK1_HUMAN	H	965;965;965;807	ENSP00000371740:Y965H;ENSP00000371734:Y965H;ENSP00000371730:Y807H	ENSP00000346479:Y965H	Y	+	1	0	KANK1	720245	0.999000	0.42202	0.955000	0.39395	0.811000	0.45836	2.367000	0.44213	1.064000	0.40671	0.533000	0.62120	TAT	KANK1	-	smart_Ankyrin_rpt	ENSG00000107104		0.498	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2		0.00	67	0	T	NM_015158		730245	+1			no_errors	ENST00000382297	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.986	C
KCNIP4	80333	genome.wustl.edu	37	4	21305474	21305474	+	Intron	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:21305474A>C	ENST00000382152.2	-	2	229				KCNIP4_ENST00000382148.3_Intron|KCNIP4_ENST00000447367.2_Intron|KCNIP4_ENST00000382150.4_Missense_Mutation_p.V19G|KCNIP4_ENST00000509207.1_Intron|RP11-120A1.1_ENST00000515680.2_RNA	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4							dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				CAATAATTTAACAAAAAGCAC	0.413																																																	0													117.0	103.0	108.0					4																	21305474		2203	4300	6503	SO:0001627	intron_variant	0			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.62-421142T>G	4.37:g.21305474A>C			Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.V19G	ENST00000382152.2	37	c.56	CCDS43216.1	4	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598092	0.66332	.	.	ENSG00000185774	ENST00000382150	T	0.71817	-0.6	5.56	5.56	0.83823	.	.	.	.	.	T	0.60625	0.2283	L	0.27053	0.805	0.80722	D	1	B	0.22800	0.075	B	0.17433	0.018	T	0.59573	-0.7429	9	0.66056	D	0.02	.	15.7023	0.77552	1.0:0.0:0.0:0.0	.	19	Q3YAC0	.	G	19	ENSP00000371585:V19G	ENSP00000371585:V19G	V	-	2	0	KCNIP4	20914572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.584000	0.90798	2.113000	0.64589	0.533000	0.62120	GTT	KCNIP4	-	NULL	ENSG00000185774		0.413	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	HGNC	protein_coding	OTTHUMT00000360407.3	-	0.00	39	0	A	NM_025221		21305474	-1	tier1	-	no_errors	ENST00000382150	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	C
KCNMA1	3778	genome.wustl.edu	37	10	78704539	78704539	+	Missense_Mutation	SNP	T	T	G	rs577988617		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:78704539T>G	ENST00000286628.8	-	23	2893	c.2894A>C	c.(2893-2895)aAt>aCt	p.N965T	KCNMA1_ENST00000372440.1_Missense_Mutation_p.N907T|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000372443.1_Missense_Mutation_p.N907T|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000404771.3_Missense_Mutation_p.N965T|KCNMA1_ENST00000286627.5_Missense_Mutation_p.N907T|RP11-443A13.5_ENST00000608791.1_RNA|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000354353.5_Missense_Mutation_p.N968T|KCNMA1_ENST00000406533.3_Missense_Mutation_p.N969T|KCNMA1_ENST00000404857.1_Missense_Mutation_p.N948T|RP11-443A13.5_ENST00000598613.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	965					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ACCTTGGGAATTAGCCTGCAA	0.473													T|||	1	0.000199681	0.0	0.0	5008	,	,		20480	0.001		0.0	False		,,,				2504	0.0																0													123.0	105.0	111.0					10																	78704539		2203	4300	6503	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2894A>C	10.37:g.78704539T>G	ENSP00000286628:p.Asn965Thr		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.N969T	ENST00000286628.8	37	c.2906		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	15.06|15.06|15.06	2.721256|2.721256|2.721256	0.48728|0.48728|0.48728	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	.|T;T;T;T;T;T;T;T;T|.	.|0.51071|.	.|0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72|.	5.75|5.75|5.75	5.75|5.75|5.75	0.90469|0.90469|0.90469	.|.|.	.|0.094831|.	.|0.64402|.	.|D|.	.|0.000001|.	T|T|.	0.48960|0.48960|.	0.1529|0.1529|.	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;B;B;B;B;B;B;B|.	.|0.29378|.	.|0.243;0.077;0.012;0.077;0.004;0.001;0.109;0.077|.	.|B;B;B;B;B;B;B;B|.	.|0.35727|.	.|0.209;0.071;0.015;0.071;0.004;0.004;0.149;0.103|.	T|T|.	0.46456|0.46456|.	-0.9190|-0.9190|.	5|10|.	.|0.11794|.	.|T|.	.|0.64|.	-14.4543|-14.4543|-14.4543	16.0518|16.0518|16.0518	0.80769|0.80769|0.80769	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|936;910;948;965;907;718;968;907|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	L|T|Y	858|907;844;900;939;902;907;907;939;969;968;948;718|895;614	.|ENSP00000361517:N907T;ENSP00000361485:N844T;ENSP00000361514:N900T;ENSP00000396608:N939T;ENSP00000361520:N907T;ENSP00000286627:N907T;ENSP00000385552:N969T;ENSP00000346321:N968T;ENSP00000385806:N948T|.	.|ENSP00000286627:N907T|.	I|N|X	-|-|-	1|2|3	0|0|2	KCNMA1|KCNMA1|KCNMA1	78374545|78374545|78374545	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.953000|7.953000|7.953000	0.87836|0.87836|0.87836	2.191000|2.191000|2.191000	0.70037|0.70037|0.70037	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	ATT|AAT|TAA	KCNMA1	-	NULL	ENSG00000156113		0.473	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	80	0	T	NM_002247		78704539	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	G
KCNQ4	9132	genome.wustl.edu	37	1	41283924	41283924	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:41283924G>A	ENST00000347132.5	+	3	576	c.494G>A	c.(493-495)gGt>gAt	p.G165D	KCNQ4_ENST00000509682.2_Missense_Mutation_p.G165D	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	165					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GGATGGCAGGGTCGCTTCCGC	0.627																																																	0													109.0	100.0	103.0					1																	41283924		2203	4300	6503	SO:0001583	missense	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.494G>A	1.37:g.41283924G>A	ENSP00000262916:p.Gly165Asp		O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.G165D	ENST00000347132.5	37	c.494	CCDS456.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.312096	0.95655	.	.	ENSG00000117013	ENST00000347132;ENST00000509682	D;D	0.98937	-5.25;-5.18	4.76	4.76	0.60689	Ion transport (1);	0.117292	0.56097	D	0.000023	D	0.98576	0.9524	L	0.48877	1.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99655	1.0992	10	0.87932	D	0	-27.9514	15.3399	0.74287	0.0:0.0:1.0:0.0	.	165;165	P56696-2;P56696	.;KCNQ4_HUMAN	D	165	ENSP00000262916:G165D;ENSP00000423756:G165D	ENSP00000262916:G165D	G	+	2	0	KCNQ4	41056511	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.616000	0.98359	2.474000	0.83562	0.650000	0.86243	GGT	KCNQ4	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_KCNQ	ENSG00000117013		0.627	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	-	0.00	77	0	G	NM_004700		41283924	+1	tier1	-	no_errors	ENST00000347132	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
KCNT2	343450	genome.wustl.edu	37	1	196451484	196451484	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:196451484T>G	ENST00000294725.9	-	4	1216	c.301A>C	c.(301-303)Agt>Cgt	p.S101R	KCNT2_ENST00000367431.4_Missense_Mutation_p.S101R|KCNT2_ENST00000367433.5_Missense_Mutation_p.S101R|KCNT2_ENST00000609185.1_Missense_Mutation_p.S101R|KCNT2_ENST00000451324.2_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	101					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AAAGGTAGACTTCTGTTCACC	0.289																																																	0													59.0	55.0	56.0					1																	196451484		2202	4300	6502	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.301A>C	1.37:g.196451484T>G	ENSP00000294725:p.Ser101Arg		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.S101R	ENST00000294725.9	37	c.301	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.298361	0.40694	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.17370	2.28;2.28;2.54	5.44	4.25	0.50352	.	0.079635	0.53938	D	0.000052	T	0.15696	0.0378	L	0.42245	1.32	0.80722	D	1	B;B;B;B	0.11235	0.004;0.001;0.002;0.004	B;B;B;B	0.10450	0.002;0.005;0.005;0.002	T	0.03364	-1.1044	10	0.48119	T	0.1	-21.5096	11.4097	0.49919	0.1351:0.0:0.0:0.8649	.	101;101;101;101	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	R	101	ENSP00000356403:S101R;ENSP00000356401:S101R;ENSP00000294725:S101R	ENSP00000294725:S101R	S	-	1	0	KCNT2	194718107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.280000	0.43443	2.183000	0.69458	0.533000	0.62120	AGT	KCNT2	-	NULL	ENSG00000162687		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	57	0	T	NM_198503		196451484	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	35.42	30	17	SNP	1.000	G
KCTD16	57528	genome.wustl.edu	37	5	143853371	143853371	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:143853371G>A	ENST00000507359.3	+	3	2072	c.981G>A	c.(979-981)acG>acA	p.T327T	KCTD16_ENST00000512467.1_Silent_p.T327T	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	327					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CCCAGGAGACGGTCATCTGTG	0.587																																																	0													86.0	80.0	82.0					5																	143853371		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.981G>A	5.37:g.143853371G>A			Q9P2M9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.T327	ENST00000507359.3	37	c.981	CCDS34260.1	5																																																																																			KCTD16	-	NULL	ENSG00000183775		0.587	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3	-	0.00	42	0	G	XM_098368		143853371	+1	tier1	-	no_errors	ENST00000507359	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.003	A
KCTD19	146212	genome.wustl.edu	37	16	67329211	67329211	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:67329211A>G	ENST00000304372.5	-	9	1401	c.1346T>C	c.(1345-1347)cTc>cCc	p.L449P		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	449	BTB 2.				protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		CAGGAAGTTGAGAATGTGTCG	0.473																																																	0													79.0	72.0	74.0					16																	67329211		1953	4145	6098	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.1346T>C	16.37:g.67329211A>G	ENSP00000305702:p.Leu449Pro		B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.L449P	ENST00000304372.5	37	c.1346	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939563	0.73557	.	.	ENSG00000168676	ENST00000304372	T	0.63744	-0.06	5.5	5.5	0.81552	BTB/POZ fold (2);	0.000000	0.56097	D	0.000033	D	0.83478	0.5263	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87575	0.2480	10	0.87932	D	0	-17.9831	12.9874	0.58599	1.0:0.0:0.0:0.0	.	449	Q17RG1	KCD19_HUMAN	P	449	ENSP00000305702:L449P	ENSP00000305702:L449P	L	-	2	0	KCTD19	65886712	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	6.064000	0.71169	2.102000	0.63906	0.533000	0.62120	CTC	KCTD19	-	superfamily_BTB/POZ_fold	ENSG00000168676		0.473	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	-	0.00	96	0	A	XM_085367		67329211	-1	tier1	-	no_errors	ENST00000304372	ensembl	human	known	74_37	missense	13.75	69	11	SNP	1.000	G
KHDRBS2	202559	genome.wustl.edu	37	6	62604553	62604553	+	Missense_Mutation	SNP	G	G	T	rs145043169		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:62604553G>T	ENST00000281156.4	-	6	1075	c.797C>A	c.(796-798)gCt>gAt	p.A266D		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)	p.A266V(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTCTTCATAAGCTTCATGGGC	0.468																																																	2	Substitution - Missense(2)	skin(2)											72.0	74.0	73.0					6																	62604553		2203	4300	6503	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.797C>A	6.37:g.62604553G>T	ENSP00000281156:p.Ala266Asp		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.A266D	ENST00000281156.4	37	c.797	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246484	0.39697	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.45668	0.89	5.82	4.01	0.46588	.	0.425442	0.26650	N	0.023209	T	0.13756	0.0333	L	0.29908	0.895	0.22081	N	0.999377	B	0.20052	0.041	B	0.23018	0.043	T	0.16719	-1.0393	10	0.62326	D	0.03	-3.8705	7.8954	0.29704	0.0651:0.1334:0.6837:0.1179	.	266	Q5VWX1	KHDR2_HUMAN	D	266	ENSP00000281156:A266D	ENSP00000281156:A266D	A	-	2	0	KHDRBS2	62662512	0.273000	0.24181	0.160000	0.22671	0.984000	0.73092	2.990000	0.49401	0.758000	0.33059	0.655000	0.94253	GCT	KHDRBS2	-	NULL	ENSG00000112232		0.468	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2		0.00	57	0	G	NM_152688		62604553	-1			no_errors	ENST00000281156	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.468	T
ICE1	23379	genome.wustl.edu	37	5	5464761	5464761	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:5464761A>G	ENST00000296564.7	+	13	5536	c.5314A>G	c.(5314-5316)Aat>Gat	p.N1772D		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1772					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCTCAAAGGGAATATTCAACT	0.512																																																	0													36.0	36.0	36.0					5																	5464761		1900	4115	6015	SO:0001583	missense	0																														ENST00000296564.7:c.5314A>G	5.37:g.5464761A>G	ENSP00000296564:p.Asn1772Asp		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.N1772D	ENST00000296564.7	37	c.5314	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	A	19.25	3.791720	0.70452	.	.	ENSG00000164151	ENST00000296564	T	0.29917	1.55	5.34	2.96	0.34315	.	.	.	.	.	T	0.47673	0.1458	M	0.61703	1.905	0.40340	D	0.979022	D	0.71674	0.998	D	0.80764	0.994	T	0.42396	-0.9454	9	0.87932	D	0	-15.1561	7.9663	0.30100	0.8292:0.0:0.1708:0.0	.	1772	Q9Y2F5	K0947_HUMAN	D	1772	ENSP00000296564:N1772D	ENSP00000296564:N1772D	N	+	1	0	KIAA0947	5517761	1.000000	0.71417	0.540000	0.28089	0.776000	0.43924	6.359000	0.73060	0.352000	0.24053	0.383000	0.25322	AAT	KIAA0947	-	NULL	ENSG00000164151		0.512	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	45	0	A			5464761	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	23.08	60	18	SNP	0.994	G
KIAA2018	205717	genome.wustl.edu	37	3	113379312	113379312	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:113379312G>T	ENST00000478658.1	-	5	1234	c.1217C>A	c.(1216-1218)tCt>tAt	p.S406Y	KIAA2018_ENST00000316407.4_Missense_Mutation_p.S406Y|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	406						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.S406Y(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AACACTTGAAGAAGGCAAAGA	0.443																																																	1	Substitution - Missense(1)	endometrium(1)											91.0	84.0	86.0					3																	113379312		1912	4128	6040	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.1217C>A	3.37:g.113379312G>T	ENSP00000420721:p.Ser406Tyr		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S406Y	ENST00000478658.1	37	c.1217	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973007	0.53614	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.17854	2.25;2.25	5.44	5.44	0.79542	.	0.433011	0.24527	N	0.037748	T	0.27524	0.0676	L	0.29908	0.895	0.53688	D	0.999974	D	0.65815	0.995	P	0.60886	0.88	T	0.01078	-1.1459	10	0.72032	D	0.01	-13.5028	14.7595	0.69596	0.0:0.0:1.0:0.0	.	406	Q68DE3	K2018_HUMAN	Y	406	ENSP00000320794:S406Y;ENSP00000420721:S406Y	ENSP00000320794:S406Y	S	-	2	0	KIAA2018	114862002	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.747000	0.62141	2.556000	0.86216	0.650000	0.86243	TCT	KIAA2018	-	NULL	ENSG00000176542		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1		0.00	38	0	G	NM_001009899		113379312	-1			no_errors	ENST00000316407	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73963953	73963953	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:73963953A>C	ENST00000055682.6	-	3	1050	c.439T>G	c.(439-441)Tta>Gta	p.L147V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	147					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AAGCAGCCTAAGCAAGTCCGA	0.483																																																	0													85.0	74.0	78.0					X																	73963953		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.439T>G	X.37:g.73963953A>C	ENSP00000055682:p.Leu147Val		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.L147V	ENST00000055682.6	37	c.439	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	A	15.29	2.790764	0.50102	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.42513	0.97;0.97	6.08	3.74	0.42951	.	0.308416	0.31061	N	0.008324	T	0.50034	0.1592	L	0.44542	1.39	0.44110	D	0.99688	D	0.89917	1.0	D	0.74348	0.983	T	0.48958	-0.8988	10	0.62326	D	0.03	-4.7674	5.8803	0.18852	0.6098:0.0:0.3902:0.0	.	147	Q5QGS0	K2022_HUMAN	V	147	ENSP00000362567:L147V;ENSP00000055682:L147V	ENSP00000055682:L147V	L	-	1	2	KIAA2022	73880678	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.189000	0.50965	0.892000	0.36259	0.486000	0.48141	TTA	KIAA2022	-	NULL	ENSG00000050030		0.483	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	31	0	A	NM_001008537		73963953	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	72.73	6	16	SNP	1.000	C
KIT	3815	genome.wustl.edu	37	4	55595599	55595599	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:55595599C>G	ENST00000288135.5	+	14	2186	c.2089C>G	c.(2089-2091)Cat>Gat	p.H697D		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	697	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.H697Y(1)|p.H697fs*28(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCAGGAAGATCATGCAGAAGC	0.378		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	2	Substitution - Missense(1)|Deletion - Frameshift(1)	thymus(1)|soft_tissue(1)											108.0	112.0	111.0					4																	55595599		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2089C>G	4.37:g.55595599C>G	ENSP00000288135:p.His697Asp		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H697D	ENST00000288135.5	37	c.2089	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	C	11.99	1.804297	0.31869	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.76448	-1.02;-1.02	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.379912	0.25310	N	0.031594	T	0.69477	0.3115	N	0.19112	0.55	0.38968	D	0.958681	B;B;B	0.22080	0.042;0.029;0.064	B;B;B	0.34038	0.023;0.047;0.174	T	0.66156	-0.5994	10	0.39692	T	0.17	.	14.4463	0.67352	0.147:0.853:0.0:0.0	.	204;693;697	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	D	697;693	ENSP00000288135:H697D;ENSP00000390987:H693D	ENSP00000288135:H697D	H	+	1	0	KIT	55290356	1.000000	0.71417	0.634000	0.29324	0.686000	0.39977	2.782000	0.47758	2.882000	0.98803	0.655000	0.94253	CAT	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000157404		0.378	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	48	0	C			55595599	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	19.61	41	10	SNP	0.859	G
KLHL1	57626	genome.wustl.edu	37	13	70456449	70456449	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:70456449A>T	ENST00000377844.4	-	5	1952	c.1193T>A	c.(1192-1194)cTt>cAt	p.L398H	KLHL1_ENST00000545028.1_Missense_Mutation_p.L205H	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	398					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TATAAAGGCAAGAAGCATGCT	0.393																																																	0													169.0	139.0	149.0					13																	70456449		2203	4300	6503	SO:0001583	missense	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1193T>A	13.37:g.70456449A>T	ENSP00000367075:p.Leu398His		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.L398H	ENST00000377844.4	37	c.1193	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071791	0.76301	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.78595	-1.19;-1.19	4.89	4.89	0.63831	BTB/Kelch-associated (2);	0.000000	0.56097	D	0.000031	D	0.92113	0.7500	H	0.97707	4.06	0.51482	D	0.999927	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94788	0.7959	10	0.87932	D	0	.	14.7871	0.69810	1.0:0.0:0.0:0.0	.	398;398	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	H	398;205	ENSP00000367075:L398H;ENSP00000439602:L205H	ENSP00000367075:L398H	L	-	2	0	KLHL1	69354450	1.000000	0.71417	0.995000	0.50966	0.941000	0.58515	9.287000	0.95975	1.948000	0.56530	0.482000	0.46254	CTT	KLHL1	-	pfam_BACK,smart_BACK	ENSG00000150361		0.393	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	-	0.00	48	0	A	NM_020866		70456449	-1	tier1	-	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	T
KLHL32	114792	genome.wustl.edu	37	6	97533159	97533159	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:97533159T>G	ENST00000369261.4	+	6	932	c.569T>G	c.(568-570)cTt>cGt	p.L190R	KLHL32_ENST00000539200.1_Missense_Mutation_p.L121R|KLHL32_ENST00000536676.1_Missense_Mutation_p.L154R|KLHL32_ENST00000544166.1_Intron	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	190										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TATTGCCTGCTTCAGGAGGTG	0.522																																																	0													75.0	74.0	74.0					6																	97533159		2203	4300	6503	SO:0001583	missense	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.569T>G	6.37:g.97533159T>G	ENSP00000358265:p.Leu190Arg		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L190R	ENST00000369261.4	37	c.569	CCDS5038.1	6	.	.	.	.	.	.	.	.	.	.	T	24.4	4.524383	0.85600	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000539200;ENST00000447886	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	6.06	6.06	0.98353	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.87826	0.6275	M	0.87827	2.91	0.80722	D	1	D;D;D;P	0.76494	0.996;0.973;0.999;0.879	D;P;D;P	0.71414	0.953;0.84;0.973;0.745	D	0.89949	0.4078	10	0.87932	D	0	.	16.6154	0.84909	0.0:0.0:0.0:1.0	.	121;154;190;190	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	R	116;190;154;121;86	ENSP00000358265:L190R;ENSP00000440382:L154R;ENSP00000441527:L121R;ENSP00000389310:L86R	ENSP00000358259:L116R	L	+	2	0	KLHL32	97639880	1.000000	0.71417	0.985000	0.45067	0.924000	0.55760	7.500000	0.81588	2.315000	0.78130	0.533000	0.62120	CTT	KLHL32	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000186231		0.522	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1	-	0.00	56	0	T	NM_052904		97533159	+1	tier1	-	no_errors	ENST00000369261	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	G
KRT1	3848	genome.wustl.edu	37	12	53069104	53069104	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:53069104C>T	ENST00000252244.3	-	9	1866	c.1808G>A	c.(1807-1809)gGc>gAc	p.G603D		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	603	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						GCCGCCAGAGCCCCGgccgcc	0.697																																																	0													15.0	22.0	20.0					12																	53069104		2101	4115	6216	SO:0001583	missense	0			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1808G>A	12.37:g.53069104C>T	ENSP00000252244:p.Gly603Asp		B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G603D	ENST00000252244.3	37	c.1808	CCDS8836.1	12	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369497	0.24771	.	.	ENSG00000167768	ENST00000252244	D	0.95171	-3.63	3.57	1.55	0.23275	.	.	.	.	.	D	0.82861	0.5129	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.12837	0.008	T	0.70174	-0.4944	9	0.06494	T	0.89	.	5.2762	0.15651	0.2226:0.6652:0.0:0.1123	.	603	P04264	K2C1_HUMAN	D	603	ENSP00000252244:G603D	ENSP00000252244:G603D	G	-	2	0	KRT1	51355371	0.000000	0.05858	0.008000	0.14137	0.440000	0.31957	0.506000	0.22658	0.551000	0.29008	0.313000	0.20887	GGC	KRT1	-	NULL	ENSG00000167768		0.697	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	-	0.00	48	0	C	NM_006121		53069104	-1	tier1	-	no_errors	ENST00000252244	ensembl	human	known	74_37	missense	22.00	39	11	SNP	0.008	T
L3MBTL4	91133	genome.wustl.edu	37	18	6171934	6171934	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:6171934A>C	ENST00000284898.6	-	13	1189	c.989T>G	c.(988-990)tTt>tGt	p.F330C	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.F330C|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.F330C|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.F330C|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.F143C	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	330					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				CCAACCATCAAAATGAACCTG	0.418																																					Esophageal Squamous(41;748 902 17366 28959 43175)												0													70.0	57.0	62.0					18																	6171934		2198	4285	6483	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.989T>G	18.37:g.6171934A>C	ENSP00000284898:p.Phe330Cys		A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.F330C	ENST00000284898.6	37	c.989	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979841	0.74360	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39	5.54	5.54	0.83059	.	0.165227	0.42294	D	0.000737	T	0.79003	0.4373	H	0.94306	3.52	0.47621	D	0.999479	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84454	0.0590	10	0.87932	D	0	.	12.0746	0.53636	1.0:0.0:0.0:0.0	.	330;330	Q8NA19;F8W9S8	LMBL4_HUMAN;.	C	330;330;330;143;330	ENSP00000382976:F330C;ENSP00000318543:F330C;ENSP00000284898:F330C;ENSP00000444774:F143C;ENSP00000382975:F330C	ENSP00000284898:F330C	F	-	2	0	L3MBTL4	6161934	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.271000	0.58902	2.108000	0.64289	0.528000	0.53228	TTT	L3MBTL4	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000154655		0.418	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	-	0.00	44	0	A	NM_173464		6171934	-1	tier1	-	no_errors	ENST00000284898	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	C
LACRT	90070	genome.wustl.edu	37	12	55026095	55026095	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:55026095C>T	ENST00000257867.4	-	3	236	c.183G>A	c.(181-183)caG>caA	p.Q61Q	LACRT_ENST00000547511.1_Silent_p.Q61Q	NM_033277.1	NP_150593.1	Q9GZZ8	LACRT_HUMAN	lacritin	61					calcineurin-NFAT signaling cascade (GO:0033173)|calcium-mediated signaling (GO:0019722)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of secretion (GO:0051047)|protein localization to Golgi apparatus (GO:0034067)|tear secretion (GO:0070075)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|growth factor activity (GO:0008083)|laminin-1 binding (GO:0043237)|protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(1)	10						CCGAAGTCTCCTGGGCTGTTG	0.517																																																	0													155.0	147.0	150.0					12																	55026095		2203	4300	6503	SO:0001819	synonymous_variant	0			AF238867	CCDS8883.1	12q13.2	2014-06-13			ENSG00000135413				16430	protein-coding gene	gene with protein product		607360				11419941	Standard	NM_033277		Approved	LACRITIN	uc001sgi.1	Q9GZZ8	OTTHUMG00000169936	ENST00000257867.4:c.183G>A	12.37:g.55026095C>T				Silent	SNP	NULL	p.Q61	ENST00000257867.4	37	c.183	CCDS8883.1	12																																																																																			LACRT	-	NULL	ENSG00000135413		0.517	LACRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LACRT	HGNC	protein_coding	OTTHUMT00000406615.1	-	0.00	109	0	C	NM_033277		55026095	-1	tier1	-	no_errors	ENST00000257867	ensembl	human	known	74_37	silent	18.75	91	21	SNP	0.000	T
LAMA1	284217	genome.wustl.edu	37	18	6983112	6983112	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:6983112T>G	ENST00000389658.3	-	40	5875	c.5782A>C	c.(5782-5784)Act>Cct	p.T1928P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1928	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTCGTCTCAGTCACAGTCCTG	0.512																																																	0													108.0	102.0	104.0					18																	6983112		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5782A>C	18.37:g.6983112T>G	ENSP00000374309:p.Thr1928Pro			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.T1928P	ENST00000389658.3	37	c.5782	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	T	9.752	1.167815	0.21621	.	.	ENSG00000101680	ENST00000389658	T	0.18016	2.24	5.23	-0.0157	0.13975	.	1.213800	0.05797	N	0.611522	T	0.11495	0.0280	N	0.22421	0.69	0.09310	N	1	B	0.28208	0.203	B	0.27608	0.081	T	0.37079	-0.9721	10	0.35671	T	0.21	.	6.2699	0.20949	0.0:0.2117:0.1257:0.6626	.	1928	P25391	LAMA1_HUMAN	P	1928	ENSP00000374309:T1928P	ENSP00000374309:T1928P	T	-	1	0	LAMA1	6973112	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.480000	0.22244	0.394000	0.25230	0.528000	0.53228	ACT	LAMA1	-	NULL	ENSG00000101680		0.512	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	105	0	T	NM_005559		6983112	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	9.82	101	11	SNP	0.000	G
LAMA1	284217	genome.wustl.edu	37	18	7010267	7010267	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:7010267C>G	ENST00000389658.3	-	26	3898	c.3805G>C	c.(3805-3807)Gtc>Ctc	p.V1269L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1269	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATGTAAATGACTTGCTTTCTG	0.458																																																	0													185.0	160.0	169.0					18																	7010267		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3805G>C	18.37:g.7010267C>G	ENSP00000374309:p.Val1269Leu			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.V1269L	ENST00000389658.3	37	c.3805	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789800	0.70337	.	.	ENSG00000101680	ENST00000389658	T	0.36878	1.23	5.57	3.75	0.43078	Laminin B type IV (2);Laminin B, subgroup (1);	0.194186	0.43260	D	0.000596	T	0.26376	0.0644	L	0.36672	1.1	0.42293	D	0.992142	P	0.38300	0.626	B	0.33121	0.158	T	0.07028	-1.0794	10	0.36615	T	0.2	.	12.7101	0.57083	0.0:0.8628:0.0:0.1372	.	1269	P25391	LAMA1_HUMAN	L	1269	ENSP00000374309:V1269L	ENSP00000374309:V1269L	V	-	1	0	LAMA1	7000267	0.990000	0.36364	0.969000	0.41365	0.967000	0.64934	2.909000	0.48758	1.335000	0.45486	0.579000	0.79373	GTC	LAMA1	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV	ENSG00000101680		0.458	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	76	0	C	NM_005559		7010267	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	5.05	94	5	SNP	0.979	G
LAMA1	284217	genome.wustl.edu	37	18	7038890	7038890	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:7038890T>G	ENST00000389658.3	-	11	1575	c.1482A>C	c.(1480-1482)gaA>gaC	p.E494D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	494	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GGGGGTTTTTTTCCTTCAAGT	0.517																																																	0													81.0	95.0	90.0					18																	7038890		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1482A>C	18.37:g.7038890T>G	ENSP00000374309:p.Glu494Asp			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E494D	ENST00000389658.3	37	c.1482	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	T	4.692	0.128606	0.08981	.	.	ENSG00000101680	ENST00000389658	T	0.62105	0.05	4.88	-9.77	0.00500	EGF-like, laminin (4);	0.191551	0.42821	D	0.000660	T	0.47875	0.1469	M	0.66297	2.02	0.19945	N	0.999948	B	0.14438	0.01	B	0.16722	0.016	T	0.19910	-1.0291	10	0.20519	T	0.43	.	11.1281	0.48330	0.0:0.5106:0.1719:0.3174	.	494	P25391	LAMA1_HUMAN	D	494	ENSP00000374309:E494D	ENSP00000374309:E494D	E	-	3	2	LAMA1	7028890	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.945000	0.03909	-2.430000	0.00557	-2.529000	0.00182	GAA	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	ENSG00000101680		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	65	0	T	NM_005559		7038890	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	61.80	34	55	SNP	0.000	G
LAMB4	22798	genome.wustl.edu	37	7	107696447	107696447	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:107696447C>A	ENST00000388781.3	-	25	3468	c.3385G>T	c.(3385-3387)Gat>Tat	p.D1129Y	LAMB4_ENST00000205386.4_Missense_Mutation_p.D1129Y|LAMB4_ENST00000388780.3_Missense_Mutation_p.D1129Y	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1129	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CTGTTACAATCACATGCTAAA	0.502																																																	0													35.0	35.0	35.0					7																	107696447		2203	4298	6501	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3385G>T	7.37:g.107696447C>A	ENSP00000373433:p.Asp1129Tyr		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.D1129Y	ENST00000388781.3	37	c.3385	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085619	0.36758	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.62941	1.18;1.18;-0.01;-0.01	5.65	2.71	0.32032	EGF-like, laminin (4);	0.345603	0.24828	N	0.035268	T	0.76919	0.4055	M	0.86268	2.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.964	T	0.77297	-0.2640	10	0.87932	D	0	.	7.5343	0.27702	0.0:0.5831:0.0:0.4169	.	1129;1129	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	Y	1129;1129;155;1129	ENSP00000205386:D1129Y;ENSP00000373433:D1129Y;ENSP00000416562:D155Y;ENSP00000373432:D1129Y	ENSP00000205386:D1129Y	D	-	1	0	LAMB4	107483683	0.997000	0.39634	0.997000	0.53966	0.245000	0.25701	0.938000	0.28965	0.949000	0.37715	0.655000	0.94253	GAT	LAMB4	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091128		0.502	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	-	0.00	45	0	C	XM_209857		107696447	-1	tier1	-	no_errors	ENST00000205386	ensembl	human	known	74_37	missense	20.00	36	9	SNP	0.994	A
LDLRAD4	753	genome.wustl.edu	37	18	13426021	13426021	+	Intron	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:13426021G>A	ENST00000359446.5	+	3	508				LDLRAD4-AS1_ENST00000588672.1_RNA|LDLRAD4_ENST00000361205.4_Intron|LDLRAD4_ENST00000399848.3_Intron	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4						negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										GGCCCATGGCGGCAGGGTGCG	0.622																																																	0																																										SO:0001627	intron_variant	0			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.41-12222G>A	18.37:g.13426021G>A			B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	RNA	SNP	-	NULL	ENST00000359446.5	37	NULL	CCDS32793.1	18																																																																																			LDLRAD4-AS1	-	-	ENSG00000267690		0.622	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLRAD4-AS1	HGNC	protein_coding	OTTHUMT00000458326.1	-	0.00	76	0	G	NM_181481		13426021	-1	tier1	-	no_errors	ENST00000588672	ensembl	human	known	74_37	rna	12.66	69	10	SNP	0.000	A
LHCGR	3973	genome.wustl.edu	37	2	48915452	48915452	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:48915452G>T	ENST00000294954.7	-	11	1505	c.1484C>A	c.(1483-1485)tCt>tAt	p.S495Y	LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000405626.1_Missense_Mutation_p.S468Y|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.S433Y	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	495					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)	p.S495F(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGCAATTAGAGAAGAAAAGAG	0.438																																																	1	Substitution - Missense(1)	lung(1)											124.0	110.0	115.0					2																	48915452		2203	4300	6503	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1484C>A	2.37:g.48915452G>T	ENSP00000294954:p.Ser495Tyr		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S495Y	ENST00000294954.7	37	c.1484	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	G	5.322	0.244763	0.10077	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.37752	1.18;1.18;1.18	5.79	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	0.652243	0.16892	N	0.195294	T	0.26702	0.0653	L	0.47716	1.5	0.09310	N	1	P	0.44627	0.839	B	0.40444	0.329	T	0.10132	-1.0643	9	.	.	.	.	4.507	0.11893	0.4102:0.1569:0.433:0.0	.	495	P22888	LSHR_HUMAN	Y	433;495;468	ENSP00000344301:S433Y;ENSP00000294954:S495Y;ENSP00000386033:S468Y	.	S	-	2	0	LHCGR	48768956	0.018000	0.18449	0.050000	0.19076	0.180000	0.23129	2.204000	0.42761	0.377000	0.24735	-0.150000	0.13652	TCT	LHCGR	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000138039		0.438	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4		0.00	31	0	G	NM_000233.3		48915452	-1			no_errors	ENST00000294954	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.001	T
LINC00158	54072	genome.wustl.edu	37	21	26802219	26802219	+	lincRNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:26802219T>G	ENST00000332587.4	-	0	626					NR_024027.2		P58513	CU042_HUMAN	long intergenic non-protein coding RNA 158																		aggagtcatcttttcttgcat	0.393																																																	0																																												0					21q21.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000185433	ENSG00000185433		"""Long non-coding RNAs"""	1283	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 42"", ""non-protein coding RNA 158"""	C21orf42, NCRNA00158			Standard	NR_024027		Approved		uc002ylk.3	P58513	OTTHUMG00000078368		21.37:g.26802219T>G				RNA	SNP	-	NULL	ENST00000332587.4	37	NULL		21																																																																																			LINC00158	-	-	ENSG00000185433		0.393	LINC00158-002	KNOWN	basic	lincRNA	LINC00158	HGNC	lincRNA	OTTHUMT00000171189.1	-	0.00	52	0	T			26802219	-1	tier1	-	no_errors	ENST00000332587	ensembl	human	known	74_37	rna	28.00	18	7	SNP	0.024	G
LINC00174	285908	genome.wustl.edu	37	7	65843727	65843727	+	lincRNA	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:65843727A>C	ENST00000421767.1	-	0	2005					NR_026873.1				long intergenic non-protein coding RNA 174																		GACTTTAAGAAGTCTGGGGCA	0.577																																																	0																																												0			AK091213		7q11.21	2013-12-05	2013-12-05	2013-12-05	ENSG00000179406	ENSG00000179406		"""Long non-coding RNAs"""	27788	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 174"""	NCRNA00174			Standard	NR_026873		Approved		uc003tux.4		OTTHUMG00000156590		7.37:g.65843727A>C				RNA	SNP	-	NULL	ENST00000421767.1	37	NULL		7																																																																																			LINC00174	-	-	ENSG00000179406		0.577	LINC00174-001	KNOWN	basic	lincRNA	LINC00174	HGNC	lincRNA	OTTHUMT00000344721.1	-	0.00	9	0	A	NR_026873		65843727	-1	tier1	-	no_errors	ENST00000421767	ensembl	human	known	74_37	rna	38.46	7	5	SNP	0.886	C
LINC00987	100499405	genome.wustl.edu	37	12	9394644	9394644	+	lincRNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:9394644C>T	ENST00000427111.3	+	0	1468					NR_036466.1				long intergenic non-protein coding RNA 987																		AAGCAGAATGCGCTGGCCTTC	0.493																																																	0																																												0			AK126248		12p13.31	2013-07-04			ENSG00000237248	ENSG00000237248		"""Long non-coding RNAs"""	48911	non-coding RNA	RNA, long non-coding							Standard	NR_036466		Approved				OTTHUMG00000168332		12.37:g.9394644C>T				RNA	SNP	-	NULL	ENST00000427111.3	37	NULL		12																																																																																			LINC00987	-	-	ENSG00000237248		0.493	LINC00987-001	KNOWN	basic	lincRNA	LINC00987	HGNC	lincRNA	OTTHUMT00000399347.1	-	0.00	54	0	C			9394644	+1	tier1	-	no_errors	ENST00000427111	ensembl	human	known	74_37	rna	14.63	35	6	SNP	0.984	T
LMBRD1	55788	genome.wustl.edu	37	6	70423564	70423564	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:70423564T>G	ENST00000370577.3	-	9	1117	c.888A>C	c.(886-888)aaA>aaC	p.K296N	LMBRD1_ENST00000370570.1_Missense_Mutation_p.K223N	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	296					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						CGCCACAAAATTTTGTCCACC	0.398																																																	0													133.0	133.0	133.0					6																	70423564		2203	4300	6503	SO:0001583	missense	0			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.888A>C	6.37:g.70423564T>G	ENSP00000359609:p.Lys296Asn		A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.K296N	ENST00000370577.3	37	c.888	CCDS4969.1	6	.	.	.	.	.	.	.	.	.	.	T	19.49	3.836971	0.71373	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.27890	1.64;1.65	5.78	3.42	0.39159	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	M	0.84773	2.715	0.58432	D	0.999993	D	0.89917	1.0	D	0.71414	0.973	T	0.38351	-0.9665	10	0.32370	T	0.25	-15.347	9.5637	0.39385	0.0:0.2576:0.0:0.7424	.	296	Q9NUN5	LMBD1_HUMAN	N	296;223	ENSP00000359609:K296N;ENSP00000359602:K223N	ENSP00000359602:K223N	K	-	3	2	LMBRD1	70480285	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.927000	0.28818	0.556000	0.29098	0.482000	0.46254	AAA	LMBRD1	-	NULL	ENSG00000168216		0.398	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD1	HGNC	protein_coding	OTTHUMT00000041124.1	-	0.00	72	0	T	NM_018368		70423564	-1	tier1	-	no_errors	ENST00000370577	ensembl	human	known	74_37	missense	16.48	76	15	SNP	1.000	G
TP53TG3HP	100130700	genome.wustl.edu	37	16	34739612	34739612	+	lincRNA	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:34739612C>A	ENST00000562591.1	-	0	310				RP11-80F22.2_ENST00000569755.2_RNA	NR_034019.1																						ATGTTCCATTCTTTACCTTAG	0.373																																																	0																																												0																															16.37:g.34739612C>A				RNA	SNP	-	NULL	ENST00000562591.1	37	NULL		16																																																																																			RP11-80F22.15	-	-	ENSG00000260857		0.373	RP11-80F22.15-001	KNOWN	basic	lincRNA	LOC100130700	Clone_based_vega_gene	lincRNA	OTTHUMT00000465648.1	-	0.00	119	0	C			34739612	-1	tier1	-	no_errors	ENST00000562591	ensembl	human	known	74_37	rna	7.44	112	9	SNP	0.000	A
CCDC180	100499483	genome.wustl.edu	37	9	100052889	100052889	+	5'UTR	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:100052889C>A	ENST00000357054.1	+	0	797				RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000411667.2_5'UTR|CCDC180_ENST00000375205.2_5'UTR|CCDC180_ENST00000375202.2_5'UTR|RP11-23J9.5_ENST00000375204.2_RNA|CCDC180_ENST00000395220.1_5'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGGCTATGGGCAGGAGATAAA	0.458																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.-139C>A	9.37:g.100052889C>A			Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	-	NULL	ENST00000357054.1	37	NULL		9																																																																																			RP11-23J9.5	-	-	ENSG00000254876		0.458	CCDC180-201	KNOWN	basic	protein_coding	LOC100499484	Clone_based_vega_gene	protein_coding		-	0.00	70	0	C	NM_020893		100052889	+1	tier1	-	no_errors	ENST00000375204	ensembl	human	known	74_37	rna	30.65	43	19	SNP	0.999	A
LOC101927079	101927079	genome.wustl.edu	37	15	22332690	22332690	+	RNA	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:22332690T>C	ENST00000558896.1	+	0	497																											AGAGCATCTCTTTTTCAGGAT	0.443																																																	0																																												0																															15.37:g.22332690T>C				RNA	SNP	-	NULL	ENST00000558896.1	37	NULL		15																																																																																			RP11-69H14.6	-	-	ENSG00000259176		0.443	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	LOC101927079	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000417625.1		0.00	88	0	T			22332690	+1			no_errors	ENST00000558896	ensembl	human	known	74_37	rna	9.38	58	6	SNP	0.809	C
LOC101927079	101927079	genome.wustl.edu	37	15	22332761	22332761	+	RNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:22332761T>G	ENST00000558896.1	+	0	568																											TTGCTGACAGTTATGGCCTAT	0.488																																																	0																																												0																															15.37:g.22332761T>G				RNA	SNP	-	NULL	ENST00000558896.1	37	NULL		15																																																																																			RP11-69H14.6	-	-	ENSG00000259176		0.488	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	LOC101927079	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000417625.1	-	0.00	102	0	T			22332761	+1	tier1	-	no_errors	ENST00000558896	ensembl	human	known	74_37	rna	38.10	52	32	SNP	0.920	G
LOC101927181	101927181	genome.wustl.edu	37	7	2485937	2485937	+	lincRNA	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:2485937G>A	ENST00000313156.3	+	0	519																											GCAGTCTGGGGGACGGGAGCC	0.607																																																	0																																												0																															7.37:g.2485937G>A				RNA	SNP	-	NULL	ENST00000313156.3	37	NULL		7																																																																																			AC004840.9	-	-	ENSG00000175873		0.607	AC004840.9-001	KNOWN	basic	lincRNA	LOC101927181	Clone_based_vega_gene	lincRNA	OTTHUMT00000325029.1	-	0.00	51	0	G			2485937	+1	tier1	-	no_errors	ENST00000313156	ensembl	human	known	74_37	rna	20.55	58	15	SNP	0.041	A
LOC101927285	101927285	genome.wustl.edu	37	2	59504879	59504879	+	lincRNA	SNP	C	C	G	rs79136033		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:59504879C>G	ENST00000409590.1	+	0	380				AC007131.2_ENST00000444001.2_lincRNA|RP11-444A22.1_ENST00000606382.1_lincRNA																							gtgtgtgtgtctgtgtgtgtg	0.363																																																	0																																												0																															2.37:g.59504879C>G				RNA	SNP	-	NULL	ENST00000409590.1	37	NULL		2																																																																																			AC007131.1	-	-	ENSG00000222030		0.363	AC007131.1-001	KNOWN	basic	lincRNA	LOC101927285	Clone_based_vega_gene	lincRNA	OTTHUMT00000327020.2	-	0.00	9	0	C			59504879	+1	tier1	rs79136033	no_errors	ENST00000409590	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.268	G
LOC154761	154761	genome.wustl.edu	37	7	143508563	143508563	+	RNA	SNP	A	A	G	rs368170545		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:143508563A>G	ENST00000494978.1	-	0	2517					NR_015421.1																						TCTAAGAAGTATGGATGACTT	0.507																																																	0																																												0																															7.37:g.143508563A>G				RNA	SNP	-	NULL	ENST00000494978.1	37	NULL		7																																																																																			RP11-61L23.2	-	-	ENSG00000253882		0.507	RP11-61L23.2-003	PUTATIVE	basic	processed_transcript	LOC154761	Clone_based_vega_gene	pseudogene	OTTHUMT00000349573.1	-	0.00	8	0	A			143508563	-1	tier1	-	no_errors	ENST00000468266	ensembl	human	putative	74_37	rna	75.00	1	3	SNP	0.012	G
LOC202181	202181	genome.wustl.edu	37	5	177099140	177099140	+	RNA	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:177099140T>A	ENST00000515045.1	-	0	70					NR_026921.1																						GATCACGATGTAATCCTCCAT	0.756																																																	0																																												0																															5.37:g.177099140T>A				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.756	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1		0.00	20	0	T			177099140	-1			no_errors	ENST00000515045	ensembl	human	known	74_37	rna	16.00	21	4	SNP	0.986	A
LOC283683	283683	genome.wustl.edu	37	15	23114224	23114224	+	RNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:23114224C>T	ENST00000557922.1	-	0	208					NR_040057.1																						GGTGTCAAGGCGAGCCTGGGC	0.448																																																	0																																												0																															15.37:g.23114224C>T				RNA	SNP	-	NULL	ENST00000557922.1	37	NULL		15																																																																																			RP11-566K19.6	-	-	ENSG00000259344		0.448	RP11-566K19.6-003	KNOWN	basic	processed_transcript	LOC283683	Clone_based_vega_gene	pseudogene	OTTHUMT00000415896.1	-	0.00	168	0	C			23114224	-1	tier1	-	no_errors	ENST00000557922	ensembl	human	known	74_37	rna	6.15	168	11	SNP	0.995	T
LOC285556	285556	genome.wustl.edu	37	4	100573334	100573334	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:100573334T>G	ENST00000511828.1	-	1	2471	c.2472A>C	c.(2470-2472)gaA>gaC	p.E824D																								TGAACTCGTGTTCCCGCTGCA	0.607																																																	0																																										SO:0001583	missense	0																														ENST00000511828.1:c.2472A>C	4.37:g.100573334T>G	ENSP00000427555:p.Glu824Asp			Missense_Mutation	SNP	NULL	p.E824D	ENST00000511828.1	37	c.2472		4	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818727	0.50633	.	.	ENSG00000248713	ENST00000511828	T	0.52526	0.66	4.47	-5.66	0.02451	.	.	.	.	.	T	0.37210	0.0995	L	0.32530	0.975	.	.	.	.	.	.	.	.	.	T	0.48536	-0.9027	6	0.37606	T	0.19	.	10.4953	0.44775	0.0995:0.5535:0.0:0.347	.	.	.	.	D	824	ENSP00000427555:E824D	ENSP00000427555:E824D	E	-	3	2	RP11-766F14.2	100792357	0.394000	0.25246	0.916000	0.36221	0.976000	0.68499	-0.398000	0.07259	-1.054000	0.03214	-0.242000	0.12053	GAA	RP11-766F14.2	-	NULL	ENSG00000248713		0.607	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	-	0.00	113	0	T			100573334	-1	tier1	-	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	20.00	52	13	SNP	0.521	G
GOLGA2P9	440518	genome.wustl.edu	37	19	22786049	22786049	+	RNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:22786049C>T	ENST00000599738.1	+	0	0				RN7SL860P_ENST00000473738.2_RNA|CTC-457E21.3_ENST00000600260.1_RNA|AC011467.1_ENST00000408863.1_RNA																							TCACCAGCAGCGTGGAGCCTG	0.612																																																	0																																												0																															19.37:g.22786049C>T				RNA	SNP	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.612	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC440518	Clone_based_vega_gene	processed_transcript	OTTHUMT00000464575.1	-	0.00	134	0	C			22786049	+1	tier1	-	no_errors	ENST00000600260	ensembl	human	known	74_37	rna	10.85	115	14	SNP	0.009	T
LOC441666	441666	genome.wustl.edu	37	10	42831838	42831838	+	RNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:42831838T>G	ENST00000609841.1	-	0	2065					NR_024380.1																						ATGAGTTATCTTATGTTCATT	0.368																																																	0																																												0																															10.37:g.42831838T>G				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.368	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	90	0	T			42831838	-1	tier1	-	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	31.96	66	31	SNP	0.919	G
LOC644669	644669	genome.wustl.edu	37	18	15316485	15316485	+	RNA	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:15316485A>G	ENST00000455308.2	-	0	938					NR_027417.1																						actaggggcaaggaggcataa	0.403																																																	0																																												0																															18.37:g.15316485A>G				RNA	SNP	-	NULL	ENST00000455308.2	37	NULL		18																																																																																			AP005901.1	-	-	ENSG00000215512		0.403	AP005901.1-001	KNOWN	basic	processed_transcript	LOC644669	Clone_based_vega_gene	pseudogene	OTTHUMT00000373635.1		0.00	21	0	A			15316485	-1			no_errors	ENST00000455308	ensembl	human	known	74_37	rna	19.05	17	4	SNP	0.392	G
LPHN2	23266	genome.wustl.edu	37	1	82416109	82416109	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:82416109T>C	ENST00000370728.1	+	9	2080	c.1435T>C	c.(1435-1437)Tgg>Cgg	p.W479R	LPHN2_ENST00000319517.6_Missense_Mutation_p.W479R|LPHN2_ENST00000370717.2_Missense_Mutation_p.W479R|LPHN2_ENST00000370713.1_Missense_Mutation_p.W479R|LPHN2_ENST00000271029.4_Missense_Mutation_p.W479R|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370723.1_Missense_Mutation_p.W479R|LPHN2_ENST00000370725.1_Missense_Mutation_p.W479R|LPHN2_ENST00000370730.1_Missense_Mutation_p.W479R|LPHN2_ENST00000370715.1_Missense_Mutation_p.W479R|LPHN2_ENST00000359929.3_Missense_Mutation_p.W479R|LPHN2_ENST00000370721.1_Missense_Mutation_p.W417R|LPHN2_ENST00000394879.1_Missense_Mutation_p.W479R|LPHN2_ENST00000335786.5_Missense_Mutation_p.W479R|LPHN2_ENST00000370727.1_Missense_Mutation_p.W479R			O95490	LPHN2_HUMAN	latrophilin 2	479					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GGGGATAAAGTGGCCTCAGAC	0.408																																																	0													92.0	93.0	92.0					1																	82416109		2203	4300	6503	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1435T>C	1.37:g.82416109T>C	ENSP00000359763:p.Trp479Arg		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.W479R	ENST00000370728.1	37	c.1435		1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.335874	0.60853	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96992	-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2;-4.2	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.97745	0.9260	M	0.92833	3.35	0.80722	D	1	D;P;P	0.52996	0.957;0.588;0.839	P;B;P	0.53313	0.723;0.429;0.723	D	0.98459	1.0595	10	0.87932	D	0	.	16.3009	0.82811	0.0:0.0:0.0:1.0	.	479;479;479	O95490-3;O95490-4;O95490-2	.;.;.	R	417;479;479;479;479;479;479;479;479;479;479;479;479;479	ENSP00000359756:W417R;ENSP00000359763:W479R;ENSP00000359765:W479R;ENSP00000359762:W479R;ENSP00000359760:W479R;ENSP00000359758:W479R;ENSP00000353006:W479R;ENSP00000359750:W479R;ENSP00000359748:W479R;ENSP00000322270:W479R;ENSP00000359752:W479R;ENSP00000378344:W479R;ENSP00000271029:W479R;ENSP00000337306:W479R	ENSP00000271029:W479R	W	+	1	0	LPHN2	82188697	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.841000	0.86834	2.246000	0.74042	0.533000	0.62120	TGG	LPHN2	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000117114		0.408	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	68	0	T	NM_012302		82416109	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	C
LRCH4	4034	genome.wustl.edu	37	7	100183598	100183598	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:100183598C>T	ENST00000310300.6	-	1	178	c.126G>A	c.(124-126)gtG>gtA	p.V42V	FBXO24_ENST00000241071.6_5'Flank|FBXO24_ENST00000465843.1_5'Flank|LRCH4_ENST00000497245.1_5'Flank|FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000360609.2_5'Flank	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	42					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCCGGTGGCCACGGCCTCCT	0.706																																																	0													25.0	29.0	27.0					7																	100183598		2203	4300	6503	SO:0001819	synonymous_variant	0			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.126G>A	7.37:g.100183598C>T			A4D2D5|Q8WV85|Q96ID0	Silent	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.V42	ENST00000310300.6	37	c.126	CCDS34706.1	7																																																																																			LRCH4	-	NULL	ENSG00000077454		0.706	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRCH4	HGNC	protein_coding	OTTHUMT00000356110.1	-	0.00	31	0	C	NM_002319		100183598	-1	tier1	-	no_errors	ENST00000310300	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	T
LRP1	4035	genome.wustl.edu	37	12	57587708	57587708	+	Missense_Mutation	SNP	C	C	T	rs377122314		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:57587708C>T	ENST00000243077.3	+	48	8297	c.7831C>T	c.(7831-7833)Cgc>Tgc	p.R2611C	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2611	LDL-receptor class A 13. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGGCGAGTTCCGCTGCCGGGA	0.612																																																	0								C	CYS/ARG	0,4406		0,0,2203	97.0	88.0	91.0		7831	4.2	1.0	12		91	1,8599		0,1,4299	no	missense	LRP1	NM_002332.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	2611/4545	57587708	1,13005	2203	4300	6503	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7831C>T	12.37:g.57587708C>T	ENSP00000243077:p.Arg2611Cys		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R2611C	ENST00000243077.3	37	c.7831	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287267	0.59867	0.0	1.16E-4	ENSG00000123384	ENST00000243077	D	0.96334	-3.98	5.09	4.2	0.49525	.	0.088458	0.49916	D	0.000140	D	0.97303	0.9118	M	0.80332	2.49	0.80722	D	1	D	0.76494	0.999	P	0.57846	0.828	D	0.97483	1.0048	10	0.72032	D	0.01	.	12.833	0.57756	0.0:0.9199:0.0:0.0801	.	2611	Q07954	LRP1_HUMAN	C	2611	ENSP00000243077:R2611C	ENSP00000243077:R2611C	R	+	1	0	LRP1	55873975	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	4.597000	0.61062	1.379000	0.46325	0.650000	0.86243	CGC	LRP1	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000123384		0.612	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	-	0.00	83	0	C	NM_002332		57587708	+1	tier1	-	no_errors	ENST00000243077	ensembl	human	known	74_37	missense	11.96	81	11	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141004675	141004675	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:141004675T>C	ENST00000389484.3	-	87	14275	c.13304A>G	c.(13303-13305)aAg>aGg	p.K4435R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4435					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGATCAGACTTGCTGCTCTT	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													108.0	101.0	103.0					2																	141004675		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13304A>G	2.37:g.141004675T>C	ENSP00000374135:p.Lys4435Arg		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.K4435R	ENST00000389484.3	37	c.13304	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.20|13.20	2.165013|2.165013	0.38217|0.38217	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977;ENST00000442974	D|.	0.90069|.	-2.61|.	5.8|5.8	4.58|4.58	0.56647|0.56647	.|.	0.064530|.	0.56097|.	D|.	0.000026|.	T|T	0.30293|0.30293	0.0760|0.0760	N|N	0.14661|0.14661	0.345|0.345	0.26106|0.26106	N|N	0.980757|0.980757	B|.	0.15141|.	0.012|.	B|.	0.11329|.	0.006|.	T|T	0.16630|0.16630	-1.0396|-1.0396	10|5	0.19147|.	T|.	0.46|.	.|.	12.6793|12.6793	0.56912|0.56912	0.0:0.0:0.1375:0.8625|0.0:0.0:0.1375:0.8625	.|.	4435|.	Q9NZR2|.	LRP1B_HUMAN|.	R|G	4435;4373|667;205	ENSP00000374135:K4435R|.	ENSP00000374135:K4435R|.	K|S	-|-	2|1	0|0	LRP1B|LRP1B	140721145|140721145	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.976000|3.976000	0.56867|0.56867	2.213000|2.213000	0.71641|0.71641	0.528000|0.528000	0.53228|0.53228	AAG|AGT	LRP1B	-	NULL	ENSG00000168702		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	36	0	T	NM_018557		141004675	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	41.67	21	15	SNP	0.998	C
LRP1B	53353	genome.wustl.edu	37	2	141031998	141031998	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:141031998A>C	ENST00000389484.3	-	85	14108	c.13137T>G	c.(13135-13137)ttT>ttG	p.F4379L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4379	EGF-like 21. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTACTTGCAAAATATATCTT	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													94.0	88.0	90.0					2																	141031998		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13137T>G	2.37:g.141031998A>C	ENSP00000374135:p.Phe4379Leu		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.F4379L	ENST00000389484.3	37	c.13137	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.15|11.15	1.553146|1.553146	0.27739|0.27739	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000437977;ENST00000442974|ENST00000389484;ENST00000544579	T;T|D	0.09350|0.89552	2.99;2.99|-2.53	5.32|5.32	2.77|2.77	0.32553|0.32553	.|.	0.817763|0.817763	0.10225|0.10225	U|N	0.700409|0.700409	T|T	0.74374|0.74374	0.3708|0.3708	N|N	0.11724|0.11724	0.165|0.165	0.25544|0.25544	N|N	0.987152|0.987152	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.60737|0.60737	-0.7204|-0.7204	8|10	0.49607|0.10902	T|T	0.09|0.67	.|.	5.0881|5.0881	0.14693|0.14693	0.3989:0.3592:0.0:0.242|0.3989:0.3592:0.0:0.242	.|.	.|4379	.|Q9NZR2	.|LRP1B_HUMAN	C|L	611;111|4379;4317	ENSP00000415052:F611C;ENSP00000393859:F111C|ENSP00000374135:F4379L	ENSP00000415052:F611C|ENSP00000374135:F4379L	F|F	-|-	2|3	0|2	LRP1B|LRP1B	140748468|140748468	0.013000|0.013000	0.17824|0.17824	0.996000|0.996000	0.52242|0.52242	0.911000|0.911000	0.54048|0.54048	0.206000|0.206000	0.17375|0.17375	2.011000|2.011000	0.59026|0.59026	0.533000|0.533000	0.62120|0.62120	TTT|TTT	LRP1B	-	smart_EG-like_dom	ENSG00000168702		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	80	0	A	NM_018557		141031998	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.955	C
LRP1B	53353	genome.wustl.edu	37	2	141459350	141459350	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:141459350T>A	ENST00000389484.3	-	40	7338	c.6367A>T	c.(6367-6369)Aga>Tga	p.R2123*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2123					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGGCCGGTTCTCATGGTTATC	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													166.0	152.0	157.0					2																	141459350		2203	4300	6503	SO:0001587	stop_gained	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6367A>T	2.37:g.141459350T>A	ENSP00000374135:p.Arg2123*		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R2123*	ENST00000389484.3	37	c.6367	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	52	20.016468	0.99926	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.11	2.48	0.30137	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	11.7344	0.51757	0.0:0.0:0.2555:0.7445	.	.	.	.	X	2123;2061	.	ENSP00000374135:R2123X	R	-	1	2	LRP1B	141175820	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	5.013000	0.64023	1.912000	0.55364	0.383000	0.25322	AGA	LRP1B	-	NULL	ENSG00000168702		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	47	0	T	NM_018557		141459350	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	nonsense	34.78	30	16	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141812823	141812823	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:141812823T>G	ENST00000389484.3	-	10	2385	c.1414A>C	c.(1414-1416)Agc>Cgc	p.S472R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	472	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATGCATGGCTTCTGACTACA	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													82.0	74.0	77.0					2																	141812823		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1414A>C	2.37:g.141812823T>G	ENSP00000374135:p.Ser472Arg		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S472R	ENST00000389484.3	37	c.1414	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	18.83	3.708085	0.68615	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.97598	-4.45	5.45	3.12	0.35913	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.057764	0.64402	U	0.000002	D	0.94518	0.8235	L	0.47716	1.5	0.80722	D	1	P	0.49961	0.93	P	0.44860	0.462	D	0.91944	0.5565	10	0.38643	T	0.18	.	9.2197	0.37368	0.0:0.1465:0.0:0.8535	.	472	Q9NZR2	LRP1B_HUMAN	R	472;410	ENSP00000374135:S472R	ENSP00000374135:S472R	S	-	1	0	LRP1B	141529293	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.967000	0.49216	0.921000	0.36994	0.455000	0.32223	AGC	LRP1B	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000168702		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	39	0	T	NM_018557		141812823	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	G
LRRC14	9684	genome.wustl.edu	37	8	145745836	145745836	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:145745836C>T	ENST00000292524.1	+	3	690	c.544C>T	c.(544-546)Cgg>Tgg	p.R182W	RECQL4_ENST00000532237.1_5'Flank|LRRC14_ENST00000529022.1_Missense_Mutation_p.R182W|RECQL4_ENST00000428558.2_5'Flank	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	182										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGCGTTCCTGCGGGAGGCACT	0.721																																																	0													44.0	50.0	48.0					8																	145745836		2203	4297	6500	SO:0001583	missense	0			BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.544C>T	8.37:g.145745836C>T	ENSP00000292524:p.Arg182Trp		A8K0A8|D3DWM8	Missense_Mutation	SNP	NULL	p.R182W	ENST00000292524.1	37	c.544	CCDS6432.1	8	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844777	0.32606	.	.	ENSG00000160959	ENST00000527730;ENST00000529022;ENST00000292524	T;T;T	0.18502	2.21;5.02;5.02	4.51	2.43	0.29744	.	0.751600	0.12378	N	0.474186	T	0.25382	0.0617	L	0.32530	0.975	0.35370	D	0.78899	D	0.89917	1.0	D	0.66084	0.941	T	0.23904	-1.0175	10	0.38643	T	0.18	.	8.4519	0.32875	0.1803:0.6633:0.1564:0.0	.	182	Q15048	LRC14_HUMAN	W	182	ENSP00000436452:R182W;ENSP00000434768:R182W;ENSP00000292524:R182W	ENSP00000292524:R182W	R	+	1	2	LRRC14	145716644	0.299000	0.24426	0.937000	0.37676	0.030000	0.12068	0.568000	0.23623	1.057000	0.40506	0.462000	0.41574	CGG	LRRC14	-	NULL	ENSG00000160959		0.721	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC14	HGNC	protein_coding	OTTHUMT00000382494.1	-	0.00	136	0	C	NM_014665		145745836	+1	tier1	-	no_errors	ENST00000292524	ensembl	human	known	74_37	missense	27.38	61	23	SNP	0.807	T
LRRC18	474354	genome.wustl.edu	37	10	50121941	50121941	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:50121941T>G	ENST00000374160.3	-	1	336	c.260A>C	c.(259-261)aAg>aCg	p.K87T	WDFY4_ENST00000413659.2_Intron|LRRC18_ENST00000298124.3_Missense_Mutation_p.K87T|RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000325239.5_Intron	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	87						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						CTCAGGCAGCTTGTCTATGTA	0.567																																																	0													101.0	84.0	89.0					10																	50121941		2203	4300	6503	SO:0001583	missense	0			AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.260A>C	10.37:g.50121941T>G	ENSP00000363275:p.Lys87Thr		Q6UY02	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K87T	ENST00000374160.3	37	c.260	CCDS31197.1	10	.	.	.	.	.	.	.	.	.	.	T	9.801	1.180578	0.21787	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.09630	2.96;2.96	6.07	1.11	0.20524	.	0.340228	0.34802	N	0.003677	T	0.03739	0.0106	N	0.02391	-0.57	0.33876	D	0.635582	B	0.31459	0.324	B	0.31390	0.129	T	0.45833	-0.9234	9	.	.	.	.	10.2448	0.43334	0.0:0.3256:0.0:0.6744	.	87	Q8N456	LRC18_HUMAN	T	87	ENSP00000363275:K87T;ENSP00000298124:K87T	.	K	-	2	0	LRRC18	49791947	0.006000	0.16342	0.991000	0.47740	0.507000	0.33981	-0.186000	0.09670	-0.025000	0.13918	-0.274000	0.10170	AAG	LRRC18	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000165383		0.567	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC18	HGNC	protein_coding	OTTHUMT00000047964.1	-	0.00	75	0	T	NM_001006939		50121941	-1	tier1	-	no_errors	ENST00000374160	ensembl	human	known	74_37	missense	34.72	46	25	SNP	0.990	G
LRRC32	2615	genome.wustl.edu	37	11	76371615	76371615	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:76371615A>G	ENST00000407242.2	-	3	1264	c.1022T>C	c.(1021-1023)cTg>cCg	p.L341P	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Missense_Mutation_p.L341P|LRRC32_ENST00000404995.1_Missense_Mutation_p.L341P|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	341					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CAGGAAGCACAGGGAGGTCAG	0.567																																																	0													32.0	33.0	33.0					11																	76371615		2200	4292	6492	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1022T>C	11.37:g.76371615A>G	ENSP00000384126:p.Leu341Pro		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.L341P	ENST00000407242.2	37	c.1022	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081580	0.55753	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.31247	1.5;1.5;1.5	4.26	4.26	0.50523	.	0.000000	0.64402	D	0.000002	T	0.63558	0.2521	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74028	-0.3796	10	0.87932	D	0	.	13.5366	0.61650	1.0:0.0:0.0:0.0	.	341	Q14392	LRC32_HUMAN	P	341	ENSP00000260061:L341P;ENSP00000384126:L341P;ENSP00000385766:L341P	ENSP00000260061:L341P	L	-	2	0	LRRC32	76049263	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	7.109000	0.77062	1.798000	0.52647	0.397000	0.26171	CTG	LRRC32	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000137507		0.567	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	85	0	A	NM_005512		76371615	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.999	G
LRRC53	100144878	genome.wustl.edu	37	1	74945891	74945891	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:74945891T>C	ENST00000294635.4	-	3	964	c.850A>G	c.(850-852)Agt>Ggt	p.S284G	TNNI3K_ENST00000326637.3_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.S284G|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	284						integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						AGGAGGGGACTTCTGTCCTTT	0.557																																																	0																																										SO:0001583	missense	0					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.850A>G	1.37:g.74945891T>C	ENSP00000294635:p.Ser284Gly			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S284G	ENST00000294635.4	37	c.850		1	.	.	.	.	.	.	.	.	.	.	T	6.895	0.534593	0.13188	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.50813	0.84;0.73	5.55	1.62	0.23740	.	0.808785	0.10926	N	0.618894	T	0.19366	0.0465	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24870	-1.0148	7	0.34782	T	0.22	-0.1202	6.1528	0.20320	0.0:0.1703:0.436:0.3937	.	.	.	.	G	284	ENSP00000391861:S284G;ENSP00000294635:S284G	ENSP00000294635:S284G	S	-	1	0	LRRC53	74718479	0.004000	0.15560	0.753000	0.31225	0.990000	0.78478	0.623000	0.24447	0.374000	0.24650	0.379000	0.24179	AGT	LRRC53	-	NULL	ENSG00000162621		0.557	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC53	HGNC	protein_coding	OTTHUMT00000026515.2	-	0.00	22	0	T			74945891	-1	tier1	-	no_errors	ENST00000294635	ensembl	human	novel	74_37	missense	24.00	19	6	SNP	0.089	C
LRRC6	23639	genome.wustl.edu	37	8	133584647	133584647	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:133584647T>G	ENST00000519595.1	-	12	1406	c.1308A>C	c.(1306-1308)aaA>aaC	p.K436N	LRRC6_ENST00000518642.1_3'UTR|LRRC6_ENST00000250173.1_Missense_Mutation_p.K436N			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	436					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGGGTGTGTGTTTTTTCTCTT	0.418																																																	0													294.0	267.0	276.0					8																	133584647		2203	4300	6503	SO:0001583	missense	0			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.1308A>C	8.37:g.133584647T>G	ENSP00000429791:p.Lys436Asn		Q13648|Q4G183	Missense_Mutation	SNP	superfamily_HSP20-like_chaperone,smart_U2A'_phosphoprotein32A_C,pfscan_CS_dom	p.K436N	ENST00000519595.1	37	c.1308		8	.	.	.	.	.	.	.	.	.	.	T	13.41	2.228086	0.39399	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000250173	T;T;T	0.52295	0.67;0.8;0.67	5.65	-2.62	0.06152	.	1.073040	0.06961	N	0.816360	T	0.36963	0.0986	L	0.50333	1.59	0.09310	N	1	B	0.32302	0.363	B	0.30646	0.118	T	0.30851	-0.9964	10	0.46703	T	0.11	-2.7049	5.2083	0.15302	0.0:0.2926:0.2714:0.436	.	436	Q86X45	LRRC6_HUMAN	N	436;176;436	ENSP00000429791:K436N;ENSP00000428015:K176N;ENSP00000250173:K436N	ENSP00000250173:K436N	K	-	3	2	LRRC6	133653829	0.000000	0.05858	0.000000	0.03702	0.940000	0.58332	-0.215000	0.09279	-0.619000	0.05648	0.533000	0.62120	AAA	LRRC6	-	NULL	ENSG00000129295		0.418	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	LRRC6	HGNC	protein_coding	OTTHUMT00000379578.1	-	0.00	91	0	T	NM_012472		133584647	-1	tier1	-	no_errors	ENST00000250173	ensembl	human	known	74_37	missense	25.61	61	21	SNP	0.000	G
LRRC71	149499	genome.wustl.edu	37	1	156896988	156896988	+	Intron	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:156896988C>T	ENST00000337428.7	+	6	747				LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71											endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						TCTCCCCTGCCCTCAGGAAGG	0.582																																																	0													83.0	89.0	87.0					1																	156896988		692	1591	2283	SO:0001627	intron_variant	0			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.594-6C>T	1.37:g.156896988C>T			Q96M24	RNA	SNP	-	NULL	ENST00000337428.7	37	NULL	CCDS44249.1	1																																																																																			LRRC71	-	-	ENSG00000160838		0.582	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC71	HGNC	protein_coding	OTTHUMT00000098961.1	-	0.00	51	0	C	NM_144702		156896988	+1	tier1	-	no_errors	ENST00000490146	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.082	T
LRRK2	120892	genome.wustl.edu	37	12	40672053	40672053	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:40672053T>C	ENST00000298910.7	+	18	2289	c.2231T>C	c.(2230-2232)tTa>tCa	p.L744S	LRRK2_ENST00000343742.2_Missense_Mutation_p.L744S	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	744					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGATCTTCTTTAATTTGTCAG	0.393																																																	0													125.0	127.0	126.0					12																	40672053		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2231T>C	12.37:g.40672053T>C	ENSP00000298910:p.Leu744Ser		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.L744S	ENST00000298910.7	37	c.2231	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	18.50	3.637917	0.67130	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.50813	0.73;1.28;1.28	5.94	5.94	0.96194	Ankyrin repeat-containing domain (1);	0.000000	0.64402	D	0.000002	T	0.60470	0.2271	L	0.36672	1.1	0.46701	D	0.999164	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.60551	-0.7241	10	0.49607	T	0.09	.	16.3945	0.83586	0.0:0.0:0.0:1.0	.	744;744	E9PC85;Q5S007	.;LRRK2_HUMAN	S	492;744;744	ENSP00000398726:L492S;ENSP00000341930:L744S;ENSP00000298910:L744S	ENSP00000298910:L744S	L	+	2	0	LRRK2	38958320	1.000000	0.71417	0.999000	0.59377	0.595000	0.36748	6.081000	0.71309	2.265000	0.75225	0.482000	0.46254	TTA	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.393	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	22	0	T	XM_058513		40672053	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	C
LRRIQ1	84125	genome.wustl.edu	37	12	85459153	85459153	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:85459153C>A	ENST00000393217.2	+	9	2566	c.2505C>A	c.(2503-2505)agC>agA	p.S835R		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	835										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTTTGCACAGCCTGAGTAATT	0.358																																																	0													121.0	117.0	118.0					12																	85459153		2203	4300	6503	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2505C>A	12.37:g.85459153C>A	ENSP00000376910:p.Ser835Arg		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.S835R	ENST00000393217.2	37	c.2505	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318981	0.41096	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.09723	2.95	5.6	-1.44	0.08856	.	0.235862	0.33364	N	0.004996	T	0.11153	0.0272	L	0.58354	1.805	0.23645	N	0.997212	P;P	0.50369	0.868;0.934	B;P	0.47206	0.23;0.541	T	0.14559	-1.0468	10	0.37606	T	0.19	.	4.363	0.11211	0.3795:0.2912:0.0:0.3293	.	835;810	Q96JM4;C9JI57	LRIQ1_HUMAN;.	R	835;810;835	ENSP00000376910:S835R	ENSP00000256007:S835R	S	+	3	2	LRRIQ1	83983284	0.944000	0.32072	0.137000	0.22149	0.938000	0.57974	0.271000	0.18626	-0.145000	0.11294	-0.224000	0.12420	AGC	LRRIQ1	-	NULL	ENSG00000133640		0.358	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	50	0	C	NM_032165		85459153	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	34.00	33	17	SNP	0.818	A
LRRN3	54674	genome.wustl.edu	37	7	110764718	110764718	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:110764718G>T	ENST00000422987.3	+	2	2721	c.1890G>T	c.(1888-1890)atG>atT	p.M630I	IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.M630I|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.M630I	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	630					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CAACACTTATGGCCTGTCTTG	0.413																																																	0													77.0	77.0	77.0					7																	110764718		2203	4300	6503	SO:0001583	missense	0			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1890G>T	7.37:g.110764718G>T	ENSP00000412417:p.Met630Ile		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.M630I	ENST00000422987.3	37	c.1890	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	G	7.975	0.749895	0.15778	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.38887	1.11;1.11;1.11	5.87	4.92	0.64577	.	0.597033	0.16882	N	0.195668	T	0.22820	0.0551	N	0.10874	0.06	0.30161	N	0.802226	B	0.02656	0.0	B	0.01281	0.0	T	0.14364	-1.0475	10	0.11182	T	0.66	.	11.7662	0.51933	0.0:0.0:0.4658:0.5342	.	630	Q9H3W5	LRRN3_HUMAN	I	630	ENSP00000312001:M630I;ENSP00000397312:M630I;ENSP00000412417:M630I	ENSP00000312001:M630I	M	+	3	0	LRRN3	110551954	1.000000	0.71417	0.995000	0.50966	0.894000	0.52154	2.807000	0.47955	1.550000	0.49438	0.655000	0.94253	ATG	LRRN3	-	NULL	ENSG00000173114		0.413	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2	-	0.00	52	0	G	NM_018334		110764718	+1	tier1	-	no_errors	ENST00000308478	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	T
LRRN4	164312	genome.wustl.edu	37	20	6022692	6022692	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:6022692G>A	ENST00000378858.4	-	5	1423	c.1199C>T	c.(1198-1200)gCg>gTg	p.A400V		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	400					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						CTGGTCTCCCGCAGGCCGGGT	0.687																																																	0													46.0	46.0	46.0					20																	6022692		2203	4299	6502	SO:0001583	missense	0			AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.1199C>T	20.37:g.6022692G>A	ENSP00000368135:p.Ala400Val		A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A400V	ENST00000378858.4	37	c.1199	CCDS13097.1	20	.	.	.	.	.	.	.	.	.	.	G	9.907	1.208530	0.22205	.	.	ENSG00000125872	ENST00000378858	T	0.58797	0.31	4.39	-6.76	0.01732	.	3.574140	0.01351	N	0.011907	T	0.37839	0.1018	L	0.27053	0.805	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.10870	-1.0611	10	0.30078	T	0.28	2.9181	4.0364	0.09731	0.0744:0.2068:0.2698:0.4491	.	400	Q8WUT4	LRRN4_HUMAN	V	400	ENSP00000368135:A400V	ENSP00000368135:A400V	A	-	2	0	LRRN4	5970692	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.250000	0.02885	-1.561000	0.01684	-1.367000	0.01198	GCG	LRRN4	-	NULL	ENSG00000125872		0.687	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN4	HGNC	protein_coding	OTTHUMT00000077907.2	-	0.00	46	0	G	NM_152611		6022692	-1	tier1	-	no_errors	ENST00000378858	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.000	A
LSP1	4046	genome.wustl.edu	37	11	1888037	1888037	+	Intron	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:1888037G>T	ENST00000311604.3	+	2	228				LSP1_ENST00000405957.2_5'Flank|AC051649.12_ENST00000509204.1_RNA|LSP1_ENST00000381775.1_Missense_Mutation_p.R111S	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		GCCCCCGGAGGAGGGGCAGAG	0.652																																																	0																																										SO:0001627	intron_variant	0			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.54-13280G>T	11.37:g.1888037G>T			B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Lymphspecific	p.R111S	ENST00000311604.3	37	c.333	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	g	9.581	1.123669	0.20959	.	.	ENSG00000130592	ENST00000381775	T	0.28454	1.61	1.83	-0.307	0.12777	.	.	.	.	.	T	0.19604	0.0471	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.28870	-1.0030	8	0.87932	D	0	.	3.0173	0.06064	0.1912:0.2904:0.5184:0.0	.	111	E9PFP3	.	S	111	ENSP00000371194:R111S	ENSP00000371194:R111S	R	+	3	2	LSP1	1844613	0.037000	0.19845	0.000000	0.03702	0.004000	0.04260	1.851000	0.39338	-0.064000	0.13043	0.491000	0.48974	AGG	LSP1	-	NULL	ENSG00000130592		0.652	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	HGNC	protein_coding	OTTHUMT00000034045.3	-	0.00	67	0	G	NM_002339		1888037	+1	tier1	-	no_errors	ENST00000381775	ensembl	human	putative	74_37	missense	7.02	53	4	SNP	0.001	T
LY75	4065	genome.wustl.edu	37	2	160663488	160663488	+	Silent	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:160663488A>T	ENST00000263636.4	-	34	5013	c.4986T>A	c.(4984-4986)ccT>ccA	p.P1662P	LY75-CD302_ENST00000504764.1_Silent_p.P1662P|LY75_ENST00000554112.1_Silent_p.P1662P|LY75_ENST00000553424.1_Intron|LY75-CD302_ENST00000505052.1_Intron	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1662					endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		ACTTACCCAGAGGCACTTTGC	0.368																																																	0													131.0	123.0	126.0					2																	160663488		2203	4300	6503	SO:0001819	synonymous_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4986T>A	2.37:g.160663488A>T			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.P1662	ENST00000263636.4	37	c.4986	CCDS2211.1	2																																																																																			LY75	-	superfamily_C-type_lectin_fold	ENSG00000054219		0.368	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	-	0.00	55	0	A			160663488	-1	tier1	-	no_errors	ENST00000554112	ensembl	human	known	74_37	silent	14.58	41	7	SNP	0.556	T
LYPD5	284348	genome.wustl.edu	37	19	44302744	44302744	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:44302744G>A	ENST00000377950.3	-	4	460	c.380C>T	c.(379-381)cCg>cTg	p.P127L	AC115522.3_ENST00000595680.1_lincRNA|LYPD5_ENST00000414615.2_Missense_Mutation_p.P84L|LYPD5_ENST00000594013.1_Missense_Mutation_p.P84L	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	127						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				GAGCGTCGGCGGGTCGGGTGC	0.677																																																	0													50.0	46.0	47.0					19																	44302744		2203	4298	6501	SO:0001583	missense	0			AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.380C>T	19.37:g.44302744G>A	ENSP00000367185:p.Pro127Leu		Q6PEX9|Q96DR2	Missense_Mutation	SNP	pfam_LY6_UPAR	p.P127L	ENST00000377950.3	37	c.380	CCDS46096.1	19	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089235	0.76756	.	.	ENSG00000159871	ENST00000377950;ENST00000414615	T;T	0.26660	3.19;1.72	4.25	4.25	0.50352	.	0.143790	0.31020	N	0.008408	T	0.39226	0.1070	L	0.34521	1.04	0.41412	D	0.987745	D	0.89917	1.0	D	0.81914	0.995	T	0.33163	-0.9879	10	0.87932	D	0	-17.8079	14.1664	0.65480	0.0:0.0:1.0:0.0	.	127	Q6UWN5	LYPD5_HUMAN	L	127;84	ENSP00000367185:P127L;ENSP00000408433:P84L	ENSP00000367185:P127L	P	-	2	0	LYPD5	48994584	0.979000	0.34478	0.143000	0.22291	0.122000	0.20287	4.425000	0.59875	2.196000	0.70406	0.561000	0.74099	CCG	LYPD5	-	NULL	ENSG00000159871		0.677	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD5	HGNC	protein_coding	OTTHUMT00000463611.1	-	0.00	55	0	G	NM_182573		44302744	-1	tier1	-	no_errors	ENST00000377950	ensembl	human	known	74_37	missense	12.70	55	8	SNP	0.548	A
MAEL	84944	genome.wustl.edu	37	1	166974517	166974517	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:166974517T>G	ENST00000367872.4	+	8	972	c.728T>G	c.(727-729)cTc>cGc	p.L243R	MAEL_ENST00000367870.2_Missense_Mutation_p.L212R|RNA5SP65_ENST00000363166.1_RNA|MAEL_ENST00000491055.1_3'UTR	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	243					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						CTACAACTTCTCACTGTAGAG	0.388																																																	0													60.0	65.0	63.0					1																	166974517		2203	4300	6503	SO:0001583	missense	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.728T>G	1.37:g.166974517T>G	ENSP00000356846:p.Leu243Arg		B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_CH-domain	p.L243R	ENST00000367872.4	37	c.728	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.694805	0.30052	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.50548	0.75;0.74;0.78	5.66	4.5	0.54988	.	0.225631	0.31427	N	0.007663	T	0.15262	0.0368	N	0.24115	0.695	0.33185	D	0.550096	B;B	0.16802	0.015;0.019	B;B	0.20955	0.008;0.032	T	0.07809	-1.0753	10	0.25106	T	0.35	.	10.0239	0.42059	0.0:0.0:0.3273:0.6727	.	212;243	E9JVC3;Q96JY0	.;MAEL_HUMAN	R	243;212;212	ENSP00000356846:L243R;ENSP00000356844:L212R;ENSP00000402143:L212R	ENSP00000356844:L212R	L	+	2	0	MAEL	165241141	0.988000	0.35896	0.963000	0.40424	0.828000	0.46876	1.363000	0.34159	0.937000	0.37394	0.482000	0.46254	CTC	MAEL	-	superfamily_CH-domain	ENSG00000143194		0.388	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	-	0.00	63	0	T	NM_032858		166974517	+1	tier1	-	no_errors	ENST00000367872	ensembl	human	known	74_37	missense	40.74	32	22	SNP	0.840	G
MAFB	9935	genome.wustl.edu	37	20	39316865	39316865	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:39316865T>C	ENST00000373313.2	-	1	1015	c.626A>G	c.(625-627)gAc>gGc	p.D209G	MAFB_ENST00000396967.1_Missense_Mutation_p.D209G	NM_005461.3	NP_005452.2	Q9Y5Q3	MAFB_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B	209					brain segmentation (GO:0035284)|inner ear morphogenesis (GO:0042472)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|respiratory gaseous exchange (GO:0007585)|rhombomere 5 development (GO:0021571)|rhombomere 6 development (GO:0021572)|segment specification (GO:0007379)|sensory organ development (GO:0007423)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(1)	2		Myeloproliferative disorder(115;0.00878)				GGAGAAGCGGTCCTCCACGCT	0.726			T	IGH@	MM																																			Dom	yes		20	20q11.2-q13.1	9935	v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)		L	0													6.0	6.0	6.0					20																	39316865		2149	4221	6370	SO:0001583	missense	0			AF134157	CCDS13311.1	20q11.1-q13.1	2013-07-09	2013-07-09	2001-11-30	ENSG00000204103	ENSG00000204103			6408	protein-coding gene	gene with protein product		608968	"""Kreisler (mouse) maf-related leucine zipper homolog"""	KRML		10444328	Standard	NM_005461		Approved		uc002xji.3	Q9Y5Q3	OTTHUMG00000033052	ENST00000373313.2:c.626A>G	20.37:g.39316865T>C	ENSP00000362410:p.Asp209Gly		B3KNE1|Q9H1F1	Missense_Mutation	SNP	pfam_bZIP_Maf,pfam_Maf_TF_N,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.D209G	ENST00000373313.2	37	c.626	CCDS13311.1	20	.	.	.	.	.	.	.	.	.	.	T	22.5	4.304092	0.81136	.	.	ENSG00000204103	ENST00000373313;ENST00000396967	D;D	0.97731	-4.51;-4.51	4.34	4.34	0.51931	Maf transcription factor (1);	0.231169	0.40728	N	0.001037	D	0.97882	0.9304	M	0.69823	2.125	0.80722	D	1	P	0.52316	0.952	P	0.57720	0.826	D	0.97583	1.0112	10	0.40728	T	0.16	-10.3824	13.7202	0.62723	0.0:0.0:0.0:1.0	.	209	Q9Y5Q3	MAFB_HUMAN	G	209	ENSP00000362410:D209G;ENSP00000380167:D209G	ENSP00000362410:D209G	D	-	2	0	MAFB	38750279	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.820000	0.86633	1.843000	0.53566	0.374000	0.22700	GAC	MAFB	-	pfam_bZIP_Maf	ENSG00000204103		0.726	MAFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAFB	HGNC	protein_coding	OTTHUMT00000080375.2	-	0.00	21	0	T			39316865	-1	tier1	-	no_errors	ENST00000373313	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	C
MAGEB16	139604	genome.wustl.edu	37	X	35820811	35820811	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:35820811T>C	ENST00000399989.1	+	2	777	c.498T>C	c.(496-498)ttT>ttC	p.F166F	MAGEB16_ENST00000399992.1_Silent_p.F198F|MAGEB16_ENST00000399987.1_Silent_p.F166F|MAGEB16_ENST00000399985.1_Silent_p.F166F|MAGEB16_ENST00000399988.1_Silent_p.F166F	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	166	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						AGATGATATTTGGCCTTGATG	0.478																																																	0													87.0	86.0	86.0					X																	35820811		2098	4205	6303	SO:0001819	synonymous_variant	0				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.498T>C	X.37:g.35820811T>C			A8MU30	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.F198	ENST00000399989.1	37	c.594	CCDS43927.1	X																																																																																			MAGEB16	-	pfam_MAGE,pfscan_MAGE	ENSG00000189023		0.478	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	HGNC	protein_coding	OTTHUMT00000251034.1	-	0.00	34	0	T			35820811	+1	tier1	-	no_errors	ENST00000399992	ensembl	human	known	74_37	silent	55.00	9	11	SNP	0.074	C
MAGEC3	139081	genome.wustl.edu	37	X	140984237	140984237	+	Intron	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:140984237T>A	ENST00000298296.1	+	7	1123				MAGEC3_ENST00000409007.1_Intron|MAGEC3_ENST00000443323.2_5'UTR|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000544766.1_5'UTR	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3											NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					AGCAAACCTCTTAGGAAGACA	0.552																																																	0																																										SO:0001627	intron_variant	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1124-431T>A	X.37:g.140984237T>A			Q3SYA7|Q5JZ43|Q9BZ80	RNA	SNP	-	NULL	ENST00000298296.1	37	NULL	CCDS14676.1	X																																																																																			MAGEC3	-	-	ENSG00000165509		0.552	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	-	0.00	17	0	T	NM_138702		140984237	+1	tier1	-	no_errors	ENST00000483584	ensembl	human	known	74_37	rna	64.71	6	11	SNP	0.000	A
MAP3K7	6885	genome.wustl.edu	37	6	91246095	91246095	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:91246095G>A	ENST00000369329.3	-	13	1478	c.1317C>T	c.(1315-1317)tcC>tcT	p.S439S	MAP3K7_ENST00000479630.1_5'UTR|MAP3K7_ENST00000369327.3_Silent_p.S412S|MAP3K7_ENST00000369320.1_Silent_p.S93S|MAP3K7_ENST00000369325.3_Silent_p.S439S|MAP3K7_ENST00000369332.3_Silent_p.S412S	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	439					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGTCTTGGATGGATCTACGTC	0.353																																																	0													113.0	106.0	108.0					6																	91246095		2203	4300	6503	SO:0001819	synonymous_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.1317C>T	6.37:g.91246095G>A			B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Silent	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S439	ENST00000369329.3	37	c.1317	CCDS5028.1	6																																																																																			MAP3K7	-	pirsf_MAPKKK7	ENSG00000135341		0.353	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1		0.00	46	0	G	NM_145331		91246095	-1			no_errors	ENST00000369329	ensembl	human	known	74_37	silent	6.67	42	3	SNP	0.998	A
MAP4K4	9448	genome.wustl.edu	37	2	102460651	102460651	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:102460651C>T	ENST00000347699.4	+	12	1111	c.1111C>T	c.(1111-1113)Cgg>Tgg	p.R371W	MAP4K4_ENST00000350198.4_Missense_Mutation_p.R371W|MAP4K4_ENST00000350878.4_Missense_Mutation_p.R351W|MAP4K4_ENST00000302217.5_Missense_Mutation_p.R224W|MAP4K4_ENST00000324219.4_Missense_Mutation_p.R371W|MAP4K4_ENST00000413150.2_Missense_Mutation_p.R371W|MAP4K4_ENST00000456652.1_Missense_Mutation_p.R224W|MAP4K4_ENST00000425019.1_Missense_Mutation_p.R371W	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	371					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CGAGGCTCTTCGGAGACAACA	0.502																																																	0													53.0	50.0	51.0					2																	102460651		1932	4145	6077	SO:0001583	missense	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1111C>T	2.37:g.102460651C>T	ENSP00000314363:p.Arg371Trp		O75172|Q9NST7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.R371W	ENST00000347699.4	37	c.1111	CCDS56130.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.159255|4.159255	0.78226|0.78226	.|.	.|.	ENSG00000071054|ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878|ENST00000421882	T;T;T;T;T;T;T;T;T|.	0.75938|.	0.94;-0.85;0.7;4.19;0.7;4.19;-0.84;-0.98;-0.82|.	5.96|5.96	5.07|5.07	0.68467|0.68467	.|.	0.066931|.	0.64402|.	D|.	0.000016|.	T|T	0.72771|0.72771	0.3502|0.3502	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D|.	0.79108|.	0.988;0.982;0.988;0.982;0.992;0.982;0.988;0.992;0.992;0.992|.	T|T	0.72609|0.72609	-0.4241|-0.4241	10|5	0.35671|.	T|.	0.21|.	.|.	16.3102|16.3102	0.82865|0.82865	0.1386:0.8614:0.0:0.0|0.1386:0.8614:0.0:0.0	.|.	351;371;351;224;371;371;371;371;371;371|.	B7Z388;B7Z3V5;E7ESS2;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948|.	.;.;.;.;.;M4K4_HUMAN;.;.;.;.|.	W|L	371;371;371;224;371;224;371;333;351|110	ENSP00000392830:R371W;ENSP00000313644:R371W;ENSP00000281111:R371W;ENSP00000303600:R224W;ENSP00000389752:R371W;ENSP00000387370:R224W;ENSP00000314363:R371W;ENSP00000409720:R333W;ENSP00000343658:R351W|.	ENSP00000303600:R224W|.	R|S	+|+	1|2	2|0	MAP4K4|MAP4K4	101827083|101827083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.971000|4.971000	0.63749|0.63749	1.485000|1.485000	0.48380|0.48380	0.655000|0.655000	0.94253|0.94253	CGG|TCG	MAP4K4	-	NULL	ENSG00000071054		0.502	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	-	0.00	35	0	C	NM_004834		102460651	+1	tier1	-	no_errors	ENST00000324219	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	T
MARK1	4139	genome.wustl.edu	37	1	220754431	220754431	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:220754431A>C	ENST00000366917.4	+	3	546	c.280A>C	c.(280-282)Act>Cct	p.T94P	MARK1_ENST00000402574.1_5'UTR|MARK1_ENST00000366918.4_Missense_Mutation_p.T94P					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AATAGACAAAACTCAGCTAAA	0.229																																																	0													19.0	20.0	19.0					1																	220754431		2098	4136	6234	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.280A>C	1.37:g.220754431A>C	ENSP00000355884:p.Thr94Pro			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.T94P	ENST00000366917.4	37	c.280	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.979048	0.92982	.	.	ENSG00000116141	ENST00000366918;ENST00000366917	T;T	0.65178	1.84;-0.14	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67050	0.2852	N	0.16862	0.45	0.80722	D	1	B;D;D	0.89917	0.408;0.996;1.0	P;D;D	0.74348	0.543;0.95;0.983	T	0.72782	-0.4189	10	0.87932	D	0	.	16.3127	0.82898	1.0:0.0:0.0:0.0	.	94;94;94	B4DIB3;Q9P0L2;Q9P0L2-3	.;MARK1_HUMAN;.	P	94	ENSP00000355885:T94P;ENSP00000355884:T94P	ENSP00000355884:T94P	T	+	1	0	MARK1	218821054	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.960000	0.93117	2.246000	0.74042	0.533000	0.62120	ACT	MARK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000116141		0.229	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	107	0	A			220754431	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	22.33	80	23	SNP	1.000	C
MC4R	4160	genome.wustl.edu	37	18	58039107	58039107	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:58039107T>G	ENST00000299766.3	-	1	894	c.476A>C	c.(475-477)aAc>aCc	p.N159T		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	159					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				TGTCATAATGTTATGGTACTG	0.438																																																	0													93.0	84.0	87.0					18																	58039107		2203	4300	6503	SO:0001583	missense	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.476A>C	18.37:g.58039107T>G	ENSP00000299766:p.Asn159Thr		B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.N159T	ENST00000299766.3	37	c.476	CCDS11976.1	18	.	.	.	.	.	.	.	.	.	.	T	14.35	2.508428	0.44660	.	.	ENSG00000166603	ENST00000299766	T	0.19105	2.17	5.65	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.044253	0.85682	D	0.000000	T	0.19366	0.0465	L	0.45228	1.405	0.53005	D	0.999965	B	0.09022	0.002	B	0.20184	0.028	T	0.04140	-1.0974	10	0.62326	D	0.03	.	10.6036	0.45381	0.0:0.0:0.1612:0.8388	.	159	P32245	MC4R_HUMAN	T	159	ENSP00000299766:N159T	ENSP00000299766:N159T	N	-	2	0	MC4R	56190087	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.798000	0.47884	2.154000	0.67381	0.533000	0.62120	AAC	MC4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt	ENSG00000166603		0.438	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1	-	0.00	53	0	T	NM_005912		58039107	-1	tier1	-	no_errors	ENST00000299766	ensembl	human	known	74_37	missense	41.94	18	13	SNP	1.000	G
MDGA2	161357	genome.wustl.edu	37	14	47351346	47351346	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:47351346A>C	ENST00000399232.2	-	11	2474	c.2110T>G	c.(2110-2112)Ttg>Gtg	p.L704V	MDGA2_ENST00000439988.3_Missense_Mutation_p.L773V|MDGA2_ENST00000399222.3_5'UTR|MDGA2_ENST00000426342.1_Missense_Mutation_p.L475V|MDGA2_ENST00000357362.3_Missense_Mutation_p.L475V	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	704	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						AGCTCTGTCAAGTTATATGTA	0.378																																																	0													63.0	61.0	62.0					14																	47351346		1824	4087	5911	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2110T>G	14.37:g.47351346A>C	ENSP00000382178:p.Leu704Val		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.L773V	ENST00000399232.2	37	c.2317		14	.	.	.	.	.	.	.	.	.	.	A	19.13	3.767160	0.69878	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.1	3.78	0.43462	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.41194	U	0.000924	T	0.48572	0.1507	M	0.61703	1.905	0.80722	D	1	D;P	0.54397	0.966;0.897	P;P	0.56563	0.801;0.463	T	0.53982	-0.8361	10	0.09084	T	0.74	.	3.9378	0.09313	0.7057:0.0:0.2943:0.0	.	475;704	F6W3S7;Q7Z553	.;MDGA2_HUMAN	V	704;475;773;475	ENSP00000400011:L704V;ENSP00000405456:L475V;ENSP00000382178:L773V;ENSP00000349925:L475V	ENSP00000349925:L475V	L	-	1	2	MDGA2	46421096	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.160000	0.71862	2.059000	0.61396	0.383000	0.25322	TTG	MDGA2	-	superfamily_Fibronectin_type3	ENSG00000272781		0.378	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	66	0	A	NM_182830		47351346	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	31.75	43	20	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70360680	70360682	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:70360680_70360682delGCA	ENST00000374080.3	+	42	6272_6274	c.6240_6242delGCA	c.(6238-6243)cggcag>cgg	p.Q2086del	MED12_ENST00000374102.1_In_Frame_Del_p.Q2085del|MED12_ENST00000333646.6_In_Frame_Del_p.Q2089del|AL590764.1_ENST00000579622.1_RNA			Q93074	MED12_HUMAN	mediator complex subunit 12	2086	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					accacatccggcagcagcagcag	0.586			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0																																										SO:0001651	inframe_deletion	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.6240_6242delGCA	X.37:g.70360689_70360691delGCA	ENSP00000363193:p.Gln2086del		O15410|O75557|Q9UHV6|Q9UND7	In_Frame_Del	DEL	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.Q2087in_frame_del	ENST00000374080.3	37	c.6249_6251	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.586	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1		0.00	25	0	GCA	NM_005120		70360682	+1	tier1		no_errors	ENST00000333646	ensembl	human	known	74_37	in_frame_del	15.79	16	3	DEL	0.997:1.000:1.000	-
MEIS1	4211	genome.wustl.edu	37	2	66691293	66691293	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:66691293C>A	ENST00000272369.9	+	7	1140	c.683C>A	c.(682-684)aCc>aAc	p.T228N	MEIS1_ENST00000444274.2_Missense_Mutation_p.T196N|MEIS1_ENST00000398506.2_Missense_Mutation_p.T226N|MEIS1_ENST00000560281.2_Missense_Mutation_p.T228N|MEIS1_ENST00000488550.1_Missense_Mutation_p.T228N|MEIS1_ENST00000407092.2_Missense_Mutation_p.T228N|MEIS1_ENST00000409517.1_3'UTR|MEIS1_ENST00000495021.2_Missense_Mutation_p.T163N	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	228	Ser/Thr-rich.				angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						TCAGGAGGAACCCCAGGCCCT	0.507																																																	0													51.0	54.0	53.0					2																	66691293		1972	4184	6156	SO:0001583	missense	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.683C>A	2.37:g.66691293C>A	ENSP00000272369:p.Thr228Asn		A8MV50	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.T228N	ENST00000272369.9	37	c.683	CCDS46309.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.41|14.41	2.527273|2.527273	0.44969|0.44969	.|.	.|.	ENSG00000143995|ENSG00000143995	ENST00000409517|ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274;ENST00000495021;ENST00000409622;ENST00000402908;ENST00000437869	D|D;D;D;T;D;T	0.91945|0.86627	-2.94|-2.15;-1.93;-1.92;1.33;-2.15;0.75	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93654|0.93654	0.7973|0.7973	M|M	0.77313|0.77313	2.365|2.365	0.58432|0.58432	D|D	0.999999|0.999999	.|P;D;P;D	.|0.89917	.|0.46;1.0;0.945;1.0	.|P;D;P;D	.|0.91635	.|0.45;0.999;0.552;0.999	D|D	0.92541|0.92541	0.6042|0.6042	7|10	0.54805|0.41790	T|T	0.06|0.15	.|.	19.8155|19.8155	0.96566|0.96566	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|163;226;228;228	.|F5GYS8;O00470-2;O00470;F8W8U3	.|.;.;MEIS1_HUMAN;.	T|N	27|228;228;226;196;163;48;84;84	ENSP00000386708:P27T|ENSP00000272369:T228N;ENSP00000384461:T228N;ENSP00000381518:T226N;ENSP00000403206:T196N;ENSP00000440571:T163N;ENSP00000397418:T84N	ENSP00000386708:P27T|ENSP00000272369:T228N	P|T	+|+	1|2	0|0	MEIS1|MEIS1	66544797|66544797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.786000|7.786000	0.85741|0.85741	2.682000|2.682000	0.91365|0.91365	0.650000|0.650000	0.86243|0.86243	CCC|ACC	MEIS1	-	NULL	ENSG00000143995		0.507	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	-	0.00	61	0	C	NM_002398		66691293	+1	tier1	-	no_errors	ENST00000407092	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	A
MFI2	4241	genome.wustl.edu	37	3	196730925	196730925	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:196730925C>A	ENST00000296350.5	-	15	2097	c.1984G>T	c.(1984-1986)Gac>Tac	p.D662Y	MFI2-AS1_ENST00000415244.1_RNA|MFI2-AS1_ENST00000437064.1_RNA|MFI2-AS1_ENST00000414354.1_RNA|MFI2-AS1_ENST00000446695.1_RNA|MFI2-AS1_ENST00000424769.1_RNA	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	662	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		TTGGAGGAGTCGAACATTTTG	0.592																																																	0													323.0	326.0	325.0					3																	196730925		2203	4300	6503	SO:0001583	missense	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1984G>T	3.37:g.196730925C>A	ENSP00000296350:p.Asp662Tyr		Q9BQE2	Missense_Mutation	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.D662Y	ENST00000296350.5	37	c.1984	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759724	0.89932	.	.	ENSG00000163975	ENST00000296350	T	0.33216	1.42	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.51805	0.1696	L	0.54908	1.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41574	-0.9501	10	0.42905	T	0.14	-43.0853	17.1327	0.86730	0.0:1.0:0.0:0.0	.	662	P08582	TRFM_HUMAN	Y	662	ENSP00000296350:D662Y	ENSP00000296350:D662Y	D	-	1	0	MFI2	198215322	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	4.622000	0.61240	2.639000	0.89480	0.561000	0.74099	GAC	MFI2	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin	ENSG00000163975		0.592	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	-	0.00	55	0	C			196730925	-1	tier1	-	no_errors	ENST00000296350	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	A
MFSD2A	84879	genome.wustl.edu	37	1	40435485	40435485	+	3'UTR	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:40435485G>T	ENST00000372809.5	+	0	2020				MFSD2A_ENST00000372811.5_3'UTR|MFSD2A_ENST00000480630.1_3'UTR	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A						establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GGACTGATCGGGCCTAGCCCG	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.*245G>T	1.37:g.40435485G>T			A8K675|Q6UWU5|Q96F59|Q9BRC8	RNA	SNP	-	NULL	ENST00000372809.5	37	NULL	CCDS44118.1	1																																																																																			MFSD2A	-	-	ENSG00000168389		0.512	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2A	HGNC	protein_coding	OTTHUMT00000025756.1	-	0.00	155	0	G	NM_032793		40435485	+1	tier1	-	no_errors	ENST00000480630	ensembl	human	known	74_37	rna	5.10	93	5	SNP	0.604	T
MICU2	221154	genome.wustl.edu	37	13	22178166	22178166	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:22178166C>T	ENST00000382374.4	-	1	187	c.122G>A	c.(121-123)gGc>gAc	p.G41D		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	41	Ala-rich.				mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										CAGGGCCGCGCCGGCCACTGC	0.711																																																	0													11.0	12.0	12.0					13																	22178166		2001	3966	5967	SO:0001583	missense	0			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.122G>A	13.37:g.22178166C>T	ENSP00000371811:p.Gly41Asp		Q8N0T6|Q8NAX8	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.G41D	ENST00000382374.4	37	c.122	CCDS9297.1	13	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502773	0.44558	.	.	ENSG00000165487	ENST00000382374	T	0.49139	0.79	5.01	4.14	0.48551	.	0.287310	0.30473	N	0.009542	T	0.51126	0.1656	M	0.68317	2.08	0.09310	N	0.99999	P	0.45348	0.856	P	0.46144	0.505	T	0.50092	-0.8868	10	0.62326	D	0.03	-16.5238	11.048	0.47870	0.0:0.8125:0.1875:0.0	.	41	Q8IYU8	EFHA1_HUMAN	D	41	ENSP00000371811:G41D	ENSP00000371811:G41D	G	-	2	0	EFHA1	21076166	0.801000	0.28930	0.269000	0.24586	0.002000	0.02628	1.656000	0.37355	1.271000	0.44313	0.561000	0.74099	GGC	MICU2	-	NULL	ENSG00000165487		0.711	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICU2	HGNC	protein_coding	OTTHUMT00000144355.1	-	0.00	32	0	C	NM_152726		22178166	-1	tier1	-	no_errors	ENST00000382374	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.258	T
AC017002.1	0	genome.wustl.edu	37	2	112252464	112252464	+	lincRNA	SNP	G	G	A	rs1128295		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:112252464G>A	ENST00000455309.1	+	0	390				AC017002.2_ENST00000432268.1_lincRNA																							ATACTCACCAGGGAGAGGCTG	0.537																																																	0																																												0																															2.37:g.112252464G>A				RNA	SNP	-	NULL	ENST00000455309.1	37	NULL		2																																																																																			MIR4435-1HG	-	-	ENSG00000172965		0.537	AC017002.1-001	KNOWN	basic|exp_conf	lincRNA	MIR4435-1HG	HGNC	lincRNA	OTTHUMT00000332149.1		0.00	115	0	G			112252464	-1			no_errors	ENST00000308604	ensembl	human	known	74_37	rna	5.88	80	5	SNP	1.000	A
LOC349160	349160	genome.wustl.edu	37	7	136849088	136849088	+	RNA	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:136849088T>C	ENST00000439694.1	-	0	164				hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000599888.2_RNA|hsa-mir-490_ENST00000597642.1_RNA																							GTGCCCAAACTGAAGGTGTGT	0.602																																																	0																																												0																															7.37:g.136849088T>C				RNA	SNP	-	NULL	ENST00000439694.1	37	NULL		7																																																																																			hsa-mir-490	-	-	ENSG00000234352		0.602	hsa-mir-490.1-001	KNOWN	basic	antisense	MIR490	miRBase	antisense	OTTHUMT00000341008.1	-	0.00	97	0	T			136849088	-1	tier1	-	no_errors	ENST00000425981	ensembl	human	known	74_37	rna	26.85	79	29	SNP	1.000	C
MIR513C	100302114	genome.wustl.edu	37	X	146271286	146271286	+	RNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:146271286T>G	ENST00000401352.1	-	0	19					NR_031709.1				microRNA 513c																		cgacacctccttgagaaaggc	0.438																																																	0													99.0	80.0	86.0					X																	146271286		1567	3581	5148			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000216171	ENSG00000216171		"""ncRNAs / Micro RNAs"""	33934	non-coding RNA	RNA, micro				MIRN513C			Standard	NR_031709		Approved	hsa-mir-513c					X.37:g.146271286T>G				RNA	SNP	-	NULL	ENST00000401352.1	37	NULL		X																																																																																			MIR513C	-	-	ENSG00000216171		0.438	MIR513C-201	KNOWN	basic	miRNA	MIR513C	HGNC	miRNA		-	0.00	43	0	T	NR_031709		146271286	-1	tier1	-	no_errors	ENST00000401352	ensembl	human	known	74_37	rna	55.17	26	32	SNP	0.001	G
MLLT4	4301	genome.wustl.edu	37	6	168323599	168323599	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:168323599C>T	ENST00000447894.2	+	21	2951	c.2951C>T	c.(2950-2952)gCa>gTa	p.A984V	MLLT4_ENST00000344191.4_Missense_Mutation_p.A984V|MLLT4_ENST00000392112.1_Missense_Mutation_p.A968V|MLLT4_ENST00000351017.4_Missense_Mutation_p.A991V|MLLT4_ENST00000366806.2_Missense_Mutation_p.A984V|MLLT4_ENST00000400822.3_Missense_Mutation_p.A983V|MLLT4_ENST00000392108.3_Missense_Mutation_p.A984V			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	984					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TTTGAAGGTGCAGATTATGAA	0.408			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													155.0	143.0	147.0					6																	168323599		2203	4300	6503	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2951C>T	6.37:g.168323599C>T	ENSP00000404595:p.Ala984Val		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.A984V	ENST00000447894.2	37	c.2951		6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062944	0.76187	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894;ENST00000497596	T;T;T;T;T;T;T	0.05081	3.68;3.59;3.68;3.7;3.5;3.57;3.58	6.0	5.13	0.70059	.	0.060971	0.64402	N	0.000003	T	0.03608	0.0103	L	0.47716	1.5	0.80722	D	1	B;B;P;B	0.34909	0.047;0.03;0.475;0.148	B;B;B;B	0.34824	0.007;0.025;0.19;0.03	T	0.43212	-0.9405	10	0.33940	T	0.23	-2.3079	15.55	0.76141	0.0:0.9333:0.0:0.0667	.	984;983;984;968	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	V	984;991;984;984;968;984;983;984;147	ENSP00000341118:A984V;ENSP00000252692:A991V;ENSP00000375956:A984V;ENSP00000355771:A984V;ENSP00000375960:A968V;ENSP00000383623:A983V;ENSP00000404595:A984V	ENSP00000345834:A984V	A	+	2	0	MLLT4	168066448	1.000000	0.71417	0.968000	0.41197	0.993000	0.82548	4.344000	0.59354	1.522000	0.49001	0.655000	0.94253	GCA	MLLT4	-	NULL	ENSG00000130396		0.408	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	-	0.00	65	0	C	NM_005936		168323599	+1	tier1	-	no_errors	ENST00000366806	ensembl	human	known	74_37	missense	8.20	56	5	SNP	1.000	T
MMRN1	22915	genome.wustl.edu	37	4	90857433	90857433	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:90857433A>C	ENST00000394980.1	+	7	2921	c.2602A>C	c.(2602-2604)Aaa>Caa	p.K868Q	MMRN1_ENST00000264790.2_Missense_Mutation_p.K868Q|MMRN1_ENST00000508372.1_Missense_Mutation_p.K610Q|MMRN1_ENST00000394981.1_Intron			Q13201	MMRN1_HUMAN	multimerin 1	868					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CATTGAGTCTAAAGTTACCCA	0.343																																																	0													37.0	39.0	39.0					4																	90857433		2198	4294	6492	SO:0001583	missense	0			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2602A>C	4.37:g.90857433A>C	ENSP00000378431:p.Lys868Gln		Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.K868Q	ENST00000394980.1	37	c.2602	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	A	14.79	2.640214	0.47153	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.71698	-0.31;-0.31;-0.59	5.3	5.3	0.74995	.	0.065263	0.64402	D	0.000006	T	0.74283	0.3696	L	0.54323	1.7	0.80722	D	1	D	0.62365	0.991	P	0.57101	0.813	T	0.70450	-0.4868	10	0.21014	T	0.42	.	11.9	0.52678	0.8545:0.1454:0.0:0.0	.	868	Q13201	MMRN1_HUMAN	Q	868;868;610	ENSP00000378431:K868Q;ENSP00000264790:K868Q;ENSP00000426461:K610Q	ENSP00000264790:K868Q	K	+	1	0	MMRN1	91076456	1.000000	0.71417	0.996000	0.52242	0.885000	0.51271	3.187000	0.50950	2.308000	0.77769	0.533000	0.62120	AAA	MMRN1	-	NULL	ENSG00000138722		0.343	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	HGNC	protein_coding	OTTHUMT00000253546.2	-	0.00	54	0	A	NM_007351		90857433	+1	tier1	-	no_errors	ENST00000264790	ensembl	human	known	74_37	missense	21.74	36	10	SNP	0.999	C
MNX1	3110	genome.wustl.edu	37	7	156803027	156803027	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:156803027A>G	ENST00000252971.6	-	1	318	c.18T>C	c.(16-18)aaT>aaC	p.N6N	MNX1-AS1_ENST00000480284.1_RNA|MNX1_ENST00000543409.1_5'Flank|MNX1_ENST00000469500.1_5'Flank	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1	6					anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGATGCGGAAATTTTTGGATT	0.716																																																	0													8.0	10.0	10.0					7																	156803027		1656	3160	4816	SO:0001819	synonymous_variant	0			AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181	ENST00000252971.6:c.18T>C	7.37:g.156803027A>G			F5H401|Q9Y648	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.N6	ENST00000252971.6	37	c.18	CCDS34788.1	7																																																																																			MNX1	-	NULL	ENSG00000130675		0.716	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNX1	HGNC	protein_coding	OTTHUMT00000347796.3	-	0.00	74	0	A			156803027	-1	tier1	-	no_errors	ENST00000252971	ensembl	human	known	74_37	silent	13.04	80	12	SNP	1.000	G
MORC2	22880	genome.wustl.edu	37	22	31330171	31330171	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr22:31330171G>A	ENST00000397641.3	-	20	2609	c.2201C>T	c.(2200-2202)cCt>cTt	p.P734L	MORC2_ENST00000469915.1_5'Flank|MORC2-AS1_ENST00000441558.1_RNA|MORC2_ENST00000215862.4_Missense_Mutation_p.P672L			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	734						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CTTCCGACTAGGGGTAGCCTA	0.537																																																	0													98.0	76.0	84.0					22																	31330171		2203	4300	6503	SO:0001583	missense	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2201C>T	22.37:g.31330171G>A	ENSP00000380763:p.Pro734Leu		B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.P734L	ENST00000397641.3	37	c.2201		22	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323825	0.41096	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.11063	2.82;2.81	5.74	4.66	0.58398	.	0.878590	0.10106	N	0.715293	T	0.14743	0.0356	L	0.51422	1.61	0.09310	N	0.999999	B	0.09022	0.002	B	0.14023	0.01	T	0.08806	-1.0704	10	0.39692	T	0.17	.	16.2885	0.82736	0.0:0.1893:0.8106:0.0	.	734	Q9Y6X9	MORC2_HUMAN	L	734;672	ENSP00000380763:P734L;ENSP00000215862:P672L	ENSP00000215862:P672L	P	-	2	0	MORC2	29660171	0.015000	0.18098	0.237000	0.24090	0.273000	0.26683	1.021000	0.30040	2.715000	0.92844	0.655000	0.94253	CCT	MORC2	-	NULL	ENSG00000133422		0.537	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	HGNC	protein_coding	OTTHUMT00000321710.2	-	0.00	104	0	G	NM_014941		31330171	-1	tier1	-	no_errors	ENST00000397641	ensembl	human	known	74_37	missense	33.33	60	30	SNP	0.002	A
MT-CO1	4512	genome.wustl.edu	37	M	6138	6138	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrM:6138G>A	ENST00000361624.2	+	1	235	c.235G>A	c.(235-237)Ggc>Agc	p.G79S	MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	79					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGGAGGCTTTGGCAACTGAC	0.458																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.235G>A	M.37:g.6138G>A	ENSP00000354499:p.Gly79Ser		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G79S	ENST00000361624.2	37	c.235		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.458	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	13	0	G	YP_003024028		6138	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	29.27	29	12	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13048	13048	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrM:13048G>A	ENST00000361567.2	+	1	712	c.712G>A	c.(712-714)Gaa>Aaa	p.E238K	MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	238					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCTCAGCCATAGAAGGCCCCA	0.542																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.712G>A	M.37:g.13048G>A	ENSP00000354813:p.Glu238Lys		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.E238K	ENST00000361567.2	37	c.712		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.542	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	11	0	G	YP_003024036		13048	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	50.00	6	6	SNP	NULL	A
MTOR	2475	genome.wustl.edu	37	1	11177065	11177065	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:11177065C>T	ENST00000361445.4	-	50	7088	c.7012G>A	c.(7012-7014)Gat>Aat	p.D2338N	MTOR_ENST00000376838.1_Missense_Mutation_p.D543N	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2338	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ACTCACCTATCTCCCAGGCCT	0.373																																																	0													155.0	149.0	151.0					1																	11177065		2203	4300	6503	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7012G>A	1.37:g.11177065C>T	ENSP00000354558:p.Asp2338Asn		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_Rapamycin-bd_dom,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_Rapamycin-bd_dom,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D2338N	ENST00000361445.4	37	c.7012	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.441055	0.96168	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	D;D	0.94897	-3.55;-3.55	5.69	5.69	0.88448	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.98848	0.9611	H	0.99842	4.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99208	1.0875	10	0.87932	D	0	.	18.7966	0.91997	0.0:1.0:0.0:0.0	.	2338	P42345	MTOR_HUMAN	N	2338;543	ENSP00000354558:D2338N;ENSP00000366034:D543N	ENSP00000354558:D2338N	D	-	1	0	MTOR	11099652	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.266000	0.78452	2.687000	0.91594	0.462000	0.41574	GAT	MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.373	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	-	0.00	42	0	C	NM_004958		11177065	-1	tier1	-	no_errors	ENST00000361445	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	T
MTSS1	9788	genome.wustl.edu	37	8	125568580	125568580	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:125568580G>A	ENST00000518547.1	-	12	1770	c.1297C>T	c.(1297-1299)Cga>Tga	p.R433*	MTSS1_ENST00000524090.1_Nonsense_Mutation_p.R323*|MTSS1_ENST00000325064.5_Nonsense_Mutation_p.R437*|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_Nonsense_Mutation_p.R151*|MTSS1_ENST00000378017.3_Nonsense_Mutation_p.R408*|MTSS1_ENST00000431961.2_Nonsense_Mutation_p.R151*|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000395508.2_Nonsense_Mutation_p.R207*	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	433					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TCCGGTTCTCGCTTCTCTTTG	0.642																																					Esophageal Squamous(160;622 1893 3862 8546 12509)												0													79.0	70.0	73.0					8																	125568580		2203	4300	6503	SO:0001587	stop_gained	0			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1297C>T	8.37:g.125568580G>A	ENSP00000429064:p.Arg433*		J3KNK6|Q8TCA2|Q96RX2	Nonsense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfscan_WH2_dom	p.R433*	ENST00000518547.1	37	c.1297	CCDS6353.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.9|29.9	5.046938|5.046938	0.93740|0.93740	.|.	.|.	ENSG00000170873|ENSG00000170873	ENST00000519168;ENST00000523179|ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	.|.	.|.	.|.	4.78|4.78	3.9|3.9	0.45041|0.45041	.|.	.|0.067295	.|0.64402	.|D	.|0.000019	T|.	0.46889|.	0.1416|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.52230|.	-0.8603|.	3|.	.|0.15499	.|T	.|0.54	-5.812|-5.812	12.7339|12.7339	0.57212|0.57212	0.0799:0.0:0.9201:0.0|0.0799:0.0:0.9201:0.0	.|.	.|.	.|.	.|.	V|X	220;215|408;433;151;207;437;151;323	.|.	.|ENSP00000322804:R437X	A|R	-|-	2|1	0|2	MTSS1|MTSS1	125637761|125637761	0.997000|0.997000	0.39634|0.39634	0.961000|0.961000	0.40146|0.40146	0.864000|0.864000	0.49448|0.49448	1.634000|1.634000	0.37123|0.37123	1.009000|1.009000	0.39289|0.39289	0.555000|0.555000	0.69702|0.69702	GCG|CGA	MTSS1	-	NULL	ENSG00000170873		0.642	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1	HGNC	protein_coding	OTTHUMT00000109625.3	-	0.00	66	0	G	NM_014751		125568580	-1	tier1	-	no_errors	ENST00000518547	ensembl	human	known	74_37	nonsense	7.22	90	7	SNP	0.988	A
MUC16	94025	genome.wustl.edu	37	19	9068270	9068270	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:9068270A>G	ENST00000397910.4	-	3	19379	c.19176T>C	c.(19174-19176)acT>acC	p.T6392T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6394	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGTAGCAGCAGTGAATGCTT	0.488																																																	0													117.0	113.0	114.0					19																	9068270		2001	4167	6168	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19176T>C	19.37:g.9068270A>G			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T6392	ENST00000397910.4	37	c.19176	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	82	0	A	NM_024690		9068270	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	37.29	37	22	SNP	0.000	G
MUC19	283463	genome.wustl.edu	37	12	40961521	40961521	+	Intron	SNP	T	T	C	rs79641772	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:40961521T>C	ENST00000454784.4	+	81	19185							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						gcaagtcatcttaactaatga	0.562																																																	0																																										SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10890+7T>C	12.37:g.40961521T>C			Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.562	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	35	0	T	XM_003403524		40961521	+1	tier1	-	no_errors	ENST00000460785	ensembl	human	known	74_37	rna	36.67	19	11	SNP	0.001	C
MYO18B	84700	genome.wustl.edu	37	22	26399252	26399252	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr22:26399252T>A	ENST00000407587.2	+	41	6481	c.6312T>A	c.(6310-6312)tgT>tgA	p.C2104*	MYO18B_ENST00000335473.7_Nonsense_Mutation_p.C2103*|MYO18B_ENST00000536101.1_Nonsense_Mutation_p.C2103*			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2103						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CAGTGGATTGTGGCAGCAGCG	0.527																																																	0													53.0	63.0	60.0					22																	26399252		2055	4187	6242	SO:0001587	stop_gained	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6312T>A	22.37:g.26399252T>A	ENSP00000386096:p.Cys2104*		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.C2103*	ENST00000407587.2	37	c.6309		22	.	.	.	.	.	.	.	.	.	.	T	46	12.550317	0.99677	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	.	.	.	3.97	0.695	0.18070	.	0.416858	0.21877	N	0.067782	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	6.0129	0.19586	0.0:0.3328:0.0:0.6672	.	.	.	.	X	2103;2103;2104	.	ENSP00000334563:C2103X	C	+	3	2	MYO18B	24729252	0.059000	0.20769	0.009000	0.14445	0.393000	0.30537	0.215000	0.17562	0.050000	0.15949	0.455000	0.32223	TGT	MYO18B	-	NULL	ENSG00000133454		0.527	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	62	0	T	NM_032608		26399252	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	0.013	A
MYO1H	283446	genome.wustl.edu	37	12	109865375	109865375	+	Missense_Mutation	SNP	G	G	A	rs369196571		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:109865375G>A	ENST00000431443.2	+	18	1915	c.1915G>A	c.(1915-1917)Gag>Aag	p.E639K	MYO1H_ENST00000310903.5_Missense_Mutation_p.E629K	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	639	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						AAGGAAATACGAGCATTTCTT	0.433																																																	0								G	LYS/GLU	0,3836		0,0,1918	207.0	202.0	204.0		1885	5.5	1.0	12		204	1,8239		0,1,4119	no	missense	MYO1H	NM_001101421.3	56	0,1,6037	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	629/1023	109865375	1,12075	1918	4120	6038	SO:0001583	missense	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1915G>A	12.37:g.109865375G>A	ENSP00000444076:p.Glu639Lys		F5H3C6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E639K	ENST00000431443.2	37	c.1915		12	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511127	0.85389	0.0	1.21E-4	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87179	-2.22;-2.22	5.46	5.46	0.80206	.	.	.	.	.	D	0.92642	0.7662	M	0.72479	2.2	0.54753	D	0.999984	D	0.76494	0.999	D	0.67548	0.952	D	0.92704	0.6177	9	0.54805	T	0.06	.	17.8541	0.88756	0.0:0.0:1.0:0.0	.	629	F5H3C6	.	K	629;639	ENSP00000439182:E629K;ENSP00000444076:E639K	ENSP00000439182:E629K	E	+	1	0	MYO1H	108349758	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	9.253000	0.95501	2.552000	0.86080	0.650000	0.86243	GAG	MYO1H	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000174527		0.433	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		-	0.00	116	0	G	NM_173597		109865375	+1	tier1	-	no_errors	ENST00000431443	ensembl	human	known	74_37	missense	7.96	104	9	SNP	1.000	A
MYT1L	23040	genome.wustl.edu	37	2	1926975	1926975	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:1926975T>G	ENST00000399161.2	-	10	1313	c.566A>C	c.(565-567)aAc>aCc	p.N189T	MYT1L_ENST00000428368.2_Missense_Mutation_p.N189T	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	189					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTCATTATTGTTATCATCCTT	0.388																																																	0													76.0	71.0	73.0					2																	1926975		1921	4135	6056	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.566A>C	2.37:g.1926975T>G	ENSP00000382114:p.Asn189Thr		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.N189T	ENST00000399161.2	37	c.566		2	.	.	.	.	.	.	.	.	.	.	T	14.92	2.677972	0.47886	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.44083	0.93;0.93	5.93	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.34521	1.04	0.58432	D	0.999994	P;P	0.40731	0.608;0.728	B;B	0.39339	0.156;0.297	T	0.03364	-1.1044	10	0.15499	T	0.54	-60.358	11.806	0.52155	0.0:0.0681:0.0:0.9319	.	189;189	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	T	189;137;189	ENSP00000382114:N189T;ENSP00000396103:N189T	ENSP00000295067:N137T	N	-	2	0	MYT1L	1905982	1.000000	0.71417	0.896000	0.35187	0.424000	0.31475	6.148000	0.71788	1.071000	0.40834	0.533000	0.62120	AAC	MYT1L	-	NULL	ENSG00000186487		0.388	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	44	0	T	NM_015025		1926975	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	G
NAALAD2	10003	genome.wustl.edu	37	11	89880576	89880576	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:89880576G>T	ENST00000534061.1	+	3	503	c.273G>T	c.(271-273)aaG>aaT	p.K91N	NAALAD2_ENST00000321955.4_Missense_Mutation_p.K91N|NAALAD2_ENST00000525171.1_Missense_Mutation_p.K91N|NAALAD2_ENST00000375944.3_Missense_Mutation_p.K91N	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	91					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CCCAGTGGAAGAAATTTGGAC	0.358																																																	0													84.0	80.0	81.0					11																	89880576		2201	4299	6500	SO:0001583	missense	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.273G>T	11.37:g.89880576G>T	ENSP00000432481:p.Lys91Asn		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.K91N	ENST00000534061.1	37	c.273	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822138	0.50739	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944;ENST00000526637	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.13	2.24	0.28232	.	0.229671	0.37304	N	0.002146	T	0.44159	0.1280	M	0.72894	2.215	0.39569	D	0.969259	P;P;P;P;P	0.43094	0.799;0.505;0.545;0.627;0.681	B;B;B;B;B	0.39617	0.305;0.179;0.213;0.15;0.247	T	0.40156	-0.9578	9	.	.	.	-3.4917	9.9257	0.41492	0.2192:0.0:0.7808:0.0	.	91;91;91;91;91	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	N	91;91;91;91;37	ENSP00000432481:K91N;ENSP00000320083:K91N;ENSP00000435249:K91N;ENSP00000365111:K91N;ENSP00000435670:K37N	.	K	+	3	2	NAALAD2	89520224	1.000000	0.71417	0.959000	0.39883	0.993000	0.82548	2.431000	0.44775	0.275000	0.22094	0.644000	0.83932	AAG	NAALAD2	-	NULL	ENSG00000077616		0.358	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	-	0.00	98	0	G	NM_005467		89880576	+1	tier1	-	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	8.33	66	6	SNP	1.000	T
NACA	4666	genome.wustl.edu	37	12	57113631	57113631	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:57113631C>T	ENST00000454682.1	-	3	1964	c.1683G>A	c.(1681-1683)ccG>ccA	p.P561P	NACA_ENST00000393891.4_Intron|NACA_ENST00000550952.1_Silent_p.P561P|NACA_ENST00000551793.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000548563.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	561	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CCTGGACTAACGGTAATACAG	0.493			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													70.0	72.0	71.0					12																	57113631		1568	3582	5150	SO:0001819	synonymous_variant	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.1683G>A	12.37:g.57113631C>T				Silent	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.P561	ENST00000454682.1	37	c.1683		12																																																																																			NACA	-	NULL	ENSG00000196531		0.493	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		-	0.00	67	0	C	NM_005594		57113631	-1	tier1	-	no_errors	ENST00000454682	ensembl	human	known	74_37	silent	31.25	33	15	SNP	0.000	T
NALCN	259232	genome.wustl.edu	37	13	101763024	101763024	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:101763024T>G	ENST00000251127.6	-	20	2391	c.2310A>C	c.(2308-2310)ggA>ggC	p.G770G		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	770					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGCTGTTTGATCCATGTCTTA	0.373																																																	0													152.0	138.0	143.0					13																	101763024		2203	4300	6503	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2310A>C	13.37:g.101763024T>G			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.G770	ENST00000251127.6	37	c.2310	CCDS9498.1	13																																																																																			NALCN	-	NULL	ENSG00000102452		0.373	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	73	0	T	NM_052867		101763024	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	silent	36.59	26	15	SNP	0.671	G
NALCN	259232	genome.wustl.edu	37	13	101997673	101997673	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:101997673A>C	ENST00000251127.6	-	7	824	c.743T>G	c.(742-744)cTt>cGt	p.L248R	NALCN_ENST00000376196.3_Missense_Mutation_p.L248R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	248					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGATCTTCAAGGTCCATGCA	0.433																																																	0													182.0	166.0	171.0					13																	101997673		2203	4300	6503	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.743T>G	13.37:g.101997673A>C	ENSP00000251127:p.Leu248Arg		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L248R	ENST00000251127.6	37	c.743	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	22.3	4.274207	0.80580	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98633	-4.66;-5.04	5.9	4.7	0.59300	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98991	0.9656	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.99308	1.0903	10	0.72032	D	0.01	.	12.2522	0.54605	0.9328:0.0:0.0672:0.0	.	248;248	F2Z323;Q8IZF0	.;NALCN_HUMAN	R	248	ENSP00000251127:L248R;ENSP00000365367:L248R	ENSP00000251127:L248R	L	-	2	0	NALCN	100795674	1.000000	0.71417	0.934000	0.37439	0.997000	0.91878	7.159000	0.77483	2.251000	0.74343	0.528000	0.53228	CTT	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.433	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	103	0	A	NM_052867		101997673	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	30.26	53	23	SNP	0.994	C
NDN	4692	genome.wustl.edu	37	15	23931491	23931491	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:23931491A>G	ENST00000331837.4	-	1	959	c.874T>C	c.(874-876)Tcc>Ccc	p.S292P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	292	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CTGTATCGGGAGGGCCAGGCC	0.587									Prader-Willi syndrome																																								0													30.0	34.0	33.0					15																	23931491		2203	4295	6498	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.874T>C	15.37:g.23931491A>G	ENSP00000332643:p.Ser292Pro		B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.S292P	ENST00000331837.4	37	c.874	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614464	0.46631	.	.	ENSG00000182636	ENST00000331837	T	0.02606	4.23	3.5	1.09	0.20402	.	0.418879	0.23830	N	0.044158	T	0.02807	0.0084	L	0.33093	0.98	0.28946	N	0.890705	P	0.51351	0.944	P	0.47603	0.551	T	0.39820	-0.9595	10	0.36615	T	0.2	.	2.7864	0.05375	0.6562:0.0:0.1229:0.2209	.	292	Q99608	NECD_HUMAN	P	292	ENSP00000332643:S292P	ENSP00000332643:S292P	S	-	1	0	NDN	21482584	0.887000	0.30362	0.913000	0.36048	0.977000	0.68977	1.527000	0.35975	0.207000	0.20607	0.459000	0.35465	TCC	NDN	-	pfscan_MAGE	ENSG00000182636		0.587	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	-	0.00	48	0	A	NM_002487		23931491	-1	tier1	-	no_errors	ENST00000331837	ensembl	human	known	74_37	missense	12.00	44	6	SNP	0.931	G
NEBL	10529	genome.wustl.edu	37	10	21076223	21076223	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:21076223C>T	ENST00000377122.4	-	27	3172	c.2776G>A	c.(2776-2778)Gga>Aga	p.G926R	NEBL_ENST00000417816.2_Missense_Mutation_p.G182R|NEBL_ENST00000377159.4_Missense_Mutation_p.G148R	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	926	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.G926R(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGATAGGCTCCGGGAAGAACA	0.453																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											177.0	142.0	154.0					10																	21076223		2203	4300	6503	SO:0001583	missense	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2776G>A	10.37:g.21076223C>T	ENSP00000366326:p.Gly926Arg		B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.G926R	ENST00000377122.4	37	c.2776	CCDS7134.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909584	0.92107	.	.	ENSG00000078114	ENST00000377122;ENST00000417816;ENST00000377159	T;T;T	0.34472	3.51;1.36;1.77	6.03	6.03	0.97812	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.87578	0.998;0.801	T	0.27606	-1.0069	10	0.15499	T	0.54	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	182;926	Q70I54;O76041	.;NEBL_HUMAN	R	926;182;148	ENSP00000366326:G926R;ENSP00000393896:G182R;ENSP00000366364:G148R	ENSP00000366326:G926R	G	-	1	0	NEBL	21116229	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.166000	0.77553	2.854000	0.98071	0.655000	0.94253	GGA	NEBL	-	superfamily_SH3_domain	ENSG00000078114		0.453	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	-	0.00	48	0	C	NM_006393		21076223	-1	tier1	-	no_errors	ENST00000377122	ensembl	human	known	74_37	missense	13.33	52	8	SNP	1.000	T
NELL1	4745	genome.wustl.edu	37	11	20940867	20940867	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:20940867A>C	ENST00000357134.5	+	7	898	c.746A>C	c.(745-747)aAg>aCg	p.K249T	NELL1_ENST00000298925.5_Missense_Mutation_p.K277T|NELL1_ENST00000532434.1_Missense_Mutation_p.K249T|NELL1_ENST00000325319.5_Missense_Mutation_p.K192T	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	249					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CTTTTGGCCAAGATGACTGCA	0.323																																																	0													120.0	118.0	119.0					11																	20940867		2203	4299	6502	SO:0001583	missense	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.746A>C	11.37:g.20940867A>C	ENSP00000349654:p.Lys249Thr		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.K249T	ENST00000357134.5	37	c.746	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349842	0.82132	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.80123	-1.34;-1.31;-1.23;-1.22	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.88183	0.6368	L	0.61218	1.895	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.83275	0.996;0.991;0.996;0.991	D	0.87772	0.2606	10	0.45353	T	0.12	-23.9465	16.1057	0.81220	1.0:0.0:0.0:0.0	.	192;277;249;249	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	T	277;249;192;249	ENSP00000298925:K277T;ENSP00000349654:K249T;ENSP00000317837:K192T;ENSP00000437170:K249T	ENSP00000298925:K277T	K	+	2	0	NELL1	20897443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.701000	0.91331	2.281000	0.76405	0.528000	0.53228	AAG	NELL1	-	NULL	ENSG00000165973		0.323	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	-	0.00	107	0	A	NM_006157		20940867	+1	tier1	-	no_errors	ENST00000357134	ensembl	human	known	74_37	missense	18.60	70	16	SNP	1.000	C
NETO1	81832	genome.wustl.edu	37	18	70451035	70451035	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:70451035T>G	ENST00000327305.6	-	7	1403	c.746A>C	c.(745-747)aAg>aCg	p.K249T	NETO1_ENST00000299430.2_Missense_Mutation_p.K248T|NETO1_ENST00000583169.1_Missense_Mutation_p.K249T	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	249	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GCTACAGAACTTAGCTTTCAA	0.473																																																	0													194.0	166.0	175.0					18																	70451035		2203	4300	6503	SO:0001583	missense	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.746A>C	18.37:g.70451035T>G	ENSP00000313088:p.Lys249Thr		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.K249T	ENST00000327305.6	37	c.746	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	T	20.4	3.991711	0.74703	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.20069	2.1;2.1	5.27	5.27	0.74061	CUB (5);	0.000000	0.64402	D	0.000006	T	0.42494	0.1205	L	0.55990	1.75	0.80722	D	1	D;P	0.76494	0.999;0.771	D;P	0.80764	0.994;0.449	T	0.33033	-0.9884	10	0.87932	D	0	-6.0763	15.5016	0.75703	0.0:0.0:0.0:1.0	.	248;249	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	T	249;248	ENSP00000313088:K249T;ENSP00000299430:K248T	ENSP00000299430:K248T	K	-	2	0	NETO1	68602015	1.000000	0.71417	0.991000	0.47740	0.942000	0.58702	7.997000	0.88414	2.102000	0.63906	0.528000	0.53228	AAG	NETO1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000166342		0.473	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	-	0.00	51	0	T	NM_138999		70451035	-1	tier1	-	no_errors	ENST00000327305	ensembl	human	known	74_37	missense	40.00	12	8	SNP	1.000	G
NETO1	81832	genome.wustl.edu	37	18	70526302	70526302	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:70526302T>G	ENST00000327305.6	-	4	885	c.228A>C	c.(226-228)ccA>ccC	p.P76P	NETO1_ENST00000397929.1_Silent_p.P75P|NETO1_ENST00000580049.1_5'UTR|NETO1_ENST00000583169.1_Silent_p.P76P|NETO1_ENST00000299430.2_Silent_p.P75P	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	76	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TGCACTGTCTTGGAGCGGCTG	0.368																																																	0													56.0	56.0	56.0					18																	70526302		2203	4300	6503	SO:0001819	synonymous_variant	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.228A>C	18.37:g.70526302T>G			Q86W85|Q8ND78|Q8TDF4	Silent	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.P76	ENST00000327305.6	37	c.228	CCDS12000.1	18																																																																																			NETO1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000166342		0.368	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	-	0.00	57	0	T	NM_138999		70526302	-1	tier1	-	no_errors	ENST00000327305	ensembl	human	known	74_37	silent	24.14	22	7	SNP	0.976	G
NFASC	23114	genome.wustl.edu	37	1	204985730	204985730	+	3'UTR	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:204985730A>C	ENST00000401399.1	+	0	3985				NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000404076.1_3'UTR|NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000404907.1_3'UTR|NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000513543.1_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGGAGACAAAACCACTGCAGA	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*63A>C	1.37:g.204985730A>C			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			NFASC	-	-	ENSG00000163531		0.577	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	-	0.00	83	0	A	NM_001005388		204985730	+1	tier1	-	no_errors	ENST00000495396	ensembl	human	known	74_37	rna	32.98	63	31	SNP	0.001	C
NFASC	23114	genome.wustl.edu	37	1	204955041	204955041	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:204955041T>G	ENST00000404076.1	+	21	2949	c.2527T>G	c.(2527-2529)Tac>Gac	p.Y843D	NFASC_ENST00000367170.4_Missense_Mutation_p.Y864D|NFASC_ENST00000339876.6_Intron|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000338586.6_Missense_Mutation_p.Y864D|NFASC_ENST00000539706.1_Missense_Mutation_p.Y860D|NFASC_ENST00000367172.4_Missense_Mutation_p.Y864D|NFASC_ENST00000367171.4_Missense_Mutation_p.Y849D|NFASC_ENST00000404907.1_Missense_Mutation_p.Y860D|NFASC_ENST00000338515.6_Missense_Mutation_p.Y864D|NFASC_ENST00000401399.1_Intron|NFASC_ENST00000360049.4_Missense_Mutation_p.Y860D|NFASC_ENST00000513543.1_Missense_Mutation_p.Y860D			O94856	NFASC_HUMAN	neurofascin	864	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCGAAGGCCTACTACTGGAG	0.602																																																	0													35.0	29.0	31.0					1																	204955041		2203	4300	6503	SO:0001583	missense	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000404076.1:c.2527T>G	1.37:g.204955041T>G	ENSP00000385676:p.Tyr843Asp		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Y864D	ENST00000404076.1	37	c.2590		1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241341	0.79912	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000404076;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.79	5.79	0.91817	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000210	T	0.71685	0.3369	M	0.75085	2.285	0.80722	D	1	P;D;P;P;D	0.89917	0.903;1.0;0.882;0.882;0.996	P;D;P;P;D	0.78314	0.744;0.991;0.718;0.627;0.963	T	0.71062	-0.4701	10	0.35671	T	0.21	.	15.7969	0.78420	0.0:0.0:0.0:1.0	.	864;875;860;849;860	O94856;O94856-11;O94856-8;F8W791;O94856-3	NFASC_HUMAN;.;.;.;.	D	864;849;864;864;864;875;860;860;843;860;860;851	ENSP00000356140:Y864D;ENSP00000356139:Y849D;ENSP00000356138:Y864D;ENSP00000342128:Y864D;ENSP00000343509:Y864D;ENSP00000438614:Y860D;ENSP00000353154:Y860D;ENSP00000385676:Y843D;ENSP00000384061:Y860D;ENSP00000425908:Y860D;ENSP00000415031:Y851D	ENSP00000295776:Y875D	Y	+	1	0	NFASC	203221664	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.201000	0.72124	2.207000	0.71202	0.533000	0.62120	TAC	NFASC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000163531		0.602	NFASC-012	NOVEL	not_organism_supported|basic	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131243.1		0.00	13	0	T	NM_001005388		204955041	+1			no_errors	ENST00000367172	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	G
NFASC	23114	genome.wustl.edu	37	1	204987647	204987647	+	3'UTR	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:204987647A>G	ENST00000401399.1	+	0	5902				NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000360049.4_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATTTGGGCCAAGCCTCAGCTA	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*1980A>G	1.37:g.204987647A>G			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			NFASC	-	-	ENSG00000163531		0.557	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	-	0.00	60	0	A	NM_001005388		204987647	+1	tier1	-	no_errors	ENST00000495396	ensembl	human	known	74_37	rna	22.81	43	13	SNP	0.001	G
NLGN1	22871	genome.wustl.edu	37	3	173996816	173996816	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:173996816T>G	ENST00000457714.1	+	6	1454	c.1025T>G	c.(1024-1026)cTt>cGt	p.L342R	NLGN1_ENST00000361589.4_Missense_Mutation_p.L342R|NLGN1_ENST00000401917.3_Missense_Mutation_p.L382R|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Missense_Mutation_p.L342R	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	359					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TACAAAGAACTTGTTGACCAA	0.423																																																	0													212.0	190.0	197.0					3																	173996816		2203	4300	6503	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1025T>G	3.37:g.173996816T>G	ENSP00000392500:p.Leu342Arg		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L382R	ENST00000457714.1	37	c.1145	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911537	0.72983	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.90542	0.7036	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94133	0.7390	10	0.87932	D	0	.	16.0817	0.81010	0.0:0.0:0.0:1.0	.	382;342	D2X2H5;Q8N2Q7-2	.;.	R	342;342;342;382	ENSP00000392500:L342R;ENSP00000354541:L342R;ENSP00000441108:L342R;ENSP00000385750:L382R	ENSP00000354541:L342R	L	+	2	0	NLGN1	175479510	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.206000	0.71126	0.383000	0.25322	CTT	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.423	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	76	0	T	NM_014932		173996816	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	missense	23.73	45	14	SNP	1.000	G
NOA1	84273	genome.wustl.edu	37	4	57839424	57839424	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:57839424C>T	ENST00000264230.4	-	3	2642	c.1405G>A	c.(1405-1407)Gac>Aac	p.D469N		NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	469	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										ATAACAGGGTCATTTTCCATG	0.403																																																	0													232.0	225.0	227.0					4																	57839424		2203	4300	6503	SO:0001583	missense	0			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.1405G>A	4.37:g.57839424C>T	ENSP00000264230:p.Asp469Asn		Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.D469N	ENST00000264230.4	37	c.1405	CCDS3510.1	4	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676447	0.67928	.	.	ENSG00000084092	ENST00000264230	T	0.30981	1.51	5.17	4.33	0.51752	.	0.205281	0.50627	D	0.000119	T	0.36717	0.0977	L	0.54323	1.7	0.42086	D	0.991277	P	0.36683	0.565	B	0.42593	0.392	T	0.17471	-1.0368	10	0.36615	T	0.2	.	15.9239	0.79597	0.0:0.8647:0.1352:0.0	.	469	Q8NC60	CD014_HUMAN	N	469	ENSP00000264230:D469N	ENSP00000264230:D469N	D	-	1	0	C4orf14	57534181	1.000000	0.71417	0.997000	0.53966	0.748000	0.42578	4.189000	0.58358	1.380000	0.46344	0.655000	0.94253	GAC	NOA1	-	superfamily_P-loop_NTPase	ENSG00000084092		0.403	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOA1	HGNC	protein_coding	OTTHUMT00000250694.2	-	0.00	76	0	C	NM_032313		57839424	-1	tier1	-	no_errors	ENST00000264230	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
NRK	203447	genome.wustl.edu	37	X	105181573	105181573	+	Splice_Site	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:105181573A>G	ENST00000243300.9	+	22	4101	c.3798A>G	c.(3796-3798)tcA>tcG	p.S1266S	NRK_ENST00000428173.2_Splice_Site_p.S1267S	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1266	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TTACCATCTCAGGTTTGTTTA	0.383										HNSCC(51;0.14)																																							0													66.0	56.0	59.0					X																	105181573		1834	4085	5919	SO:0001630	splice_region_variant	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.3799+1A>G	X.37:g.105181573A>G			Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.S1267	ENST00000243300.9	37	c.3801		X																																																																																			NRK	-	pfam_Citron,smart_Citron	ENSG00000123572		0.383	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6		0.00	31	0	A	NM_198465	Silent	105181573	+1			no_errors	ENST00000428173	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.697	G
NRXN2	9379	genome.wustl.edu	37	11	64428468	64428468	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:64428468C>T	ENST00000377551.1	-	9	2153	c.1942G>A	c.(1942-1944)Gca>Aca	p.A648T	NRXN2_ENST00000409571.1_Missense_Mutation_p.A641T|NRXN2_ENST00000265459.6_Missense_Mutation_p.A648T|NRXN2_ENST00000496291.1_5'UTR|NRXN2_ENST00000377559.3_Missense_Mutation_p.A617T|AP001092.4_ENST00000433606.1_RNA			Q9P2S2	NRX2A_HUMAN	neurexin 2	648	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CGGAGTGCTGCTGTCCACACC	0.682																																																	0													29.0	29.0	29.0					11																	64428468		2200	4297	6497	SO:0001583	missense	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1942G>A	11.37:g.64428468C>T	ENSP00000366774:p.Ala648Thr		A7E2C1|Q9Y2D6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.A648T	ENST00000377551.1	37	c.1942	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.416701	0.96092	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	4.8	4.8	0.61643	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.41938	U	0.000790	T	0.80059	0.4554	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.998;0.997	T	0.82230	-0.0560	10	0.87932	D	0	.	15.3943	0.74778	0.0:1.0:0.0:0.0	.	617;648;394	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	T	648;617;648;617;641	ENSP00000366774:A648T;ENSP00000366782:A617T;ENSP00000265459:A648T;ENSP00000386416:A641T	ENSP00000265459:A648T	A	-	1	0	NRXN2	64185044	1.000000	0.71417	0.527000	0.27925	0.993000	0.82548	7.541000	0.82084	2.496000	0.84212	0.555000	0.69702	GCA	NRXN2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000110076		0.682	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	-	0.00	62	0	C	NM_015080		64428468	-1	tier1	-	no_errors	ENST00000265459	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.998	T
NXF5	55998	genome.wustl.edu	37	X	101093213	101093213	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:101093213T>C	ENST00000361708.2	-	13	1178	c.819A>G	c.(817-819)ggA>ggG	p.G273G	NXF5_ENST00000537026.1_Silent_p.G273G|NXF5_ENST00000473265.2_Silent_p.G273G			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	273					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						GGGTCTCAGATCCAGTAAAGT	0.502																																																	0													1.0	1.0	1.0					X																	101093213		729	1560	2289	SO:0001819	synonymous_variant	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.819A>G	X.37:g.101093213T>C			A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Silent	SNP	pfam_Tap_RNA-bd	p.G273	ENST00000361708.2	37	c.819		X																																																																																			NXF5	-	NULL	ENSG00000126952		0.502	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		-	0.00	25	0	T			101093213	-1	tier1	-	no_errors	ENST00000263032	ensembl	human	known	74_37	silent	59.52	17	25	SNP	0.768	C
OLAH	55301	genome.wustl.edu	37	10	15098958	15098958	+	Intron	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:15098958T>C	ENST00000378228.3	+	4	417				OLAH_ENST00000378217.3_Missense_Mutation_p.L100P	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase						fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)			endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						attcttggtctattctggatt	0.458																																																	0													267.0	267.0	267.0					10																	15098958		1327	2309	3636	SO:0001627	intron_variant	0			AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.164-4765T>C	10.37:g.15098958T>C			Q5VUB6|Q9NUW1	Missense_Mutation	SNP	pfam_Thioesterase	p.L100P	ENST00000378228.3	37	c.299	CCDS31152.1	10	.	.	.	.	.	.	.	.	.	.	t	5.309	0.242353	0.10077	.	.	ENSG00000152463	ENST00000378217	.	.	.	0.439	0.439	0.16567	.	.	.	.	.	T	0.36026	0.0952	.	.	.	0.09310	N	1	D	0.62365	0.991	P	0.50231	0.635	T	0.18272	-1.0342	5	.	.	.	.	.	.	.	.	100	Q9NV23-2	.	P	100	.	.	L	+	2	0	OLAH	15138964	0.005000	0.15991	0.038000	0.18304	0.121000	0.20230	0.397000	0.20883	0.400000	0.25396	0.155000	0.16302	CTA	OLAH	-	NULL	ENSG00000152463		0.458	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLAH	HGNC	protein_coding	OTTHUMT00000046964.1	-	0.00	73	0	T	NM_018324		15098958	+1	tier1	-	no_errors	ENST00000378217	ensembl	human	known	74_37	missense	15.00	51	9	SNP	0.052	C
OLFM3	118427	genome.wustl.edu	37	1	102302454	102302454	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:102302454A>C	ENST00000338858.5	-	2	256	c.257T>G	c.(256-258)cTt>cGt	p.L86R	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.L66R|OLFM3_ENST00000536598.1_5'UTR|OLFM3_ENST00000359814.3_Missense_Mutation_p.L86R			Q96PB7	NOE3_HUMAN	olfactomedin 3	86					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TAGTTGGCGAAGTTGCCTGCT	0.463																																																	0													129.0	120.0	123.0					1																	102302454		2203	4300	6503	SO:0001583	missense	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.257T>G	1.37:g.102302454A>C	ENSP00000345192:p.Leu86Arg		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.L86R	ENST00000338858.5	37	c.257		1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.388361	0.82902	.	.	ENSG00000118733	ENST00000370103;ENST00000338858;ENST00000359814	T;T;T	0.62232	0.04;0.04;0.04	5.62	5.62	0.85841	.	0.061993	0.64402	D	0.000006	T	0.73458	0.3589	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.991;0.998	T	0.77351	-0.2620	10	0.66056	D	0.02	.	15.5066	0.75745	1.0:0.0:0.0:0.0	.	66;86	Q5T3V6;Q96PB7	.;NOE3_HUMAN	R	66;86;86	ENSP00000359121:L66R;ENSP00000345192:L86R;ENSP00000352867:L86R	ENSP00000345192:L86R	L	-	2	0	OLFM3	102075042	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.310000	0.96267	2.133000	0.65898	0.477000	0.44152	CTT	OLFM3	-	pfam_Noelin-1,superfamily_Quino_amine_DH_bsu	ENSG00000118733		0.463	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030142.1	-	0.00	64	0	A			102302454	-1	tier1	-	no_errors	ENST00000338858	ensembl	human	known	74_37	missense	11.86	52	7	SNP	1.000	C
OPCML	4978	genome.wustl.edu	37	11	132290138	132290138	+	Silent	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:132290138A>T	ENST00000331898.7	-	7	1565	c.987T>A	c.(985-987)gcT>gcA	p.A329A	OPCML_ENST00000374778.4_Silent_p.A288A|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Silent_p.A338A|OPCML_ENST00000524381.1_Silent_p.A322A	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	329					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GCCAGAGACAAGCCAGTGCTC	0.512																																																	0													133.0	110.0	118.0					11																	132290138		2201	4297	6498	SO:0001819	synonymous_variant	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.987T>A	11.37:g.132290138A>T			B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A338	ENST00000331898.7	37	c.1014	CCDS8492.1	11																																																																																			OPCML	-	NULL	ENSG00000183715		0.512	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	43	0	A	NM_001012393		132290138	-1	tier1	-	no_errors	ENST00000541867	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.986	T
OR10J5	127385	genome.wustl.edu	37	1	159505541	159505541	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:159505541A>C	ENST00000334857.2	-	1	301	c.257T>G	c.(256-258)aTt>aGt	p.I86S		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GTTATGAAAAATGAGGCTCAA	0.443																																																	0													152.0	128.0	136.0					1																	159505541		2203	4300	6503	SO:0001583	missense	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.257T>G	1.37:g.159505541A>C	ENSP00000334441:p.Ile86Ser		B9EH35|Q6IFH2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I86S	ENST00000334857.2	37	c.257	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	A	10.21	1.287339	0.23478	.	.	ENSG00000184155	ENST00000334857	T	0.00417	7.5	4.32	4.32	0.51571	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	L	0.27975	0.815	0.09310	N	1	B	0.27068	0.167	B	0.29598	0.104	T	0.39375	-0.9617	9	0.87932	D	0	.	11.737	0.51771	1.0:0.0:0.0:0.0	.	86	Q8NHC4	O10J5_HUMAN	S	86	ENSP00000334441:I86S	ENSP00000334441:I86S	I	-	2	0	OR10J5	157772165	0.605000	0.26941	0.825000	0.32803	0.183000	0.23260	5.697000	0.68295	1.927000	0.55829	0.383000	0.25322	ATT	OR10J5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000184155		0.443	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	-	0.00	40	0	A	NM_001004469		159505541	-1	tier1	-	no_errors	ENST00000334857	ensembl	human	known	74_37	missense	36.36	28	16	SNP	0.134	C
OPN3	23596	genome.wustl.edu	37	1	241761155	241761155	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:241761155T>C	ENST00000366554.2	-	3	944	c.838A>G	c.(838-840)Aat>Gat	p.N280D	OPN3_ENST00000331838.5_Missense_Mutation_p.N201D|OPN3_ENST00000469376.1_5'UTR	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	280					detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CCATGACCATTAACCACCAAG	0.368																																																	0													168.0	159.0	162.0					1																	241761155		2203	4300	6503	SO:0001583	missense	0			AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.838A>G	1.37:g.241761155T>C	ENSP00000355512:p.Asn280Asp		Q8IX08|Q9Y344	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.N280D	ENST00000366554.2	37	c.838	CCDS31072.1	1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.152786	0.38021	.	.	ENSG00000054277	ENST00000366554;ENST00000331838	T;T	0.37058	1.22;1.22	4.49	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.138956	0.49305	D	0.000151	T	0.29914	0.0748	L	0.49513	1.565	0.28360	N	0.920509	P	0.37573	0.6	B	0.39299	0.296	T	0.12863	-1.0531	10	0.36615	T	0.2	.	6.0632	0.19848	0.1959:0.0:0.1386:0.6655	.	280	Q9H1Y3	OPN3_HUMAN	D	280;201	ENSP00000355512:N280D;ENSP00000328018:N201D	ENSP00000328018:N201D	N	-	1	0	OPN3	239827778	0.999000	0.42202	0.856000	0.33681	0.233000	0.25261	2.396000	0.44468	1.794000	0.52575	0.533000	0.62120	AAT	OPN3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000054277		0.368	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN3	HGNC	protein_coding	OTTHUMT00000095713.1	-	0.00	38	0	T	NM_014322		241761155	-1	tier1	-	no_errors	ENST00000366554	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.990	C
OR11H12	440153	genome.wustl.edu	37	14	19378261	19378261	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:19378261T>G	ENST00000550708.1	+	1	740	c.668T>G	c.(667-669)tTt>tGt	p.F223C		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTAGTTATTTTTGGTAACTTC	0.438																																																	0													1.0	1.0	1.0					14																	19378261		416	910	1326	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.668T>G	14.37:g.19378261T>G	ENSP00000449002:p.Phe223Cys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F223C	ENST00000550708.1	37	c.668	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	5.433	0.264985	0.10294	.	.	ENSG00000257115	ENST00000550708	T	0.39787	1.06	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.345819	0.20869	N	0.084217	T	0.38054	0.1026	M	0.61703	1.905	0.26580	N	0.973401	B	0.22146	0.065	B	0.32342	0.144	T	0.46062	-0.9218	9	0.66056	D	0.02	.	5.5303	0.16980	0.0:1.0E-4:0.0:0.9999	.	223	B2RN74	O11HC_HUMAN	C	223	ENSP00000449002:F223C	ENSP00000449002:F223C	F	+	2	0	CR383656.1	18448261	0.007000	0.16637	0.991000	0.47740	0.273000	0.26683	1.758000	0.38410	0.518000	0.28383	0.055000	0.15244	TTT	OR11H12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000257115		0.438	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	-	0.00	41	0	T	NM_001013354		19378261	+1	tier1	-	no_errors	ENST00000550708	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.095	G
OR13D1	286365	genome.wustl.edu	37	9	107456835	107456835	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:107456835T>G	ENST00000318763.5	+	1	176	c.133T>G	c.(133-135)Ttt>Gtt	p.F45V		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						GACTGAATTCTTTCTGGTGGG	0.443																																																	0													68.0	68.0	68.0					9																	107456835		2203	4300	6503	SO:0001583	missense	0				CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.133T>G	9.37:g.107456835T>G	ENSP00000317357:p.Phe45Val		B9EIS1|Q6IFL1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F45V	ENST00000318763.5	37	c.133	CCDS35094.1	9	.	.	.	.	.	.	.	.	.	.	T	0.346	-0.947776	0.02304	.	.	ENSG00000179055	ENST00000318763	T	0.00545	6.67	3.75	2.6	0.31112	.	0.249479	0.28641	N	0.014640	T	0.00271	0.0008	N	0.03253	-0.375	0.22468	N	0.999077	B	0.13145	0.007	B	0.09377	0.004	T	0.42189	-0.9466	10	0.26408	T	0.33	.	5.2412	0.15473	0.0:0.2414:0.0:0.7586	.	45	Q8NGV5	O13D1_HUMAN	V	45	ENSP00000317357:F45V	ENSP00000317357:F45V	F	+	1	0	OR13D1	106496656	0.000000	0.05858	1.000000	0.80357	0.750000	0.42670	-1.391000	0.02525	0.508000	0.28173	0.496000	0.49642	TTT	OR13D1	-	NULL	ENSG00000179055		0.443	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13D1	HGNC	protein_coding	OTTHUMT00000053483.1	-	0.00	93	0	T			107456835	+1	tier1	-	no_errors	ENST00000318763	ensembl	human	known	74_37	missense	16.81	94	19	SNP	0.472	G
OR1J2	26740	genome.wustl.edu	37	9	125273131	125273131	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:125273131C>T	ENST00000335302.5	+	1	51	c.51C>T	c.(49-51)ctC>ctT	p.L17L		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						TTCTGGGCCTCCCCATCCGGC	0.567																																																	0													167.0	155.0	159.0					9																	125273131		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.51C>T	9.37:g.125273131C>T			A3KFL9|Q6IF14|Q96R90|Q9NZP1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L17	ENST00000335302.5	37	c.51	CCDS35121.1	9																																																																																			OR1J2	-	NULL	ENSG00000197233		0.567	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J2	HGNC	protein_coding	OTTHUMT00000053932.1	-	0.00	103	0	C			125273131	+1	tier1	-	no_errors	ENST00000335302	ensembl	human	known	74_37	silent	22.52	86	25	SNP	0.852	T
OR2AE1	81392	genome.wustl.edu	37	7	99474048	99474048	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:99474048G>T	ENST00000316368.2	-	1	632	c.609C>A	c.(607-609)agC>agA	p.S203R		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GGAGGAGAATGCTGCTGATGT	0.483																																																	0													142.0	117.0	125.0					7																	99474048		2203	4300	6503	SO:0001583	missense	0			AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.609C>A	7.37:g.99474048G>T	ENSP00000313936:p.Ser203Arg		B2RPD2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S203R	ENST00000316368.2	37	c.609	CCDS34696.1	7	.	.	.	.	.	.	.	.	.	.	G	7.351	0.622908	0.14193	.	.	ENSG00000244623	ENST00000316368	T	0.39229	1.09	3.62	-2.47	0.06442	GPCR, rhodopsin-like superfamily (1);	0.764774	0.11109	N	0.598835	T	0.50103	0.1596	M	0.84773	2.715	0.09310	N	1	P	0.36354	0.549	B	0.42798	0.398	T	0.54262	-0.8320	10	0.87932	D	0	.	9.5588	0.39355	0.4887:0.0:0.5113:0.0	.	203	Q8NHA4	O2AE1_HUMAN	R	203	ENSP00000313936:S203R	ENSP00000313936:S203R	S	-	3	2	OR2AE1	99311984	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.105000	0.01339	-0.598000	0.05806	-0.387000	0.06579	AGC	OR2AE1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000244623		0.483	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AE1	HGNC	protein_coding	OTTHUMT00000345053.1		0.00	40	0	G			99474048	-1			no_errors	ENST00000316368	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.000	T
OR2L5	81466	genome.wustl.edu	37	1	248185344	248185344	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:248185344T>C	ENST00000355281.1	+	1	95	c.95T>C	c.(94-96)cTc>cCc	p.L32P	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CTCTTTGTTCTCATTTTCCTA	0.413																																																	0																																										SO:0001583	missense	0				CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.95T>C	1.37:g.248185344T>C	ENSP00000347428:p.Leu32Pro		Q6IF04	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L32P	ENST00000355281.1	37	c.95	CCDS58068.1	1	.	.	.	.	.	.	.	.	.	.	.	6.870	0.529912	0.13127	.	.	ENSG00000197454	ENST00000355281	T	0.00441	7.41	2.11	2.11	0.27256	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.30736	N	0.746691	.	.	.	.	.	.	T	0.39961	-0.9588	6	0.62326	D	0.03	.	5.8684	0.18789	0.0:0.0:0.2719:0.7281	.	.	.	.	P	32	ENSP00000347428:L32P	ENSP00000347428:L32P	L	+	2	0	OR2L5	246251967	0.001000	0.12720	0.185000	0.23176	0.230000	0.25150	0.692000	0.25482	0.796000	0.33947	0.352000	0.21897	CTC	OR2L5	-	prints_GPCR_Rhodpsn	ENSG00000197454		0.413	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L5	HGNC	protein_coding	OTTHUMT00000096851.1	-	0.00	148	0	T			248185344	+1	tier1	-	no_errors	ENST00000355281	ensembl	human	known	74_37	missense	17.09	97	20	SNP	0.146	C
OR2T12	127064	genome.wustl.edu	37	1	248457939	248457939	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:248457939A>G	ENST00000317996.1	-	1	941	c.942T>C	c.(940-942)aaT>aaC	p.N314N		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TGTGGGCCTCATTTTGCTGGT	0.418																																																	0													165.0	164.0	165.0					1																	248457939		2203	4300	6503	SO:0001819	synonymous_variant	0			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.942T>C	1.37:g.248457939A>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N314	ENST00000317996.1	37	c.942	CCDS31110.1	1																																																																																			OR2T12	-	NULL	ENSG00000177201		0.418	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	HGNC	protein_coding	OTTHUMT00000097353.1	-	0.00	91	0	A	NM_001004692		248457939	-1	tier1	-	no_errors	ENST00000317996	ensembl	human	known	74_37	silent	16.18	57	11	SNP	0.000	G
OR4C12	283093	genome.wustl.edu	37	11	50003726	50003726	+	Silent	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:50003726A>T	ENST00000335238.4	-	1	345	c.312T>A	c.(310-312)atT>atA	p.I104I		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TAGCACCAAAAATGTGTTCTG	0.443																																																	0													141.0	140.0	141.0					11																	50003726		2201	4294	6495	SO:0001819	synonymous_variant	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.312T>A	11.37:g.50003726A>T			B2RNF0|Q6IF49	Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.I104	ENST00000335238.4	37	c.312	CCDS31496.1	11																																																																																			OR4C12	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221954		0.443	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	-	0.00	83	0	A	NM_001005270		50003726	-1	tier1	-	no_errors	ENST00000335238	ensembl	human	known	74_37	silent	12.05	73	10	SNP	0.787	T
OR4A5	81318	genome.wustl.edu	37	11	51411646	51411646	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:51411646G>T	ENST00000319760.6	-	1	802	c.750C>A	c.(748-750)ccC>ccA	p.P250P		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P250Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TGAAAATACAGGGTACAAAAA	0.393																																																	1	Substitution - Missense(1)	lung(1)											54.0	53.0	53.0					11																	51411646		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.750C>A	11.37:g.51411646G>T			Q6IF84	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P250	ENST00000319760.6	37	c.750	CCDS31497.1	11																																																																																			OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221840		0.393	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1		0.00	67	0	G	NM_001005272		51411646	-1			no_errors	ENST00000319760	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.002	T
OR52K1	390036	genome.wustl.edu	37	11	4510952	4510952	+	Silent	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:4510952C>A	ENST00000307632.3	+	1	844	c.822C>A	c.(820-822)gtC>gtA	p.V274V		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCCCTCGTGTCCACATACTCC	0.498																																																	0													199.0	178.0	185.0					11																	4510952		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.822C>A	11.37:g.4510952C>A			B9EH54|Q6IFK5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V274	ENST00000307632.3	37	c.822	CCDS31352.1	11																																																																																			OR52K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196778		0.498	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1	-	0.00	89	0	C	NM_001005171		4510952	+1	tier1	-	no_errors	ENST00000307632	ensembl	human	known	74_37	silent	17.31	43	9	SNP	0.037	A
OR51G1	79324	genome.wustl.edu	37	11	4945125	4945125	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:4945125T>G	ENST00000321961.2	-	1	512	c.445A>C	c.(445-447)Agc>Cgc	p.S149R	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCACTGAGCTTAGCCCCATC	0.527																																																	0													104.0	87.0	93.0					11																	4945125		2201	4298	6499	SO:0001583	missense	0			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.445A>C	11.37:g.4945125T>G	ENSP00000322546:p.Ser149Arg		B9EGW8|Q6IFH6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S149R	ENST00000321961.2	37	c.445	CCDS31366.1	11	.	.	.	.	.	.	.	.	.	.	T	7.352	0.623051	0.14193	.	.	ENSG00000176879	ENST00000321961	T	0.37915	1.17	4.2	-1.45	0.08828	GPCR, rhodopsin-like superfamily (1);	1.461070	0.04684	U	0.412848	T	0.33904	0.0879	L	0.43923	1.385	0.09310	N	1	B	0.27013	0.166	B	0.37480	0.251	T	0.48980	-0.8986	10	0.72032	D	0.01	.	3.6149	0.08074	0.267:0.337:0.0:0.3961	.	149	Q8NGK1	O51G1_HUMAN	R	149	ENSP00000322546:S149R	ENSP00000322546:S149R	S	-	1	0	OR51G1	4901701	0.000000	0.05858	0.002000	0.10522	0.127000	0.20565	-0.124000	0.10595	0.114000	0.18032	0.455000	0.32223	AGC	OR51G1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176879		0.527	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1	-	0.00	28	0	T	NM_001005237		4945125	-1	tier1	-	no_errors	ENST00000321961	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.000	G
OR52A5	390054	genome.wustl.edu	37	11	5153403	5153403	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:5153403A>G	ENST00000307388.1	-	1	469	c.470T>C	c.(469-471)cTt>cCt	p.L157P		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	157					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGTATTATAAGAATGGCAGC	0.473																																																	0													90.0	87.0	88.0					11																	5153403		2201	4298	6499	SO:0001583	missense	0			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.470T>C	11.37:g.5153403A>G	ENSP00000303469:p.Leu157Pro			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L157P	ENST00000307388.1	37	c.470	CCDS31373.1	11	.	.	.	.	.	.	.	.	.	.	A	9.773	1.173304	0.21704	.	.	ENSG00000171944	ENST00000307388	T	0.16324	2.35	5.22	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	D	0.000661	T	0.44030	0.1274	M	0.90705	3.14	0.20821	N	0.999847	D	0.67145	0.996	D	0.71184	0.972	T	0.31251	-0.9950	10	0.87932	D	0	.	9.2901	0.37782	0.8453:0.0:0.1547:0.0	.	157	Q9H2C5	O52A5_HUMAN	P	157	ENSP00000303469:L157P	ENSP00000303469:L157P	L	-	2	0	OR52A5	5109979	0.000000	0.05858	0.072000	0.20136	0.023000	0.10783	1.295000	0.33377	0.954000	0.37851	0.533000	0.62120	CTT	OR52A5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171944		0.473	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	-	0.00	75	0	A	NM_001005160		5153403	-1	tier1	-	no_errors	ENST00000307388	ensembl	human	known	74_37	missense	17.24	48	10	SNP	0.001	G
OR56A1	120796	genome.wustl.edu	37	11	6048648	6048648	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:6048648A>C	ENST00000316650.5	-	1	323	c.287T>G	c.(286-288)cTt>cGt	p.L96R		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATCGACCTAAGATCATACCA	0.557																																																	0													108.0	96.0	100.0					11																	6048648		2201	4296	6497	SO:0001583	missense	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.287T>G	11.37:g.6048648A>C	ENSP00000321246:p.Leu96Arg		B2RNI2|Q6IFL0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L96R	ENST00000316650.5	37	c.287	CCDS31405.1	11	.	.	.	.	.	.	.	.	.	.	A	2.240	-0.373955	0.05034	.	.	ENSG00000180934	ENST00000316650	T	0.02944	4.1	4.16	0.149	0.14863	GPCR, rhodopsin-like superfamily (1);	0.727269	0.11036	N	0.606633	T	0.02193	0.0068	N	0.20881	0.62	0.09310	N	1	B	0.12630	0.006	B	0.15484	0.013	T	0.45991	-0.9223	10	0.36615	T	0.2	.	5.9754	0.19375	0.5339:0.3073:0.0:0.1588	.	96	Q8NGH5	O56A1_HUMAN	R	96	ENSP00000321246:L96R	ENSP00000321246:L96R	L	-	2	0	OR56A1	6005224	0.000000	0.05858	0.153000	0.22517	0.119000	0.20118	-2.287000	0.01151	-0.070000	0.12908	0.533000	0.62120	CTT	OR56A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180934		0.557	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	-	0.00	80	0	A	NM_001001917		6048648	-1	tier1	-	no_errors	ENST00000316650	ensembl	human	known	74_37	missense	29.89	61	26	SNP	0.003	C
OR4C16	219428	genome.wustl.edu	37	11	55340513	55340513	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:55340513T>G	ENST00000314634.3	+	1	910	c.910T>G	c.(910-912)Ttg>Gtg	p.L304V		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GAGCAAGAAATTGATCACAGA	0.328																																																	0													34.0	33.0	33.0					11																	55340513		2200	4296	6496	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.910T>G	11.37:g.55340513T>G	ENSP00000324913:p.Leu304Val		Q6IEV8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L304V	ENST00000314634.3	37	c.910	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	T	3.450	-0.112236	0.06881	.	.	ENSG00000181935	ENST00000314634	T	0.37915	1.17	4.68	-9.37	0.00626	.	1.557740	0.04190	N	0.328181	T	0.13756	0.0333	N	0.16201	0.385	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.25152	-1.0140	10	0.02654	T	1	.	5.1345	0.14928	0.1038:0.1512:0.5399:0.2051	.	304	Q8NGL9	OR4CG_HUMAN	V	304	ENSP00000324913:L304V	ENSP00000324913:L304V	L	+	1	2	OR4C16	55097089	0.000000	0.05858	0.000000	0.03702	0.596000	0.36781	-7.102000	0.00044	-1.622000	0.01560	0.448000	0.29417	TTG	OR4C16	-	NULL	ENSG00000181935		0.328	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	-	0.00	20	0	T	NM_001004701		55340513	+1	tier1	-	no_errors	ENST00000314634	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.000	G
OR5D14	219436	genome.wustl.edu	37	11	55563498	55563498	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:55563498T>G	ENST00000335605.1	+	1	467	c.467T>G	c.(466-468)tTt>tGt	p.F156C		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TGGGGCATGTTTGGCCCCTTG	0.498																																																	0													152.0	147.0	149.0					11																	55563498		2200	4296	6496	SO:0001583	missense	0			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.467T>G	11.37:g.55563498T>G	ENSP00000334456:p.Phe156Cys		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F156C	ENST00000335605.1	37	c.467	CCDS31508.1	11	.	.	.	.	.	.	.	.	.	.	t	4.253	0.045917	0.08243	.	.	ENSG00000186113	ENST00000335605	T	0.38077	1.16	5.08	3.95	0.45737	GPCR, rhodopsin-like superfamily (1);	0.148155	0.31721	N	0.007170	T	0.28067	0.0692	L	0.31845	0.965	0.09310	N	1	B	0.15719	0.014	B	0.21151	0.033	T	0.26430	-1.0103	10	0.87932	D	0	-17.1087	9.7123	0.40254	0.0:0.0829:0.0:0.9171	.	156	Q8NGL3	OR5DE_HUMAN	C	156	ENSP00000334456:F156C	ENSP00000334456:F156C	F	+	2	0	OR5D14	55320074	0.049000	0.20398	0.196000	0.23383	0.015000	0.08874	2.561000	0.45905	0.786000	0.33708	-0.269000	0.10298	TTT	OR5D14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186113		0.498	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	HGNC	protein_coding	OTTHUMT00000391513.1	-	0.00	110	0	T	NM_001004735		55563498	+1	tier1	-	no_errors	ENST00000335605	ensembl	human	known	74_37	missense	23.66	71	22	SNP	0.010	G
OR5L1	219437	genome.wustl.edu	37	11	55579377	55579377	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:55579377T>G	ENST00000333973.2	+	1	524	c.435T>G	c.(433-435)gcT>gcG	p.A145A		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TGGAGCTGGCTTCTTGCTGCT	0.478																																																	0													215.0	175.0	189.0					11																	55579377		2200	4296	6496	SO:0001819	synonymous_variant	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.435T>G	11.37:g.55579377T>G			B2RNK6|Q6IFD0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A145	ENST00000333973.2	37	c.435	CCDS31509.1	11																																																																																			OR5L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186117		0.478	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	-	0.00	72	0	T	NM_001004738		55579377	+1	tier1	-	no_errors	ENST00000333973	ensembl	human	known	74_37	silent	30.19	37	16	SNP	0.000	G
OR7D4	125958	genome.wustl.edu	37	19	9324982	9324982	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:9324982A>C	ENST00000308682.2	-	1	560	c.532T>G	c.(532-534)Ttc>Gtc	p.F178V		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						GGTTCACAGAAGAAATGCGGA	0.498																																																	0													102.0	95.0	98.0					19																	9324982		2203	4300	6503	SO:0001583	missense	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.532T>G	19.37:g.9324982A>C	ENSP00000310488:p.Phe178Val		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F178V	ENST00000308682.2	37	c.532	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	A	14.21	2.467181	0.43839	.	.	ENSG00000174667	ENST00000308682	T	0.00220	8.52	4.0	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.00440	0.0014	M	0.86573	2.825	0.35912	D	0.831165	P	0.44195	0.828	P	0.50934	0.654	T	0.65998	-0.6032	10	0.72032	D	0.01	.	12.1734	0.54172	1.0:0.0:0.0:0.0	.	178	Q8NG98	OR7D4_HUMAN	V	178	ENSP00000310488:F178V	ENSP00000310488:F178V	F	-	1	0	OR7D4	9185982	0.949000	0.32298	0.999000	0.59377	0.172000	0.22775	7.433000	0.80362	1.831000	0.53308	0.358000	0.22013	TTC	OR7D4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000174667		0.498	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	-	0.00	115	0	A			9324982	-1	tier1	-	no_errors	ENST00000308682	ensembl	human	known	74_37	missense	31.03	80	36	SNP	1.000	C
OTOA	146183	genome.wustl.edu	37	16	21716385	21716385	+	Intron	SNP	C	C	T	rs369416778		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:21716385C>T	ENST00000286149.4	+	11	1023				OTOA_ENST00000388958.3_Intron|OTOA_ENST00000388956.4_Intron|OTOA_ENST00000569064.1_3'UTR|OTOA_ENST00000388957.3_Intron			Q7RTW8	OTOAN_HUMAN	otoancorin						cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		cctgggagtccgtggcaactg	0.488																																																	0													159.0	144.0	149.0					16																	21716385		2199	4300	6499	SO:0001627	intron_variant	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1023-105C>T	16.37:g.21716385C>T			A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	RNA	SNP	-	NULL	ENST00000286149.4	37	NULL		16																																																																																			OTOA	-	-	ENSG00000155719		0.488	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	-	0.00	51	0	C			21716385	+1	tier1	-	no_errors	ENST00000569064	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.025	T
OTOF	9381	genome.wustl.edu	37	2	26683806	26683806	+	Missense_Mutation	SNP	G	G	A	rs376585613		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:26683806G>A	ENST00000272371.2	-	44	5752	c.5626C>T	c.(5626-5628)Ccc>Tcc	p.P1876S	OTOF_ENST00000338581.6_Missense_Mutation_p.P1109S|OTOF_ENST00000339598.3_Missense_Mutation_p.P1109S|OTOF_ENST00000403946.3_Missense_Mutation_p.P1876S|OTOF_ENST00000402415.3_Missense_Mutation_p.P1186S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1876					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACACGAGGGGCACGTCCACC	0.637																																					GBM(102;732 1451 20652 24062 31372)												0													79.0	64.0	69.0					2																	26683806		2203	4300	6503	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5626C>T	2.37:g.26683806G>A	ENSP00000272371:p.Pro1876Ser		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P1876S	ENST00000272371.2	37	c.5626	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	g	23.8	4.454652	0.84209	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.81163	-1.17;-1.18;-1.16;-1.45;-1.46	4.73	4.73	0.59995	C2 calcium/lipid-binding domain, CaLB (1);	0.167541	0.53938	D	0.000049	D	0.89501	0.6733	M	0.77313	2.365	0.80722	D	1	D;P;D;D	0.89917	1.0;0.863;0.984;0.969	D;P;P;P	0.91635	0.999;0.614;0.833;0.828	D	0.89794	0.3970	10	0.45353	T	0.12	-19.5372	17.3091	0.87204	0.0:0.0:1.0:0.0	.	1876;1109;1186;1109	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	S	1109;1109;1186;1876;1876	ENSP00000345137:P1109S;ENSP00000344521:P1109S;ENSP00000383906:P1186S;ENSP00000272371:P1876S;ENSP00000385255:P1876S	ENSP00000272371:P1876S	P	-	1	0	OTOF	26537310	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.620000	0.74224	2.180000	0.69256	0.457000	0.33378	CCC	OTOF	-	superfamily_C2_dom	ENSG00000115155		0.637	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	-	0.00	113	0	G			26683806	-1	tier1	-	no_errors	ENST00000272371	ensembl	human	known	74_37	missense	25.61	61	21	SNP	1.000	A
OTX1	5013	genome.wustl.edu	37	2	63283401	63283401	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:63283401G>A	ENST00000282549.2	+	5	1291	c.1015G>A	c.(1015-1017)Gac>Aac	p.D339N	OTX1_ENST00000366671.3_Missense_Mutation_p.D339N	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	339					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					CAACTCCCCCGACTGTCTGGA	0.577																																																	0													55.0	55.0	55.0					2																	63283401		2203	4300	6503	SO:0001583	missense	0				CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.1015G>A	2.37:g.63283401G>A	ENSP00000282549:p.Asp339Asn		A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	pfam_Otx_TF_C,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Otx1_TF,prints_Otx_TF	p.D339N	ENST00000282549.2	37	c.1015	CCDS1873.1	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604274	0.87157	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.94537	-3.45;-3.45	3.93	3.93	0.45458	.	0.000000	0.85682	D	0.000000	D	0.94751	0.8306	L	0.52126	1.63	0.58432	D	0.999999	D	0.71674	0.998	P	0.55303	0.773	D	0.95361	0.8455	10	0.87932	D	0	.	15.2352	0.73422	0.0:0.0:1.0:0.0	.	339	P32242	OTX1_HUMAN	N	339	ENSP00000355631:D339N;ENSP00000282549:D339N	ENSP00000282549:D339N	D	+	1	0	OTX1	63136905	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	9.551000	0.98112	2.179000	0.69175	0.561000	0.74099	GAC	OTX1	-	NULL	ENSG00000115507		0.577	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX1	HGNC	protein_coding	OTTHUMT00000251617.1	-	0.00	88	0	G			63283401	+1	tier1	-	no_errors	ENST00000282549	ensembl	human	known	74_37	missense	11.11	64	8	SNP	1.000	A
OXR1	55074	genome.wustl.edu	37	8	107763096	107763096	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:107763096delC	ENST00000442977.2	+	16	2651	c.2552delC	c.(2551-2553)acgfs	p.T851fs	OXR1_ENST00000312046.6_Frame_Shift_Del_p.T816fs|OXR1_ENST00000531443.1_Frame_Shift_Del_p.T823fs|OXR1_ENST00000297447.6_Frame_Shift_Del_p.T220fs|OXR1_ENST00000445937.1_Frame_Shift_Del_p.T823fs|OXR1_ENST00000517566.2_Frame_Shift_Del_p.T850fs|OXR1_ENST00000449762.2_Frame_Shift_Del_p.T193fs|OXR1_ENST00000521592.1_Frame_Shift_Del_p.T96fs|OXR1_ENST00000452423.2_Frame_Shift_Del_p.T271fs	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	851					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TCTTGTAAAACGTTTGGGAAT	0.353																																																	0													83.0	85.0	84.0					8																	107763096		2203	4300	6503	SO:0001589	frameshift_variant	0			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2552delC	8.37:g.107763096delC	ENSP00000405424:p.Thr851fs		A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Frame_Shift_Del	DEL	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.T851fs	ENST00000442977.2	37	c.2552	CCDS56548.1	8																																																																																			OXR1	-	pfam_TLDc,smart_TLDc	ENSG00000164830		0.353	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding			0.00	102	0	C	NM_181354		107763096	+1	tier1		no_errors	ENST00000442977	ensembl	human	known	74_37	frame_shift_del	30.67	52	23	DEL	1.000	-
PAPPA2	60676	genome.wustl.edu	37	1	176564118	176564118	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:176564118T>G	ENST00000367662.3	+	3	2542	c.1378T>G	c.(1378-1380)Ttt>Gtt	p.F460V	PAPPA2_ENST00000367661.3_Missense_Mutation_p.F460V	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	460	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GACAGCGAGCTTTGAGCCTGT	0.542																																																	0													94.0	100.0	98.0					1																	176564118		2096	4218	6314	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1378T>G	1.37:g.176564118T>G	ENSP00000356634:p.Phe460Val		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.F460V	ENST00000367662.3	37	c.1378	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	T	11.36	1.617251	0.28801	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.39056	4.27;1.1	5.08	3.96	0.45880	.	0.255981	0.39274	N	0.001413	T	0.58892	0.2154	M	0.74881	2.28	0.09310	N	1	D;D	0.71674	0.997;0.998	D;P	0.64506	0.926;0.859	T	0.51911	-0.8645	10	0.72032	D	0.01	-14.9126	9.9293	0.41512	0.0:0.081:0.0:0.919	.	460;460	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	V	460	ENSP00000356634:F460V;ENSP00000356633:F460V	ENSP00000356633:F460V	F	+	1	0	PAPPA2	174830741	1.000000	0.71417	0.088000	0.20740	0.009000	0.06853	3.756000	0.55205	1.910000	0.55303	0.528000	0.53228	TTT	PAPPA2	-	NULL	ENSG00000116183		0.542	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	72	0	T			176564118	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	24.14	43	14	SNP	0.077	G
PARK2	5071	genome.wustl.edu	37	6	162683700	162683700	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:162683700T>G	ENST00000366898.1	-	3	371	c.269A>C	c.(268-270)aAc>aCc	p.N90T	PARK2_ENST00000366896.1_Intron|PARK2_ENST00000366897.1_Missense_Mutation_p.N90T|PARK2_ENST00000338468.3_5'UTR|PARK2_ENST00000366894.1_Intron|PARK2_ENST00000366892.1_Missense_Mutation_p.N90T	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	90					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TCCCGCCGCGTTTCTGGGGTC	0.577																																																	0													88.0	86.0	87.0					6																	162683700		2203	4300	6503	SO:0001583	missense	0				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.269A>C	6.37:g.162683700T>G	ENSP00000355865:p.Asn90Thr		A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Znf_C6HC,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,smart_Znf_C6HC,pirsf_Parkin,pfscan_Ubiquitin_supergroup,prints_Parkin,prints_Ubiquitin	p.N90T	ENST00000366898.1	37	c.269	CCDS5281.1	6	.	.	.	.	.	.	.	.	.	.	T	6.235	0.411423	0.11812	.	.	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366892;ENST00000366895;ENST00000542682	D;D;D	0.91792	-2.79;-2.91;-2.84	5.05	-10.1	0.00402	.	1.442670	0.04002	N	0.296654	T	0.59582	0.2204	N	0.08118	0	0.09310	N	1	B;B;B	0.19583	0.037;0.004;0.004	B;B;B	0.17979	0.02;0.005;0.005	T	0.61505	-0.7049	10	0.15066	T	0.55	.	9.191	0.37200	0.0:0.1046:0.2963:0.5991	.	90;90;90	O60260-5;Q5VVX4;O60260	.;.;PRKN2_HUMAN	T	90;90;90;11;89	ENSP00000355865:N90T;ENSP00000355863:N90T;ENSP00000355858:N90T	ENSP00000355858:N90T	N	-	2	0	PARK2	162603690	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.398000	0.01051	-2.528000	0.00493	-0.366000	0.07423	AAC	PARK2	-	pirsf_Parkin	ENSG00000185345		0.577	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	-	0.00	48	0	T			162683700	-1	tier1	-	no_errors	ENST00000366898	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.000	G
PCDH15	65217	genome.wustl.edu	37	10	55581039	55581039	+	3'UTR	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:55581039A>C	ENST00000320301.6	-	0	6841				PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000361849.3_3'UTR|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395433.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000373957.3_3'UTR|PCDH15_ENST00000395430.1_3'UTR|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000409834.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTTATCAGAAAACAGATGAC	0.299										HNSCC(58;0.16)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.*579T>G	10.37:g.55581039A>C			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	RNA	SNP	-	NULL	ENST00000320301.6	37	NULL	CCDS7248.1	10																																																																																			PCDH15	-	-	ENSG00000150275		0.299	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	19	0	A	NM_033056		55581039	-1	tier1	-	no_errors	ENST00000463095	ensembl	human	known	74_37	rna	35.00	13	7	SNP	0.546	C
PCDH9	5101	genome.wustl.edu	37	13	67205467	67205467	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:67205467T>C	ENST00000377865.2	-	3	3349	c.3215A>G	c.(3214-3216)gAg>gGg	p.E1072G	PCDH9_ENST00000456367.1_Missense_Mutation_p.E1038G|PCDH9_ENST00000328454.5_Missense_Mutation_p.E1038G|PCDH9_ENST00000544246.1_Missense_Mutation_p.E1072G|RNU7-87P_ENST00000459343.1_RNA			Q9HC56	PCDH9_HUMAN	protocadherin 9	1072					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		ACCCACCGGCTCATGGTCTCC	0.552																																																	0													121.0	105.0	110.0					13																	67205467		2203	4300	6503	SO:0001583	missense	0			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3215A>G	13.37:g.67205467T>C	ENSP00000367096:p.Glu1072Gly		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E1072G	ENST00000377865.2	37	c.3215	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	T	20.8	4.043398	0.75732	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.66995	-0.24;-0.24;-0.08;-0.08	5.63	5.63	0.86233	.	0.000000	0.45126	D	0.000400	T	0.64538	0.2607	L	0.56199	1.76	0.46185	D	0.998914	B;B	0.18610	0.014;0.029	B;B	0.17722	0.019;0.015	T	0.63395	-0.6647	10	0.87932	D	0	.	15.8367	0.78805	0.0:0.0:0.0:1.0	.	1038;1072	Q9HC56-2;Q9HC56	.;PCDH9_HUMAN	G	1072;1072;1038;1038	ENSP00000442186:E1072G;ENSP00000367096:E1072G;ENSP00000401699:E1038G;ENSP00000332060:E1038G	ENSP00000332060:E1038G	E	-	2	0	PCDH9	66103468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.661000	0.83786	2.142000	0.66516	0.533000	0.62120	GAG	PCDH9	-	NULL	ENSG00000184226		0.552	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	HGNC	protein_coding	OTTHUMT00000276387.1	-	0.00	56	0	T	NM_203487		67205467	-1	tier1	-	no_errors	ENST00000377865	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	C
PCDHB2	56133	genome.wustl.edu	37	5	140476060	140476060	+	Silent	SNP	C	C	T	rs17844377	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:140476060C>T	ENST00000194155.4	+	1	1834	c.1686C>T	c.(1684-1686)ttC>ttT	p.F562F		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	562	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCGCCCTTCGTGCTGTACC	0.731													C|||	293	0.0585064	0.0053	0.036	5008	,	,		17851	0.0784		0.0716	False		,,,				2504	0.1125																0								C		89,4245		1,87,2079	12.0	14.0	13.0		1686	1.5	1.0	5	dbSNP_123	13	626,7778		31,564,3607	no	coding-synonymous	PCDHB2	NM_018936.2		32,651,5686	TT,TC,CC		7.4488,2.0535,5.6131		562/799	140476060	715,12023	2167	4202	6369	SO:0001819	synonymous_variant	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1686C>T	5.37:g.140476060C>T			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F562	ENST00000194155.4	37	c.1686	CCDS4244.1	5																																																																																			PCDHB2	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000112852		0.731	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	-	0.00	204	0	C	NM_018936		140476060	+1	tier1	rs17844377	no_errors	ENST00000194155	ensembl	human	known	74_37	silent	15.92	131	25	SNP	0.623	T
PCDHB6	56130	genome.wustl.edu	37	5	140529937	140529937	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:140529937C>T	ENST00000231136.1	+	1	99	c.99C>T	c.(97-99)tcC>tcT	p.S33S	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	33					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCAGTATTCCGTATTGGAGG	0.493																																																	0													158.0	159.0	159.0					5																	140529937		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.99C>T	5.37:g.140529937C>T			B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S33	ENST00000231136.1	37	c.99	CCDS4248.1	5																																																																																			PCDHB6	-	pfam_Cadherin_N,superfamily_Cadherin-like	ENSG00000113211		0.493	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	-	0.00	70	0	C	NM_018939		140529937	+1	tier1	-	no_errors	ENST00000231136	ensembl	human	known	74_37	silent	10.71	50	6	SNP	0.007	T
PCLO	27445	genome.wustl.edu	37	7	82581892	82581892	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:82581892C>A	ENST00000333891.9	-	5	8714	c.8377G>T	c.(8377-8379)Gag>Tag	p.E2793*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.E2793*|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTCACTGTCTCAGTGGCCAGA	0.433																																																	0													198.0	172.0	181.0					7																	82581892		2003	4166	6169	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8377G>T	7.37:g.82581892C>A	ENSP00000334319:p.Glu2793*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.E2793*	ENST00000333891.9	37	c.8377	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	49	15.288264	0.99829	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	.	.	.	5.39	2.52	0.30459	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.0308	0.30463	0.0:0.7213:0.1321:0.1466	.	.	.	.	X	2724;2793;2793	.	ENSP00000334319:E2793X	E	-	1	0	PCLO	82419828	0.998000	0.40836	0.002000	0.10522	0.220000	0.24768	3.753000	0.55180	0.302000	0.22762	0.655000	0.94253	GAG	PCLO	-	NULL	ENSG00000186472		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	50	0	C	NM_014510		82581892	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	nonsense	44.09	52	41	SNP	0.373	A
PCLO	27445	genome.wustl.edu	37	7	82585678	82585678	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:82585678T>G	ENST00000333891.9	-	5	4928	c.4591A>C	c.(4591-4593)Act>Cct	p.T1531P	PCLO_ENST00000423517.2_Missense_Mutation_p.T1531P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCAACACTAGTTCTTCGTTTT	0.398																																																	0													137.0	123.0	127.0					7																	82585678		1907	4147	6054	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4591A>C	7.37:g.82585678T>G	ENSP00000334319:p.Thr1531Pro			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.T1531P	ENST00000333891.9	37	c.4591	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314128	0.23908	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16743	2.32;2.32	5.47	-2.7	0.06004	.	.	.	.	.	T	0.10078	0.0247	N	0.22421	0.69	0.20307	N	0.999914	P;P	0.44946	0.846;0.846	B;B	0.39258	0.295;0.295	T	0.23154	-1.0196	9	0.87932	D	0	.	8.2314	0.31601	0.1152:0.4724:0.0:0.4124	.	1531;1531	Q9Y6V0-5;Q9Y6V0-6	.;.	P	1462;1531;1531	ENSP00000334319:T1531P;ENSP00000388393:T1531P	ENSP00000334319:T1531P	T	-	1	0	PCLO	82423614	0.002000	0.14202	0.006000	0.13384	0.996000	0.88848	-1.046000	0.03525	-0.490000	0.06707	0.533000	0.62120	ACT	PCLO	-	NULL	ENSG00000186472		0.398	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	64	0	T	NM_014510		82585678	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	22.35	66	19	SNP	0.113	G
PDS5B	23047	genome.wustl.edu	37	13	33344580	33344580	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:33344580delA	ENST00000315596.10	+	32	4132	c.3946delA	c.(3946-3948)aaafs	p.K1318fs		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1318					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.K1318fs*76(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AAAAGGAAGCAAAAAAAAATC	0.443																																																	1	Deletion - Frameshift(1)	ovary(1)								12,3522		1,10,1756	36.0	35.0	36.0			4.2	1.0	13		36	23,7817		2,19,3899	no	frameshift	PDS5B	NM_015032.3		3,29,5655	A1A1,A1R,RR		0.2934,0.3396,0.3077			33344580	35,11339	1833	4094	5927	SO:0001589	frameshift_variant	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3946delA	13.37:g.33344580delA	ENSP00000313851:p.Lys1318fs		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.K1318fs	ENST00000315596.10	37	c.3946	CCDS41878.1	13																																																																																			PDS5B	-	NULL	ENSG00000083642		0.443	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3		0.00	22	0	A	NM_015032		33344580	+1	tier1		no_errors	ENST00000315596	ensembl	human	known	74_37	frame_shift_del	10.00	27	3	DEL	1.000	-
PDYN	5173	genome.wustl.edu	37	20	1961103	1961103	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:1961103A>C	ENST00000217305.2	-	4	856	c.631T>G	c.(631-633)Ttg>Gtg	p.L211V	RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000540134.1_Missense_Mutation_p.L211V|PDYN_ENST00000539905.1_Missense_Mutation_p.L211V	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	211			L -> S (in SCA23; the mutant PDYN protein is produced, but processing to opioid peptides is dramatically affected, with increased levels of dynorphin A compared to dynorphin B; these results suggest slow conversion of dynorphin A to short enkephalins; mutant S-211 dynorphin A is not neurotoxic to cultured striatal neurons). {ECO:0000269|PubMed:21035104}.		cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATGCGCCGCAAGAAGCCCCCA	0.587																																																	0													103.0	113.0	110.0					20																	1961103		2203	4300	6503	SO:0001583	missense	0				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.631T>G	20.37:g.1961103A>C	ENSP00000217305:p.Leu211Val		A8K0Q3	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_B,prints_Opioid_neupept	p.L211V	ENST00000217305.2	37	c.631	CCDS13023.1	20	.	.	.	.	.	.	.	.	.	.	A	18.73	3.687427	0.68157	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.81739	-1.53;-1.53;-1.53	5.0	-2.32	0.06745	.	0.118991	0.52532	N	0.000078	T	0.73830	0.3637	M	0.64404	1.975	0.38535	D	0.94906	D	0.60160	0.987	P	0.48425	0.577	T	0.69650	-0.5088	10	0.62326	D	0.03	-8.1026	1.5849	0.02642	0.5032:0.1311:0.2215:0.1442	.	211	P01213	PDYN_HUMAN	V	211	ENSP00000440185:L211V;ENSP00000442259:L211V;ENSP00000217305:L211V	ENSP00000217305:L211V	L	-	1	2	PDYN	1909103	0.866000	0.29940	0.912000	0.35992	0.983000	0.72400	-0.122000	0.10627	-0.179000	0.10654	0.260000	0.18958	TTG	PDYN	-	prints_Proenkphlin_B	ENSG00000101327		0.587	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	HGNC	protein_coding	OTTHUMT00000077569.2	-	0.00	63	0	A			1961103	-1	tier1	-	no_errors	ENST00000217305	ensembl	human	known	74_37	missense	32.98	63	31	SNP	0.995	C
SGCE	8910	genome.wustl.edu	37	7	94285890	94285890	+	5'Flank	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:94285890G>A	ENST00000265735.7	-	0	0				PEG10_ENST00000488574.1_5'UTR|PEG10_ENST00000482108.1_5'UTR|SGCE_ENST00000428696.2_5'Flank|SGCE_ENST00000415788.2_5'Flank|SGCE_ENST00000445866.2_5'Flank|SGCE_ENST00000437425.2_5'Flank|SGCE_ENST00000447873.1_5'Flank	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon						cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GAGTCCTCGCGTGGTGAGTAT	0.597											OREG0018170	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828		7.37:g.94285890G>A	Exception_encountered	1304	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	RNA	SNP	-	NULL	ENST00000265735.7	37	NULL	CCDS5637.1	7																																																																																			PEG10	-	-	ENSG00000242265		0.597	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG10	HGNC	protein_coding	OTTHUMT00000255251.2	-	0.00	94	0	G			94285890	+1	tier1	-	no_errors	ENST00000493935	ensembl	human	known	74_37	rna	14.86	63	11	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57325574	57325574	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:57325574T>C	ENST00000326441.9	-	10	4599	c.4236A>G	c.(4234-4236)gaA>gaG	p.E1412E	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.E1412E|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Silent_p.E1286E|PEG3_ENST00000598410.1_Silent_p.E1288E	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1412	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGCCTCCACTTCTGGCTCAG	0.587																																																	0													44.0	47.0	46.0					19																	57325574		2202	4294	6496	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4236A>G	19.37:g.57325574T>C			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E1412	ENST00000326441.9	37	c.4236	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.587	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	90	0	T			57325574	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	18.18	63	14	SNP	0.000	C
PEG3	5178	genome.wustl.edu	37	19	57327776	57327776	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:57327776A>C	ENST00000326441.9	-	10	2397	c.2034T>G	c.(2032-2034)acT>acG	p.T678T	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.T678T|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Silent_p.T552T|PEG3_ENST00000598410.1_Silent_p.T554T	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	678					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CCTTATTGTAAGTTTTCTGAC	0.428																																																	0													97.0	100.0	99.0					19																	57327776		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2034T>G	19.37:g.57327776A>C			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.T678	ENST00000326441.9	37	c.2034	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.428	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	49	0	A			57327776	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	37.50	25	15	SNP	0.240	C
GATB	5188	genome.wustl.edu	37	4	152680021	152680021	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:152680021G>T	ENST00000515812.1	-	2	246	c.230C>A	c.(229-231)tCc>tAc	p.S77Y	PET112_ENST00000508611.1_Missense_Mutation_p.S77Y|PET112_ENST00000263985.6_Missense_Mutation_p.S77Y|PET112_ENST00000512306.1_Missense_Mutation_p.S77Y																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						TTTAGAGTTGGAGGAAATCTG	0.393																																																	0													133.0	136.0	135.0					4																	152680021		2203	4300	6503	SO:0001583	missense	0																														ENST00000515812.1:c.230C>A	4.37:g.152680021G>T	ENSP00000426859:p.Ser77Tyr			Missense_Mutation	SNP	pfam_Asn/Gln-tRNA_Trfase_suB/E_cat,pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu	p.S77Y	ENST00000515812.1	37	c.230		4	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268321	0.80469	.	.	ENSG00000059691	ENST00000263985;ENST00000515812;ENST00000512306;ENST00000508611	T;T;T;T	0.49720	0.85;0.84;0.86;0.77	5.92	5.92	0.95590	Aspartyl/Glutamyl-tRNA(Gln) amidotransferase, subunit B/E, catalytic (1);	0.052790	0.85682	D	0.000000	T	0.74635	0.3742	M	0.90082	3.085	0.80722	D	1	D;D	0.60160	0.987;0.987	P;P	0.62014	0.852;0.897	T	0.79060	-0.1958	10	0.87932	D	0	-25.6165	20.3167	0.98654	0.0:0.0:1.0:0.0	.	77;77	D6RDU9;O75879	.;GATB_HUMAN	Y	77	ENSP00000263985:S77Y;ENSP00000426859:S77Y;ENSP00000420831:S77Y;ENSP00000421105:S77Y	ENSP00000263985:S77Y	S	-	2	0	PET112	152899471	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.638000	0.83328	2.809000	0.96659	0.557000	0.71058	TCC	PET112	-	pfam_Asn/Gln-tRNA_Trfase_suB/E_cat,tigrfam_Apn/Gln-ADT_bsu	ENSG00000059691		0.393	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PET112	HGNC	protein_coding	OTTHUMT00000365672.1	-	0.00	72	0	G			152680021	-1	tier1	-	no_errors	ENST00000263985	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
PGBD2	267002	genome.wustl.edu	37	1	249211405	249211407	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	CAT	CAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:249211405_249211407delCAT	ENST00000329291.5	+	3	769_771	c.622_624delCAT	c.(622-624)catdel	p.H210del	PGBD2_ENST00000539153.1_In_Frame_Del_p.H207del|PGBD2_ENST00000462488.1_Intron|PGBD2_ENST00000355360.4_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	210										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCCCGATTCACATCATCATCTTG	0.399																																																	0																																										SO:0001651	inframe_deletion	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.622_624delCAT	1.37:g.249211411_249211413delCAT	ENSP00000331643:p.His210del		B3KVR8|Q6MZF8	In_Frame_Del	DEL	NULL	p.H210in_frame_del	ENST00000329291.5	37	c.622_624	CCDS31128.1	1																																																																																			PGBD2	-	NULL	ENSG00000185220		0.399	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1		0.00	26	0	CAT			249211407	+1	tier1		no_errors	ENST00000329291	ensembl	human	known	74_37	in_frame_del	13.79	25	4	DEL	0.992:0.999:1.000	-
PHKA2	5256	genome.wustl.edu	37	X	18936849	18936849	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:18936849G>T	ENST00000379942.4	-	19	2752	c.2087C>A	c.(2086-2088)aCg>aAg	p.T696K		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	696					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TATGTCCCGCGTGGAGTGGAT	0.423																																																	0													119.0	103.0	109.0					X																	18936849		2203	4300	6503	SO:0001583	missense	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2087C>A	X.37:g.18936849G>T	ENSP00000369274:p.Thr696Lys		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.T696K	ENST00000379942.4	37	c.2087	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	g	18.88	3.717876	0.68844	.	.	ENSG00000044446	ENST00000379942	D	0.91124	-2.79	5.72	5.72	0.89469	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.94518	0.8235	M	0.77103	2.36	0.80722	D	1	D	0.53312	0.959	P	0.57620	0.824	D	0.94883	0.8041	10	0.72032	D	0.01	-17.4829	18.4461	0.90685	0.0:0.0:1.0:0.0	.	696	P46019	KPB2_HUMAN	K	696	ENSP00000369274:T696K	ENSP00000369274:T696K	T	-	2	0	PHKA2	18846770	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	5.949000	0.70257	2.397000	0.81536	0.597000	0.82753	ACG	PHKA2	-	pfam_Glyco_hydro_15	ENSG00000044446		0.423	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	-	0.00	25	0	G	NM_000292		18936849	-1	tier1	-	no_errors	ENST00000379942	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
PHKG1	5260	genome.wustl.edu	37	7	56149352	56149352	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:56149352G>A	ENST00000297373.2	-	9	1083	c.889C>T	c.(889-891)Cgg>Tgg	p.R297W	PHKG1_ENST00000537360.1_Missense_Mutation_p.R243W|PHKG1_ENST00000452681.2_Missense_Mutation_p.R329W|PHKG1_ENST00000489604.1_5'Flank	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	297					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTGAAGTGCCGCACTTCCTCC	0.607																																					Melanoma(184;580 2064 5329 24177 35303)												0													38.0	41.0	40.0					7																	56149352		2203	4300	6503	SO:0001583	missense	0			X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.889C>T	7.37:g.56149352G>A	ENSP00000297373:p.Arg297Trp		B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Phosph_kin_gamma	p.R329W	ENST00000297373.2	37	c.985	CCDS5525.1	7	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750148	0.49257	.	.	ENSG00000164776	ENST00000452681;ENST00000537360;ENST00000297373	T;T;T	0.31247	1.5;1.5;1.5	4.32	4.32	0.51571	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000016	T	0.32734	0.0839	M	0.63843	1.955	0.80722	D	1	B;B;B;B	0.28419	0.134;0.035;0.211;0.134	B;B;B;B	0.24269	0.023;0.014;0.052;0.023	T	0.19877	-1.0292	10	0.44086	T	0.13	-16.8792	16.1753	0.81845	0.0:0.0:1.0:0.0	.	243;288;329;297	B7Z5U3;B7Z6U2;F5H2S1;Q16816	.;.;.;PHKG1_HUMAN	W	329;243;297	ENSP00000445440:R329W;ENSP00000441528:R243W;ENSP00000297373:R297W	ENSP00000297373:R297W	R	-	1	2	PHKG1	56116846	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	6.745000	0.74860	2.124000	0.65301	0.313000	0.20887	CGG	PHKG1	-	superfamily_Kinase-like_dom,prints_Phosph_kin_gamma	ENSG00000164776		0.607	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKG1	HGNC	protein_coding	OTTHUMT00000251587.1	-	0.00	74	0	G	NM_006213		56149352	-1	tier1	-	no_errors	ENST00000452681	ensembl	human	known	74_37	missense	9.86	64	7	SNP	1.000	A
PIK3C2B	5287	genome.wustl.edu	37	1	204425171	204425171	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:204425171C>T	ENST00000367187.3	-	12	2312	c.1756G>A	c.(1756-1758)Gtg>Atg	p.V586M	PIK3C2B_ENST00000496872.1_5'UTR|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.V586M	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	586					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			AGGGCTTCCACGACCTTCTCT	0.577																																																	0													62.0	56.0	59.0					1																	204425171		2203	4300	6503	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1756G>A	1.37:g.204425171C>T	ENSP00000356155:p.Val586Met		O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.V586M	ENST00000367187.3	37	c.1756	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428784	0.43122	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.44083	0.93;0.93	5.42	4.51	0.55191	.	0.154543	0.40908	N	0.000996	T	0.32852	0.0843	L	0.39397	1.21	0.33015	D	0.528027	B;B	0.26445	0.02;0.149	B;B	0.18871	0.01;0.023	T	0.42120	-0.9470	10	0.35671	T	0.21	.	12.1278	0.53926	0.0:0.9195:0.0:0.0805	.	586;586	F5GWN5;O00750	.;P3C2B_HUMAN	M	586	ENSP00000356155:V586M;ENSP00000400561:V586M	ENSP00000356155:V586M	V	-	1	0	PIK3C2B	202691794	0.999000	0.42202	0.945000	0.38365	0.987000	0.75469	4.299000	0.59073	1.279000	0.44446	0.655000	0.94253	GTG	PIK3C2B	-	NULL	ENSG00000133056		0.577	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	-	0.00	39	0	C	NM_002646		204425171	-1	tier1	-	no_errors	ENST00000367187	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.992	T
PIKFYVE	200576	genome.wustl.edu	37	2	209190314	209190314	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:209190314A>G	ENST00000264380.4	+	20	2937	c.2779A>G	c.(2779-2781)Agc>Ggc	p.S927G		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	927					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CTGTGATGATAGCAGTTTGCT	0.522																																																	0													70.0	64.0	66.0					2																	209190314		2203	4300	6503	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2779A>G	2.37:g.209190314A>G	ENSP00000264380:p.Ser927Gly		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.S927G	ENST00000264380.4	37	c.2779	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	A	7.678	0.688454	0.14973	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.28666	1.6;1.78	6.07	4.92	0.64577	.	0.360924	0.29892	N	0.010936	T	0.22126	0.0533	L	0.36672	1.1	0.20489	N	0.999899	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21008	-1.0258	10	0.16896	T	0.51	-6.2956	9.7679	0.40572	0.8521:0.0:0.1479:0.0	.	927;871	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	G	927;503;871	ENSP00000264380:S927G;ENSP00000405736:S871G	ENSP00000264380:S927G	S	+	1	0	PIKFYVE	208898559	0.566000	0.26618	0.301000	0.25044	0.762000	0.43233	2.316000	0.43761	1.124000	0.41980	0.528000	0.53228	AGC	PIKFYVE	-	NULL	ENSG00000115020		0.522	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	-	0.00	55	0	A	NM_015040		209190314	+1	tier1	-	no_errors	ENST00000264380	ensembl	human	known	74_37	missense	15.00	51	9	SNP	0.009	G
PKHD1L1	93035	genome.wustl.edu	37	8	110394765	110394765	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:110394765A>G	ENST00000378402.5	+	4	486	c.382A>G	c.(382-384)Aaa>Gaa	p.K128E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	128	IPT/TIG 1.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAACACCTGCAAAGGTCACAT	0.403										HNSCC(38;0.096)																																							0													124.0	123.0	123.0					8																	110394765		1948	4154	6102	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.382A>G	8.37:g.110394765A>G	ENSP00000367655:p.Lys128Glu		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.K128E	ENST00000378402.5	37	c.382	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671757	0.47781	.	.	ENSG00000205038	ENST00000378402	D	0.85773	-2.03	5.94	3.49	0.39957	Cell surface receptor IPT/TIG (1);	0.731322	0.13718	N	0.367577	T	0.77745	0.4176	L	0.44542	1.39	0.20821	N	0.999847	B	0.23891	0.093	B	0.27380	0.079	T	0.60831	-0.7185	10	0.18710	T	0.47	.	6.9275	0.24424	0.561:0.2966:0.0:0.1424	.	128	Q86WI1	PKHL1_HUMAN	E	128	ENSP00000367655:K128E	ENSP00000367655:K128E	K	+	1	0	PKHD1L1	110463941	0.988000	0.35896	0.925000	0.36789	0.991000	0.79684	0.668000	0.25127	0.455000	0.26910	0.528000	0.53228	AAA	PKHD1L1	-	smart_IPT	ENSG00000205038		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1		0.00	36	0	A	NM_177531		110394765	+1			no_errors	ENST00000378402	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.978	G
PLD5	200150	genome.wustl.edu	37	1	242277236	242277236	+	Silent	SNP	G	G	T	rs576261716	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:242277236G>T	ENST00000536534.2	-	7	1267	c.1026C>A	c.(1024-1026)atC>atA	p.I342I	PLD5_ENST00000442594.2_Silent_p.I250I|PLD5_ENST00000427495.1_Silent_p.I280I			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	342						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.I250M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCATGACAGCGATGTACACAT	0.458																																																	1	Substitution - Missense(1)	skin(1)											190.0	142.0	159.0					1																	242277236		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1026C>A	1.37:g.242277236G>T			A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	smart_PLipase_D/transphosphatidylase	p.I342	ENST00000536534.2	37	c.1026	CCDS1621.2	1																																																																																			PLD5	-	NULL	ENSG00000180287		0.458	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2		0.00	64	0	G	NM_152666		242277236	-1			no_errors	ENST00000536534	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.862	T
PLEC	5339	genome.wustl.edu	37	8	144994186	144994186	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:144994186T>C	ENST00000322810.4	-	32	10383	c.10214A>G	c.(10213-10215)cAg>cGg	p.Q3405R	PLEC_ENST00000356346.3_Missense_Mutation_p.Q3254R|PLEC_ENST00000398774.2_Missense_Mutation_p.Q3236R|PLEC_ENST00000354589.3_Missense_Mutation_p.Q3268R|PLEC_ENST00000354958.2_Missense_Mutation_p.Q3246R|PLEC_ENST00000527096.1_Missense_Mutation_p.Q3291R|PLEC_ENST00000345136.3_Missense_Mutation_p.Q3268R|PLEC_ENST00000436759.2_Missense_Mutation_p.Q3295R|PLEC_ENST00000357649.2_Missense_Mutation_p.Q3272R	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3405	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CAACAGCTCCTGCCGCTGCTC	0.607																																																	0													58.0	67.0	64.0					8																	144994186		2179	4271	6450	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10214A>G	8.37:g.144994186T>C	ENSP00000323856:p.Gln3405Arg		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.Q3405R	ENST00000322810.4	37	c.10214	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	T	7.722	0.697329	0.15106	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76060	-0.95;-0.95;-0.99;-0.99;-0.97;-0.95;-0.95;-0.95;-0.95	4.91	2.48	0.30137	.	0.496209	0.17112	U	0.186592	T	0.39517	0.1081	N	0.02842	-0.48	0.26834	N	0.968514	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.27739	-1.0065	10	0.07030	T	0.85	.	2.0361	0.03540	0.2278:0.2543:0.0:0.5178	.	3295;3254;3246;3405;3236;3268;3272;3268	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	R	3268;3272;3268;3236;3405;3246;3254;3295;3291	ENSP00000344848:Q3268R;ENSP00000350277:Q3272R;ENSP00000346602:Q3268R;ENSP00000381756:Q3236R;ENSP00000323856:Q3405R;ENSP00000347044:Q3246R;ENSP00000348702:Q3254R;ENSP00000388180:Q3295R;ENSP00000434583:Q3291R	ENSP00000323856:Q3405R	Q	-	2	0	PLEC	145066174	0.000000	0.05858	0.990000	0.47175	0.596000	0.36781	0.081000	0.14823	0.784000	0.33661	0.368000	0.22195	CAG	PLEC	-	NULL	ENSG00000178209		0.607	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	48	0	T	NM_000445		144994186	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	41.46	24	17	SNP	0.991	C
PLEKHG3	26030	genome.wustl.edu	37	14	65198172	65198172	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:65198172C>T	ENST00000394691.1	+	8	1090	c.943C>T	c.(943-945)Cgc>Tgc	p.R315C	PLEKHG3_ENST00000247226.7_Missense_Mutation_p.R259C			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	315	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GCATCGCGTGCGCAATGAAAG	0.557																																																	0													90.0	81.0	84.0					14																	65198172		2203	4300	6503	SO:0001583	missense	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.943C>T	14.37:g.65198172C>T	ENSP00000378183:p.Arg315Cys		A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R315C	ENST00000394691.1	37	c.943		14	.	.	.	.	.	.	.	.	.	.	c	20.6	4.022431	0.75275	.	.	ENSG00000126822	ENST00000247226;ENST00000394691	T;T	0.76316	-1.01;-1.01	4.61	4.61	0.57282	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.210705	0.40469	N	0.001094	D	0.82999	0.5159	M	0.63843	1.955	0.80722	D	1	D;D	0.69078	0.997;0.993	P;P	0.58970	0.849;0.828	D	0.84857	0.0817	10	0.72032	D	0.01	.	12.1202	0.53887	0.1723:0.8277:0.0:0.0	.	315;259	A1L390;A1L390-3	PKHG3_HUMAN;.	C	259;315	ENSP00000247226:R259C;ENSP00000378183:R315C	ENSP00000247226:R259C	R	+	1	0	PLEKHG3	64267925	0.691000	0.27709	1.000000	0.80357	0.989000	0.77384	1.149000	0.31626	2.113000	0.64589	0.550000	0.68814	CGC	PLEKHG3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000126822		0.557	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1		0.00	59	0	C	NM_015549		65198172	+1			no_errors	ENST00000394691	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
PLIN4	729359	genome.wustl.edu	37	19	4511303	4511303	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:4511303A>G	ENST00000301286.3	-	3	2626	c.2627T>C	c.(2626-2628)gTc>gCc	p.V876A		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	876	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCCAGTCAGGACAGACTTTGT	0.597																																																	0													95.0	102.0	100.0					19																	4511303		1955	4127	6082	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2627T>C	19.37:g.4511303A>G	ENSP00000301286:p.Val876Ala		A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.V876A	ENST00000301286.3	37	c.2627	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	A	17.90	3.501263	0.64298	.	.	ENSG00000167676	ENST00000301286	T	0.06608	3.28	4.93	4.93	0.64822	.	0.000000	0.39210	N	0.001430	T	0.17831	0.0428	M	0.73753	2.245	0.09310	N	1	D	0.71674	0.998	D	0.67548	0.952	T	0.11324	-1.0592	10	0.07482	T	0.82	-12.8716	10.9537	0.47345	1.0:0.0:0.0:0.0	.	876	Q96Q06	PLIN4_HUMAN	A	876	ENSP00000301286:V876A	ENSP00000301286:V876A	V	-	2	0	PLIN4	4462303	0.003000	0.15002	0.004000	0.12327	0.019000	0.09904	1.324000	0.33712	1.844000	0.53588	0.379000	0.24179	GTC	PLIN4	-	NULL	ENSG00000167676		0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	-	0.00	111	0	A	XM_170901		4511303	-1	tier1	-	no_errors	ENST00000301286	ensembl	human	novel	74_37	missense	21.82	86	24	SNP	0.045	G
PLIN4	729359	genome.wustl.edu	37	19	4511699	4511699	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:4511699A>G	ENST00000301286.3	-	3	2230	c.2231T>C	c.(2230-2232)gTc>gCc	p.V744A		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	744	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCCAGTCAGGACAGACTTTGT	0.587																																																	0													109.0	79.0	89.0					19																	4511699		1952	4113	6065	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2231T>C	19.37:g.4511699A>G	ENSP00000301286:p.Val744Ala		A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.V744A	ENST00000301286.3	37	c.2231	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	A	12.44	1.937540	0.34189	.	.	ENSG00000167676	ENST00000301286	T	0.07444	3.19	4.76	4.76	0.60689	.	0.181217	0.26248	N	0.025475	T	0.10981	0.0268	M	0.82323	2.585	0.09310	N	1	B	0.28378	0.209	B	0.33960	0.173	T	0.39375	-0.9617	10	0.06891	T	0.86	-17.7559	4.2964	0.10904	0.7278:0.0:0.0949:0.1772	.	744	Q96Q06	PLIN4_HUMAN	A	744	ENSP00000301286:V744A	ENSP00000301286:V744A	V	-	2	0	PLIN4	4462699	0.010000	0.17322	0.003000	0.11579	0.012000	0.07955	-0.287000	0.08388	1.772000	0.52199	0.379000	0.24179	GTC	PLIN4	-	NULL	ENSG00000167676		0.587	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	-	0.00	47	0	A	XM_170901		4511699	-1	tier1	-	no_errors	ENST00000301286	ensembl	human	novel	74_37	missense	14.29	42	7	SNP	0.002	G
PLOD1	5351	genome.wustl.edu	37	1	12009874	12009874	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:12009874G>A	ENST00000196061.4	+	3	240	c.213G>A	c.(211-213)tcG>tcA	p.S71S	PLOD1_ENST00000376369.3_Silent_p.S118S|PLOD1_ENST00000485046.1_3'UTR	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	71					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	AGGGGACGTCGGCAGGTGGAG	0.557																																																	0													119.0	125.0	123.0					1																	12009874		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.213G>A	1.37:g.12009874G>A			B4DR87|Q96AV9|Q9H132	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.S118	ENST00000196061.4	37	c.354	CCDS142.1	1																																																																																			PLOD1	-	NULL	ENSG00000083444		0.557	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	-	0.00	50	0	G	NM_000302		12009874	+1	tier1	-	no_errors	ENST00000376369	ensembl	human	known	74_37	silent	14.58	41	7	SNP	0.000	A
PLXNA1	5361	genome.wustl.edu	37	3	126737155	126737155	+	Nonsense_Mutation	SNP	G	G	T	rs375219341		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:126737155G>T	ENST00000393409.2	+	19	3679	c.3679G>T	c.(3679-3681)Gag>Tag	p.E1227*	PLXNA1_ENST00000251772.4_Nonsense_Mutation_p.E1204*	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1227	IPT/TIG 4.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AGGTGGCTTCGAGTTCTCGCC	0.647																																																	0													36.0	37.0	37.0					3																	126737155		2197	4299	6496	SO:0001587	stop_gained	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3679G>T	3.37:g.126737155G>T	ENSP00000377061:p.Glu1227*			Nonsense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.E1227*	ENST00000393409.2	37	c.3679	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	G	41	9.113046	0.99069	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	.	.	.	4.18	3.29	0.37713	.	0.381624	0.22553	N	0.058580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	12.9937	0.58634	0.0:0.1637:0.8363:0.0	.	.	.	.	X	1227;1204	.	ENSP00000251772:E1204X	E	+	1	0	PLXNA1	128219845	1.000000	0.71417	0.954000	0.39281	0.688000	0.40055	5.367000	0.66127	0.938000	0.37419	0.467000	0.42956	GAG	PLXNA1	-	superfamily_Ig_E-set,smart_IPT	ENSG00000114554		0.647	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1		0.00	102	0	G	NM_032242		126737155	+1			no_errors	ENST00000393409	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	0.995	T
PLXNA4	91584	genome.wustl.edu	37	7	132174198	132174198	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:132174198G>T	ENST00000359827.3	-	3	2186	c.1224C>A	c.(1222-1224)gaC>gaA	p.D408E	PLXNA4_ENST00000423507.2_Missense_Mutation_p.D408E|PLXNA4_ENST00000378539.5_Missense_Mutation_p.D408E|PLXNA4_ENST00000321063.4_Missense_Mutation_p.D408E			Q9HCM2	PLXA4_HUMAN	plexin A4	408	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GAGCATTCATGTCCAGGCCAC	0.468																																																	0													78.0	71.0	73.0					7																	132174198		2203	4300	6503	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1224C>A	7.37:g.132174198G>T	ENSP00000352882:p.Asp408Glu		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.D408E	ENST00000359827.3	37	c.1224	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044539	0.55110	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.04603	3.59;3.59;3.59;3.59	5.23	2.84	0.33178	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	U	0.000004	T	0.04679	0.0127	L	0.37561	1.115	0.54753	D	0.999985	B;B;B	0.19331	0.001;0.018;0.035	B;B;B	0.29176	0.009;0.099;0.05	T	0.44065	-0.9352	10	0.22706	T	0.39	.	7.5859	0.27993	0.576:0.0:0.424:0.0	.	408;408;408	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	E	408	ENSP00000323194:D408E;ENSP00000352882:D408E;ENSP00000392772:D408E;ENSP00000367800:D408E	ENSP00000323194:D408E	D	-	3	2	PLXNA4	131824738	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.423000	0.44705	0.430000	0.26230	0.655000	0.94253	GAC	PLXNA4	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000221866		0.468	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	51	0	G	NM_181775		132174198	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	missense	16.00	42	8	SNP	1.000	T
CDH12	1010	genome.wustl.edu	37	5	22143063	22143063	+	Intron	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:22143063A>C	ENST00000382254.1	-	5	901				PMCHL1_ENST00000418902.1_RNA|CDH12_ENST00000504376.2_Intron|RP11-855C21.1_ENST00000524042.1_RNA|CDH12_ENST00000522262.1_Intron	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TCAGAAGAAAAGCATTTAATT	0.373										HNSCC(59;0.17)																																							0																																										SO:0001627	intron_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.186-64092T>G	5.37:g.22143063A>C			B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			PMCHL1	-	-	ENSG00000168967		0.373	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMCHL1	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	49	0	A	NM_004061		22143063	+1	tier1	-	no_errors	ENST00000418902	ensembl	human	known	74_37	rna	12.77	41	6	SNP	0.002	C
POM121L2	94026	genome.wustl.edu	37	6	27279045	27279045	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:27279045A>T	ENST00000444565.1	-	1	904	c.905T>A	c.(904-906)gTa>gAa	p.V302E	POM121L2_ENST00000377451.2_Missense_Mutation_p.V302E	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	302										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						AAAATCTGATACCAGTGGGAC	0.488																																																	0													56.0	53.0	54.0					6																	27279045		692	1591	2283	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.905T>A	6.37:g.27279045A>T	ENSP00000392726:p.Val302Glu		C9J1I7	Missense_Mutation	SNP	NULL	p.V302E	ENST00000444565.1	37	c.905	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	A	1.459	-0.562808	0.03939	.	.	ENSG00000158553	ENST00000429945;ENST00000377451;ENST00000444565	T;T;T	0.12465	2.68;2.68;2.68	3.01	-5.07	0.02938	.	1.710450	0.04329	N	0.352088	T	0.01061	0.0035	N	0.12853	0.265	0.09310	N	1	B	0.28636	0.218	B	0.28139	0.086	T	0.25676	-1.0125	10	0.02654	T	1	.	0.809	0.01089	0.2277:0.3084:0.1158:0.3481	.	302	C9J1I7	.	E	16;302;302	ENSP00000415181:V16E;ENSP00000366671:V302E;ENSP00000392726:V302E	ENSP00000366671:V302E	V	-	2	0	POM121L2	27387024	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.406000	0.07187	-1.107000	0.03004	0.459000	0.35465	GTA	POM121L2	-	NULL	ENSG00000158553		0.488	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	-	0.00	32	0	A	NM_033482		27279045	-1	tier1	-	no_errors	ENST00000444565	ensembl	human	known	74_37	missense	39.39	19	13	SNP	0.000	T
POP4	10775	genome.wustl.edu	37	19	30106180	30106180	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:30106180G>A	ENST00000585603.1	+	7	2858	c.556G>A	c.(556-558)Gtg>Atg	p.V186M	POP4_ENST00000392279.3_Missense_Mutation_p.V105M|POP4_ENST00000221770.3_Missense_Mutation_p.V62M|POP4_ENST00000591824.1_3'UTR			O95707	RPP29_HUMAN	processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)	186					mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)|ribonuclease P complex (GO:0030677)	ribonuclease P activity (GO:0004526)|ribonuclease P RNA binding (GO:0033204)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|lung(4)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			CGTGTTCACTGTGGAAACCGA	0.368																																					Melanoma(89;1165 1449 14085 34436 43672)												0													84.0	79.0	81.0					19																	30106180		2203	4300	6503	SO:0001583	missense	0			BC006098	CCDS12416.1	19q13.11	2012-05-21				ENSG00000105171			30081	protein-coding gene	gene with protein product		606114				10352175, 10024167	Standard	NM_006627		Approved	RPP29	uc002nsf.2	O95707		ENST00000585603.1:c.556G>A	19.37:g.30106180G>A	ENSP00000465213:p.Val186Met		Q5XKL7|Q6FHW9|Q9UQQ3	Missense_Mutation	SNP	pfam_RNase_P/MRP_p29,superfamily_Rof/RNase_P-like,smart_RNase_P/MRP_p29,pirsf_RNase_P/MRP_p29-subunit	p.V186M	ENST00000585603.1	37	c.556	CCDS12416.1	19	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134245	0.56828	.	.	ENSG00000105171	ENST00000221770;ENST00000392279	.	.	.	6.17	5.14	0.70334	Rof/RNase P-like (1);Ribonuclease P/MRP, subunit p29 (3);	0.187025	0.46442	D	0.000297	T	0.62060	0.2397	L	0.48362	1.52	0.48185	D	0.999604	P;P	0.51147	0.942;0.87	P;P	0.56434	0.671;0.798	T	0.62267	-0.6890	9	0.45353	T	0.12	-14.5722	9.4129	0.38503	0.0762:0.0:0.7717:0.1521	.	105;186	A8MYC1;O95707	.;RPP29_HUMAN	M	186;105	.	ENSP00000221770:V186M	V	+	1	0	POP4	34798020	0.997000	0.39634	0.897000	0.35233	0.047000	0.14425	2.375000	0.44283	1.598000	0.50083	0.655000	0.94253	GTG	POP4	-	pfam_RNase_P/MRP_p29,superfamily_Rof/RNase_P-like,smart_RNase_P/MRP_p29,pirsf_RNase_P/MRP_p29-subunit	ENSG00000105171		0.368	POP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP4	HGNC	protein_coding	OTTHUMT00000458710.1	-	0.00	53	0	G	NM_006627		30106180	+1	tier1	-	no_errors	ENST00000585603	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.996	A
POSTN	10631	genome.wustl.edu	37	13	38158981	38158981	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr13:38158981T>C	ENST00000379747.4	-	8	1097	c.980A>G	c.(979-981)aAt>aGt	p.N327S	POSTN_ENST00000379743.4_Missense_Mutation_p.N327S|POSTN_ENST00000541481.1_Missense_Mutation_p.N327S|POSTN_ENST00000379742.4_Missense_Mutation_p.N327S|POSTN_ENST00000379749.4_Missense_Mutation_p.N327S|POSTN_ENST00000541179.1_Missense_Mutation_p.N327S	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	327	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CTCAATTGTATTTCCTTCCAG	0.378																																																	0													217.0	189.0	198.0					13																	38158981		2203	4300	6503	SO:0001583	missense	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.980A>G	13.37:g.38158981T>C	ENSP00000369071:p.Asn327Ser		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.N327S	ENST00000379747.4	37	c.980	CCDS9364.1	13	.	.	.	.	.	.	.	.	.	.	T	7.844	0.722620	0.15439	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82;-2.82;-2.82	5.41	4.16	0.48862	FAS1 domain (5);	0.208381	0.53938	D	0.000049	T	0.67002	0.2847	N	0.00572	-1.36	0.38782	D	0.954783	B;B;B;B;B;B;B	0.14012	0.005;0.002;0.004;0.004;0.007;0.009;0.004	B;B;B;B;B;B;B	0.23574	0.047;0.017;0.017;0.017;0.028;0.01;0.017	T	0.66126	-0.6001	10	0.08179	T	0.78	.	6.7649	0.23560	0.0:0.0762:0.154:0.7698	.	327;327;327;327;327;327;327	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	S	327;327;327;327;327;327;244	ENSP00000437959:N327S;ENSP00000369073:N327S;ENSP00000369071:N327S;ENSP00000369067:N327S;ENSP00000369066:N327S;ENSP00000437953:N327S	ENSP00000369066:N327S	N	-	2	0	POSTN	37056981	1.000000	0.71417	0.999000	0.59377	0.826000	0.46750	1.053000	0.30442	2.043000	0.60533	0.533000	0.62120	AAT	POSTN	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_FAS1_domain	ENSG00000133110		0.378	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	-	0.00	50	0	T	NM_006475		38158981	-1	tier1	-	no_errors	ENST00000379747	ensembl	human	known	74_37	missense	38.46	40	25	SNP	0.998	C
POTEM	641455	genome.wustl.edu	37	14	20020051	20020051	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:20020051A>C	ENST00000551509.1	-	1	221	c.170T>G	c.(169-171)cTc>cGc	p.L57R		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	57										endometrium(4)|kidney(1)|lung(4)	9						CTTGCTCCTGAGTGTCTTCAT	0.617																																																	0													10.0	15.0	14.0					14																	20020051		300	1019	1319	SO:0001583	missense	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.170T>G	14.37:g.20020051A>C	ENSP00000452296:p.Leu57Arg			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L57R	ENST00000551509.1	37	c.170	CCDS45076.1	14	.	.	.	.	.	.	.	.	.	.	a	8.401	0.841916	0.16963	.	.	ENSG00000187537	ENST00000551509;ENST00000439503;ENST00000344684	T	0.42900	0.96	.	.	.	.	.	.	.	.	T	0.51787	0.1695	L	0.59436	1.845	0.09310	N	1	D	0.71674	0.998	D	0.63488	0.915	T	0.37596	-0.9699	6	.	.	.	.	.	.	.	.	57	A6NI47	POTEM_HUMAN	R	57	ENSP00000452296:L57R	.	L	-	2	0	POTEM	19090051	0.000000	0.05858	0.029000	0.17559	0.033000	0.12548	-1.469000	0.02348	0.129000	0.18514	0.128000	0.15822	CTC	POTEM	-	NULL	ENSG00000187537		0.617	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	-	0.00	140	0	A	NM_001145442		20020051	-1	tier1	-	no_errors	ENST00000547848	ensembl	human	known	74_37	missense	7.45	148	12	SNP	0.031	C
POU3F2	5454	genome.wustl.edu	37	6	99283090	99283090	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:99283090G>A	ENST00000328345.5	+	1	511	c.341G>A	c.(340-342)cGc>cAc	p.R114H		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	114					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CAGGGCGGCCGCGGAGACGAG	0.731																																																	0													3.0	3.0	3.0					6																	99283090		1429	2764	4193	SO:0001583	missense	0			Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.341G>A	6.37:g.99283090G>A	ENSP00000329170:p.Arg114His		Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.R114H	ENST00000328345.5	37	c.341	CCDS5040.1	6	.	.	.	.	.	.	.	.	.	.	G	9.738	1.164004	0.21538	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	T	0.10382	2.88	3.41	3.41	0.39046	.	0.956494	0.08470	U	0.941126	T	0.08133	0.0203	M	0.61703	1.905	0.40973	D	0.984713	D	0.56287	0.975	B	0.42087	0.375	T	0.36359	-0.9751	10	0.52906	T	0.07	.	12.403	0.55424	0.0:0.0:1.0:0.0	.	114	P20265	PO3F2_HUMAN	H	114;95	ENSP00000329170:R114H	ENSP00000329170:R114H	R	+	2	0	POU3F2	99389811	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	7.072000	0.76777	1.761000	0.52028	0.162000	0.16502	CGC	POU3F2	-	pirsf_Transcription_factor_POU	ENSG00000184486		0.731	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	HGNC	protein_coding	OTTHUMT00000041586.2		0.00	18	0	G			99283090	+1			no_errors	ENST00000328345	ensembl	human	known	74_37	missense	16.67	15	3	SNP	1.000	A
PPP2R1A	5518	genome.wustl.edu	37	19	52716315	52716315	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:52716315A>C	ENST00000322088.6	+	6	817	c.759A>C	c.(757-759)gaA>gaC	p.E253D	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.E198D|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.E74D	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	253	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		AGGCCGCTGAAGACAAGTCCT	0.627			Mis		clear cell ovarian carcinoma																																			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0													41.0	38.0	39.0					19																	52716315		2203	4300	6503	SO:0001583	missense	0				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.759A>C	19.37:g.52716315A>C	ENSP00000324804:p.Glu253Asp		Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E253D	ENST00000322088.6	37	c.759	CCDS12849.1	19	.	.	.	.	.	.	.	.	.	.	A	13.83	2.355394	0.41700	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06371	3.31;3.31	4.48	-0.117	0.13551	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000020	T	0.07728	0.0194	M	0.72479	2.2	0.44092	D	0.996852	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.001	T	0.14699	-1.0463	10	0.37606	T	0.19	-26.2928	8.1486	0.31126	0.4426:0.0:0.5574:0.0	.	198;253;253	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	D	243;173;253;198	ENSP00000324804:E253D;ENSP00000415067:E198D	ENSP00000324804:E253D	E	+	3	2	PPP2R1A	57408127	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	1.110000	0.31147	-0.054000	0.13266	-0.274000	0.10170	GAA	PPP2R1A	-	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	ENSG00000105568		0.627	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1A	HGNC	protein_coding	OTTHUMT00000267967.2	-	0.00	23	0	A	NM_014225		52716315	+1	tier1	-	no_errors	ENST00000322088	ensembl	human	known	74_37	missense	27.27	16	6	SNP	1.000	C
PPRC1	23082	genome.wustl.edu	37	10	103899460	103899460	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:103899460G>T	ENST00000278070.2	+	5	1234	c.1195G>T	c.(1195-1197)Gag>Tag	p.E399*	PPRC1_ENST00000413464.2_Nonsense_Mutation_p.E399*|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GTCAGAGACAGAGGCTGCTGT	0.562																																																	0													110.0	117.0	114.0					10																	103899460		2203	4300	6503	SO:0001587	stop_gained	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1195G>T	10.37:g.103899460G>T	ENSP00000278070:p.Glu399*		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E399*	ENST00000278070.2	37	c.1195	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343170	0.41498	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	.	.	.	5.82	5.82	0.92795	.	0.441512	0.21178	N	0.078871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.8254	0.85929	0.0:0.0:1.0:0.0	.	.	.	.	X	399	.	ENSP00000278070:E399X	E	+	1	0	PPRC1	103889450	0.174000	0.23070	0.105000	0.21289	0.012000	0.07955	2.679000	0.46909	2.751000	0.94390	0.555000	0.69702	GAG	PPRC1	-	NULL	ENSG00000148840		0.562	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1		0.00	41	0	G	NM_015062		103899460	+1			no_errors	ENST00000278070	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	0.036	T
PRR16	51334	genome.wustl.edu	37	5	120021940	120021940	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:120021940G>T	ENST00000407149.2	+	2	660	c.451G>T	c.(451-453)Ggc>Tgc	p.G151C	PRR16_ENST00000379551.2_Missense_Mutation_p.G128C|PRR16_ENST00000446965.1_Missense_Mutation_p.G81C|PRR16_ENST00000505123.1_Missense_Mutation_p.G81C			Q569H4	LARGN_HUMAN	proline rich 16	151	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		AAAAACCAATGGCACCCTTCT	0.488																																																	0													82.0	73.0	76.0					5																	120021940		2203	4300	6503	SO:0001583	missense	0			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.451G>T	5.37:g.120021940G>T	ENSP00000385118:p.Gly151Cys		D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	NULL	p.G151C	ENST00000407149.2	37	c.451		5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038277	0.75617	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.62793	-0.6779	9	.	.	.	-0.1381	18.6986	0.91611	0.0:0.0:1.0:0.0	.	151;128	Q569H4;Q569H4-3	PRR16_HUMAN;.	C	151;128;81;81;81	ENSP00000385118:G151C;ENSP00000368869:G128C;ENSP00000421256:G81C;ENSP00000423446:G81C;ENSP00000405491:G81C	.	G	+	1	0	PRR16	120049839	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.111000	0.94308	2.709000	0.92574	0.644000	0.83932	GGC	PRR16	-	NULL	ENSG00000184838		0.488	PRR16-002	KNOWN	basic|appris_principal	protein_coding	PRR16	HGNC	protein_coding	OTTHUMT00000371059.1		0.00	48	0	G	NM_016644		120021940	+1			no_errors	ENST00000407149	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
PSMD14	10213	genome.wustl.edu	37	2	162267813	162267813	+	Splice_Site	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:162267813G>A	ENST00000409682.3	+	12	1539	c.835G>A	c.(835-837)Gac>Aac	p.D279N	5S_rRNA_ENST00000605921.1_RNA	NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	279					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						GTTCTTTTAGGACCCCAAACG	0.333																																																	0													116.0	105.0	109.0					2																	162267813		1837	4080	5917	SO:0001630	splice_region_variant	0			U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.835-1G>A	2.37:g.162267813G>A			B3KNW2|O00176	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.D279N	ENST00000409682.3	37	c.835	CCDS46437.1	2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261398	0.80358	.	.	ENSG00000115233	ENST00000409682	.	.	.	5.32	5.32	0.75619	.	0.140285	0.64402	D	0.000007	T	0.71426	0.3338	M	0.65498	2.005	0.80722	D	1	P	0.36125	0.538	P	0.46975	0.533	T	0.68727	-0.5332	8	.	.	.	.	18.9963	0.92813	0.0:0.0:1.0:0.0	.	279	O00487	PSDE_HUMAN	N	279	.	.	D	+	1	0	PSMD14	161976059	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.727000	0.98787	2.504000	0.84457	0.591000	0.81541	GAC	PSMD14	-	NULL	ENSG00000115233		0.333	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD14	HGNC	protein_coding	OTTHUMT00000332833.1	-	0.00	58	0	G	NM_005805	Missense_Mutation	162267813	+1	tier1	-	no_errors	ENST00000409682	ensembl	human	known	74_37	missense	8.82	62	6	SNP	1.000	A
PSMD1	5707	genome.wustl.edu	37	2	231927340	231927340	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:231927340G>A	ENST00000308696.6	+	4	417	c.255G>A	c.(253-255)ggG>ggA	p.G85G	PSMD1_ENST00000409643.1_Silent_p.G85G|PSMD1_ENST00000373635.4_Silent_p.G85G	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	85				G -> R (in Ref. 1; BAA07918). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TTGGAGCAGGGGACCTCTTCA	0.423																																																	0													97.0	103.0	101.0					2																	231927340		2203	4300	6503	SO:0001819	synonymous_variant	0			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.255G>A	2.37:g.231927340G>A			B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Silent	SNP	pfam_Proteasome/cyclosome_rpt,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.G85	ENST00000308696.6	37	c.255	CCDS2482.1	2																																																																																			PSMD1	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	ENSG00000173692		0.423	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	HGNC	protein_coding	OTTHUMT00000256958.2		0.00	53	0	G			231927340	+1			no_errors	ENST00000308696	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.996	A
PSMD6	9861	genome.wustl.edu	37	3	64005037	64005037	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:64005037G>A	ENST00000295901.4	-	3	572	c.432C>T	c.(430-432)ctC>ctT	p.L144L	RP11-245J9.6_ENST00000605919.1_RNA|PSMD6_ENST00000492933.1_Silent_p.L197L|PSMD6_ENST00000482510.1_Silent_p.L105L|PSMD6_ENST00000394431.2_Silent_p.L106L	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	144					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		CAATCCTAAGGAGATAGAATA	0.413																																																	0													103.0	104.0	103.0					3																	64005037		2203	4300	6503	SO:0001819	synonymous_variant	0			AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.432C>T	3.37:g.64005037G>A			A8K2E0|E9PHI9|Q6UV22	Silent	SNP	pfam_26S_proteasome_reg_su-Rpn7,pfam_PCI_dom,smart_PCI_dom	p.L144	ENST00000295901.4	37	c.432	CCDS2901.1	3																																																																																			PSMD6	-	pfam_26S_proteasome_reg_su-Rpn7	ENSG00000163636		0.413	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD6	HGNC	protein_coding	OTTHUMT00000352082.1	-	0.00	64	0	G	NM_014814		64005037	-1	tier1	-	no_errors	ENST00000295901	ensembl	human	known	74_37	silent	11.84	66	9	SNP	0.999	A
PSMG1	8624	genome.wustl.edu	37	21	40551881	40551881	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:40551881G>T	ENST00000331573.3	-	4	890	c.425C>A	c.(424-426)gCa>gAa	p.A142E	PSMG1_ENST00000380900.2_Intron	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	142					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				TTGATCTTCTGCAACATAGCA	0.378																																																	0													103.0	93.0	96.0					21																	40551881		2203	4300	6503	SO:0001583	missense	0			AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.425C>A	21.37:g.40551881G>T	ENSP00000329915:p.Ala142Glu		B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Missense_Mutation	SNP	pirsf_Proteasome_assmbl_chp_1	p.A142E	ENST00000331573.3	37	c.425	CCDS13660.1	21	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404140	0.83230	.	.	ENSG00000183527	ENST00000331573	T	0.49139	0.79	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.69504	0.3118	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66002	-0.6031	10	0.42905	T	0.14	-26.3849	19.1586	0.93522	0.0:0.0:1.0:0.0	.	142	O95456	PSMG1_HUMAN	E	142	ENSP00000329915:A142E	ENSP00000329915:A142E	A	-	2	0	PSMG1	39473751	1.000000	0.71417	0.939000	0.37840	0.968000	0.65278	6.541000	0.73865	2.873000	0.98535	0.563000	0.77884	GCA	PSMG1	-	pirsf_Proteasome_assmbl_chp_1	ENSG00000183527		0.378	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG1	HGNC	protein_coding	OTTHUMT00000141404.2	-	0.00	49	0	G	NM_003720		40551881	-1	tier1	-	no_errors	ENST00000331573	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.997	T
PTCHD2	57540	genome.wustl.edu	37	1	11596444	11596444	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:11596444G>A	ENST00000294484.6	+	21	4018	c.3880G>A	c.(3880-3882)Gtc>Atc	p.V1294I	PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1294I|PTCHD2_ENST00000304391.6_Missense_Mutation_p.R180H	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1294					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CGTGGCCATCGTCTCCAGTGC	0.657																																																	0													89.0	94.0	92.0					1																	11596444		2200	4279	6479	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3880G>A	1.37:g.11596444G>A	ENSP00000294484:p.Val1294Ile		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.V1294I	ENST00000294484.6	37	c.3880	CCDS41247.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.154759|4.154759	0.78114|0.78114	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.91407	.|-2.84;-2.84	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.87281|0.87281	0.6138|0.6138	N|N	0.13235|0.13235	0.315|0.315	0.54753|0.54753	D|D	0.999986|0.999986	.|D	.|0.54207	.|0.965	.|P	.|0.51974	.|0.686	D|D	0.86116|0.86116	0.1565|0.1565	6|10	0.87932|0.23891	D|T	0|0.37	-49.9588|-49.9588	17.0791|17.0791	0.86593|0.86593	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1294	.|Q9P2K9	.|PTHD2_HUMAN	H|I	180|1294	.|ENSP00000294484:V1294I;ENSP00000374226:V1294I	ENSP00000303400:R180H|ENSP00000294484:V1294I	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11519031|11519031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	6.263000|6.263000	0.72521|0.72521	2.256000|2.256000	0.74724|0.74724	0.655000|0.655000	0.94253|0.94253	CGT|GTC	PTCHD2	-	pfam_Patched,pfam_MMPL_dom	ENSG00000204624		0.657	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	92	0	G	XM_052561		11596444	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	14.71	58	10	SNP	1.000	A
PTGS1	5742	genome.wustl.edu	37	9	125148852	125148852	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:125148852G>T	ENST00000362012.2	+	9	1142	c.1137G>T	c.(1135-1137)gaG>gaT	p.E379D	AL162424.1_ENST00000600713.1_Intron|PTGS1_ENST00000373698.5_Missense_Mutation_p.E270D|PTGS1_ENST00000540753.1_Missense_Mutation_p.E354D|PTGS1_ENST00000223423.4_Missense_Mutation_p.E379D	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	379					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.E379D(1)		large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTGCCATGGAGTTCAACCATC	0.537																																																	1	Substitution - Missense(1)	lung(1)											221.0	206.0	211.0					9																	125148852		2203	4300	6503	SO:0001583	missense	0			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1137G>T	9.37:g.125148852G>T	ENSP00000354612:p.Glu379Asp		A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_EG-like_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.E379D	ENST00000362012.2	37	c.1137	CCDS6842.1	9	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601584	0.87055	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.04	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.63139	-0.6704	10	0.87932	D	0	-27.2112	11.6194	0.51108	0.0873:0.0:0.9127:0.0	.	354;379;379	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	D	354;379;379;270	ENSP00000437709:E354D;ENSP00000354612:E379D;ENSP00000223423:E379D;ENSP00000362802:E270D	ENSP00000223423:E379D	E	+	3	2	PTGS1	124188673	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.137000	0.58010	1.084000	0.41184	0.563000	0.77884	GAG	PTGS1	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000095303		0.537	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS1	HGNC	protein_coding	OTTHUMT00000053933.1		0.00	70	0	G			125148852	+1			no_errors	ENST00000362012	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
PTGS1	5742	genome.wustl.edu	37	9	125154752	125154752	+	Missense_Mutation	SNP	G	G	A	rs533328230		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:125154752G>A	ENST00000362012.2	+	11	1734	c.1729G>A	c.(1729-1731)Gtt>Att	p.V577I	PTGS1_ENST00000373698.5_Missense_Mutation_p.V468I|PTGS1_ENST00000540753.1_Missense_Mutation_p.V515I|PTGS1_ENST00000223423.4_Missense_Mutation_p.V540I	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	577					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTGTCCCTACGTTTCCTTCCG	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		20183	0.0		0.0	False		,,,				2504	0.001																0													103.0	91.0	95.0					9																	125154752		2203	4300	6503	SO:0001583	missense	0			M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1729G>A	9.37:g.125154752G>A	ENSP00000354612:p.Val577Ile		A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_EG-like_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.V577I	ENST00000362012.2	37	c.1729	CCDS6842.1	9	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681997	0.68042	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000373698	T;T;T;T	0.09911	2.93;2.93;2.93;2.93	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	M	0.70903	2.155	0.80722	D	1	D;P;P	0.89917	1.0;0.934;0.925	D;B;B	0.91635	0.999;0.321;0.411	T	0.00875	-1.1531	10	0.39692	T	0.17	-17.8951	18.5257	0.90971	0.0:0.0:1.0:0.0	.	515;577;540	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	I	515;577;540;468	ENSP00000437709:V515I;ENSP00000354612:V577I;ENSP00000223423:V540I;ENSP00000362802:V468I	ENSP00000223423:V540I	V	+	1	0	PTGS1	124194573	1.000000	0.71417	0.895000	0.35142	0.633000	0.38033	6.766000	0.74970	2.620000	0.88729	0.655000	0.94253	GTT	PTGS1	-	superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000095303		0.582	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS1	HGNC	protein_coding	OTTHUMT00000053933.1	-	0.00	80	0	G			125154752	+1	tier1	-	no_errors	ENST00000362012	ensembl	human	known	74_37	missense	15.38	44	8	SNP	1.000	A
PTGDS	5730	genome.wustl.edu	37	9	139874722	139874722	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:139874722T>C	ENST00000371625.3	+	5	610	c.536T>C	c.(535-537)tTc>tCc	p.F179S	LCNL1_ENST00000408973.2_5'Flank|PTGDS_ENST00000224167.2_Missense_Mutation_p.F213S	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)	179					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACCATTGTCTTCCTGCCCCAA	0.592																																																	0													71.0	68.0	69.0					9																	139874722		2203	4300	6503	SO:0001583	missense	0			AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.536T>C	9.37:g.139874722T>C	ENSP00000360687:p.Phe179Ser		B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_PstgldnD_synth	p.F213S	ENST00000371625.3	37	c.638	CCDS7019.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	18.02|18.02	3.530556|3.530556	0.64860|0.64860	.|.	.|.	ENSG00000107317|ENSG00000107317	ENST00000224167;ENST00000371625|ENST00000444903	T;T|.	0.07908|.	3.15;3.15|.	5.07|5.07	5.07|5.07	0.68467|0.68467	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);|.	0.082122|.	0.49305|.	D|.	0.000148|.	T|T	0.71787|0.71787	0.3381|0.3381	M|M	0.83012|0.83012	2.62|2.62	0.34466|0.34466	D|D	0.702334|0.702334	P|.	0.44627|.	0.839|.	P|.	0.48400|.	0.576|.	T|T	0.81924|0.81924	-0.0710|-0.0710	10|5	0.72032|.	D|.	0.01|.	0.3952|0.3952	12.202|12.202	0.54331|0.54331	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	179|.	P41222|.	PTGDS_HUMAN|.	S|P	213;179|6	ENSP00000224167:F213S;ENSP00000360687:F179S|.	ENSP00000224167:F213S|.	F|S	+|+	2|1	0|0	PTGDS|PTGDS	138994543|138994543	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.571000|0.571000	0.35966|0.35966	3.438000|3.438000	0.52871|0.52871	1.923000|1.923000	0.55706|0.55706	0.529000|0.529000	0.55759|0.55759	TTC|TCC	PTGDS	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000107317		0.592	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	HGNC	protein_coding	OTTHUMT00000055188.1	-	0.00	124	0	T	NM_000954		139874722	+1	tier1	-	no_errors	ENST00000224167	ensembl	human	known	74_37	missense	5.97	126	8	SNP	1.000	C
PTP4A1	7803	genome.wustl.edu	37	6	64289213	64289213	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:64289213A>C	ENST00000370651.3	+	5	1534	c.381A>C	c.(379-381)gaA>gaC	p.E127D	PTP4A1_ENST00000370650.2_Intron	NM_003463.3	NP_003454.1	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1	127	Interaction with ATF5. {ECO:0000250}.|Tyrosine-protein phosphatase.				cell cycle (GO:0007049)|multicellular organismal development (GO:0007275)|positive regulation of cell migration (GO:0030335)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			large_intestine(3)|lung(4)|skin(1)	8	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			TGAAATACGAAGATGCAGTAC	0.328																																					Pancreas(91;1019 1502 28028 38110 51645)												0													123.0	114.0	117.0					6																	64289213		2203	4299	6502	SO:0001583	missense	0			U48296	CCDS4965.1	6q12	2011-06-09			ENSG00000112245	ENSG00000112245		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9634	protein-coding gene	gene with protein product		601585				9642300	Standard	NM_003463		Approved	PTPCAAX1, PRL-1	uc003pel.3	Q93096	OTTHUMG00000014949	ENST00000370651.3:c.381A>C	6.37:g.64289213A>C	ENSP00000359685:p.Glu127Asp		B2R6C8|O00648|Q49A54	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.E127D	ENST00000370651.3	37	c.381	CCDS4965.1	6	.	.	.	.	.	.	.	.	.	.	A	17.69	3.450743	0.63290	.	.	ENSG00000112245	ENST00000370651	D	0.85702	-2.02	5.96	5.96	0.96718	Protein-tyrosine phosphatase, receptor/non-receptor type (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.80654	0.4664	M	0.66297	2.02	0.80722	D	1	B	0.21821	0.061	B	0.27608	0.081	T	0.79783	-0.1658	10	0.62326	D	0.03	-42.1022	16.4221	0.83766	1.0:0.0:0.0:0.0	.	127	Q93096	TP4A1_HUMAN	D	127	ENSP00000359685:E127D	ENSP00000359685:E127D	E	+	3	2	PTP4A1	64347172	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	6.325000	0.72901	2.283000	0.76528	0.477000	0.44152	GAA	PTP4A1	-	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	ENSG00000112245		0.328	PTP4A1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A1	HGNC	protein_coding	OTTHUMT00000041083.2	-	0.00	64	0	A			64289213	+1	tier1	-	no_errors	ENST00000370651	ensembl	human	known	74_37	missense	11.59	61	8	SNP	1.000	C
PTPN13	5783	genome.wustl.edu	37	4	87693997	87693997	+	Silent	SNP	T	T	G	rs574873739	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:87693997T>G	ENST00000411767.2	+	32	5298	c.5235T>G	c.(5233-5235)gcT>gcG	p.A1745A	PTPN13_ENST00000316707.6_Silent_p.A1554A|PTPN13_ENST00000511467.1_Silent_p.A1750A|PTPN13_ENST00000436978.1_Silent_p.A1750A|PTPN13_ENST00000427191.2_Silent_p.A1726A			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1745	Poly-Ser.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAGAATCTGCTTCCTCTAGTT	0.393																																																	0													138.0	131.0	133.0					4																	87693997		1839	4087	5926	SO:0001819	synonymous_variant	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5235T>G	4.37:g.87693997T>G			B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A1750	ENST00000411767.2	37	c.5250	CCDS47094.1	4																																																																																			PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.393	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	81	0	T			87693997	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	silent	29.63	38	16	SNP	0.002	G
PTPN4	5775	genome.wustl.edu	37	2	120704130	120704130	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:120704130C>T	ENST00000263708.2	+	18	2407	c.1636C>T	c.(1636-1638)Cga>Tga	p.R546*	PTPN4_ENST00000544261.1_Nonsense_Mutation_p.R179*	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	546	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GATTGTGTCTCGAGTAGCACC	0.279																																																	0													101.0	99.0	100.0					2																	120704130		2203	4300	6503	SO:0001587	stop_gained	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1636C>T	2.37:g.120704130C>T	ENSP00000263708:p.Arg546*		B2RBV8|Q9UDA7	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R546*	ENST00000263708.2	37	c.1636	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434706	0.83885	.	.	ENSG00000088179	ENST00000263708;ENST00000544261;ENST00000431283	.	.	.	4.94	4.0	0.46444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1242	0.48308	0.3668:0.6332:0.0:0.0	.	.	.	.	X	546;179;172	.	ENSP00000263708:R546X	R	+	1	2	PTPN4	120420600	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	2.099000	0.41767	2.421000	0.82119	0.591000	0.81541	CGA	PTPN4	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_PDZ	ENSG00000088179		0.279	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	-	0.00	70	0	C			120704130	+1	tier1	-	no_errors	ENST00000263708	ensembl	human	known	74_37	nonsense	34.67	49	26	SNP	1.000	T
PTPRS	5802	genome.wustl.edu	37	19	5265039	5265039	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:5265039C>T	ENST00000587303.1	-	4	647	c.548G>A	c.(547-549)cGc>cAc	p.R183H	PTPRS_ENST00000592099.1_Missense_Mutation_p.R183H|PTPRS_ENST00000348075.2_Missense_Mutation_p.R183H|PTPRS_ENST00000262963.6_Missense_Mutation_p.R183H|PTPRS_ENST00000372412.4_Missense_Mutation_p.R183H|PTPRS_ENST00000353284.2_Missense_Mutation_p.R183H|PTPRS_ENST00000357368.4_Missense_Mutation_p.R183H|PTPRS_ENST00000588012.1_Missense_Mutation_p.R183H|PTPRS_ENST00000588552.1_5'UTR			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	183	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CTGTTTGATGCGTCCATTGCT	0.617																																																	0													140.0	99.0	112.0					19																	5265039		2203	4300	6503	SO:0001583	missense	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.548G>A	19.37:g.5265039C>T	ENSP00000467537:p.Arg183His		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.R183H	ENST00000587303.1	37	c.548	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419066	0.62622	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.69806	1.29;-0.43;-0.43;0.7;0.7	3.31	3.31	0.37934	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000014	T	0.80025	0.4548	M	0.71581	2.175	0.38319	D	0.943483	D;P;D;D;D;D	0.89917	0.97;0.946;1.0;0.999;1.0;1.0	P;B;D;P;D;D	0.97110	0.497;0.376;0.995;0.901;1.0;0.997	D	0.85144	0.0982	10	0.87932	D	0	.	15.1718	0.72878	0.0:1.0:0.0:0.0	.	183;183;183;183;183;209	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	H	209;183;183;183;183;183;183;183;183;183	ENSP00000361489:R183H;ENSP00000349932:R183H;ENSP00000262963:R183H;ENSP00000269907:R183H;ENSP00000327313:R183H	ENSP00000262963:R183H	R	-	2	0	PTPRS	5216039	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	7.514000	0.81750	1.871000	0.54225	0.561000	0.74099	CGC	PTPRS	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000105426		0.617	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	-	0.00	46	0	C			5265039	-1	tier1	-	no_errors	ENST00000372412	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
PTPRT	11122	genome.wustl.edu	37	20	40944511	40944511	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:40944511A>C	ENST00000373187.1	-	12	1990	c.1991T>G	c.(1990-1992)tTt>tGt	p.F664C	PTPRT_ENST00000373201.1_Missense_Mutation_p.F664C|PTPRT_ENST00000373184.1_Missense_Mutation_p.F664C|PTPRT_ENST00000373198.4_Missense_Mutation_p.F664C|PTPRT_ENST00000356100.2_Missense_Mutation_p.F664C|PTPRT_ENST00000373193.3_Missense_Mutation_p.F664C|PTPRT_ENST00000373190.1_Missense_Mutation_p.F664C			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	664	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CTCAGCAGCAAAGTAGTGTAG	0.527																																																	0													132.0	131.0	132.0					20																	40944511		2012	4157	6169	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1991T>G	20.37:g.40944511A>C	ENSP00000362283:p.Phe664Cys		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.F664C	ENST00000373187.1	37	c.1991	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	A	19.45	3.829627	0.71258	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.36878	1.27;1.26;1.26;1.23;1.23;1.27;1.26	5.57	5.57	0.84162	.	0.105237	0.64402	D	0.000003	T	0.61578	0.2358	M	0.80847	2.515	0.53688	D	0.999972	D;D	0.71674	0.998;0.996	D;P	0.65987	0.94;0.873	T	0.67546	-0.5643	10	0.87932	D	0	.	15.7373	0.77856	1.0:0.0:0.0:0.0	.	664;664	O14522-1;O14522	.;PTPRT_HUMAN	C	664	ENSP00000362286:F664C;ENSP00000362283:F664C;ENSP00000362289:F664C;ENSP00000348408:F664C;ENSP00000362294:F664C;ENSP00000362280:F664C;ENSP00000362297:F664C	ENSP00000348408:F664C	F	-	2	0	PTPRT	40377925	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.179000	0.65043	2.120000	0.65058	0.460000	0.39030	TTT	PTPRT	-	NULL	ENSG00000196090		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	91	0	A			40944511	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	30.86	56	25	SNP	1.000	C
RAB11B	9230	genome.wustl.edu	37	19	8467047	8467047	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:8467047G>A	ENST00000328024.6	+	3	532	c.314G>A	c.(313-315)tGg>tAg	p.W105*	RAB11B_ENST00000601897.1_5'UTR|RAB11B_ENST00000594216.1_Nonsense_Mutation_p.W105*	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	105					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(1)|ovary(1)	4						GTGGAGCGCTGGCTGAAGGAG	0.632																																																	0													80.0	47.0	58.0					19																	8467047		2203	4300	6503	SO:0001587	stop_gained	0			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.314G>A	19.37:g.8467047G>A	ENSP00000333547:p.Trp105*		A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.W105*	ENST00000328024.6	37	c.314	CCDS12201.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.672994	0.96754	.	.	ENSG00000185236	ENST00000328024	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5947	0.84792	0.0:0.0:1.0:0.0	.	.	.	.	X	105	.	ENSP00000333547:W105X	W	+	2	0	RAB11B	8373047	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.657000	0.98554	2.570000	0.86706	0.561000	0.74099	TGG	RAB11B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000185236		0.632	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11B	HGNC	protein_coding	OTTHUMT00000460343.2	-	0.00	39	0	G	NM_004218		8467047	+1	tier1	-	no_errors	ENST00000328024	ensembl	human	known	74_37	nonsense	17.24	24	5	SNP	1.000	A
RAB11FIP2	22841	genome.wustl.edu	37	10	119805614	119805614	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:119805614G>T	ENST00000355624.3	-	1	500	c.61C>A	c.(61-63)Caa>Aaa	p.Q21K	RP11-354M20.3_ENST00000417968.4_RNA|RP11-354M20.3_ENST00000451610.2_RNA|CASC2_ENST00000414722.1_RNA|CASC2_ENST00000454857.1_RNA|CASC2_ENST00000426021.1_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.Q21K|CASC2_ENST00000435944.1_RNA|CASC2_ENST00000454781.1_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	21	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Necessary for its cellular translocation to the plasma membrane.				establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		TCTTTGGCTTGGAGCACTGTG	0.507																																																	0													262.0	240.0	247.0					10																	119805614		2203	4300	6503	SO:0001583	missense	0			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.61C>A	10.37:g.119805614G>T	ENSP00000347839:p.Gln21Lys		A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.Q21K	ENST00000355624.3	37	c.61	CCDS7602.1	10	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737966	0.89573	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.68025	-0.3;-0.3	4.83	4.83	0.62350	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.125778	0.56097	D	0.000034	T	0.59542	0.2201	N	0.24115	0.695	0.58432	D	0.999997	B;P	0.42456	0.423;0.78	P;P	0.47941	0.562;0.506	T	0.56038	-0.8045	10	0.24483	T	0.36	-13.3297	14.0265	0.64588	0.0:0.1512:0.8487:0.0	.	21;21	Q3I768;Q7L804	.;RFIP2_HUMAN	K	21	ENSP00000347839:Q21K;ENSP00000358200:Q21K	ENSP00000347839:Q21K	Q	-	1	0	RAB11FIP2	119795604	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.564000	0.82326	2.416000	0.81992	0.549000	0.68633	CAA	RAB11FIP2	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000107560		0.507	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP2	HGNC	protein_coding	OTTHUMT00000050583.1	-	0.00	73	0	G	NM_014904		119805614	-1	tier1	-	no_errors	ENST00000369199	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
RAB21	23011	genome.wustl.edu	37	12	72164387	72164387	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:72164387G>C	ENST00000261263.3	+	3	491	c.235G>C	c.(235-237)Gag>Cag	p.E79Q		NM_014999.2	NP_055814.1	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	79					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)	6						GGCAGGTCAAGAGAGATTCCA	0.343																																																	0													72.0	76.0	75.0					12																	72164387		2203	4300	6503	SO:0001583	missense	0			AF091035	CCDS9003.1	12q21.1	2014-09-04			ENSG00000080371	ENSG00000080371		"""RAB, member RAS oncogene"""	18263	protein-coding gene	gene with protein product		612398				10887961, 11697911, 16754960	Standard	NM_014999		Approved	KIAA0118	uc001swt.3	Q9UL25	OTTHUMG00000169572	ENST00000261263.3:c.235G>C	12.37:g.72164387G>C	ENSP00000261263:p.Glu79Gln		Q14466|Q569H3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E79Q	ENST00000261263.3	37	c.235	CCDS9003.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.177719	0.94846	.	.	ENSG00000080371	ENST00000261263	D	0.83914	-1.78	5.93	5.93	0.95920	Small GTP-binding protein domain (1);	0.093593	0.64402	D	0.000001	D	0.93983	0.8073	H	0.95950	3.745	0.80722	D	1	D	0.55800	0.973	P	0.62014	0.897	D	0.95048	0.8184	10	0.87932	D	0	-11.1732	19.949	0.97192	0.0:0.0:1.0:0.0	.	79	Q9UL25	RAB21_HUMAN	Q	79	ENSP00000261263:E79Q	ENSP00000261263:E79Q	E	+	1	0	RAB21	70450654	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.184000	0.94893	2.826000	0.97356	0.655000	0.94253	GAG	RAB21	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000080371		0.343	RAB21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB21	HGNC	protein_coding	OTTHUMT00000404855.1	-	0.00	35	0	G			72164387	+1	tier1	-	no_errors	ENST00000261263	ensembl	human	known	74_37	missense	28.00	17	7	SNP	1.000	C
RAB7A	7879	genome.wustl.edu	37	3	128526498	128526498	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:128526498G>A	ENST00000265062.3	+	5	758	c.512G>A	c.(511-513)cGg>cAg	p.R171Q	RAB7A_ENST00000485280.1_Intron|RAB7A_ENST00000482525.1_Missense_Mutation_p.R124Q	NM_004637.5	NP_004628.4	P51149	RAB7A_HUMAN	RAB7A, member RAS oncogene family	171					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|bone resorption (GO:0045453)|cell death (GO:0008219)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|epidermal growth factor catabolic process (GO:0007174)|GTP catabolic process (GO:0006184)|phagosome acidification (GO:0090383)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein targeting to lysosome (GO:0006622)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	alveolar lamellar body (GO:0097208)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(114;0.231)		ACGATTGCACGGAATGCACTT	0.577																																																	0													158.0	144.0	149.0					3																	128526498		2203	4300	6503	SO:0001583	missense	0			X93499	CCDS3052.1	3q21	2014-09-17	2007-01-15	2007-01-15	ENSG00000075785	ENSG00000075785		"""RAB, member RAS oncogene"""	9788	protein-coding gene	gene with protein product		602298	"""RAB7, member RAS oncogene family"""	RAB7		9126495, 9428630	Standard	NM_004637		Approved		uc003eks.1	P51149	OTTHUMG00000159812	ENST00000265062.3:c.512G>A	3.37:g.128526498G>A	ENSP00000265062:p.Arg171Gln		A8K3V6|Q9NWJ0|Q9UPB0	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R171Q	ENST00000265062.3	37	c.512	CCDS3052.1	3	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687634	0.68157	.	.	ENSG00000075785	ENST00000265062;ENST00000482525;ENST00000493186;ENST00000483906	T;T;D;T	0.83591	-1.18;-1.38;-1.74;-1.38	5.36	3.58	0.41010	.	.	.	.	.	T	0.74779	0.3761	L	0.35854	1.095	0.80722	D	1	B;B	0.25850	0.136;0.079	B;B	0.22601	0.04;0.019	T	0.69577	-0.5108	9	0.42905	T	0.14	-10.4107	12.0997	0.53776	0.1392:0.0:0.8608:0.0	.	124;171	C9J8S3;P51149	.;RAB7A_HUMAN	Q	171;124;62;98	ENSP00000265062:R171Q;ENSP00000417668:R124Q;ENSP00000417189:R62Q;ENSP00000417155:R98Q	ENSP00000265062:R171Q	R	+	2	0	RAB7A	130009188	1.000000	0.71417	0.884000	0.34674	0.581000	0.36288	8.674000	0.91191	0.835000	0.34877	-0.157000	0.13467	CGG	RAB7A	-	pfam_Small_GTPase,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000075785		0.577	RAB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB7A	HGNC	protein_coding	OTTHUMT00000357479.1	-	0.00	41	0	G			128526498	+1	tier1	-	no_errors	ENST00000265062	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	A
RALGAPA2	57186	genome.wustl.edu	37	20	20484080	20484080	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:20484080G>A	ENST00000202677.7	-	35	5130	c.5123C>T	c.(5122-5124)cCt>cTt	p.P1708L		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1708	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AGCATAGTAAGGGGCCGTCTG	0.522																																																	0													70.0	71.0	70.0					20																	20484080		1984	4173	6157	SO:0001583	missense	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.5123C>T	20.37:g.20484080G>A	ENSP00000202677:p.Pro1708Leu		Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.P1708L	ENST00000202677.7	37	c.5123	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.108112|5.108112	0.94292|0.94292	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000430436;ENST00000427175|ENST00000417022;ENST00000202677	.|D;D	.|0.94576	.|-3.46;-3.46	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Rap/ran-GAP (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96611|0.96611	0.8894|0.8894	L|L	0.56340|0.56340	1.77|1.77	0.80722|0.80722	D|D	1|1	.|P;D;D	.|0.89917	.|0.933;1.0;1.0	.|D;D;D	.|0.97110	.|0.958;0.999;1.0	D|D	0.96336|0.96336	0.9247|0.9247	5|10	.|0.54805	.|T	.|0.06	.|.	19.9376|19.9376	0.97146|0.97146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1546;1708;1708	.|A8MSM5;Q2PPJ7-2;Q2PPJ7	.|.;.;RGPA2_HUMAN	F|L	1525;119|138;1708	.|ENSP00000408332:P138L;ENSP00000202677:P1708L	.|ENSP00000202677:P1708L	L|P	-|-	1|2	0|0	RALGAPA2|RALGAPA2	20432080|20432080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.634000|0.634000	0.38068|0.38068	9.799000|9.799000	0.99117|0.99117	2.711000|2.711000	0.92665|0.92665	0.655000|0.655000	0.94253|0.94253	CTT|CCT	RALGAPA2	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	ENSG00000188559		0.522	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	-	0.00	53	0	G	NM_020343		20484080	-1	tier1	-	no_errors	ENST00000202677	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
RANBP17	64901	genome.wustl.edu	37	5	170722912	170722912	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:170722912A>C	ENST00000523189.1	+	27	3228	c.3064A>C	c.(3064-3066)Agt>Cgt	p.S1022R	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1022					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACTGAGAGCAAGTTTGATAAA	0.532			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	0													125.0	119.0	121.0					5																	170722912		2203	4300	6503	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.3064A>C	5.37:g.170722912A>C	ENSP00000427975:p.Ser1022Arg		Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.S1022R	ENST00000523189.1	37	c.3064	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	A	3.143	-0.175873	0.06421	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.23147	1.92	5.85	2.17	0.27698	Armadillo-like helical (1);	0.310038	0.32416	N	0.006132	T	0.18299	0.0439	L	0.39245	1.2	0.20403	N	0.999906	B	0.12013	0.005	B	0.14023	0.01	T	0.24440	-1.0160	10	0.21540	T	0.41	-1.2175	9.2114	0.37320	0.7225:0.0:0.2775:0.0	.	1022	Q9H2T7	RBP17_HUMAN	R	1022;452	ENSP00000427975:S1022R	ENSP00000427975:S1022R	S	+	1	0	RANBP17	170655517	1.000000	0.71417	0.090000	0.20809	0.135000	0.20990	3.152000	0.50677	0.141000	0.18875	0.533000	0.62120	AGT	RANBP17	-	NULL	ENSG00000204764		0.532	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	-	0.00	65	0	A	NM_022897		170722912	+1	tier1	-	no_errors	ENST00000523189	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.382	C
RAPGEF2	9693	genome.wustl.edu	37	4	160275112	160275112	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:160275112T>C	ENST00000264431.4	+	22	4501	c.4082T>C	c.(4081-4083)cTa>cCa	p.L1361P		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1361					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AGCAGTAGCCTAACGTCTGTG	0.488																																																	0													45.0	46.0	46.0					4																	160275112		1954	4174	6128	SO:0001583	missense	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.4082T>C	4.37:g.160275112T>C	ENSP00000264431:p.Leu1361Pro		D3DP27	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L1361P	ENST00000264431.4	37	c.4082	CCDS43277.1	4	.	.	.	.	.	.	.	.	.	.	T	13.48	2.249473	0.39797	.	.	ENSG00000109756	ENST00000264431	T	0.38722	1.12	6.17	6.17	0.99709	.	0.468781	0.25520	N	0.030105	T	0.26376	0.0644	N	0.08118	0	0.44547	D	0.997505	P	0.36789	0.57	B	0.33799	0.17	T	0.13308	-1.0514	10	0.42905	T	0.14	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1361	Q9Y4G8	RPGF2_HUMAN	P	1361	ENSP00000264431:L1361P	ENSP00000264431:L1361P	L	+	2	0	RAPGEF2	160494562	0.997000	0.39634	0.012000	0.15200	0.001000	0.01503	4.605000	0.61119	2.371000	0.80710	0.533000	0.62120	CTA	RAPGEF2	-	NULL	ENSG00000109756		0.488	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2		0.00	48	0	T	NM_014247		160275112	+1			no_errors	ENST00000264431	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.942	C
RASGRP4	115727	genome.wustl.edu	37	19	38905746	38905746	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:38905746A>G	ENST00000587738.1	-	9	1042	c.972T>C	c.(970-972)acT>acC	p.T324T	RASGRP4_ENST00000433821.2_Intron|RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000587753.1_Intron|RASGRP4_ENST00000293062.9_Silent_p.T227T|RASGRP4_ENST00000454404.2_Silent_p.T290T|RASGRP4_ENST00000586305.1_Silent_p.T310T			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	324	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAAGGAGCTCAGTGAGCTCCA	0.657																																																	0													8.0	10.0	10.0					19																	38905746		1950	4135	6085	SO:0001819	synonymous_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.972T>C	19.37:g.38905746A>G			A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.T324	ENST00000587738.1	37	c.972	CCDS46068.1	19																																																																																			RASGRP4	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000171777		0.657	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1		0.00	45	0	A	NM_170604		38905746	-1			no_errors	ENST00000587738	ensembl	human	known	74_37	silent	10.81	32	4	SNP	0.198	G
RBFA	79863	genome.wustl.edu	37	18	77805976	77805976	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:77805976C>T	ENST00000306735.5	+	7	991	c.853C>T	c.(853-855)Cgc>Tgc	p.R285C	RBFA_ENST00000262197.7_3'UTR|RP11-795F19.5_ENST00000564012.1_Intron|RP11-795F19.5_ENST00000569722.1_Intron	NM_024805.2	NP_079081.2	Q8N0V3	RBFA_HUMAN	ribosome binding factor A (putative)	285					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						GGCCAAGCCCCGCCTGGAGCA	0.597																																																	0													74.0	73.0	73.0					18																	77805976		2203	4300	6503	SO:0001583	missense	0			BC014195	CCDS12021.1, CCDS54194.1	18q23	2010-10-21	2010-10-21	2010-10-21	ENSG00000101546	ENSG00000101546			26120	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 22"""	C18orf22		12477932	Standard	NM_024805		Approved	FLJ21172, HsT169	uc002lns.3	Q8N0V3	OTTHUMG00000132923	ENST00000306735.5:c.853C>T	18.37:g.77805976C>T	ENSP00000305696:p.Arg285Cys		Q6PF07|Q8WZ65|Q9H776	Missense_Mutation	SNP	pfam_Ribosome-bd_facA,superfamily_Ribosome-bd_facA_dom	p.R285C	ENST00000306735.5	37	c.853	CCDS12021.1	18	.	.	.	.	.	.	.	.	.	.	C	8.145	0.786094	0.16189	.	.	ENSG00000101546	ENST00000306735	T	0.26373	1.74	4.05	-1.62	0.08372	.	1.234610	0.05732	N	0.599675	T	0.12902	0.0313	N	0.17474	0.49	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.25882	-1.0119	10	0.38643	T	0.18	-1.7111	0.8253	0.01119	0.1619:0.3662:0.1584:0.3136	.	285	Q8N0V3	RBFA_HUMAN	C	285	ENSP00000305696:R285C	ENSP00000305696:R285C	R	+	1	0	RBFA	75906964	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.210000	0.09345	-0.479000	0.06813	-0.150000	0.13652	CGC	RBFA	-	NULL	ENSG00000101546		0.597	RBFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBFA	HGNC	protein_coding	OTTHUMT00000256436.2	-	0.00	54	0	C	NM_024805		77805976	+1	tier1	-	no_errors	ENST00000306735	ensembl	human	known	74_37	missense	22.92	37	11	SNP	0.000	T
RBM27	54439	genome.wustl.edu	37	5	145610441	145610441	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:145610441C>T	ENST00000265271.5	+	6	977	c.811C>T	c.(811-813)Cga>Tga	p.R271*	RBM27_ENST00000506502.1_Nonsense_Mutation_p.R271*	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	271					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R271*(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTTTTGGTCGAAACCTACC	0.413																																																	1	Substitution - Nonsense(1)	endometrium(1)											120.0	103.0	108.0					5																	145610441		1568	3582	5150	SO:0001587	stop_gained	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.811C>T	5.37:g.145610441C>T	ENSP00000265271:p.Arg271*		Q8IYW9	Nonsense_Mutation	SNP	pfam_PWI_dom,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.R271*	ENST00000265271.5	37	c.811	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.998832	0.97990	.	.	ENSG00000091009	ENST00000265271	.	.	.	5.56	4.62	0.57501	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4267	11.1132	0.48246	0.408:0.592:0.0:0.0	.	.	.	.	X	271	.	ENSP00000265271:R271X	R	+	1	2	RBM27	145590634	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.615000	0.61190	2.614000	0.88457	0.563000	0.77884	CGA	RBM27	-	NULL	ENSG00000091009		0.413	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	-	0.00	48	0	C	XM_291128		145610441	+1	tier1	-	no_errors	ENST00000265271	ensembl	human	known	74_37	nonsense	28.57	25	10	SNP	1.000	T
REC8	9985	genome.wustl.edu	37	14	24641929	24641929	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:24641929G>T	ENST00000311457.3	+	3	663	c.64G>T	c.(64-66)Gcg>Tcg	p.A22S	REC8_ENST00000559919.1_Missense_Mutation_p.A22S			O95072	REC8_HUMAN	REC8 meiotic recombination protein	22					double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|reciprocal meiotic recombination (GO:0007131)|seminiferous tubule development (GO:0072520)|sister chromatid cohesion (GO:0007062)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)	condensed nuclear chromosome kinetochore (GO:0000778)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(265;0.00839)		CAGGCTGGCGGCGACTCGCGG	0.667																																					NSCLC(139;1764 2537 12868 49041)												0													30.0	37.0	35.0					14																	24641929		1933	4135	6068	SO:0001583	missense	0			AF006264	CCDS41932.1	14q11.2-q12	2013-08-06	2013-08-06	2007-04-03		ENSG00000100918			16879	protein-coding gene	gene with protein product		608193	"""REC8-like 1 (yeast)"", ""REC8 homolog (yeast)"""	REC8L1		10207075, 15935783, 12759374	Standard	NM_005132		Approved	Rec8p, kleisin-alpha	uc001wms.3	O95072		ENST00000311457.3:c.64G>T	14.37:g.24641929G>T	ENSP00000308699:p.Ala22Ser		A8K576|D3DS62|Q658V5|Q6IA92|Q8WUV8|Q9BTF2|Q9NVQ9	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.A22S	ENST00000311457.3	37	c.64	CCDS41932.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.648476	0.96714	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.55413	0.52	5.25	5.25	0.73442	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71367	0.3331	M	0.71871	2.18	0.42704	D	0.993627	D;D	0.89917	0.988;1.0	D;D	0.87578	0.982;0.998	T	0.73458	-0.3976	10	0.52906	T	0.07	-15.0076	15.7429	0.77914	0.0:0.0:1.0:0.0	.	22;22	O95072-2;O95072	.;REC8_HUMAN	S	22	ENSP00000308699:A22S	ENSP00000308699:A22S	A	+	1	0	REC8	23711769	1.000000	0.71417	0.232000	0.24009	0.622000	0.37654	5.156000	0.64905	2.440000	0.82611	0.561000	0.74099	GCG	REC8	-	pfam_Rad21_Rec8_N	ENSG00000100918		0.667	REC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REC8	HGNC	protein_coding	OTTHUMT00000415889.3	-	0.00	70	0	G	NM_005132		24641929	+1	tier1	-	no_errors	ENST00000311457	ensembl	human	known	74_37	missense	16.67	60	12	SNP	0.808	T
RETN	56729	genome.wustl.edu	37	19	7734758	7734758	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:7734758delG	ENST00000221515.2	+	3	258	c.170delG	c.(169-171)aggfs	p.R57fs	RETN_ENST00000381324.2_Intron	NM_001193374.1|NM_020415.3	NP_001180303.1|NP_065148.1	Q9HD89	RETN_HUMAN	resistin	57					aging (GO:0007568)|fat cell differentiation (GO:0045444)|negative regulation of feeding behavior (GO:2000252)|positive regulation of collagen metabolic process (GO:0010714)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				ovary(1)	1						GTCACCTCCAGGGGGGACCTG	0.622																																																	0													56.0	55.0	55.0					19																	7734758		2203	4300	6503	SO:0001589	frameshift_variant	0			AF205952	CCDS12182.1	19p13.2	2008-02-05				ENSG00000104918			20389	protein-coding gene	gene with protein product		605565				12050208	Standard	NM_020415		Approved	FIZZ3, ADSF, RETN1	uc002mhf.1	Q9HD89		ENST00000221515.2:c.170delG	19.37:g.7734758delG	ENSP00000221515:p.Arg57fs		D6W649|Q540D9|Q76B53	Frame_Shift_Del	DEL	pfam_Resistin,superfamily_Resistin	p.D59fs	ENST00000221515.2	37	c.170	CCDS12182.1	19																																																																																			RETN	-	pfam_Resistin,superfamily_Resistin	ENSG00000104918		0.622	RETN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETN	HGNC	protein_coding	OTTHUMT00000461731.1		0.00	46	0	G	NM_020415		7734758	+1	tier1		no_errors	ENST00000221515	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.709	-
RFX6	222546	genome.wustl.edu	37	6	117237390	117237390	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:117237390G>T	ENST00000332958.2	+	9	901	c.885G>T	c.(883-885)tgG>tgT	p.W295C	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	295					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TACACTTTTGGCAAGGAATGC	0.338																																																	0													139.0	136.0	137.0					6																	117237390		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.885G>T	6.37:g.117237390G>T	ENSP00000332208:p.Trp295Cys		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.W295C	ENST00000332958.2	37	c.885	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260337	0.80246	.	.	ENSG00000185002	ENST00000332958	T	0.63255	-0.03	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.80177	0.4575	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82675	-0.0340	10	0.87932	D	0	-8.5573	19.6354	0.95731	0.0:0.0:1.0:0.0	.	295	Q8HWS3	RFX6_HUMAN	C	295	ENSP00000332208:W295C	ENSP00000332208:W295C	W	+	3	0	RFX6	117344083	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.641000	0.89580	0.591000	0.81541	TGG	RFX6	-	NULL	ENSG00000185002		0.338	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	-	0.00	62	0	G	NM_173560		117237390	+1	tier1	-	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	T
RGMA	56963	genome.wustl.edu	37	15	93588441	93588441	+	Silent	SNP	G	G	A	rs373680871		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:93588441G>A	ENST00000329082.7	-	4	1411	c.1140C>T	c.(1138-1140)ttC>ttT	p.F380F	RGMA_ENST00000557420.1_3'UTR|RGMA_ENST00000425933.2_Silent_p.F364F|RGMA_ENST00000557301.1_Silent_p.F388F|RGMA_ENST00000556658.1_Silent_p.F271F|RGMA_ENST00000538818.1_Silent_p.F271F|RGMA_ENST00000543599.1_Silent_p.F364F|RGMA_ENST00000542321.2_Silent_p.F364F	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	380					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			TGAGGAGGTCGAAGACGCAGG	0.597																																																	0								G	,,,,,	1,4237		0,1,2118	38.0	42.0	41.0		1164,1092,1092,1092,1092,1140	1.5	1.0	15		41	0,8470		0,0,4235	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RGMA	NM_001166283.1,NM_001166286.1,NM_001166287.1,NM_001166288.1,NM_001166289.1,NM_020211.2	,,,,,	0,1,6353	AA,AG,GG		0.0,0.0236,0.0079	,,,,,	388/459,364/435,364/435,364/435,364/435,380/451	93588441	1,12707	2119	4235	6354	SO:0001819	synonymous_variant	0			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.1140C>T	15.37:g.93588441G>A			B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Silent	SNP	pfam_RGM_N,pfam_RGM_C	p.F380	ENST00000329082.7	37	c.1140	CCDS45357.1	15																																																																																			RGMA	-	pfam_RGM_C	ENSG00000182175		0.597	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGMA	HGNC	protein_coding	OTTHUMT00000415091.1	-	0.00	51	0	G	NM_020211		93588441	-1	tier1	-	no_errors	ENST00000329082	ensembl	human	known	74_37	silent	8.33	66	6	SNP	0.998	A
RIMS1	22999	genome.wustl.edu	37	6	73108705	73108705	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:73108705A>G	ENST00000521978.1	+	33	4769	c.4769A>G	c.(4768-4770)aAg>aGg	p.K1590R	RIMS1_ENST00000491071.2_Missense_Mutation_p.K1379R|RIMS1_ENST00000520567.1_Missense_Mutation_p.K1240R|RIMS1_ENST00000538414.1_Missense_Mutation_p.K396R|RIMS1_ENST00000348717.5_Missense_Mutation_p.K1373R|RIMS1_ENST00000517960.1_Missense_Mutation_p.K1373R|RIMS1_ENST00000523963.1_Missense_Mutation_p.K715R|RIMS1_ENST00000517827.1_Missense_Mutation_p.K724R|RIMS1_ENST00000264839.7_Missense_Mutation_p.K1439R|RIMS1_ENST00000414192.2_Missense_Mutation_p.K117R|RIMS1_ENST00000401910.3_Missense_Mutation_p.K910R|RIMS1_ENST00000518273.1_Missense_Mutation_p.K1269R|RIMS1_ENST00000425662.2_Missense_Mutation_p.K658R|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000522291.1_Missense_Mutation_p.K1189R	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1590	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TGTATAGCCAAGAAGAAGACA	0.343																																																	0													106.0	103.0	104.0					6																	73108705		1822	4085	5907	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4769A>G	6.37:g.73108705A>G	ENSP00000428417:p.Lys1590Arg		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.K1590R	ENST00000521978.1	37	c.4769	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	29.4|29.4	5.006352|5.006352	0.93287|0.93287	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192|ENST00000522211	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.70282|.	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47|.	5.37|5.37	5.37|5.37	0.77165|0.77165	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|T	0.72653|0.72653	0.3487|0.3487	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89917|.	0.965;0.999;0.988;0.999;0.978;1.0;0.992;1.0;0.978;0.992;0.974;0.997;0.99|.	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.97110|.	0.93;1.0;0.992;0.992;0.913;0.999;0.92;0.999;0.913;0.946;0.965;0.98;0.976|.	T|T	0.75966|0.75966	-0.3131|-0.3131	10|5	0.87932|.	D|.	0|.	-30.3756|-30.3756	15.6586|15.6586	0.77162|0.77162	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	214;396;724;715;1439;910;1189;493;1269;1373;666;1379;1590|.	B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	R|G	1379;1439;1379;1373;1269;1189;1439;1373;1269;1240;1189;1590;910;715;658;724;638;396;117|508	ENSP00000430101:K1379R;ENSP00000275037:K1373R;ENSP00000264839:K1439R;ENSP00000429959:K1373R;ENSP00000430408:K1269R;ENSP00000430502:K1240R;ENSP00000430932:K1189R;ENSP00000428417:K1590R;ENSP00000385649:K910R;ENSP00000428328:K715R;ENSP00000411235:K658R;ENSP00000428367:K724R;ENSP00000359448:K638R;ENSP00000439730:K396R;ENSP00000402273:K117R|.	ENSP00000264839:K1439R|.	K|R	+|+	2|1	0|2	RIMS1|RIMS1	73165426|73165426	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	9.212000|9.212000	0.95126|0.95126	2.157000|2.157000	0.67596|0.67596	0.482000|0.482000	0.46254|0.46254	AAG|AGA	RIMS1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000079841		0.343	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	77	0	A			73108705	+1	tier1	-	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	11.67	53	7	SNP	1.000	G
RIMS2	9699	genome.wustl.edu	37	8	104780597	104780597	+	Intron	SNP	A	A	C	rs562758510	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:104780597A>C	ENST00000406091.3	+	3	698					NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTTTATGAGAAGCATATGGCC	0.463										HNSCC(12;0.0054)																																							0																																										SO:0001627	intron_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.698+1832A>C	8.37:g.104780597A>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	SNP	-	NULL	ENST00000406091.3	37	NULL	CCDS55269.1	8																																																																																			RIMS2	-	-	ENSG00000176406		0.463	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		-	0.00	22	0	A	NM_001100117		104780597	+1	tier1	-	no_errors	ENST00000395361	ensembl	human	known	74_37	rna	24.14	22	7	SNP	1.000	C
RIMS2	9699	genome.wustl.edu	37	8	105263839	105263839	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:105263839T>C	ENST00000436393.2	+	28	4136	c.3895T>C	c.(3895-3897)Tgg>Cgg	p.W1299R	RIMS2_ENST00000507740.1_Missense_Mutation_p.W1095R|RIMS2_ENST00000406091.3_Missense_Mutation_p.W1281R|RIMS2_ENST00000262231.10_Missense_Mutation_p.W1120R|RIMS2_ENST00000339750.2_Missense_Mutation_p.W217R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1343	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GATCATCGTCTGGGGAGATTA	0.363										HNSCC(12;0.0054)																																							0													120.0	117.0	118.0					8																	105263839		1878	4138	6016	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3895T>C	8.37:g.105263839T>C	ENSP00000390665:p.Trp1299Arg		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.W1281R	ENST00000436393.2	37	c.3841		8	.	.	.	.	.	.	.	.	.	.	T	16.29	3.081447	0.55753	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.64	5.64	0.86602	.	.	.	.	.	D	0.90758	0.7099	M	0.93062	3.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.92948	0.6378	9	0.87932	D	0	.	15.8494	0.78916	0.0:0.0:0.0:1.0	.	1299;1120;1095;1281	D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	.;.;.;.	R	1318;1281;1343;1120;1095;1299;217;217	ENSP00000384892:W1281R;ENSP00000262231:W1120R;ENSP00000423559:W1095R;ENSP00000390665:W1299R;ENSP00000428478:W217R;ENSP00000342051:W217R	ENSP00000262231:W1120R	W	+	1	0	RIMS2	105333015	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.031000	0.88826	2.148000	0.66965	0.533000	0.62120	TGG	RIMS2	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000176406		0.363	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	54	0	T	NM_001100117		105263839	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	C
RIN2	54453	genome.wustl.edu	37	20	19981543	19981543	+	Frame_Shift_Del	DEL	T	T	-	rs555805677		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:19981543delT	ENST00000255006.6	+	12	2947	c.2798delT	c.(2797-2799)attfs	p.I933fs	RIN2_ENST00000440354.2_Frame_Shift_Del_p.I451fs|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	884					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						TATGGCATCATTTTCCAGAAC	0.532																																																	0													61.0	63.0	62.0					20																	19981543		1990	4170	6160	SO:0001589	frameshift_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2798delT	20.37:g.19981543delT	ENSP00000255006:p.Ile933fs		Q00425|Q5TFT8|Q9BQL3|Q9H071	Frame_Shift_Del	DEL	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.F934fs	ENST00000255006.6	37	c.2798	CCDS56182.1	20																																																																																			RIN2	-	NULL	ENSG00000132669		0.532	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1		0.00	46	0	T			19981543	+1	tier1		no_errors	ENST00000255006	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.631	-
RNASEH2A	10535	genome.wustl.edu	37	19	12918292	12918292	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:12918292C>T	ENST00000221486.4	+	4	477	c.383C>T	c.(382-384)gCa>gTa	p.A128V		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	128					DNA replication (GO:0006260)|mismatch repair (GO:0006298)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	metal ion binding (GO:0046872)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14						ATACAGTATGCATTGGACCAG	0.478																																																	0													137.0	118.0	124.0					19																	12918292		2203	4300	6503	SO:0001583	missense	0			Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889	3.1.26.-		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""			9789007, 16845400	Standard	NM_006397		Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.383C>T	19.37:g.12918292C>T	ENSP00000221486:p.Ala128Val		B2RCY1|Q96F11	Missense_Mutation	SNP	pfam_RNase_HII/HIII_dom,superfamily_RNaseH-like_dom,tigrfam_RNase_H2_suA	p.A128V	ENST00000221486.4	37	c.383	CCDS12282.1	19	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977822	0.53720	.	.	ENSG00000104889	ENST00000221486	D	0.83075	-1.68	4.67	3.63	0.41609	Ribonuclease HII/HIII domain (1);Ribonuclease H-like (1);	0.058129	0.64402	D	0.000002	T	0.67011	0.2848	N	0.25144	0.715	0.80722	D	1	B	0.27166	0.17	B	0.24269	0.052	T	0.60198	-0.7310	10	0.02654	T	1	-6.6926	11.598	0.50986	0.0:0.9102:0.0:0.0898	.	128	O75792	RNH2A_HUMAN	V	128	ENSP00000221486:A128V	ENSP00000221486:A128V	A	+	2	0	RNASEH2A	12779292	1.000000	0.71417	0.036000	0.18154	0.880000	0.50808	5.307000	0.65762	0.946000	0.37632	0.400000	0.26472	GCA	RNASEH2A	-	pfam_RNase_HII/HIII_dom,superfamily_RNaseH-like_dom,tigrfam_RNase_H2_suA	ENSG00000104889		0.478	RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH2A	HGNC	protein_coding	OTTHUMT00000451507.1	-	0.00	49	0	C	NM_006397		12918292	+1	tier1	-	no_errors	ENST00000221486	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.990	T
RLN3	117579	genome.wustl.edu	37	19	14139096	14139096	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:14139096C>T	ENST00000431365.2	+	1	137	c.80C>T	c.(79-81)gCa>gTa	p.A27V	RLN3_ENST00000585987.1_Missense_Mutation_p.A27V|CTB-55O6.4_ENST00000590528.1_RNA	NM_080864.2	NP_543140.1	Q8WXF3	REL3_HUMAN	relaxin 3	27						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5						GAGGCCCGGGCAGCGCCTTAC	0.647																																																	0													46.0	50.0	48.0					19																	14139096		2203	4300	6503	SO:0001583	missense	0			AF447451	CCDS12302.1	19p13.2	2013-02-26	2004-11-15					"""Endogenous ligands"""	17135	protein-coding gene	gene with protein product	"""prorelaxin H3"""	606855	"""relaxin 3 (H3)"""				Standard	NM_080864		Approved	ZINS4, RXN3, H3	uc002mxw.1	Q8WXF3		ENST00000431365.2:c.80C>T	19.37:g.14139096C>T	ENSP00000397415:p.Ala27Val		Q6UXW5	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Insulin_family	p.A27V	ENST00000431365.2	37	c.80	CCDS12302.1	19	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397914	0.42512	.	.	ENSG00000171136	ENST00000431365	D	0.84660	-1.88	4.57	2.23	0.28157	Insulin-like (1);	0.750480	0.12232	N	0.487379	T	0.75845	0.3905	N	0.24115	0.695	0.09310	N	1	B;B	0.21905	0.062;0.062	B;B	0.16722	0.016;0.01	T	0.66952	-0.5793	10	0.59425	D	0.04	-2.4709	11.5779	0.50875	0.0:0.6532:0.3468:0.0	.	27;27	B2RU28;Q8WXF3	.;REL3_HUMAN	V	27	ENSP00000397415:A27V	ENSP00000397415:A27V	A	+	2	0	RLN3	14000096	0.000000	0.05858	0.032000	0.17829	0.242000	0.25591	-0.203000	0.09438	0.888000	0.36160	0.491000	0.48974	GCA	RLN3	-	superfamily_Insulin-like	ENSG00000171136		0.647	RLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN3	HGNC	protein_coding	OTTHUMT00000458529.1	-	0.00	141	0	C			14139096	+1	tier1	-	no_errors	ENST00000431365	ensembl	human	known	74_37	missense	14.16	95	16	SNP	0.001	T
RNF5	6048	genome.wustl.edu	37	6	32147865	32147865	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:32147865C>T	ENST00000375094.3	+	5	565	c.407C>T	c.(406-408)aCc>aTc	p.T136I	AGPAT1_ENST00000375104.2_5'Flank|RNF5_ENST00000427134.2_Missense_Mutation_p.T136I|AGPAT1_ENST00000395497.1_5'Flank|AGPAT1_ENST00000490711.1_5'Flank|AGPAT1_ENST00000336984.6_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	136					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T136I(3)		endometrium(1)|lung(7)|urinary_tract(2)	10						TTTTTCACCACCGTCTTCAAT	0.557																																																	3	Substitution - Missense(3)	lung(3)											151.0	153.0	152.0					6																	32147865		1511	2709	4220	SO:0001583	missense	0			U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.407C>T	6.37:g.32147865C>T	ENSP00000364235:p.Thr136Ile		A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T136I	ENST00000375094.3	37	c.407	CCDS4745.1	6	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403896	0.83230	.	.	ENSG00000204308	ENST00000375094;ENST00000427134	D;D	0.93604	-3.25;-3.25	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	L	0.47716	1.5	0.58432	D	0.999999	B	0.33345	0.409	B	0.27715	0.082	D	0.86266	0.1658	10	0.37606	T	0.19	-2.0092	16.9524	0.86249	0.0:1.0:0.0:0.0	.	136	Q99942	RNF5_HUMAN	I	136	ENSP00000364235:T136I;ENSP00000407656:T136I	ENSP00000364235:T136I	T	+	2	0	RNF5	32255843	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.897000	0.75671	2.666000	0.90696	0.655000	0.94253	ACC	RNF5	-	NULL	ENSG00000204308		0.557	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF5	HGNC	protein_coding	OTTHUMT00000076133.2		0.00	44	0	C	NM_006913		32147865	+1			no_errors	ENST00000427134	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77626728	77626728	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:77626728C>G	ENST00000461745.1	+	15	3191	c.2291C>G	c.(2290-2292)cCt>cGt	p.P764R	ROBO2_ENST00000487694.3_Missense_Mutation_p.P780R|ROBO2_ENST00000332191.8_Missense_Mutation_p.P764R	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	764	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATCCTCCTCCTCCAGATCAC	0.483																																																	0													84.0	84.0	84.0					3																	77626728		1895	4109	6004	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2291C>G	3.37:g.77626728C>G	ENSP00000417164:p.Pro764Arg		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P764R	ENST00000461745.1	37	c.2291	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979692	0.92982	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.56776	0.44;0.44;0.44	5.66	5.66	0.87406	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.45867	D	0.000339	T	0.70116	0.3187	M	0.90145	3.09	0.46336	D	0.998996	P;P;P	0.44986	0.847;0.707;0.847	P;P;P	0.46917	0.531;0.464;0.531	T	0.76721	-0.2855	9	0.62326	D	0.03	.	19.7501	0.96265	0.0:1.0:0.0:0.0	.	780;764;764	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	R	780;780;784;764;764;485	ENSP00000417335:P780R;ENSP00000417164:P764R;ENSP00000327536:P764R	ENSP00000327536:P764R	P	+	2	0	ROBO2	77709418	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.818000	0.86416	2.667000	0.90743	0.491000	0.48974	CCT	ROBO2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000185008		0.483	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	-	0.00	49	0	C	XM_031246		77626728	+1	tier1	-	no_errors	ENST00000461745	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	G
ROBO1	6091	genome.wustl.edu	37	3	78685023	78685023	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:78685023G>A	ENST00000464233.1	-	23	3386	c.3273C>T	c.(3271-3273)agC>agT	p.S1091S	ROBO1_ENST00000467549.1_Silent_p.S991S|ROBO1_ENST00000495273.1_Silent_p.S1046S|ROBO1_ENST00000436010.2_Silent_p.S1052S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1091			S -> N (in dbSNP:rs35456279).		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CAGAGTCCCCGCTGCCATTGT	0.512																																																	0													167.0	169.0	168.0					3																	78685023		2148	4262	6410	SO:0001819	synonymous_variant	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3273C>T	3.37:g.78685023G>A			B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1091	ENST00000464233.1	37	c.3273	CCDS54611.1	3																																																																																			ROBO1	-	NULL	ENSG00000169855		0.512	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	-	0.00	82	0	G	NM_002941		78685023	-1	tier1	-	no_errors	ENST00000464233	ensembl	human	known	74_37	silent	28.89	63	26	SNP	0.115	A
RP1	6101	genome.wustl.edu	37	8	55540671	55540671	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:55540671T>G	ENST00000220676.1	+	4	4377	c.4229T>G	c.(4228-4230)cTt>cGt	p.L1410R		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1410					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GAAGCAGAACTTGATAAGAAA	0.343																																					Colon(91;1014 1389 7634 14542 40420)												0													51.0	57.0	55.0					8																	55540671		2199	4298	6497	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4229T>G	8.37:g.55540671T>G	ENSP00000220676:p.Leu1410Arg			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L1410R	ENST00000220676.1	37	c.4229	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	4.998	0.185387	0.09495	.	.	ENSG00000104237	ENST00000220676	T	0.21932	1.98	5.48	4.33	0.51752	.	0.790403	0.11116	N	0.597998	T	0.15825	0.0381	L	0.27053	0.805	0.09310	N	1	B	0.32693	0.38	B	0.32465	0.146	T	0.22487	-1.0215	10	0.72032	D	0.01	-0.064	7.4679	0.27332	0.0:0.0997:0.0:0.9003	.	1410	P56715	RP1_HUMAN	R	1410	ENSP00000220676:L1410R	ENSP00000220676:L1410R	L	+	2	0	RP1	55703224	0.000000	0.05858	0.005000	0.12908	0.091000	0.18340	-0.212000	0.09319	0.923000	0.37045	0.533000	0.62120	CTT	RP1	-	NULL	ENSG00000104237		0.343	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	42	0	T	NM_006269		55540671	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.003	G
RPS6KC1	26750	genome.wustl.edu	37	1	213414381	213414381	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:213414381A>G	ENST00000366960.3	+	11	1712	c.1562A>G	c.(1561-1563)cAa>cGa	p.Q521R	RPS6KC1_ENST00000543470.1_Missense_Mutation_p.Q309R|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.Q509R|RPS6KC1_ENST00000543354.1_Missense_Mutation_p.Q224R	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	521					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GAATATGGGCAAGAAAAGATT	0.403																																																	0													38.0	39.0	39.0					1																	213414381		2203	4300	6503	SO:0001583	missense	0			AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.1562A>G	1.37:g.213414381A>G	ENSP00000355927:p.Gln521Arg		B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_MIT,pfam_Phox,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Phox,pfscan_Prot_kinase_dom	p.Q521R	ENST00000366960.3	37	c.1562	CCDS1513.1	1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.251641	0.59212	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.64991	0.39;0.68;0.71;-0.13	5.59	4.47	0.54385	.	0.062472	0.64402	D	0.000004	T	0.76154	0.3948	M	0.71581	2.175	0.48571	D	0.999677	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.993;0.993	T	0.77349	-0.2621	10	0.72032	D	0.01	-2.0711	11.0517	0.47894	0.9278:0.0:0.0722:0.0	.	309;521;509	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	R	309;521;509;224	ENSP00000442306:Q309R;ENSP00000355927:Q521R;ENSP00000355926:Q509R;ENSP00000439282:Q224R	ENSP00000355926:Q509R	Q	+	2	0	RPS6KC1	211481004	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	5.713000	0.68415	0.972000	0.38314	0.377000	0.23210	CAA	RPS6KC1	-	NULL	ENSG00000136643		0.403	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	RPS6KC1	HGNC	protein_coding	OTTHUMT00000089690.3		0.00	21	0	A	NM_012424		213414381	+1			no_errors	ENST00000366960	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	G
RSPO4	343637	genome.wustl.edu	37	20	941070	941070	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:941070C>T	ENST00000217260.4	-	5	731	c.635G>A	c.(634-636)cGc>cAc	p.R212H	RSPO4_ENST00000400634.2_Missense_Mutation_p.R150H	NM_001029871.3	NP_001025042.2	Q2I0M5	RSPO4_HUMAN	R-spondin 4	212					Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	heparin binding (GO:0008201)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						CTTGCGTGGGCGCCGGTCCTT	0.692																																																	0													12.0	16.0	15.0					20																	941070		1895	4008	5903	SO:0001583	missense	0			AK122609	CCDS42845.1, CCDS42846.1	20p13	2014-01-30	2011-06-29	2005-08-08	ENSG00000101282	ENSG00000101282		"""Endogenous ligands"""	16175	protein-coding gene	gene with protein product		610573	"""chromosome 20 open reading frame 182"", ""R-spondin family, member 4"""	C20orf182		15469841	Standard	NM_001029871		Approved	dJ824F16.3	uc002wej.3	Q2I0M5	OTTHUMG00000031651	ENST00000217260.4:c.635G>A	20.37:g.941070C>T	ENSP00000217260:p.Arg212His		A2A2I6|Q9UGB2	Missense_Mutation	SNP	superfamily_Growth_fac_rcpt_N_dom,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.R212H	ENST00000217260.4	37	c.635	CCDS42846.1	20	.	.	.	.	.	.	.	.	.	.	c	16.04	3.009855	0.54361	.	.	ENSG00000101282	ENST00000217260;ENST00000400634	T;D	0.90133	-1.23;-2.62	4.14	3.09	0.35607	.	0.636430	0.12705	N	0.446007	D	0.90452	0.7010	L	0.29908	0.895	0.18873	N	0.999985	D;D	0.76494	0.999;0.999	D;D	0.64595	0.927;0.927	T	0.80993	-0.1134	10	0.72032	D	0.01	-20.685	9.0851	0.36577	0.0:0.7749:0.2251:0.0	.	150;212	Q2I0M5-2;Q2I0M5	.;RSPO4_HUMAN	H	212;150	ENSP00000217260:R212H;ENSP00000383475:R150H	ENSP00000217260:R212H	R	-	2	0	RSPO4	889070	0.933000	0.31639	0.660000	0.29694	0.974000	0.67602	1.641000	0.37197	2.256000	0.74724	0.556000	0.70494	CGC	RSPO4	-	NULL	ENSG00000101282		0.692	RSPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO4	HGNC	protein_coding	OTTHUMT00000077492.3	-	0.00	91	0	C	XM_297816		941070	-1	tier1	-	no_errors	ENST00000217260	ensembl	human	known	74_37	missense	35.80	51	29	SNP	0.454	T
RTCB	51493	genome.wustl.edu	37	22	32795674	32795674	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr22:32795674C>A	ENST00000216038.5	-	6	668	c.570G>T	c.(568-570)aaG>aaT	p.K190N	RTCB_ENST00000451746.2_Intron|RTCB_ENST00000476619.1_5'UTR	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase																		CGCAGTGCTCCTTGTCTTCAG	0.517																																																	0													246.0	229.0	235.0					22																	32795674		2203	4300	6503	SO:0001583	missense	0			BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.570G>T	22.37:g.32795674C>A	ENSP00000216038:p.Lys190Asn			Missense_Mutation	SNP	pfam_RtcB,superfamily_RtcB	p.K190N	ENST00000216038.5	37	c.570	CCDS13905.1	22	.	.	.	.	.	.	.	.	.	.	C	18.71	3.683068	0.68157	.	.	ENSG00000100220	ENST00000216038	T	0.30182	1.54	5.61	3.54	0.40534	.	0.042214	0.85682	D	0.000000	T	0.50820	0.1638	M	0.71036	2.16	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.48854	-0.8998	10	0.54805	T	0.06	-22.2283	10.2159	0.43168	0.0:0.7884:0.0:0.2116	.	190	Q9Y3I0	RTCB_HUMAN	N	190	ENSP00000216038:K190N	ENSP00000216038:K190N	K	-	3	2	C22orf28	31125674	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.053000	0.30442	0.737000	0.32582	-0.137000	0.14449	AAG	RTCB	-	pfam_RtcB,superfamily_RtcB	ENSG00000100220		0.517	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTCB	HGNC	protein_coding	OTTHUMT00000075188.3	-	0.00	81	0	C	NM_014306		32795674	-1	tier1	-	no_errors	ENST00000216038	ensembl	human	known	74_37	missense	15.12	73	13	SNP	1.000	A
TNFRSF6B	8771	genome.wustl.edu	37	20	62326237	62326237	+	5'Flank	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:62326237G>T	ENST00000369996.1	+	0	0				RTEL1_ENST00000370018.3_Missense_Mutation_p.A1085S|RTEL1_ENST00000360203.5_Missense_Mutation_p.A1085S|RTEL1_ENST00000318100.4_Missense_Mutation_p.A1085S|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.A1085S|RTEL1_ENST00000508582.2_Missense_Mutation_p.A1109S|RTEL1_ENST00000370003.1_Missense_Mutation_p.A330S	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			AGCGCTGACAGCCTATAAGCA	0.657																																																	0													53.0	55.0	54.0					20																	62326237		2190	4280	6470	SO:0001631	upstream_gene_variant	0			AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724		20.37:g.62326237G>T	Exception_encountered			Missense_Mutation	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A1085S	ENST00000369996.1	37	c.3253	CCDS13532.1	20	.	.	.	.	.	.	.	.	.	.	G	8.315	0.823073	0.16678	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	D;D;D;D;T	0.82984	-1.62;-1.67;-1.57;-1.62;0.76	4.76	-1.5	0.08691	.	0.859425	0.10673	N	0.647271	T	0.80974	0.4727	L	0.53249	1.67	0.09310	N	1	P;P;B;P	0.51537	0.492;0.946;0.232;0.492	B;P;B;B	0.48840	0.133;0.592;0.063;0.184	T	0.71290	-0.4637	10	0.42905	T	0.14	-7.1457	9.6744	0.40032	0.3358:0.0:0.6642:0.0	.	1109;330;1085;1085	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	S	1085;1085;1109;1085;330	ENSP00000359035:A1085S;ENSP00000322287:A1085S;ENSP00000424307:A1109S;ENSP00000353332:A1085S;ENSP00000359020:A330S	ENSP00000353332:A1085S	A	+	1	0	AL353715.1	61796681	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-1.250000	0.02885	-0.296000	0.08947	0.462000	0.41574	GCC	RTEL1	-	NULL	ENSG00000258366		0.657	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000080182.1	-	0.00	48	0	G			62326237	+1	tier1	-	no_errors	ENST00000318100	ensembl	human	known	74_37	missense	42.50	23	17	SNP	0.000	T
RYR2	6262	genome.wustl.edu	37	1	237604648	237604648	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:237604648A>G	ENST00000366574.2	+	13	1352	c.1035A>G	c.(1033-1035)gaA>gaG	p.E345E	RYR2_ENST00000542537.1_Silent_p.E329E|RYR2_ENST00000360064.6_Silent_p.E343E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	345					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAGAAAAGAAGTAGATGGCA	0.393																																																	0													147.0	141.0	143.0					1																	237604648		1854	4106	5960	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1035A>G	1.37:g.237604648A>G			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.E343	ENST00000366574.2	37	c.1029	CCDS55691.1	1																																																																																			RYR2	-	pfam_MIR_motif,superfamily_MIR_motif,smart_MIR_motif	ENSG00000198626		0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	51	0	A	NM_001035		237604648	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	43.18	25	19	SNP	0.997	G
RYR3	6263	genome.wustl.edu	37	15	33922209	33922209	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:33922209G>A	ENST00000389232.4	+	22	2818	c.2748G>A	c.(2746-2748)aaG>aaA	p.K916K	RYR3_ENST00000415757.3_Silent_p.K916K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	916	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAACTGAGAAGAACTATAACC	0.333																																																	0													92.0	84.0	86.0					15																	33922209		1837	4091	5928	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2748G>A	15.37:g.33922209G>A			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.K916	ENST00000389232.4	37	c.2748	CCDS45210.1	15																																																																																			RYR3	-	pfam_Ryanodine_rcpt	ENSG00000198838		0.333	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	56	0	G			33922209	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	15.79	32	6	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34102717	34102717	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:34102717G>A	ENST00000389232.4	+	71	10134	c.10064G>A	c.(10063-10065)cGg>cAg	p.R3355Q	RYR3_ENST00000415757.3_Missense_Mutation_p.R3350Q	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3355					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAGACAAAGCGGCGGGGAGAC	0.517																																																	0													68.0	92.0	85.0					15																	34102717		1923	4113	6036	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10064G>A	15.37:g.34102717G>A	ENSP00000373884:p.Arg3355Gln		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R3355Q	ENST00000389232.4	37	c.10064	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679638	0.88542	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T	0.72615	-0.67	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.85544	0.5721	M	0.82323	2.585	0.48135	D	0.999594	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.914	D	0.87282	0.2293	10	0.72032	D	0.01	.	18.813	0.92065	0.0:0.0:1.0:0.0	.	3350;3355	Q15413-2;Q15413	.;RYR3_HUMAN	Q	3355;3355;3350	ENSP00000373884:R3355Q	ENSP00000354735:R3350Q	R	+	2	0	RYR3	31890009	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.860000	0.86993	2.667000	0.90743	0.561000	0.74099	CGG	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.517	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	41	0	G			34102717	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
S1PR5	53637	genome.wustl.edu	37	19	10624956	10624956	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:10624956C>T	ENST00000439028.3	-	2	857	c.732G>A	c.(730-732)ccG>ccA	p.P244P	S1PR5_ENST00000333430.4_Silent_p.P244P	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	244					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	CCAGCGAGCGCGGCTTGCGAC	0.721																																																	0													11.0	11.0	11.0					19																	10624956		2148	4234	6382	SO:0001819	synonymous_variant	0			AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.732G>A	19.37:g.10624956C>T			Q6NW11	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_EDG8_S1P_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn	p.P244	ENST00000439028.3	37	c.732	CCDS12240.1	19	.	.	.	.	.	.	.	.	.	.	C	1.989	-0.432318	0.04669	.	.	ENSG00000180739	ENST00000359134	.	.	.	4.16	-8.33	0.00992	.	.	.	.	.	T	0.42517	0.1206	.	.	.	0.45025	D	0.998046	.	.	.	.	.	.	T	0.58393	-0.7644	5	0.72032	D	0.01	.	0.6725	0.00861	0.3002:0.2756:0.1089:0.3154	.	.	.	.	T	213	.	ENSP00000352045:A213T	A	-	1	0	S1PR5	10485956	0.340000	0.24792	0.635000	0.29338	0.046000	0.14306	-0.421000	0.07053	-1.041000	0.03266	-0.339000	0.08088	GCG	S1PR5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_EDG8_S1P_rcpt	ENSG00000180739		0.721	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR5	HGNC	protein_coding	OTTHUMT00000452015.1	-	0.00	45	0	C	NM_030760		10624956	-1	tier1	-	no_errors	ENST00000333430	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.206	T
SALL3	27164	genome.wustl.edu	37	18	76753580	76753580	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:76753580T>G	ENST00000537592.2	+	2	1589	c.1589T>G	c.(1588-1590)cTg>cGg	p.L530R	SALL3_ENST00000536229.3_Missense_Mutation_p.L397R|SALL3_ENST00000575389.2_Missense_Mutation_p.L530R	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	530					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGGCTGCAACTGCCGCCCACT	0.736																																																	0													14.0	12.0	13.0					18																	76753580		2182	4276	6458	SO:0001583	missense	0			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1589T>G	18.37:g.76753580T>G	ENSP00000441823:p.Leu530Arg		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L530R	ENST00000537592.2	37	c.1589	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	T	9.486	1.099493	0.20552	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.10005	2.92	5.39	5.39	0.77823	.	0.000000	0.48767	D	0.000164	T	0.36413	0.0966	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.988;0.998	T	0.21042	-1.0257	10	0.27785	T	0.31	-41.6958	15.4294	0.75081	0.0:0.0:0.0:1.0	.	262;530	F5GXY4;Q9BXA9	.;SALL3_HUMAN	R	530;530;262	ENSP00000441823:L530R	ENSP00000299466:L530R	L	+	2	0	SALL3	74854568	1.000000	0.71417	0.961000	0.40146	0.260000	0.26232	7.972000	0.88022	2.034000	0.60081	0.460000	0.39030	CTG	SALL3	-	NULL	ENSG00000256463		0.736	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	-	0.00	54	0	T	NM_171999		76753580	+1	tier1	-	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	30.77	27	12	SNP	0.999	G
SAMSN1	64092	genome.wustl.edu	37	21	15872860	15872860	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr21:15872860A>C	ENST00000400566.1	-	6	839	c.758T>G	c.(757-759)aTt>aGt	p.I253S	SAMSN1_ENST00000463807.1_5'UTR|SAMSN1_ENST00000285670.2_Missense_Mutation_p.I321S|SAMSN1_ENST00000400564.1_Missense_Mutation_p.I85S	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	253	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTGCAGATGAATCCTCTCTAG	0.433																																																	0													93.0	87.0	89.0					21																	15872860		1852	4101	5953	SO:0001583	missense	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.758T>G	21.37:g.15872860A>C	ENSP00000383411:p.Ile253Ser		B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.I253S	ENST00000400566.1	37	c.758	CCDS42906.1	21	.	.	.	.	.	.	.	.	.	.	A	23.6	4.435545	0.83885	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	D;D;D	0.88046	-2.33;-2.33;-2.33	5.63	5.63	0.86233	Src homology-3 domain (1);Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.113015	0.64402	D	0.000012	D	0.91831	0.7415	M	0.83953	2.67	0.45837	D	0.998707	D;D;D	0.63880	0.96;0.993;0.958	P;P;P	0.53649	0.677;0.731;0.678	D	0.93087	0.6496	10	0.87932	D	0	-18.7911	15.841	0.78845	1.0:0.0:0.0:0.0	.	85;321;253	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	S	321;253;85	ENSP00000285670:I321S;ENSP00000383411:I253S;ENSP00000383409:I85S	ENSP00000285670:I321S	I	-	2	0	SAMSN1	14794731	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	8.962000	0.93254	2.147000	0.66899	0.528000	0.53228	ATT	SAMSN1	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SAM,pfscan_SAM	ENSG00000155307		0.433	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157914.1	-	0.00	89	0	A			15872860	-1	tier1	-	no_errors	ENST00000400566	ensembl	human	known	74_37	missense	21.13	56	15	SNP	1.000	C
SART3	9733	genome.wustl.edu	37	12	108938242	108938242	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:108938242G>T	ENST00000228284.3	-	5	976	c.742C>A	c.(742-744)Cac>Aac	p.H248N	SART3_ENST00000552221.1_5'Flank|SART3_ENST00000431469.2_Missense_Mutation_p.H248N	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	248					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						AAAAGACTGTGGACTTTCTCA	0.453									Porokeratosis																																								0													151.0	147.0	149.0					12																	108938242		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.742C>A	12.37:g.108938242G>T	ENSP00000228284:p.His248Asn		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.H248N	ENST00000228284.3	37	c.742	CCDS9117.1	12	.	.	.	.	.	.	.	.	.	.	G	9.652	1.141736	0.21205	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000412617;ENST00000546815;ENST00000550322	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.85	4.94	0.65067	.	0.046742	0.85682	D	0.000000	T	0.26846	0.0657	L	0.42245	1.32	0.80722	D	1	B;B;B;B	0.31680	0.147;0.335;0.287;0.287	B;B;B;B	0.30943	0.056;0.122;0.057;0.113	T	0.03221	-1.1059	10	0.19147	T	0.46	-23.6633	15.1201	0.72434	0.0:0.1409:0.8591:0.0	.	196;266;248;248	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	N	248;248;196;266;116	ENSP00000228284:H248N;ENSP00000414453:H248N;ENSP00000449386:H266N;ENSP00000447324:H116N	ENSP00000228284:H248N	H	-	1	0	SART3	107462372	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.414000	0.66405	1.417000	0.47077	0.655000	0.94253	CAC	SART3	-	NULL	ENSG00000075856		0.453	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1	-	0.00	64	0	G			108938242	-1	tier1	-	no_errors	ENST00000228284	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
SATB2	23314	genome.wustl.edu	37	2	200213845	200213845	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:200213845C>T	ENST00000417098.1	-	7	1568	c.752G>A	c.(751-753)cGt>cAt	p.R251H	SATB2_ENST00000457245.1_Missense_Mutation_p.R251H|SATB2_ENST00000443023.1_Missense_Mutation_p.R192H|SATB2_ENST00000260926.5_Missense_Mutation_p.R251H|SATB2_ENST00000428695.1_Missense_Mutation_p.R133H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	251					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ATGCATTGGACGCTGGCCCAG	0.413																																					Colon(30;262 767 11040 24421 36230)												0													138.0	124.0	129.0					2																	200213845		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.752G>A	2.37:g.200213845C>T	ENSP00000401112:p.Arg251His		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.R251H	ENST00000417098.1	37	c.752	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869393	0.51588	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.47	5.47	0.80525	.	0.143132	0.46442	D	0.000290	T	0.44685	0.1305	N	0.08118	0	0.38184	D	0.939698	B;D	0.69078	0.291;0.997	B;P	0.56865	0.02;0.808	T	0.46721	-0.9171	10	0.23891	T	0.37	-9.9323	19.692	0.96007	0.0:1.0:0.0:0.0	.	133;251	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	H	251;192;251;133;251	ENSP00000401112:R251H;ENSP00000388764:R192H;ENSP00000260926:R251H;ENSP00000388581:R133H;ENSP00000405420:R251H	ENSP00000260926:R251H	R	-	2	0	SATB2	199922090	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.850000	0.62889	2.735000	0.93741	0.655000	0.94253	CGT	SATB2	-	NULL	ENSG00000119042		0.413	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	106	0	C	NM_015265		200213845	-1	tier1	-	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	5.83	97	6	SNP	1.000	T
SCARA5	286133	genome.wustl.edu	37	8	27779320	27779320	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:27779320G>A	ENST00000354914.3	-	4	1169	c.684C>T	c.(682-684)cgC>cgT	p.R228R	SCARA5_ENST00000301906.4_Silent_p.R185R|SCARA5_ENST00000524352.1_Silent_p.R228R|SCARA5_ENST00000380385.2_Intron|SCARA5_ENST00000518030.1_Silent_p.R185R	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	228					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		GGTTGAGGCCGCGCAGCACGC	0.751																																																	0													10.0	12.0	12.0					8																	27779320		2155	4194	6349	SO:0001819	synonymous_variant	0			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.684C>T	8.37:g.27779320G>A			Q6UXZ1|Q7Z4A1|Q8N4Z7	Silent	SNP	pfam_SRCR,pfam_Collagen,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.R228	ENST00000354914.3	37	c.684	CCDS6064.1	8																																																																																			SCARA5	-	NULL	ENSG00000168079		0.751	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARA5	HGNC	protein_coding	OTTHUMT00000255223.2		0.00	13	0	G	NM_173833		27779320	-1			no_errors	ENST00000354914	ensembl	human	known	74_37	silent	25.00	15	5	SNP	0.364	A
SCN9A	6335	genome.wustl.edu	37	2	167159806	167159806	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:167159806T>G	ENST00000409435.1	-	6	694	c.695A>C	c.(694-696)aAg>aCg	p.K232T	SCN9A_ENST00000303354.6_Missense_Mutation_p.K233T|SCN9A_ENST00000409672.1_Missense_Mutation_p.K232T|SCN9A_ENST00000375387.4_Missense_Mutation_p.K233T|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	232					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TACAATTGTCTTCAGGCCTGA	0.393																																																	0													70.0	69.0	69.0					2																	167159806		2195	4299	6494	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.695A>C	2.37:g.167159806T>G	ENSP00000386330:p.Lys232Thr		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.K233T	ENST00000409435.1	37	c.698	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870220	0.91587	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12;-5.12;-5.12	6.07	6.07	0.98685	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99498	0.9821	H	0.97516	4.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.985	D	0.98117	1.0423	10	0.87932	D	0	.	16.635	0.85050	0.0:0.0:0.0:1.0	.	232;232;233	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	T	232;233;233;232;97;97	ENSP00000386306:K232T;ENSP00000364536:K233T;ENSP00000304748:K233T;ENSP00000386330:K232T;ENSP00000413212:K97T;ENSP00000393141:K97T	ENSP00000304748:K233T	K	-	2	0	SCN9A	166868052	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	8.040000	0.89188	2.330000	0.79161	0.477000	0.44152	AAG	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.393	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1		0.00	44	0	T	NM_002977		167159806	-1			no_errors	ENST00000303354	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	G
SEMA5A	9037	genome.wustl.edu	37	5	9190519	9190519	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:9190519T>G	ENST00000382496.5	-	11	1798	c.1133A>C	c.(1132-1134)aAg>aCg	p.K378T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	378	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CAGAATGAACTTCTGAGCATC	0.577																																																	0													136.0	108.0	118.0					5																	9190519		2203	4300	6503	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1133A>C	5.37:g.9190519T>G	ENSP00000371936:p.Lys378Thr		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.K378T	ENST00000382496.5	37	c.1133	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	T	19.62	3.861916	0.71949	.	.	ENSG00000112902	ENST00000382496	T	0.10763	2.84	5.75	4.6	0.57074	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.050061	0.85682	D	0.000000	T	0.11153	0.0272	L	0.28054	0.825	0.47949	D	0.999554	P	0.38148	0.62	P	0.46339	0.513	T	0.17501	-1.0367	10	0.42905	T	0.14	.	7.1859	0.25799	0.0:0.17:0.0:0.83	.	378	Q13591	SEM5A_HUMAN	T	378	ENSP00000371936:K378T	ENSP00000371936:K378T	K	-	2	0	SEMA5A	9243519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.156000	0.42310	1.017000	0.39495	0.533000	0.62120	AAG	SEMA5A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000112902		0.577	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	-	0.00	36	0	T			9190519	-1	tier1	-	no_errors	ENST00000382496	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	G
SEMA6D	80031	genome.wustl.edu	37	15	48063701	48063701	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:48063701T>G	ENST00000316364.5	+	19	3380	c.2941T>G	c.(2941-2943)Tta>Gta	p.L981V	SEMA6D_ENST00000389428.3_Missense_Mutation_p.L906V|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000389432.2_Missense_Mutation_p.L938V|SEMA6D_ENST00000536845.2_Missense_Mutation_p.L981V|SEMA6D_ENST00000389433.2_Missense_Mutation_p.L962V|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.L919V|SEMA6D_ENST00000354744.4_Missense_Mutation_p.L925V|SEMA6D_ENST00000358066.4_Missense_Mutation_p.L919V|SEMA6D_ENST00000537942.1_Missense_Mutation_p.L919V	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	981					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GCCTAAAAACTTAAACTCACC	0.473																																																	0													99.0	103.0	101.0					15																	48063701		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2941T>G	15.37:g.48063701T>G	ENSP00000324857:p.Leu981Val		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.L981V	ENST00000316364.5	37	c.2941	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	T	5.245	0.230637	0.09969	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.16324	2.37;2.36;2.36;2.35;2.37;2.37;2.37;2.37	5.8	3.52	0.40303	.	0.236955	0.36066	N	0.002820	T	0.07324	0.0185	N	0.08118	0	0.80722	D	1	B;B;B;B	0.20780	0.01;0.0;0.0;0.048	B;B;B;B	0.18871	0.007;0.003;0.003;0.023	T	0.21075	-1.0256	10	0.44086	T	0.13	.	3.5285	0.07768	0.1302:0.0714:0.15:0.6484	.	906;925;981;919	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	V	919;981;981;962;938;925;919;906	ENSP00000442040:L919V;ENSP00000446152:L981V;ENSP00000324857:L981V;ENSP00000374084:L962V;ENSP00000374083:L938V;ENSP00000346786:L925V;ENSP00000350770:L919V;ENSP00000374079:L906V	ENSP00000324857:L981V	L	+	1	2	SEMA6D	45850993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.102000	0.31050	1.032000	0.39892	0.460000	0.39030	TTA	SEMA6D	-	NULL	ENSG00000137872		0.473	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	62	0	T	NM_024966		48063701	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	G
SGSH	6448	genome.wustl.edu	37	17	78185909	78185909	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:78185909G>T	ENST00000326317.6	-	7	996	c.910C>A	c.(910-912)Cgc>Agc	p.R304S	SGSH_ENST00000534910.1_Missense_Mutation_p.R101S|SGSH_ENST00000570923.1_3'UTR|SGSH_ENST00000572208.1_5'Flank	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	304			R -> L. {ECO:0000269|PubMed:17128482}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGGCCCCAGCGTTTTGGGTGC	0.622																																																	0													76.0	63.0	67.0					17																	78185909		2203	4300	6503	SO:0001583	missense	0			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.910C>A	17.37:g.78185909G>T	ENSP00000314606:p.Arg304Ser		A8K5E2	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.R304S	ENST00000326317.6	37	c.910	CCDS11770.1	17	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854795	0.71719	.	.	ENSG00000181523	ENST00000326317;ENST00000534910	D;D	0.98493	-4.96;-4.96	4.62	4.62	0.57501	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98413	0.9472	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98660	1.0683	10	0.15952	T	0.53	-40.3214	17.0355	0.86474	0.0:0.0:1.0:0.0	.	304	P51688	SPHM_HUMAN	S	304;101	ENSP00000314606:R304S;ENSP00000437778:R101S	ENSP00000314606:R304S	R	-	1	0	SGSH	75800504	1.000000	0.71417	0.912000	0.35992	0.522000	0.34438	7.660000	0.83776	2.115000	0.64714	0.557000	0.71058	CGC	SGSH	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000181523		0.622	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSH	HGNC	protein_coding	OTTHUMT00000437695.1		0.00	46	0	G	NM_000199		78185909	-1			no_errors	ENST00000326317	ensembl	human	known	74_37	missense	8.33	55	5	SNP	0.998	T
SIGMAR1	10280	genome.wustl.edu	37	9	34636882	34636882	+	Intron	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:34636882A>G	ENST00000277010.4	-	3	519				SIGMAR1_ENST00000378892.1_Intron|SIGMAR1_ENST00000461426.1_Intron|SIGMAR1_ENST00000477726.1_Intron	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1						cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	GGAGGAAGGGAACCATGAGGA	0.572																																																	0																																										SO:0001627	intron_variant	0			BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.445+111T>C	9.37:g.34636882A>G			D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	RNA	SNP	-	NULL	ENST00000277010.4	37	NULL	CCDS6562.1	9																																																																																			SIGMAR1	-	-	ENSG00000147955		0.572	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGMAR1	HGNC	protein_coding	OTTHUMT00000052204.1	-	0.00	48	0	A	NM_005866		34636882	-1	tier1	-	no_errors	ENST00000478146	ensembl	human	known	74_37	rna	20.00	24	6	SNP	0.001	G
SIM1	6492	genome.wustl.edu	37	6	100838294	100838294	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:100838294T>G	ENST00000369208.3	-	12	3026	c.2244A>C	c.(2242-2244)caA>caC	p.Q748H	SIM1_ENST00000262901.4_Missense_Mutation_p.Q748H			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	748	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.Q748H(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CTGGGTCTGGTTGCATCCTCA	0.413																																																	1	Substitution - Missense(1)	lung(1)											168.0	160.0	163.0					6																	100838294		2203	4300	6503	SO:0001583	missense	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.2244A>C	6.37:g.100838294T>G	ENSP00000358210:p.Gln748His		Q5TDP7	Missense_Mutation	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.Q748H	ENST00000369208.3	37	c.2244	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	T	13.66	2.304644	0.40795	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.03951	3.75;3.75	6.1	4.25	0.50352	Single-minded, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.02418	0.0074	N	0.24115	0.695	0.49130	D	0.999752	P	0.50943	0.94	P	0.48030	0.564	T	0.55055	-0.8200	10	0.59425	D	0.04	.	10.5036	0.44821	0.0:0.7981:0.0:0.2019	.	748	P81133	SIM1_HUMAN	H	748	ENSP00000358210:Q748H;ENSP00000262901:Q748H	ENSP00000262901:Q748H	Q	-	3	2	SIM1	100945015	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.574000	0.23714	0.879000	0.35944	-0.182000	0.12963	CAA	SIM1	-	NULL	ENSG00000112246		0.413	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	-	0.00	89	0	T	NM_005068		100838294	-1	tier1	-	no_errors	ENST00000262901	ensembl	human	known	74_37	missense	36.14	53	30	SNP	1.000	G
SIRT6	51548	genome.wustl.edu	37	19	4175147	4175147	+	Splice_Site	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:4175147T>A	ENST00000337491.2	-	7	680	c.616A>T	c.(616-618)Aac>Tac	p.N206Y	SIRT6_ENST00000305232.6_Splice_Site_p.N179Y|SIRT6_ENST00000381935.3_Splice_Site_p.N134Y|SIRT6_ENST00000601488.1_Intron|SIRT6_ENST00000594279.1_Intron	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	206	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCGGCGTTCCTGGGGCCG	0.692																																																	0													19.0	18.0	18.0					19																	4175147		2199	4298	6497	SO:0001630	splice_region_variant	0			AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.615-1A>T	19.37:g.4175147T>A			B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.N206Y	ENST00000337491.2	37	c.616	CCDS12122.1	19	.	.	.	.	.	.	.	.	.	.	T	14.00	2.404093	0.42613	.	.	ENSG00000077463	ENST00000337491;ENST00000305232;ENST00000381935	T;T;T	0.43688	0.94;2.24;0.94	4.63	4.63	0.57726	.	0.534882	0.20065	N	0.099998	T	0.49133	0.1539	M	0.72118	2.19	0.25856	N	0.983887	B;B	0.33694	0.421;0.389	B;B	0.40477	0.044;0.33	T	0.51779	-0.8662	10	0.66056	D	0.02	-21.8784	12.8482	0.57842	0.0:0.0:0.0:1.0	.	179;206	Q8N6T7-2;Q8N6T7	.;SIRT6_HUMAN	Y	206;179;134	ENSP00000337332:N206Y;ENSP00000305310:N179Y;ENSP00000371360:N134Y	ENSP00000305310:N179Y	N	-	1	0	SIRT6	4126147	1.000000	0.71417	0.990000	0.47175	0.695000	0.40330	2.633000	0.46519	1.723000	0.51488	0.379000	0.24179	AAC	SIRT6	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	ENSG00000077463		0.692	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT6	HGNC	protein_coding	OTTHUMT00000457931.2	-	0.00	26	0	T		Missense_Mutation	4175147	-1	tier1	-	no_errors	ENST00000337491	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.991	A
SKIV2L2	23517	genome.wustl.edu	37	5	54696074	54696074	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:54696074G>A	ENST00000230640.5	+	21	2560	c.2306G>A	c.(2305-2307)cGt>cAt	p.R769H	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.R668H	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	769					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GTTCAGAAACGTTTTCCTGAC	0.343																																					Melanoma(2;92 134 23744 29976 33782)												0													58.0	60.0	59.0					5																	54696074		2203	4300	6503	SO:0001583	missense	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2306G>A	5.37:g.54696074G>A	ENSP00000230640:p.Arg769His		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R769H	ENST00000230640.5	37	c.2306	CCDS3967.1	5	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875045	0.91664	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.35789	1.29;1.34	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.72982	0.979;0.818	T	0.81940	-0.0703	10	0.87932	D	0	-26.6664	19.157	0.93516	0.0:0.0:1.0:0.0	.	668;769	F5H7E2;P42285	.;SK2L2_HUMAN	H	769;668	ENSP00000230640:R769H;ENSP00000442583:R668H	ENSP00000230640:R769H	R	+	2	0	SKIV2L2	54731831	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.259000	0.95561	2.525000	0.85131	0.655000	0.94253	CGT	SKIV2L2	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000039123		0.343	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	-	0.00	94	0	G			54696074	+1	tier1	-	no_errors	ENST00000230640	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	A
SLC15A5	729025	genome.wustl.edu	37	12	16425513	16425514	+	Frame_Shift_Ins	INS	-	-	T	rs559517803		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:16425513_16425514insT	ENST00000344941.3	-	2	564_565	c.565_566insA	c.(565-567)acgfs	p.T189fs		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	189					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						AAAAGACATCGTTTTTTGTGAT	0.441																																																	0										1,2337		0,1,1168						-10.5	0.0			111	0,4486		0,0,2243	no	frameshift	SLC15A5	NM_001170798.1		0,1,3411	A1A1,A1R,RR		0.0,0.0428,0.0147				1,6823				SO:0001589	frameshift_variant	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.566dupA	12.37:g.16425519_16425519dupT	ENSP00000340402:p.Thr189fs			Frame_Shift_Ins	INS	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt	p.T189fs	ENST00000344941.3	37	c.566_565		12																																																																																			SLC15A5	-	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.441	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2		0.00	48	0	-	XM_001129090		16425514	-1	tier1		no_errors	ENST00000344941	ensembl	human	novel	74_37	frame_shift_ins	15.62	27	5	INS	0.000:0.152	T
SLC29A4	222962	genome.wustl.edu	37	7	5336639	5336639	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:5336639C>T	ENST00000396872.3	+	7	853	c.692C>T	c.(691-693)aCg>aTg	p.T231M	SLC29A4_ENST00000406453.3_Missense_Mutation_p.T217M|SLC29A4_ENST00000297195.4_Missense_Mutation_p.T231M			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	231					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	CGCGCCAGCACGCTCATCTTC	0.662																																																	0													30.0	31.0	31.0					7																	5336639		2188	4267	6455	SO:0001583	missense	0			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.692C>T	7.37:g.5336639C>T	ENSP00000380081:p.Thr231Met		Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.T231M	ENST00000396872.3	37	c.692	CCDS5340.1	7	.	.	.	.	.	.	.	.	.	.	.	24.2	4.510106	0.85282	.	.	ENSG00000164638	ENST00000396872;ENST00000297195;ENST00000406453	T;T;T	0.80738	-1.41;-1.41;-1.41	3.45	3.45	0.39498	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.89350	0.6690	M	0.82630	2.6	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91045	0.4874	10	0.87932	D	0	-0.3632	13.4531	0.61182	0.0:1.0:0.0:0.0	.	217;231	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	M	231;231;217	ENSP00000380081:T231M;ENSP00000297195:T231M;ENSP00000385845:T217M	ENSP00000297195:T231M	T	+	2	0	SLC29A4	5303165	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	6.945000	0.75947	1.652000	0.50683	0.555000	0.69702	ACG	SLC29A4	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	ENSG00000164638		0.662	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	HGNC	protein_coding	OTTHUMT00000060118.6	-	0.00	85	0	C	NM_153247		5336639	+1	tier1	-	no_errors	ENST00000297195	ensembl	human	known	74_37	missense	10.10	89	10	SNP	0.998	T
SLC2A12	154091	genome.wustl.edu	37	6	134312398	134312400	+	In_Frame_Del	DEL	TTC	TTC	-	rs35561264		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:134312398_134312400delTTC	ENST00000275230.5	-	5	1902_1904	c.1747_1749delGAA	c.(1747-1749)gaadel	p.E583del		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	583					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TTGGCACTAATTCTTCTTGGTGA	0.399																																					Melanoma(122;1663 1672 14489 35294 41228)												0																																										SO:0001651	inframe_deletion	0			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.1747_1749delGAA	6.37:g.134312401_134312403delTTC	ENSP00000275230:p.Glu583del		B3KV17|Q7Z6U3|Q96MR8	In_Frame_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.E583in_frame_del	ENST00000275230.5	37	c.1749_1747	CCDS5169.1	6																																																																																			SLC2A12	-	NULL	ENSG00000146411		0.399	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A12	HGNC	protein_coding	OTTHUMT00000042302.1		0.00	109	0	TTC			134312400	-1	tier1		no_errors	ENST00000275230	ensembl	human	known	74_37	in_frame_del	32.11	74	35	DEL	1.000:1.000:1.000	-
SLC35F2	54733	genome.wustl.edu	37	11	107673781	107673781	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:107673781G>T	ENST00000525815.1	-	7	1305	c.885C>A	c.(883-885)atC>atA	p.I295I	SLC35F2_ENST00000429869.1_Silent_p.I295I|SLC35F2_ENST00000525071.1_Silent_p.I295I|SLC35F2_ENST00000265836.7_Silent_p.I147I|SLC35F2_ENST00000375682.4_Silent_p.I248I	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	295					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		CCGCTGTCAGGATGCCCAGGT	0.453																																																	0													91.0	88.0	89.0					11																	107673781		1984	4172	6156	SO:0001819	synonymous_variant	0				CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.885C>A	11.37:g.107673781G>T			Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Silent	SNP	pfam_SLC35_F1/F2/F6,pfam_DMT,pfam_UAA,pfam_Tpt_PEP_trans_dom	p.I295	ENST00000525815.1	37	c.885	CCDS41709.1	11																																																																																			SLC35F2	-	pfam_SLC35_F1/F2/F6,pfam_DMT,pfam_UAA,pfam_Tpt_PEP_trans_dom	ENSG00000110660		0.453	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F2	HGNC	protein_coding	OTTHUMT00000389417.1		0.00	85	0	G	NM_017515		107673781	-1			no_errors	ENST00000429869	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
SLC6A10P	386757	genome.wustl.edu	37	16	32890751	32890751	+	RNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:32890751C>T	ENST00000330048.5	-	0	3129					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		ccagcccTTACCATGCAAACC	0.627																																																	0																																												0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890751C>T				Splice_Site	SNP	-	NULL	ENST00000330048.5	37	c.NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.627	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2		0.00	147	0	C			32890751	-1			no_errors	ENST00000330048	ensembl	human	known	74_37	splice_site	7.48	99	8	SNP	1.000	T
SLC7A3	84889	genome.wustl.edu	37	X	70147798	70147798	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:70147798G>A	ENST00000374299.3	-	6	1037	c.893C>T	c.(892-894)gCg>gTg	p.A298V	SLC7A3_ENST00000298085.4_Missense_Mutation_p.A298V			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	298					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AGCAAAATACGCCAAAAAGCA	0.502																																																	0													163.0	130.0	141.0					X																	70147798		2203	4300	6503	SO:0001583	missense	0			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.893C>T	X.37:g.70147798G>A	ENSP00000363417:p.Ala298Val		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.A298V	ENST00000374299.3	37	c.893	CCDS14404.1	X	.	.	.	.	.	.	.	.	.	.	G	13.79	2.340949	0.41498	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.88431	-2.38;-2.38	5.15	4.28	0.50868	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.85405	0.5689	N	0.25380	0.74	0.80722	D	1	B	0.22851	0.076	B	0.38378	0.272	T	0.80926	-0.1164	10	0.37606	T	0.19	.	13.238	0.59982	0.0:0.0:0.8403:0.1597	.	298	Q8WY07	CTR3_HUMAN	V	298	ENSP00000363417:A298V;ENSP00000298085:A298V	ENSP00000298085:A298V	A	-	2	0	SLC7A3	70064523	1.000000	0.71417	0.854000	0.33618	0.905000	0.53344	9.489000	0.97949	1.143000	0.42306	0.468000	0.43344	GCG	SLC7A3	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000165349		0.502	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	-	0.00	21	0	G	NM_032803		70147798	-1	tier1	-	no_errors	ENST00000298085	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.998	A
SLC8A1	6546	genome.wustl.edu	37	2	40657254	40657254	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:40657254T>G	ENST00000403092.1	-	2	200	c.167A>C	c.(166-168)aAg>aCg	p.K56T	SLC8A1_ENST00000406785.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000542024.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000405269.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000542756.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000332839.4_Missense_Mutation_p.K56T|SLC8A1_ENST00000406391.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000402441.1_Missense_Mutation_p.K56T|SLC8A1_ENST00000408028.2_Missense_Mutation_p.K56T|SLC8A1_ENST00000405901.3_Missense_Mutation_p.K56T			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	56					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.K56T(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CACCCCTTTCTTACAGTAATA	0.418																																																	1	Substitution - Missense(1)	large_intestine(1)											124.0	123.0	124.0					2																	40657254		2203	4300	6503	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.167A>C	2.37:g.40657254T>G	ENSP00000384763:p.Lys56Thr		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_domain,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.K56T	ENST00000403092.1	37	c.167	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	T	10.57	1.387597	0.25031	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000542640;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024;ENST00000455476;ENST00000448531;ENST00000417271	T;T;T;T;T;T;T;T;T;T	0.29142	1.59;1.62;1.62;1.62;1.59;1.59;1.62;1.58;1.59;1.59	6.04	6.04	0.98038	.	0.378221	0.33127	N	0.005255	T	0.43500	0.1250	L	0.28504	0.86	0.46279	D	0.998962	B;D;B;B;B	0.61080	0.218;0.989;0.051;0.065;0.017	B;D;B;B;B	0.70487	0.056;0.969;0.023;0.049;0.007	T	0.32955	-0.9887	10	0.54805	T	0.06	.	14.5406	0.67990	0.0:0.0:0.0:1.0	.	56;56;56;56;56	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	T	56	ENSP00000383886:K56T;ENSP00000440727:K56T;ENSP00000384763:K56T;ENSP00000385678:K56T;ENSP00000385188:K56T;ENSP00000385535:K56T;ENSP00000332931:K56T;ENSP00000384908:K56T;ENSP00000385811:K56T;ENSP00000443515:K56T	ENSP00000332931:K56T	K	-	2	0	SLC8A1	40510758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.918000	0.63376	2.317000	0.78254	0.460000	0.39030	AAG	SLC8A1	-	prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	ENSG00000183023		0.418	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	-	0.00	40	0	T	NM_021097		40657254	-1	tier1	-	no_errors	ENST00000332839	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	G
SLCO1B3	28234	genome.wustl.edu	37	12	21011399	21011399	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:21011399A>C	ENST00000381545.3	+	5	472	c.253A>C	c.(253-255)Agt>Cgt	p.S85R	SLCO1B3_ENST00000261196.2_Missense_Mutation_p.S85R|SLCO1B3_ENST00000545880.1_3'UTR|LST3_ENST00000540229.1_Missense_Mutation_p.S85R|SLCO1B7_ENST00000554957.1_Missense_Mutation_p.S85R|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.S85R|LST3_ENST00000381541.3_Missense_Mutation_p.S85R	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	85					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TGTATTTGTAAGTTACTTTGG	0.318																																																	0													157.0	140.0	146.0					12																	21011399		2202	4299	6501	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.253A>C	12.37:g.21011399A>C	ENSP00000370956:p.Ser85Arg		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S85R	ENST00000381545.3	37	c.253	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080314	0.76528	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046;ENSG00000257046;ENSG00000205754	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000381541;ENST00000540229;ENST00000554957	T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.58;0.26;0.58	3.99	3.99	0.46301	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81380	0.4810	H	0.94964	3.605	0.51482	D	0.999925	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.86571	0.1847	10	0.87932	D	0	.	13.189	0.59700	1.0:0.0:0.0:0.0	.	85;85;85	F5H094;Q5JAR4;Q9NPD5	.;.;SO1B3_HUMAN	R	85	ENSP00000442000:S85R;ENSP00000261196:S85R;ENSP00000370956:S85R;ENSP00000451758:S85R;ENSP00000370952:S85R;ENSP00000441269:S85R;ENSP00000452013:S85R	ENSP00000370952:S85R	S	+	1	0	SLCO1B3;SLCO1B7;RP11-545J16.1	20902666	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.810000	0.91950	1.569000	0.49696	0.377000	0.23210	AGT	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.318	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	-	0.00	108	0	A	NM_019844		21011399	+1	tier1	-	no_errors	ENST00000553473	ensembl	human	known	74_37	missense	37.61	68	41	SNP	1.000	C
SLCO1B7	338821	genome.wustl.edu	37	12	21172304	21172304	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:21172304T>G	ENST00000421593.2	+	2	208	c.208T>G	c.(208-210)Ttc>Gtc	p.F70V	LST3_ENST00000540229.1_Intron|SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ACCACATTTCTTCATGGGATA	0.318																																																	0													138.0	135.0	136.0					12																	21172304		2203	4300	6503	SO:0001583	missense	0			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.208T>G	12.37:g.21172304T>G	ENSP00000394168:p.Phe70Val		Q71QF0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.F70V	ENST00000421593.2	37	c.208	CCDS44843.1	12	.	.	.	.	.	.	.	.	.	.	.	19.05	3.752787	0.69648	.	.	ENSG00000205754	ENST00000421593	T	0.38722	1.12	3.31	3.31	0.37934	.	0.097844	0.64402	D	0.000001	T	0.57051	0.2027	M	0.68593	2.085	0.80722	D	1	D	0.54047	0.964	P	0.61201	0.885	T	0.61367	-0.7077	10	0.66056	D	0.02	.	11.8252	0.52263	0.0:0.0:0.0:1.0	.	70	G3V0H7	.	V	70	ENSP00000394168:F70V	ENSP00000394168:F70V	F	+	1	0	SLCO1B7	21063571	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.398000	0.34554	1.358000	0.45922	0.413000	0.27773	TTC	SLCO1B7	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000205754		0.318	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	SLCO1B7	HGNC	protein_coding	OTTHUMT00000402066.1	-	0.00	118	0	T	NM_001009562		21172304	+1	tier1	-	no_errors	ENST00000421593	ensembl	human	known	74_37	missense	21.93	89	25	SNP	1.000	G
SLCO6A1	133482	genome.wustl.edu	37	5	101816047	101816047	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:101816047A>C	ENST00000506729.1	-	2	621	c.450T>G	c.(448-450)agT>agG	p.S150R	SLCO6A1_ENST00000379807.3_Missense_Mutation_p.S150R|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.S150R|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.S150R|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.S150R|SLCO6A1_ENST00000514551.1_Splice_Site			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AAATATCGTAACTCTTTTCCA	0.358																																																	0													127.0	128.0	128.0					5																	101816047		2203	4300	6503	SO:0001583	missense	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.450T>G	5.37:g.101816047A>C	ENSP00000421339:p.Ser150Arg		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Splice_Site	SNP	-	NULL	ENST00000506729.1	37	c.NULL	CCDS34206.1	5	.	.	.	.	.	.	.	.	.	.	A	5.845	0.340035	0.11069	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52	4.56	-1.63	0.08345	Major facilitator superfamily domain, general substrate transporter (1);	1.172060	0.06324	N	0.704955	D	0.86952	0.6057	M	0.78344	2.41	0.09310	N	1	D;D;D	0.71674	0.995;0.985;0.998	D;P;D	0.72075	0.933;0.831;0.976	T	0.72871	-0.4161	10	0.72032	D	0.01	.	4.5231	0.11969	0.453:0.1757:0.3713:0.0	.	150;150;150	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	R	150	ENSP00000421339:S150R;ENSP00000369135:S150R;ENSP00000373671:S150R;ENSP00000421990:S150R;ENSP00000369138:S150R	ENSP00000369135:S150R	S	-	3	2	SLCO6A1	101843946	0.035000	0.19736	0.019000	0.16419	0.017000	0.09413	-0.026000	0.12392	-0.201000	0.10284	0.533000	0.62120	AGT	SLCO6A1	-	-	ENSG00000205359		0.358	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	-	0.00	57	0	A	NM_173488		101816047	-1	tier1	-	no_errors	ENST00000514551	ensembl	human	known	74_37	splice_site	16.67	35	7	SNP	0.045	C
SLITRK2	84631	genome.wustl.edu	37	X	144905921	144905921	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:144905921T>G	ENST00000370490.1	+	1	6233	c.1978T>G	c.(1978-1980)Tta>Gta	p.L660V	SLITRK2_ENST00000447897.2_Missense_Mutation_p.L660V|SLITRK2_ENST00000434188.2_Missense_Mutation_p.L660V|SLITRK2_ENST00000413937.2_Missense_Mutation_p.L660V|SLITRK2_ENST00000428560.2_Missense_Mutation_p.L660V			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	660					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.L660I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TACCAACAACTTAGACGTAAG	0.458																																																	1	Substitution - Missense(1)	lung(1)											93.0	82.0	86.0					X																	144905921		2203	4300	6503	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1978T>G	X.37:g.144905921T>G	ENSP00000359521:p.Leu660Val		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L660V	ENST00000370490.1	37	c.1978	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	T	0.917	-0.717044	0.03206	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.49720	0.8;0.77;0.77;0.77;0.77;0.77	5.91	2.0	0.26442	.	0.000000	0.64402	D	0.000002	T	0.29817	0.0745	L	0.33485	1.01	0.45883	D	0.99873	B	0.10296	0.003	B	0.06405	0.002	T	0.06679	-1.0813	10	0.35671	T	0.21	-4.1788	3.5022	0.07677	0.1632:0.2818:0.0:0.5549	.	660	Q9H156	SLIK2_HUMAN	V	660	ENSP00000334374:L660V;ENSP00000411681:L660V;ENSP00000359521:L660V;ENSP00000397015:L660V;ENSP00000407347:L660V;ENSP00000412010:L660V	ENSP00000334374:L660V	L	+	1	2	SLITRK2	144713613	0.997000	0.39634	0.881000	0.34555	0.886000	0.51366	0.381000	0.20619	-0.008000	0.14320	-0.438000	0.05819	TTA	SLITRK2	-	NULL	ENSG00000185985		0.458	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	-	0.00	25	0	T	NM_032539		144905921	+1	tier1	-	no_errors	ENST00000370490	ensembl	human	known	74_37	missense	75.00	8	24	SNP	1.000	G
SLX4	84464	genome.wustl.edu	37	16	3642792	3642792	+	Silent	SNP	G	G	T	rs75184268	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:3642792G>T	ENST00000294008.3	-	11	2875	c.2235C>A	c.(2233-2235)acC>acA	p.T745T		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	745	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGGCGGCCTCGGTGCTCACGT	0.607								Direct reversal of damage																																									0													68.0	61.0	64.0					16																	3642792		2197	4300	6497	SO:0001819	synonymous_variant	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2235C>A	16.37:g.3642792G>T			Q69YT8|Q8TF15|Q96JP1	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.T745	ENST00000294008.3	37	c.2235	CCDS10506.2	16																																																																																			SLX4	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000188827		0.607	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	-	0.00	51	0	G	NM_032444		3642792	-1	tier1	-	no_errors	ENST00000294008	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.000	T
SMARCAD1	56916	genome.wustl.edu	37	4	95200104	95200104	+	Missense_Mutation	SNP	T	T	C	rs112326108		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:95200104T>C	ENST00000354268.4	+	19	2394	c.2321T>C	c.(2320-2322)gTc>gCc	p.V774A	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.V776A|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.V344A			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	774					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		ATGTGCAATGTCATGATGCAG	0.333																																																	0													104.0	99.0	101.0					4																	95200104		2203	4300	6503	SO:0001583	missense	0			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2321T>C	4.37:g.95200104T>C	ENSP00000346217:p.Val774Ala		B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_CUE,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V776A	ENST00000354268.4	37	c.2327	CCDS3639.1	4	.	.	.	.	.	.	.	.	.	.	T	14.51	2.555605	0.45487	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	6.08	4.9	0.64082	SNF2-related (1);	0.000000	0.43579	D	0.000555	T	0.63283	0.2498	L	0.35793	1.09	0.49582	D	0.999806	B;B	0.15719	0.014;0.011	B;B	0.24006	0.05;0.03	T	0.55392	-0.8148	10	0.21540	T	0.41	-2.7614	9.7452	0.40442	0.0:0.1482:0.0:0.8518	.	774;776	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	A	776;776;774;344	ENSP00000351947:V776A;ENSP00000415576:V776A;ENSP00000346217:V774A;ENSP00000423286:V344A	ENSP00000346217:V774A	V	+	2	0	SMARCAD1	95419127	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.246000	0.58740	1.127000	0.42034	0.533000	0.62120	GTC	SMARCAD1	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000163104		0.333	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMARCAD1	HGNC	protein_coding	OTTHUMT00000253583.1	-	0.00	66	0	T	NM_020159		95200104	+1	tier1	rs112326108	no_errors	ENST00000359052	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	C
SMPD2	6610	genome.wustl.edu	37	6	109763198	109763198	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:109763198C>T	ENST00000258052.3	+	4	605	c.246C>T	c.(244-246)ctC>ctT	p.L82L	PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	82					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		GCAGTGGCCTCTGTGTCTTCT	0.517																																																	0													252.0	251.0	251.0					6																	109763198		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.246C>T	6.37:g.109763198C>T			Q5TED1|Q9BWR3	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.L82	ENST00000258052.3	37	c.246	CCDS5075.1	6																																																																																			SMPD2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000135587		0.517	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD2	HGNC	protein_coding	OTTHUMT00000041755.1	-	0.00	57	0	C			109763198	+1	tier1	-	no_errors	ENST00000258052	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.996	T
JMJD4	65094	genome.wustl.edu	37	1	227921505	227921505	+	Intron	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:227921505T>C	ENST00000366758.3	-	3	692				SNAP47_ENST00000366759.4_5'Flank|JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000480897.1_3'UTR|SNAP47_ENST00000315781.5_5'Flank|JMJD4_ENST00000438896.2_Intron|SNAP47_ENST00000366760.1_Intron	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TGGCACCCACTGTGAGGCCTG	0.652																																																	0																																										SO:0001627	intron_variant	0			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.692+102A>G	1.37:g.227921505T>C			Q5TBZ1|Q5TBZ6|Q9H970	RNA	SNP	-	NULL	ENST00000366758.3	37	NULL	CCDS1561.1	1																																																																																			SNAP47	-	-	ENSG00000143740		0.652	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNAP47	HGNC	protein_coding	OTTHUMT00000091970.1	-	0.00	60	0	T	NM_023007		227921505	+1	tier1	-	no_errors	ENST00000480265	ensembl	human	known	74_37	rna	6.85	68	5	SNP	0.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25427611	25427611	+	RNA	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25427611C>T	ENST00000424208.1	+	0	272				SNHG14_ENST00000365306.1_RNA|SNORD115-8_ENST00000363856.1_RNA|SNHG14_ENST00000441592.2_RNA|SNORD115-6_ENST00000363942.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		TACGCTGAGGCCCAGTCTAGG	0.522																																																	0													256.0	269.0	265.0					15																	25427611		876	1989	2865			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25427611C>T				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.522	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	66	0	C			25427611	+1	tier1	-	no_errors	ENST00000365306	ensembl	human	known	74_37	rna	7.37	87	7	SNP	0.920	T
SNHG14	104472715	genome.wustl.edu	37	15	25430680	25430680	+	RNA	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25430680T>G	ENST00000424208.1	+	0	541				SNORD115-9_ENST00000362912.1_RNA|SNORD115-10_ENST00000365073.1_RNA|SNORD115-8_ENST00000363856.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GCGCTAAAGCTCAGGTCCTTC	0.607																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25430680T>G				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.607	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	39	0	T			25430680	+1	tier1	-	no_errors	ENST00000424208	ensembl	human	known	74_37	rna	34.62	33	18	SNP	0.000	G
SNRPN	6638	genome.wustl.edu	37	15	25219561	25219561	+	5'UTR	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25219561A>C	ENST00000400100.1	+	0	851				SNRPN_ENST00000390687.4_5'UTR|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000444203.2_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		AGAAGCATCAAGTTTTAACTG	0.438									Prader-Willi syndrome																																								0													168.0	156.0	160.0					15																	25219561		1893	4131	6024	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.-40A>C	15.37:g.25219561A>C			B3KVR1|P14648|P17135|Q0D2Q5	RNA	SNP	-	NULL	ENST00000400100.1	37	NULL	CCDS10017.1	15																																																																																			SNRPN	-	-	ENSG00000128739		0.438	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	90	0	A	NM_003097		25219561	+1	tier1	-	no_errors	ENST00000553597	ensembl	human	known	74_37	rna	32.84	45	22	SNP	0.000	C
SNRPN	6638	genome.wustl.edu	37	15	25223584	25223584	+	Missense_Mutation	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25223584G>C	ENST00000400100.1	+	13	1606	c.716G>C	c.(715-717)aGa>aCa	p.R239T	SNRPN_ENST00000390687.4_Missense_Mutation_p.R239T|SNHG14_ENST00000551631.2_RNA|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000346403.6_Missense_Mutation_p.R239T|SNRPN_ENST00000554227.2_Missense_Mutation_p.R243T|SNRPN_ENST00000577565.1_Missense_Mutation_p.R239T|SNRPN_ENST00000444203.2_Missense_Mutation_p.R243T|SNRPN_ENST00000400098.1_Missense_Mutation_p.R239T|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000400097.1_Missense_Mutation_p.R239T	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	239					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CGTCCACCAAGACCTTAGCAT	0.453									Prader-Willi syndrome																																								0													274.0	258.0	263.0					15																	25223584		1911	4124	6035	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.716G>C	15.37:g.25223584G>C	ENSP00000382972:p.Arg239Thr		B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.R243T	ENST00000400100.1	37	c.728	CCDS10017.1	15	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884395	0.51908	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	4.6	3.68	0.42216	.	0.104566	0.64402	D	0.000008	T	0.29491	0.0735	L	0.47716	1.5	0.80722	D	1	P;P	0.37781	0.608;0.608	B;B	0.32289	0.143;0.143	T	0.05305	-1.0893	10	0.21014	T	0.42	-8.3275	8.9155	0.35579	0.1027:0.0:0.8973:0.0	.	243;239	B3KVR1;P63162	.;RSMN_HUMAN	T	239;239;239;243;239;243	ENSP00000382972:R239T;ENSP00000382970:R239T;ENSP00000382969:R239T;ENSP00000452342:R243T;ENSP00000375105:R239T;ENSP00000408767:R243T	ENSP00000375105:R239T	R	+	2	0	SNRPN	22774677	1.000000	0.71417	0.729000	0.30791	0.946000	0.59487	6.504000	0.73704	1.299000	0.44798	0.591000	0.81541	AGA	SNRPN	-	pirsf_snRNP-assoc_SmB/SmN	ENSG00000128739		0.453	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	31	0	G	NM_003097		25223584	+1	tier1	-	no_errors	ENST00000444203	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25438367	25438367	+	RNA	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25438367A>G	ENST00000424208.1	+	0	1226				SNORD115-14_ENST00000363090.1_RNA|SNORD115-12_ENST00000362583.1_RNA|SNHG14_ENST00000414175.1_RNA|SNHG14_ENST00000363358.1_RNA|SNHG14_ENST00000456576.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GGTGCACTGAAGATTGGGCAC	0.597																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25438367A>G				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.597	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	49	0	A			25438367	+1	tier1	-	no_errors	ENST00000414175	ensembl	human	known	74_37	rna	10.34	52	6	SNP	0.001	G
SNTG1	54212	genome.wustl.edu	37	8	51503460	51503460	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:51503460T>G	ENST00000522124.1	+	13	1493	c.832T>G	c.(832-834)Ttt>Gtt	p.F278V	SNTG1_ENST00000276467.5_Missense_Mutation_p.F278V|SNTG1_ENST00000518864.1_Missense_Mutation_p.F278V|SNTG1_ENST00000517473.1_Missense_Mutation_p.F278V	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	278					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CAACAGAAACTTTCCTGTAAA	0.279																																																	0													22.0	23.0	23.0					8																	51503460		2188	4267	6455	SO:0001583	missense	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.832T>G	8.37:g.51503460T>G	ENSP00000429842:p.Phe278Val		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.F278V	ENST00000522124.1	37	c.832	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	T	13.58	2.279955	0.40294	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.27256	1.68;1.68;2.39;2.39	4.78	4.78	0.61160	.	0.047406	0.85682	D	0.000000	T	0.26304	0.0642	L	0.59436	1.845	0.80722	D	1	B;B	0.21821	0.061;0.035	B;B	0.23716	0.048;0.027	T	0.05115	-1.0905	10	0.40728	T	0.16	.	10.726	0.46068	0.0:0.0:0.0:1.0	.	278;278	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	V	278	ENSP00000429276:F278V;ENSP00000429842:F278V;ENSP00000431123:F278V;ENSP00000276467:F278V	ENSP00000276467:F278V	F	+	1	0	SNTG1	51666013	1.000000	0.71417	0.995000	0.50966	0.968000	0.65278	4.066000	0.57520	1.791000	0.52520	0.528000	0.53228	TTT	SNTG1	-	NULL	ENSG00000147481		0.279	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	-	0.00	111	0	T			51503460	+1	tier1	-	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	12.93	100	15	SNP	1.000	G
SOX11	6664	genome.wustl.edu	37	2	5833994	5833994	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:5833994C>T	ENST00000322002.3	+	1	1196	c.1141C>T	c.(1141-1143)Ctg>Ttg	p.L381L	AC010729.1_ENST00000455579.2_RNA|AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	381					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CGAGCAGCAGCTggggggcgg	0.662																																																	0													7.0	7.0	7.0					2																	5833994		1861	3581	5442	SO:0001819	synonymous_variant	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.1141C>T	2.37:g.5833994C>T			Q4ZFV8	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.L381	ENST00000322002.3	37	c.1141	CCDS1654.1	2																																																																																			SOX11	-	pirsf_SOX-12/11/4a	ENSG00000176887		0.662	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	47	0	C	NM_003108		5833994	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	silent	22.58	48	14	SNP	1.000	T
SPATA31A1	647060	genome.wustl.edu	37	9	39360840	39360840	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:39360840A>C	ENST00000377647.3	+	4	3107	c.3078A>C	c.(3076-3078)caA>caC	p.Q1026H		NM_001085452.1	NP_001078921.1	Q5TZJ5	S31A1_HUMAN	SPATA31 subfamily A, member 1	1026					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCCAGCCTCAAGTTTGTGCCG	0.512																																																	0													1.0	1.0	1.0					9																	39360840		216	330	546	SO:0001583	missense	0				CCDS43808.1	9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000204849	ENSG00000204849			23394	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 36"", ""family with sequence similarity 75, member A1"""	C9orf36, FAM75A1		20850414	Standard	XM_006716851		Approved	DKFZP434B204, C9orf36A, OTTHUMG00000013156		Q5TZJ5	OTTHUMG00000013156	ENST00000377647.3:c.3078A>C	9.37:g.39360840A>C	ENSP00000366875:p.Gln1026His			Missense_Mutation	SNP	NULL	p.Q1026H	ENST00000377647.3	37	c.3078	CCDS43808.1	9	.	.	.	.	.	.	.	.	.	.	A	7.963	0.747382	0.15710	.	.	ENSG00000204849	ENST00000377647	T	0.10382	2.88	1.46	0.269	0.15631	.	.	.	.	.	T	0.23926	0.0579	M	0.69358	2.11	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.10291	-1.0636	9	0.72032	D	0.01	.	3.2736	0.06891	0.7518:0.0:0.2482:0.0	.	1026	Q5TZJ5	F75A1_HUMAN	H	1026	ENSP00000366875:Q1026H	ENSP00000366875:Q1026H	Q	+	3	2	FAM75A1	39350840	0.001000	0.12720	0.001000	0.08648	0.101000	0.19017	-0.141000	0.10327	0.079000	0.16929	0.113000	0.15668	CAA	SPATA31A1	-	NULL	ENSG00000204849		0.512	SPATA31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A1	HGNC	protein_coding	OTTHUMT00000036910.1	-	0.00	39	0	A	NM_001085452		39360840	+1	tier1	-	no_errors	ENST00000377647	ensembl	human	known	74_37	missense	20.93	34	9	SNP	0.001	C
RP11-383M4.6	0	genome.wustl.edu	37	9	84547525	84547525	+	lincRNA	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:84547525A>G	ENST00000585776.1	-	0	1039				RP11-383M4.2_ENST00000427387.1_lincRNA|SPATA31D4_ENST00000341875.4_RNA																							TTCAGGGGTGAGACTAGGTCA	0.458																																																	0													8.0	8.0	8.0					9																	84547525		667	1504	2171			0																															9.37:g.84547525A>G				RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			SPATA31D4	-	-	ENSG00000189357		0.458	RP11-383M4.6-001	KNOWN	basic	lincRNA	SPATA31D4	HGNC	lincRNA	OTTHUMT00000453562.1	-	0.00	85	0	A			84547525	+1	tier1	-	no_errors	ENST00000341875	ensembl	human	known	74_37	rna	12.37	85	12	SNP	0.001	G
SPEF2	79925	genome.wustl.edu	37	5	35800171	35800171	+	Silent	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:35800171A>G	ENST00000356031.3	+	34	5086	c.4932A>G	c.(4930-4932)ggA>ggG	p.G1644G	SPEF2_ENST00000303129.4_Silent_p.G441G|SPEF2_ENST00000440995.2_Silent_p.G1639G|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1644					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCGTGGAAGGAGTCTACAGGG	0.463																																																	0													162.0	151.0	155.0					5																	35800171		1959	4148	6107	SO:0001819	synonymous_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4932A>G	5.37:g.35800171A>G			Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.G1644	ENST00000356031.3	37	c.4932	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.463	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	72	0	A	NM_144722		35800171	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	silent	50.63	39	40	SNP	0.634	G
SPRED2	200734	genome.wustl.edu	37	2	65540839	65540839	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:65540839A>T	ENST00000356388.4	-	6	1242	c.1053T>A	c.(1051-1053)taT>taA	p.Y351*	SPRED2_ENST00000443619.2_Nonsense_Mutation_p.Y348*	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	351	SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						ACATACAGTGATAGAGCATGC	0.602																																																	0													94.0	89.0	91.0					2																	65540839		2203	4300	6503	SO:0001587	stop_gained	0			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.1053T>A	2.37:g.65540839A>T	ENSP00000348753:p.Tyr351*		A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Nonsense_Mutation	SNP	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.Y351*	ENST00000356388.4	37	c.1053	CCDS33211.1	2	.	.	.	.	.	.	.	.	.	.	A	18.76	3.692717	0.68271	.	.	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087	.	.	.	5.75	-3.1	0.05315	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1819	12.5102	0.56002	0.5184:0.0:0.4816:0.0	.	.	.	.	X	351;348;366;233	.	ENSP00000348753:Y351X	Y	-	3	2	SPRED2	65394343	0.998000	0.40836	0.996000	0.52242	0.996000	0.88848	0.650000	0.24858	-0.240000	0.09696	-0.242000	0.12053	TAT	SPRED2	-	pfam_Sprouty	ENSG00000198369		0.602	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	HGNC	protein_coding	OTTHUMT00000327632.1	-	0.00	81	0	A			65540839	-1	tier1	-	no_errors	ENST00000356388	ensembl	human	known	74_37	nonsense	14.04	49	8	SNP	0.993	T
SPHKAP	80309	genome.wustl.edu	37	2	228881930	228881930	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:228881930G>A	ENST00000392056.3	-	7	3686	c.3640C>T	c.(3640-3642)Cgg>Tgg	p.R1214W	SPHKAP_ENST00000344657.5_Missense_Mutation_p.R1214W	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1214						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.R1214W(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGGCTGCTCCGTCTGGAGGAG	0.572																																																	2	Substitution - Missense(2)	prostate(2)											86.0	86.0	86.0					2																	228881930		2203	4300	6503	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3640C>T	2.37:g.228881930G>A	ENSP00000375909:p.Arg1214Trp		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.R1214W	ENST00000392056.3	37	c.3640	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665163	0.29604	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.53423	0.62;0.62	5.87	-0.27	0.12926	.	0.349867	0.30850	N	0.008747	T	0.62319	0.2418	M	0.66939	2.045	0.09310	N	1	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.71184	0.912;0.791;0.972	T	0.60556	-0.7240	10	0.87932	D	0	.	13.5188	0.61555	0.0:0.0735:0.2444:0.6821	.	245;1214;1214	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	W	1214	ENSP00000375909:R1214W;ENSP00000339886:R1214W	ENSP00000339886:R1214W	R	-	1	2	SPHKAP	228590174	0.010000	0.17322	0.000000	0.03702	0.223000	0.24884	0.296000	0.19083	-0.287000	0.09064	0.655000	0.94253	CGG	SPHKAP	-	NULL	ENSG00000153820		0.572	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1		0.00	27	0	G	NM_030623		228881930	-1			no_errors	ENST00000392056	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.002	A
STAB1	23166	genome.wustl.edu	37	3	52547774	52547774	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:52547774C>T	ENST00000321725.6	+	31	3388	c.3312C>T	c.(3310-3312)ctC>ctT	p.L1104L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1104	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGGCTGACCTCCTTGCCACCA	0.582																																																	0													106.0	87.0	93.0					3																	52547774		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3312C>T	3.37:g.52547774C>T			A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.L1104	ENST00000321725.6	37	c.3312	CCDS33768.1	3																																																																																			STAB1	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000010327		0.582	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	-	0.00	23	0	C	NM_015136		52547774	+1	tier1	-	no_errors	ENST00000321725	ensembl	human	known	74_37	silent	20.00	12	3	SNP	1.000	T
STAB2	55576	genome.wustl.edu	37	12	104098353	104098353	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:104098353C>T	ENST00000388887.2	+	36	4065	c.3861C>T	c.(3859-3861)tgC>tgT	p.C1287C		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GTAGGACATGCTCCTCAGAGC	0.373																																																	0													113.0	112.0	112.0					12																	104098353		2203	4300	6503	SO:0001819	synonymous_variant	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3861C>T	12.37:g.104098353C>T				Silent	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.C1287	ENST00000388887.2	37	c.3861	CCDS31888.1	12																																																																																			STAB2	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000136011		0.373	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	63	0	C			104098353	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	silent	16.67	45	9	SNP	0.649	T
STAMBP	10617	genome.wustl.edu	37	2	74058030	74058030	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:74058030G>A	ENST00000394070.2	+	2	550	c.47G>A	c.(46-48)aGg>aAg	p.R16K	STAMBP_ENST00000394073.1_Missense_Mutation_p.R16K|STAMBP_ENST00000536064.1_Missense_Mutation_p.R16K|STAMBP_ENST00000339566.3_Missense_Mutation_p.R16K|STAMBP_ENST00000409707.1_Missense_Mutation_p.R16K	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein	16	Interaction with CHMP3.				JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						GACCGGGTGAGGGCTCTCTCC	0.537																																																	0													71.0	68.0	69.0					2																	74058030		2203	4300	6503	SO:0001583	missense	0			BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.47G>A	2.37:g.74058030G>A	ENSP00000377633:p.Arg16Lys		B5M0B6|D6W5H7|Q3MJE7	Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.R16K	ENST00000394070.2	37	c.47	CCDS1929.1	2	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808045	0.50421	.	.	ENSG00000124356	ENST00000339566;ENST00000539933;ENST00000409707;ENST00000452725;ENST00000432295;ENST00000424659;ENST00000394073;ENST00000394070;ENST00000536064	T;T;T;T;T;T	0.49139	1.84;1.84;1.78;1.84;1.84;0.79	4.86	3.99	0.46301	.	0.000000	0.85682	D	0.000000	T	0.49236	0.1545	L	0.39326	1.205	0.80722	D	1	P	0.48589	0.912	P	0.53549	0.729	T	0.37103	-0.9720	10	0.25751	T	0.34	-8.193	12.4693	0.55777	0.0826:0.0:0.9174:0.0	.	16	O95630	STABP_HUMAN	K	16	ENSP00000344742:R16K;ENSP00000386548:R16K;ENSP00000413874:R16K;ENSP00000377636:R16K;ENSP00000377633:R16K;ENSP00000443502:R16K	ENSP00000344742:R16K	R	+	2	0	STAMBP	73911538	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.240000	0.78192	1.418000	0.47098	-0.136000	0.14681	AGG	STAMBP	-	NULL	ENSG00000124356		0.537	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBP	HGNC	protein_coding	OTTHUMT00000252048.2	-	0.00	52	0	G	NM_006463		74058030	+1	tier1	-	no_errors	ENST00000339566	ensembl	human	known	74_37	missense	28.12	46	18	SNP	1.000	A
STAT2	6773	genome.wustl.edu	37	12	56744894	56744894	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:56744894G>A	ENST00000314128.4	-	10	1045	c.1022C>T	c.(1021-1023)aCc>aTc	p.T341I	STAT2_ENST00000418572.2_Missense_Mutation_p.T337I|STAT2_ENST00000556539.1_5'Flank|STAT2_ENST00000557235.1_Missense_Mutation_p.T337I|RNU7-40P_ENST00000516397.1_RNA			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	341					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TGTTCGGACGGTGAACTTGCT	0.532																																																	0													120.0	114.0	116.0					12																	56744894		2203	4300	6503	SO:0001583	missense	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1022C>T	12.37:g.56744894G>A	ENSP00000315768:p.Thr341Ile		B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.T341I	ENST00000314128.4	37	c.1022	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543204	0.65198	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	D;D;D	0.88896	-2.44;-2.44;-2.44	4.4	2.53	0.30540	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.276731	0.35615	N	0.003094	D	0.92344	0.7571	M	0.83312	2.635	0.38164	D	0.939122	P;D;D	0.56521	0.952;0.976;0.97	P;P;P	0.59056	0.603;0.851;0.743	D	0.92224	0.5787	10	0.87932	D	0	-2.6381	8.7051	0.34349	0.088:0.1633:0.7487:0.0	.	337;337;341	B4DLC8;G3V2M6;P52630	.;.;STAT2_HUMAN	I	341;337;337	ENSP00000315768:T341I;ENSP00000450751:T337I;ENSP00000387354:T337I	ENSP00000315768:T341I	T	-	2	0	STAT2	55031161	1.000000	0.71417	0.636000	0.29352	0.901000	0.52897	5.146000	0.64845	0.603000	0.29913	0.467000	0.42956	ACC	STAT2	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000170581		0.532	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1		0.00	52	0	G	NM_005419		56744894	-1			no_errors	ENST00000314128	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.995	A
STEAP2	261729	genome.wustl.edu	37	7	89859343	89859343	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:89859343T>C	ENST00000287908.3	+	4	1571	c.1178T>C	c.(1177-1179)tTt>tCt	p.F393S	STEAP2_ENST00000394622.2_Missense_Mutation_p.F393S|STEAP2_ENST00000394629.2_Missense_Mutation_p.F393S|STEAP2_ENST00000402625.2_Missense_Mutation_p.F393S|STEAP2_ENST00000394632.1_Missense_Mutation_p.F393S|STEAP2_ENST00000394621.2_Missense_Mutation_p.F393S|STEAP2_ENST00000394626.1_Missense_Mutation_p.F393S	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	393	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					GAATTCAGTTTTATTCAGGTA	0.388																																																	0													162.0	170.0	167.0					7																	89859343		2203	4300	6503	SO:0001583	missense	0			AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.1178T>C	7.37:g.89859343T>C	ENSP00000287908:p.Phe393Ser		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.F393S	ENST00000287908.3	37	c.1178	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	T	28.0	4.883152	0.91740	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	D;D;D;D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0	5.93	5.93	0.95920	Flavoprotein transmembrane component (1);	0.000000	0.85682	D	0.000000	D	0.96241	0.8774	M	0.83384	2.64	0.80722	D	1	D;D;D	0.76494	0.994;0.996;0.999	D;D;D	0.79108	0.924;0.954;0.992	D	0.96721	0.9532	10	0.87932	D	0	-23.4371	16.3839	0.83495	0.0:0.0:0.0:1.0	.	393;393;393	G5E9C6;Q6YPB2;Q8NFT2	.;.;STEA2_HUMAN	S	393	ENSP00000287908:F393S;ENSP00000378123:F393S;ENSP00000378120:F393S;ENSP00000378128:F393S;ENSP00000378119:F393S;ENSP00000384191:F393S;ENSP00000378125:F393S	ENSP00000287908:F393S	F	+	2	0	STEAP2	89697279	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.258000	0.74832	0.533000	0.62120	TTT	STEAP2	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000157214		0.388	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	HGNC	protein_coding	OTTHUMT00000059662.4	-	0.00	60	0	T	NM_152999		89859343	+1	tier1	-	no_errors	ENST00000287908	ensembl	human	known	74_37	missense	15.91	73	14	SNP	1.000	C
SULF1	23213	genome.wustl.edu	37	8	70512986	70512986	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:70512986A>C	ENST00000260128.4	+	9	1600	c.883A>C	c.(883-885)Agg>Cgg	p.R295R	SULF1_ENST00000419716.3_Silent_p.R295R|SULF1_ENST00000402687.4_Silent_p.R295R|SULF1_ENST00000458141.2_Silent_p.R295R|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	295					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TTCTGTGGAGAGGGTAAGCAC	0.443																																																	0													152.0	146.0	148.0					8																	70512986		2203	4300	6503	SO:0001819	synonymous_variant	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.883A>C	8.37:g.70512986A>C			Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.R295	ENST00000260128.4	37	c.883	CCDS6204.1	8																																																																																			SULF1	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.443	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	76	0	A	NM_015170		70512986	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	silent	27.27	56	21	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152472789	152472789	+	Missense_Mutation	SNP	G	G	A	rs144056525	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:152472789G>A	ENST00000367255.5	-	135	24950	c.24349C>T	c.(24349-24351)Cgg>Tgg	p.R8117W	SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000354674.4_Missense_Mutation_p.R272W|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2641W|SYNE1_ENST00000448038.1_Missense_Mutation_p.R8046W|SYNE1_ENST00000539504.1_Missense_Mutation_p.R272W|SYNE1_ENST00000423061.1_Missense_Mutation_p.R8046W|SYNE1_ENST00000265368.4_Missense_Mutation_p.R8117W|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7729W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8117					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R8117W(4)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGCTGTCCCGCGCAGTCTCA	0.398										HNSCC(10;0.0054)																																							4	Substitution - Missense(4)	large_intestine(2)|pancreas(2)						G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	40.0	40.0	40.0		24136,24349	6.0	1.0	6	dbSNP_134	40	14,8586	10.5+/-38.8	1,12,4287	yes	missense,missense	SYNE1	NM_033071.3,NM_182961.3	101,101	1,12,6490	AA,AG,GG		0.1628,0.0,0.1076	probably-damaging,probably-damaging	8046/8750,8117/8798	152472789	14,12992	2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24349C>T	6.37:g.152472789G>A	ENSP00000356224:p.Arg8117Trp		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R8117W	ENST00000367255.5	37	c.24349	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348052	0.82132	0.0	0.001628	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.97	5.97	0.96955	.	0.000000	0.53938	D	0.000046	T	0.59487	0.2197	M	0.64404	1.975	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.998;0.996;0.998;0.997	T	0.58233	-0.7672	10	0.51188	T	0.08	.	15.1877	0.73016	0.0:0.0:0.8592:0.1408	.	8117;8117;8046;8046;319	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	W	8117;272;763;8046;8117;8046;7729;2641;279;274;1039;272	ENSP00000356224:R8117W;ENSP00000441052:R272W;ENSP00000356226:R763W;ENSP00000396024:R8046W;ENSP00000265368:R8117W;ENSP00000390975:R8046W;ENSP00000341887:R7729W;ENSP00000349276:R2641W;ENSP00000356220:R1039W;ENSP00000346701:R272W	ENSP00000265368:R8117W	R	-	1	2	SYNE1	152514482	1.000000	0.71417	0.972000	0.41901	0.961000	0.63080	3.000000	0.49481	2.836000	0.97738	0.655000	0.94253	CGG	SYNE1	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.398	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	48	0	G	NM_182961		152472789	-1	tier1	rs144056525	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.987	A
SYNE1	23345	genome.wustl.edu	37	6	152542686	152542686	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:152542686T>G	ENST00000367255.5	-	118	22132	c.21531A>C	c.(21529-21531)caA>caC	p.Q7177H	SYNE1_ENST00000356820.4_Missense_Mutation_p.Q1701H|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q7106H|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q7106H|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q7177H|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q6789H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7177					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAGATCATCTTGGAGATTCT	0.348										HNSCC(10;0.0054)																																							0													127.0	134.0	132.0					6																	152542686		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21531A>C	6.37:g.152542686T>G	ENSP00000356224:p.Gln7177His		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q7177H	ENST00000367255.5	37	c.21531	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	12.19	1.863366	0.32884	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.86	-0.617	0.11579	.	0.105190	0.42548	N	0.000683	T	0.14270	0.0345	L	0.33710	1.025	0.51012	D	0.999907	B;B;B;B	0.20988	0.02;0.02;0.04;0.05	B;B;B;B	0.28139	0.086;0.086;0.052;0.086	T	0.06092	-1.0846	10	0.19147	T	0.46	.	6.0486	0.19773	0.1601:0.3875:0.0:0.4524	.	7177;7177;7106;7106	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	H	7177;7106;7177;7106;6789;1701;99	ENSP00000356224:Q7177H;ENSP00000396024:Q7106H;ENSP00000265368:Q7177H;ENSP00000390975:Q7106H;ENSP00000341887:Q6789H;ENSP00000349276:Q1701H;ENSP00000356220:Q99H	ENSP00000265368:Q7177H	Q	-	3	2	SYNE1	152584379	0.896000	0.30565	0.998000	0.56505	0.669000	0.39330	-0.017000	0.12590	-0.026000	0.13895	-0.256000	0.11100	CAA	SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.348	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	49	0	T	NM_182961		152542686	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	43.75	27	21	SNP	0.993	G
SYTL4	94121	genome.wustl.edu	37	X	99930886	99930887	+	3'UTR	INS	-	-	AC	rs10623103		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:99930886_99930887insAC	ENST00000372989.1	-	0	2485_2486				SYTL4_ENST00000455616.1_3'UTR|SYTL4_ENST00000276141.6_3'UTR|SYTL4_ENST00000491602.1_5'UTR|RP11-524D16__A.3_ENST00000568809.1_RNA|SYTL4_ENST00000454200.2_3'UTR	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TACATGTTTGTacacatacaca	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.*139->GT	X.37:g.99930889_99930890dupAC			Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	RNA	INS	-	NULL	ENST00000372989.1	37	NULL	CCDS14472.1	X																																																																																			SYTL4	-	-	ENSG00000102362		0.351	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	HGNC	protein_coding	OTTHUMT00000057488.1		0.00	8	0	-	NM_080737		99930887	-1	tier1		no_errors	ENST00000491602	ensembl	human	known	74_37	rna	35.71	9	5	INS	0.041:0.081	AC
TBCD	6904	genome.wustl.edu	37	17	80895742	80895742	+	Intron	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:80895742T>G	ENST00000355528.4	+	36	3411				TBCD_ENST00000576691.1_3'UTR|TBCD_ENST00000539345.2_Missense_Mutation_p.L1101R	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D						'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AGTGCGACACTCGTGTGTGTA	0.632																																																	0																																										SO:0001627	intron_variant	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3282-183T>G	17.37:g.80895742T>G			O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.L1101R	ENST00000355528.4	37	c.3302	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	T	4.056	0.008115	0.07912	.	.	ENSG00000141556	ENST00000334614	.	.	.	0.674	-1.14	0.09741	.	.	.	.	.	T	0.17831	0.0428	.	.	.	0.09310	N	1	B	0.26775	0.159	B	0.21546	0.035	T	0.22487	-1.0215	5	.	.	.	.	.	.	.	.	1101	Q9BTW9-4	.	R	852	.	.	L	+	2	0	TBCD	78489031	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.203000	0.03019	-0.450000	0.07107	0.338000	0.21704	CTC	TBCD	-	NULL	ENSG00000141556		0.632	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	-	0.00	59	0	T	NM_005993		80895742	+1	tier1	-	no_errors	ENST00000539345	ensembl	human	novel	74_37	missense	28.95	27	11	SNP	0.001	G
TBP	6908	genome.wustl.edu	37	6	170873672	170873672	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:170873672C>A	ENST00000392092.2	+	4	816	c.537C>A	c.(535-537)gaC>gaA	p.D179E	TBP_ENST00000230354.6_Missense_Mutation_p.D179E|TBP_ENST00000540980.1_Missense_Mutation_p.D159E	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	179					cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		GTAAACTTGACCTAAAGACCA	0.328																																																	0													79.0	81.0	80.0					6																	170873672		2203	4300	6503	SO:0001583	missense	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.537C>A	6.37:g.170873672C>A	ENSP00000375942:p.Asp179Glu		B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.D179E	ENST00000392092.2	37	c.537	CCDS5315.1	6	.	.	.	.	.	.	.	.	.	.	C	15.66	2.897814	0.52227	.	.	ENSG00000112592	ENST00000421512;ENST00000392092;ENST00000540980;ENST00000230354;ENST00000392091	T;T;T;T	0.62941	-0.01;2.33;2.33;2.33	5.84	4.08	0.47627	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.70903	2.155	0.58432	D	0.999999	B	0.25521	0.128	B	0.26693	0.072	T	0.51132	-0.8744	10	0.62326	D	0.03	-12.43	9.4686	0.38829	0.0:0.7255:0.0:0.2745	.	179	P20226	TBP_HUMAN	E	179;179;159;179;156	ENSP00000400008:D179E;ENSP00000375942:D179E;ENSP00000442132:D159E;ENSP00000230354:D179E	ENSP00000230354:D179E	D	+	3	2	TBP	170715597	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.986000	0.29590	0.821000	0.34540	-0.145000	0.13849	GAC	TBP	-	pfam_TBP,prints_TBP	ENSG00000112592		0.328	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	-	0.00	53	0	C	NM_003194		170873672	+1	tier1	-	no_errors	ENST00000230354	ensembl	human	known	74_37	missense	47.37	20	18	SNP	1.000	A
TBX22	50945	genome.wustl.edu	37	X	79278078	79278078	+	Intron	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:79278078A>C	ENST00000373294.5	+	1	203				TBX22_ENST00000442340.1_Intron|TBX22_ENST00000476373.1_3'UTR|TBX22_ENST00000373291.1_5'Flank|TBX22_ENST00000373296.3_Intron	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22						multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GTGAAGGGGAAGTTTCAGCGC	0.577																																																	0																																										SO:0001627	intron_variant	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.175+135A>C	X.37:g.79278078A>C			Q5JZ06|Q96LC0|Q9HBF1	RNA	SNP	-	NULL	ENST00000373294.5	37	NULL	CCDS14445.1	X																																																																																			TBX22	-	-	ENSG00000122145		0.577	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	-	0.00	10	0	A	NM_016954		79278078	+1	tier1	-	no_errors	ENST00000476373	ensembl	human	known	74_37	rna	46.15	7	6	SNP	0.001	C
TCEAL2	140597	genome.wustl.edu	37	X	101382465	101382465	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:101382465T>G	ENST00000372780.1	+	3	882	c.663T>G	c.(661-663)acT>acG	p.T221T	TCEAL2_ENST00000329035.2_Silent_p.T221T	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						GAAGGGACACTGAAGACATTC	0.493																																																	0													65.0	71.0	69.0					X																	101382465		2129	4245	6374	SO:0001819	synonymous_variant	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.663T>G	X.37:g.101382465T>G			B2R5C7	Silent	SNP	pfam_TF_A-like/BEX-like	p.T221	ENST00000372780.1	37	c.663	CCDS14496.1	X																																																																																			TCEAL2	-	NULL	ENSG00000184905		0.493	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	-	0.00	38	0	T	NM_080390		101382465	+1	tier1	-	no_errors	ENST00000329035	ensembl	human	known	74_37	silent	39.39	20	13	SNP	0.000	G
TELO2	9894	genome.wustl.edu	37	16	1547508	1547508	+	Splice_Site	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:1547508G>C	ENST00000262319.6	+	5	1108	c.829G>C	c.(829-831)Ggg>Cgg	p.G277R		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	277					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGCCGCACTGGGGTAAGCAGC	0.687																																																	0													8.0	9.0	8.0					16																	1547508		2150	4246	6396	SO:0001630	splice_region_variant	0			AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.830+1G>C	16.37:g.1547508G>C			D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	pfam_Telomere_length_regulation_dom,superfamily_ARM-type_fold	p.G277R	ENST00000262319.6	37	c.829	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	g	0.142	-1.100979	0.01843	.	.	ENSG00000100726	ENST00000262319	T	0.32515	1.45	5.07	3.09	0.35607	.	0.153244	0.64402	N	0.000019	T	0.20292	0.0488	L	0.36672	1.1	0.46823	D	0.999218	B	0.21821	0.061	B	0.19946	0.027	T	0.05162	-1.0902	10	0.09590	T	0.72	-28.0846	9.7867	0.40681	0.1736:0.0:0.8264:0.0	.	277	Q9Y4R8	TELO2_HUMAN	R	277	ENSP00000262319:G277R	ENSP00000262319:G277R	G	+	1	0	TELO2	1487509	0.997000	0.39634	0.551000	0.28230	0.094000	0.18550	2.560000	0.45896	0.520000	0.28426	0.651000	0.88453	GGG	TELO2	-	NULL	ENSG00000100726		0.687	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2	-	0.00	42	0	G	NM_016111	Missense_Mutation	1547508	+1	tier1	-	no_errors	ENST00000262319	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.867	C
TESPA1	9840	genome.wustl.edu	37	12	55360978	55360978	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:55360978A>G	ENST00000449076.1	-	5	431	c.299T>C	c.(298-300)cTg>cCg	p.L100P	TESPA1_ENST00000316577.8_Missense_Mutation_p.L100P|TESPA1_ENST00000531122.1_5'UTR|TESPA1_ENST00000524959.1_5'UTR|TESPA1_ENST00000532804.1_5'UTR|TESPA1_ENST00000524622.1_5'UTR	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	100					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											CTCCGCTCCCAGGGTCAAGTC	0.468																																																	0													71.0	70.0	70.0					12																	55360978		1952	4141	6093	SO:0001583	missense	0			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.299T>C	12.37:g.55360978A>G	ENSP00000400892:p.Leu100Pro		B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	NULL	p.L100P	ENST00000449076.1	37	c.299	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777149	0.70107	.	.	ENSG00000135426	ENST00000449076;ENST00000316577	T;T	0.73789	-0.78;-0.78	4.94	4.94	0.65067	.	.	.	.	.	D	0.82953	0.5149	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84765	0.0764	9	0.87932	D	0	.	12.8634	0.57926	1.0:0.0:0.0:0.0	.	100	A2RU30	K0748_HUMAN	P	100	ENSP00000400892:L100P;ENSP00000312679:L100P	ENSP00000312679:L100P	L	-	2	0	KIAA0748	53647245	1.000000	0.71417	0.656000	0.29637	0.892000	0.51952	7.133000	0.77259	1.993000	0.58246	0.528000	0.53228	CTG	TESPA1	-	NULL	ENSG00000135426		0.468	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TESPA1	HGNC	protein_coding	OTTHUMT00000383822.1		0.00	41	0	A	NM_001098815		55360978	-1			no_errors	ENST00000316577	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.940	G
TG	7038	genome.wustl.edu	37	8	134042140	134042140	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:134042140C>T	ENST00000220616.4	+	41	7151	c.7111C>T	c.(7111-7113)Cga>Tga	p.R2371*	TG_ENST00000377869.1_Nonsense_Mutation_p.R2314*|TG_ENST00000519543.1_Nonsense_Mutation_p.R504*|TG_ENST00000542445.1_Nonsense_Mutation_p.R741*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2371					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.R2371*(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACCCACATCCGAGGATTTGG	0.642																																																	1	Substitution - Nonsense(1)	ovary(1)											47.0	48.0	48.0					8																	134042140		2203	4300	6503	SO:0001587	stop_gained	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7111C>T	8.37:g.134042140C>T	ENSP00000220616:p.Arg2371*		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.R2371*	ENST00000220616.4	37	c.7111	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.335392|10.335392	0.99385|0.99385	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000519178;ENST00000518108|ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543	.|.	.|.	.|.	5.47|5.47	-1.68|-1.68	0.08212|0.08212	.|.	.|1.253950	.|0.05376	.|N	.|0.536251	T|.	0.12433|.	0.0302|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.18808|.	-1.0325|.	3|.	.|0.12103	.|T	.|0.63	.|.	2.5159|2.5159	0.04667|0.04667	0.218:0.2297:0.4416:0.1108|0.218:0.2297:0.4416:0.1108	.|.	.|.	.|.	.|.	L|X	826;166|2314;1177;2371;741;504	.|.	.|ENSP00000220616:R2371X	P|R	+|+	2|1	0|2	TG|TG	134111322|134111322	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.036000|0.036000	0.12997|0.12997	0.461000|0.461000	0.21940|0.21940	-0.292000|-0.292000	0.08999|0.08999	-1.086000|-1.086000	0.02197|0.02197	CCG|CGA	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin	ENSG00000042832		0.642	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	68	0	C	NM_003235		134042140	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	nonsense	14.14	85	14	SNP	0.000	T
TINAG	27283	genome.wustl.edu	37	6	54214543	54214543	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr6:54214543T>C	ENST00000259782.4	+	7	1025	c.929T>C	c.(928-930)tTc>tCc	p.F310S		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	310					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TACCCACTTTTCAAAGACCAA	0.428																																																	0													145.0	135.0	139.0					6																	54214543		2203	4300	6503	SO:0001583	missense	0			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.929T>C	6.37:g.54214543T>C	ENSP00000259782:p.Phe310Ser		Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,smart_Peptidase_C1A_C,pfscan_Somatomedin_B_dom	p.F310S	ENST00000259782.4	37	c.929	CCDS4955.1	6	.	.	.	.	.	.	.	.	.	.	T	9.690	1.151756	0.21371	.	.	ENSG00000137251	ENST00000339741;ENST00000259782	D	0.86230	-2.09	5.87	2.23	0.28157	Peptidase C1A, papain C-terminal (2);	0.152899	0.47455	N	0.000239	T	0.46229	0.1382	N	0.01086	-1.025	0.80722	D	1	P	0.42785	0.79	B	0.41332	0.354	T	0.53107	-0.8485	10	0.16420	T	0.52	.	8.2517	0.31730	0.0:0.2319:0.0:0.7681	.	310	Q9UJW2	TINAG_HUMAN	S	169;310	ENSP00000259782:F310S	ENSP00000259782:F310S	F	+	2	0	TINAG	54322502	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	1.547000	0.36190	0.478000	0.27488	-0.346000	0.07831	TTC	TINAG	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000137251		0.428	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	HGNC	protein_coding	OTTHUMT00000040984.1	-	0.00	30	0	T	NM_014464		54214543	+1	tier1	-	no_errors	ENST00000259782	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	C
TLL1	7092	genome.wustl.edu	37	4	166976339	166976339	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr4:166976339A>C	ENST00000061240.2	+	13	2283	c.1636A>C	c.(1636-1638)Aga>Cga	p.R546R	TLL1_ENST00000507499.1_Silent_p.R569R|RNA5SP170_ENST00000517150.1_RNA	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	546	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGAAGACATAAGATCTACCTC	0.378																																																	0													123.0	120.0	121.0					4																	166976339		2203	4300	6503	SO:0001819	synonymous_variant	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1636A>C	4.37:g.166976339A>C			B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.R546	ENST00000061240.2	37	c.1636	CCDS3811.1	4																																																																																			TLL1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom	ENSG00000038295		0.378	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1		0.00	56	0	A			166976339	+1			no_errors	ENST00000061240	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.338	C
TMEM206	55248	genome.wustl.edu	37	1	212551021	212551021	+	Silent	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:212551021G>T	ENST00000261455.4	-	6	803	c.666C>A	c.(664-666)gcC>gcA	p.A222A	TMEM206_ENST00000535273.1_Silent_p.A283A	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	222						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CACTCTCACAGGCCTGCATGA	0.577																																																	0													97.0	89.0	91.0					1																	212551021		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.666C>A	1.37:g.212551021G>T			B7Z4D6|Q6IA87|Q9NV85	Silent	SNP	NULL	p.A283	ENST00000261455.4	37	c.849	CCDS1504.1	1																																																																																			TMEM206	-	NULL	ENSG00000065600		0.577	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM206	HGNC	protein_coding	OTTHUMT00000089306.1	-	0.00	40	0	G	NM_018252		212551021	-1	tier1	-	no_errors	ENST00000535273	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
TMEM26	219623	genome.wustl.edu	37	10	63170312	63170312	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:63170312T>G	ENST00000399298.3	-	6	1243	c.875A>C	c.(874-876)aAg>aCg	p.K292T	TMEM26_ENST00000507507.1_5'UTR	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	292						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					GAGGAAGTTCTTCGCGGCAAA	0.502																																																	0													107.0	112.0	110.0					10																	63170312		2108	4227	6335	SO:0001583	missense	0			BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.875A>C	10.37:g.63170312T>G	ENSP00000382237:p.Lys292Thr		Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	pfam_Transmembrane_26	p.K292T	ENST00000399298.3	37	c.875	CCDS41530.1	10	.	.	.	.	.	.	.	.	.	.	T	19.48	3.836010	0.71373	.	.	ENSG00000196932	ENST00000399298	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.83908	0.5356	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86486	0.1794	9	0.87932	D	0	-2.2548	16.4288	0.83833	0.0:0.0:0.0:1.0	.	292	Q6ZUK4	TMM26_HUMAN	T	292	.	ENSP00000382237:K292T	K	-	2	0	TMEM26	62840318	1.000000	0.71417	0.994000	0.49952	0.131000	0.20780	7.651000	0.83577	2.282000	0.76494	0.533000	0.62120	AAG	TMEM26	-	pfam_Transmembrane_26	ENSG00000196932		0.502	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM26	HGNC	protein_coding	OTTHUMT00000359121.1	-	0.00	63	0	T	NM_178505		63170312	-1	tier1	-	no_errors	ENST00000399298	ensembl	human	known	74_37	missense	35.09	37	20	SNP	1.000	G
TNC	3371	genome.wustl.edu	37	9	117848461	117848461	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:117848461C>T	ENST00000350763.4	-	3	1960	c.1549G>A	c.(1549-1551)Gtc>Atc	p.V517I	TNC_ENST00000423613.2_Missense_Mutation_p.V517I|TNC_ENST00000542877.1_Missense_Mutation_p.V517I|TNC_ENST00000535648.1_Missense_Mutation_p.V517I|TNC_ENST00000537320.1_Missense_Mutation_p.V517I|TNC_ENST00000341037.4_Missense_Mutation_p.V517I|TNC_ENST00000346706.3_Missense_Mutation_p.V517I|TNC_ENST00000345230.3_Missense_Mutation_p.V517I|TNC_ENST00000340094.3_Missense_Mutation_p.V517I	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	517	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TCCTCACAGACGCACTGTCCG	0.607																																																	0													89.0	77.0	81.0					9																	117848461		2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1549G>A	9.37:g.117848461C>T	ENSP00000265131:p.Val517Ile		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.V517I	ENST00000350763.4	37	c.1549	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	0.763	-0.768594	0.02974	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92;2.92	5.82	-0.598	0.11649	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);	0.751962	0.12674	N	0.448551	T	0.04634	0.0126	N	0.12611	0.24	0.09310	N	1	P;B	0.35551	0.509;0.007	B;B	0.29716	0.106;0.009	T	0.40701	-0.9549	10	0.31617	T	0.26	.	6.9964	0.24784	0.0:0.5702:0.186:0.2438	.	517;517	E9PC84;P24821	.;TENA_HUMAN	I	517	ENSP00000344400:V517I;ENSP00000438152:V517I;ENSP00000344555:V517I;ENSP00000345861:V517I;ENSP00000265131:V517I;ENSP00000339553:V517I;ENSP00000411406:V517I;ENSP00000443478:V517I;ENSP00000442242:V517I	ENSP00000344400:V517I	V	-	1	0	TNC	116888282	0.000000	0.05858	0.023000	0.16930	0.034000	0.12701	0.301000	0.19174	-0.119000	0.11830	-0.368000	0.07277	GTC	TNC	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000041982		0.607	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	29	0	C	NM_002160		117848461	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.002	T
TNRC18	84629	genome.wustl.edu	37	7	5410841	5410841	+	Silent	SNP	G	G	A	rs541066805		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:5410841G>A	ENST00000430969.1	-	11	3732	c.3384C>T	c.(3382-3384)ccC>ccT	p.P1128P	TNRC18_ENST00000399537.4_Silent_p.P1128P	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1128	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCTTGTCTTCGGGTGAGAGTG	0.701													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12940	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3384C>T	7.37:g.5410841G>A			A8MX41|Q96JH1|Q96K91	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.P1128	ENST00000430969.1	37	c.3384	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.701	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		-	0.00	78	0	G			5410841	-1	tier1	-	no_errors	ENST00000399537	ensembl	human	known	74_37	silent	14.73	110	19	SNP	0.031	A
TNS1	7145	genome.wustl.edu	37	2	218682490	218682490	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:218682490C>T	ENST00000171887.4	-	24	4705	c.4253G>A	c.(4252-4254)gGc>gAc	p.G1418D	TNS1_ENST00000419504.1_Missense_Mutation_p.G1405D|TNS1_ENST00000430930.1_Missense_Mutation_p.G1397D	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1418					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		ACTGGACATGCCGCTGGCGAC	0.617																																																	0													85.0	76.0	79.0					2																	218682490		2203	4300	6503	SO:0001583	missense	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4253G>A	2.37:g.218682490C>T	ENSP00000171887:p.Gly1418Asp		Q4ZG71|Q6IPI5	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.G1418D	ENST00000171887.4	37	c.4253	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800372	0.70567	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.93763	-3.28;2.0;-3.27;-3.27	5.02	5.02	0.67125	.	0.254959	0.37393	N	0.002109	D	0.96065	0.8718	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.993	D	0.95990	0.8985	10	0.51188	T	0.08	.	18.3526	0.90343	0.0:1.0:0.0:0.0	.	1418;1397;1405	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	D	1418;556;1405;1397	ENSP00000171887:G1418D;ENSP00000394171:G556D;ENSP00000408724:G1405D;ENSP00000406016:G1397D	ENSP00000171887:G1418D	G	-	2	0	TNS1	218390735	1.000000	0.71417	0.997000	0.53966	0.671000	0.39405	3.434000	0.52841	2.326000	0.78906	0.650000	0.86243	GGC	TNS1	-	NULL	ENSG00000079308		0.617	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2		0.00	64	0	C	NM_022648		218682490	-1			no_errors	ENST00000171887	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:7578403C>A	ENST00000269305.4	-	5	716	c.527G>T	c.(526-528)tGc>tTc	p.C176F	TP53_ENST00000420246.2_Missense_Mutation_p.C176F|TP53_ENST00000359597.4_Missense_Mutation_p.C176F|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.C176F|TP53_ENST00000455263.2_Missense_Mutation_p.C176F|TP53_ENST00000445888.2_Missense_Mutation_p.C176F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)											49.0	49.0	49.0					17																	7578403		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>T	17.37:g.7578403C>A	ENSP00000269305:p.Cys176Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C176F	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433429	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.994;0.996;0.998;0.997;0.995;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176F;ENSP00000352610:C176F;ENSP00000269305:C176F;ENSP00000398846:C176F;ENSP00000391127:C176F;ENSP00000391478:C176F;ENSP00000425104:C44F;ENSP00000423862:C83F	ENSP00000269305:C176F	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	43	0	C	NM_000546		7578403	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	A
TP53I11	9537	genome.wustl.edu	37	11	44958848	44958848	+	Intron	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:44958848G>A	ENST00000533940.1	-	7	842				TP53I11_ENST00000531130.2_Intron|TP53I11_ENST00000525680.1_Intron|TP53I11_ENST00000308212.5_Intron|TP53I11_ENST00000395648.3_Intron|TP53I11_ENST00000531928.2_Intron	NM_001258320.1	NP_001245249.1	O14683	P5I11_HUMAN	tumor protein p53 inducible protein 11						negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5						TGGGGGTGGGGGCTCACCATG	0.667											OREG0020923	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													26.0	31.0	29.0					11																	44958848		2165	4233	6398	SO:0001627	intron_variant	0			AF010315	CCDS7911.1	11p11.2	2005-09-22				ENSG00000175274			16842	protein-coding gene	gene with protein product						9305847	Standard	NM_006034		Approved	PIG11	uc001myk.3	O14683		ENST00000533940.1:c.237+6C>T	11.37:g.44958848G>A		115	Q3ZCS0	Missense_Mutation	SNP	NULL	p.P82S	ENST00000533940.1	37	c.244	CCDS7911.1	11																																																																																			TP53I11	-	NULL	ENSG00000175274		0.667	TP53I11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TP53I11	HGNC	protein_coding	OTTHUMT00000389909.1	-	0.00	30	0	G	NM_006034		44958848	-1	tier1	-	no_errors	ENST00000525145	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.216	A
TRHDE	29953	genome.wustl.edu	37	12	72680620	72680620	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr12:72680620A>C	ENST00000261180.4	+	2	1035	c.939A>C	c.(937-939)gaA>gaC	p.E313D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	313					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TGTTTGAGGAAGATGGATGGG	0.408																																																	0													167.0	157.0	160.0					12																	72680620		2203	4300	6503	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.939A>C	12.37:g.72680620A>C	ENSP00000261180:p.Glu313Asp		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E313D	ENST00000261180.4	37	c.939	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	A	19.33	3.807773	0.70797	.	.	ENSG00000072657	ENST00000261180	T	0.03689	3.84	6.17	6.17	0.99709	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.099655	0.64402	D	0.000002	T	0.03739	0.0106	N	0.26162	0.8	0.54753	D	0.999982	P	0.34934	0.476	B	0.33196	0.159	T	0.58211	-0.7676	10	0.13470	T	0.59	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	313	Q9UKU6	TRHDE_HUMAN	D	313	ENSP00000261180:E313D	ENSP00000261180:E313D	E	+	3	2	TRHDE	70966887	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.376000	0.66178	2.371000	0.80710	0.533000	0.62120	GAA	TRHDE	-	pfam_Peptidase_M1_N	ENSG00000072657		0.408	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	32	0	A	NM_013381		72680620	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	30.00	28	12	SNP	1.000	C
TRIM64C	646754	genome.wustl.edu	37	11	49075357	49075357	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:49075357A>C	ENST00000530230.1	-	7	1252	c.1253T>G	c.(1252-1254)tTt>tGt	p.F418C		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	418	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						AGAAACATCAAAAAAACTCAC	0.423																																																	0																																										SO:0001583	missense	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.1253T>G	11.37:g.49075357A>C	ENSP00000431987:p.Phe418Cys			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.F418C	ENST00000530230.1	37	c.1253		11	.	.	.	.	.	.	.	.	.	.	A	12.82	2.052727	0.36181	.	.	ENSG00000214891	ENST00000530230	T	0.62105	0.05	1.55	-3.11	0.05299	.	.	.	.	.	T	0.55689	0.1936	L	0.58510	1.815	0.09310	N	1	.	.	.	.	.	.	T	0.55036	-0.8203	7	0.87932	D	0	.	2.1897	0.03895	0.4915:0.1844:0.0:0.3241	.	.	.	.	C	418	ENSP00000431987:F418C	ENSP00000431987:F418C	F	-	2	0	TRIM64C	49031933	0.423000	0.25482	0.000000	0.03702	0.673000	0.39480	-0.038000	0.12144	-0.937000	0.03719	0.155000	0.16302	TTT	TRIM64C	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000214891		0.423	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	-	0.00	201	0	A			49075357	-1	tier1	-	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	24.00	114	36	SNP	0.094	C
TRIM77	390231	genome.wustl.edu	37	11	89444611	89444611	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:89444611delA	ENST00000398290.3	+	2	445	c.445delA	c.(445-447)aaafs	p.K151fs		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	151						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										GTCCATCTGGAAAAAAAAACA	0.323																																																	0													34.0	34.0	34.0					11																	89444611		692	1587	2279	SO:0001589	frameshift_variant	0				CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.445delA	11.37:g.89444611delA	ENSP00000474003:p.Lys151fs			Frame_Shift_Del	DEL	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K151fs	ENST00000398290.3	37	c.445		11																																																																																			TRIM77	-	NULL	ENSG00000214414		0.323	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	TRIM77	HGNC	protein_coding			0.00	84	0	A	NM_001146162		89444611	+1	tier1		no_errors	ENST00000398290	ensembl	human	known	74_37	frame_shift_del	12.50	56	8	DEL	0.039	-
TRIM9	114088	genome.wustl.edu	37	14	51489642	51489642	+	Missense_Mutation	SNP	C	C	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr14:51489642C>A	ENST00000298355.3	-	3	2073	c.952G>T	c.(952-954)Gcc>Tcc	p.A318S	TRIM9_ENST00000338969.5_Missense_Mutation_p.A318S|TRIM9_ENST00000360392.4_Missense_Mutation_p.A318S	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	318					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TCACATTGGGCCACCAGACAG	0.547																																																	0													138.0	132.0	134.0					14																	51489642		2203	4300	6503	SO:0001583	missense	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.952G>T	14.37:g.51489642C>A	ENSP00000298355:p.Ala318Ser		D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.A318S	ENST00000298355.3	37	c.952	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	C	31	5.063393	0.93898	.	.	ENSG00000100505	ENST00000298355;ENST00000338969;ENST00000360392	T;T;T	0.70164	-0.32;-0.46;0.58	5.58	5.58	0.84498	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77039	0.4072	L	0.52364	1.645	0.58432	D	0.999999	D;D;P	0.89917	1.0;0.999;0.938	D;D;P	0.91635	0.999;0.998;0.676	T	0.70156	-0.4949	10	0.15952	T	0.53	.	18.5617	0.91102	0.0:1.0:0.0:0.0	.	318;318;318	Q9C026-5;Q9C026-4;Q9C026	.;.;TRIM9_HUMAN	S	318	ENSP00000298355:A318S;ENSP00000342970:A318S;ENSP00000353561:A318S	ENSP00000298355:A318S	A	-	1	0	TRIM9	50559392	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.478000	0.81082	2.636000	0.89361	0.655000	0.94253	GCC	TRIM9	-	smart_Bbox_C	ENSG00000100505		0.547	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	-	0.00	51	0	C	NM_015163		51489642	-1	tier1	-	no_errors	ENST00000338969	ensembl	human	known	74_37	missense	10.00	61	7	SNP	1.000	A
TRIP12	9320	genome.wustl.edu	37	2	230664051	230664051	+	Silent	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:230664051T>C	ENST00000283943.5	-	21	3208	c.3030A>G	c.(3028-3030)ccA>ccG	p.P1010P	TRIP12_ENST00000389045.3_Silent_p.P740P|TRIP12_ENST00000389044.4_Silent_p.P1058P|TRIP12_ENST00000543084.1_Intron	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1010					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTGGCCTTCTTGGCCCTCGTT	0.423																																																	0													196.0	176.0	183.0					2																	230664051		2203	4300	6503	SO:0001819	synonymous_variant	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3030A>G	2.37:g.230664051T>C			D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.P1010	ENST00000283943.5	37	c.3030	CCDS33391.1	2																																																																																			TRIP12	-	NULL	ENSG00000153827		0.423	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	-	0.00	57	0	T	NM_004238		230664051	-1	tier1	-	no_errors	ENST00000283943	ensembl	human	known	74_37	silent	15.69	43	8	SNP	1.000	C
TRPA1	8989	genome.wustl.edu	37	8	72964838	72964838	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:72964838T>C	ENST00000262209.4	-	14	2014	c.1807A>G	c.(1807-1809)Aaa>Gaa	p.K603E	RP11-383H13.1_ENST00000524152.1_3'UTR|RP11-383H13.1_ENST00000537896.1_3'UTR|RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	603					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GTGTACCTTTTGCTCCTGATG	0.428																																																	0													127.0	112.0	117.0					8																	72964838		2203	4300	6503	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1807A>G	8.37:g.72964838T>C	ENSP00000262209:p.Lys603Glu		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K603E	ENST00000262209.4	37	c.1807	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	T	3.326	-0.137673	0.06711	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.42513	0.97;1.08	4.98	-0.886	0.10590	.	0.357798	0.36591	N	0.002519	T	0.21267	0.0512	L	0.31845	0.965	0.29155	N	0.87812	B	0.13594	0.008	B	0.10450	0.005	T	0.32214	-0.9915	10	0.05620	T	0.96	.	6.1312	0.20207	0.0:0.1457:0.4106:0.4437	.	603	O75762	TRPA1_HUMAN	E	455;603	ENSP00000428151:K455E;ENSP00000262209:K603E	ENSP00000262209:K603E	K	-	1	0	TRPA1	73127392	0.991000	0.36638	0.391000	0.26233	0.540000	0.34992	2.296000	0.43584	0.004000	0.14682	-0.449000	0.05564	AAA	TRPA1	-	smart_Ankyrin_rpt	ENSG00000104321		0.428	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	-	0.00	42	0	T	NM_007332		72964838	-1	tier1	-	no_errors	ENST00000262209	ensembl	human	known	74_37	missense	23.08	60	18	SNP	0.712	C
TRPM3	80036	genome.wustl.edu	37	9	73458045	73458046	+	Splice_Site	INS	-	-	AA	rs3833697|rs533390097	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr9:73458045_73458046insAA	ENST00000377111.2	-	5	920		c.e5-2		TRPM3_ENST00000377110.3_Splice_Site|TRPM3_ENST00000377106.1_Splice_Site|TRPM3_ENST00000377101.1_Splice_Site|TRPM3_ENST00000377105.1_Splice_Site|TRPM3_ENST00000396280.5_Splice_Site|TRPM3_ENST00000408909.2_Splice_Site|TRPM3_ENST00000396292.4_Splice_Site|TRPM3_ENST00000358082.3_Splice_Site|TRPM3_ENST00000361823.5_Splice_Site|TRPM3_ENST00000357533.2_Splice_Site|TRPM3_ENST00000396285.1_Splice_Site|TRPM3_ENST00000423814.3_Splice_Site|TRPM3_ENST00000360823.2_Splice_Site|TRPM3_ENST00000396283.1_Splice_Site|TRPM3_ENST00000377097.3_Splice_Site	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GAATAACACCTAAAAAAAAAAG	0.371																																																	0									,,,,,,,,	2873,228,1163		935,177,826,1,49,144					,,,,,,,,	4.6	0.9		dbSNP_130	42	5493,56,2699		1753,52,1935,0,4,380	no	intron,intron,intron,intron,intron,intron,intron,intron,intron	TRPM3	NM_206948.2,NM_206947.3,NM_206946.3,NM_206945.3,NM_206944.3,NM_024971.5,NM_020952.4,NM_001007471.2,NM_001007470.1	,,,,,,,,	2688,229,2761,1,53,524	A1A1,A1A2,A1R,A2A2,A2R,RR		33.402,32.622,33.1362	,,,,,,,,	,,,,,,,,		8366,284,3862				SO:0001630	splice_region_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.677-2->TT	9.37:g.73458054_73458055dupAA			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Splice_Site	INS	-	e5-2	ENST00000377111.2	37	c.683-3_683-2		9																																																																																			TRPM3	-	-	ENSG00000083067		0.371	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5		0.00	59	0	-	NM_206945	Intron	73458046	-1	tier1		no_errors	ENST00000423814	ensembl	human	known	74_37	splice_site_ins	9.64	75	8	INS	0.995:0.010	AA
TSGA10	80705	genome.wustl.edu	37	2	99636828	99636828	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:99636828C>G	ENST00000393483.3	-	18	2576	c.1732G>C	c.(1732-1734)Gaa>Caa	p.E578Q	TSGA10_ENST00000355053.4_Missense_Mutation_p.E578Q|TSGA10_ENST00000539964.1_Missense_Mutation_p.E578Q|TSGA10_ENST00000410001.1_Missense_Mutation_p.E578Q	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	578	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						GACTGATATTCTTTGTCTCGA	0.383																																																	0													89.0	89.0	89.0					2																	99636828		2203	4300	6503	SO:0001583	missense	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1732G>C	2.37:g.99636828C>G	ENSP00000377123:p.Glu578Gln		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.E578Q	ENST00000393483.3	37	c.1732	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611542	0.87258	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.40719	0.1128	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.01920	-1.1247	10	0.36615	T	0.2	-16.0512	18.3342	0.90282	0.0:1.0:0.0:0.0	.	578	Q9BZW7	TSG10_HUMAN	Q	578;578;578;578;508;578	ENSP00000377123:E578Q;ENSP00000386956:E578Q;ENSP00000347161:E578Q;ENSP00000444419:E578Q;ENSP00000386508:E508Q;ENSP00000377122:E578Q	ENSP00000347161:E578Q	E	-	1	0	TSGA10	99003260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.011000	0.57124	2.805000	0.96524	0.650000	0.86243	GAA	TSGA10	-	NULL	ENSG00000135951		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	40	0	C	NM_182911		99636828	-1	tier1	-	no_errors	ENST00000355053	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	G
TTC17	55761	genome.wustl.edu	37	11	43513624	43513624	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:43513624G>A	ENST00000039989.4	+	23	3219	c.3205G>A	c.(3205-3207)Gac>Aac	p.D1069N		NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1069					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GCTCTGGAATGACGCCGTCAT	0.517																																																	0													260.0	219.0	233.0					11																	43513624		2203	4300	6503	SO:0001583	missense	0			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.3205G>A	11.37:g.43513624G>A	ENSP00000039989:p.Asp1069Asn		G3XAB3|Q8NEC0	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D1069N	ENST00000039989.4	37	c.3205	CCDS31466.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.470726|5.470726	0.96274|0.96274	.|.	.|.	ENSG00000052841|ENSG00000052841	ENST00000039989|ENST00000418561	T|.	0.54675|.	0.56|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73361|0.73361	0.3577|0.3577	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.77004|.	0.989|.	T|T	0.71126|0.71126	-0.4683|-0.4683	10|5	0.72032|.	D|.	0.01|.	-18.3048|-18.3048	17.8183|17.8183	0.88642|0.88642	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1069|.	Q96AE7|.	TTC17_HUMAN|.	N|I	1069|99	ENSP00000039989:D1069N|.	ENSP00000039989:D1069N|.	D|M	+|+	1|3	0|0	TTC17|TTC17	43470200|43470200	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.888000|0.888000	0.51559|0.51559	9.496000|9.496000	0.97967|0.97967	2.631000|2.631000	0.89168|0.89168	0.655000|0.655000	0.94253|0.94253	GAC|ATG	TTC17	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000052841		0.517	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	HGNC	protein_coding	OTTHUMT00000389577.2	-	0.00	74	0	G	NM_018259		43513624	+1	tier1	-	no_errors	ENST00000039989	ensembl	human	known	74_37	missense	10.67	67	8	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179440283	179440283	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:179440283G>A	ENST00000591111.1	-	276	65877	c.65653C>T	c.(65653-65655)Ccc>Tcc	p.P21885S	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P14461S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P14586S|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P14653S|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P20958S|TTN_ENST00000589042.1_Missense_Mutation_p.P23526S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21885	Fibronectin type-III 58. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTTTACGGGCTCTGTAGTT	0.468																																																	0													234.0	231.0	232.0					2																	179440283		1981	4166	6147	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65653C>T	2.37:g.179440283G>A	ENSP00000465570:p.Pro21885Ser		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P20958S	ENST00000591111.1	37	c.62872		2	.	.	.	.	.	.	.	.	.	.	G	12.35	1.912878	0.33815	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.6	5.6	0.85130	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66954	0.2842	L	0.55990	1.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.68127	-0.5491	9	0.87932	D	0	.	19.612	0.95610	0.0:0.0:1.0:0.0	.	14461;14586;14653;21885	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	20958;14461;14653;14586;14459	ENSP00000343764:P20958S;ENSP00000434586:P14461S;ENSP00000340554:P14653S;ENSP00000352154:P14586S	ENSP00000340554:P14653S	P	-	1	0	TTN	179148529	1.000000	0.71417	0.918000	0.36340	0.636000	0.38137	9.869000	0.99810	2.651000	0.90000	0.585000	0.79938	CCC	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	42	0	G	NM_133378		179440283	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179506042	179506042	+	Splice_Site	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:179506042A>C	ENST00000591111.1	-	170	35860	c.35636T>G	c.(35635-35637)gTt>gGt	p.V11879G	TTN_ENST00000460472.2_Splice_Site_p.V4455G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Splice_Site_p.V4580G|TTN_ENST00000342175.6_Splice_Site_p.V4647G|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Splice_Site_p.V10952G|TTN_ENST00000589042.1_Splice_Site_p.V13520G|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000418062.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11879	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCTTAGAACTTTAAAGAC	0.299																																																	0													70.0	62.0	64.0					2																	179506042		1747	3958	5705	SO:0001630	splice_region_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35636-1T>G	2.37:g.179506042A>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V10952G	ENST00000591111.1	37	c.32855		2	.	.	.	.	.	.	.	.	.	.	A	15.07	2.724485	0.48728	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000414766	T;T;T;T	0.68765	-0.35;0.17;0.14;0.14	5.82	5.82	0.92795	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.76716	0.4026	L	0.43923	1.385	0.54753	D	0.999981	D;D;D;D;D	0.89917	0.998;0.998;0.998;0.998;1.0	D;D;D;D;D	0.87578	0.987;0.987;0.987;0.987;0.998	T	0.78922	-0.2013	9	0.87932	D	0	.	15.3553	0.74423	1.0:0.0:0.0:0.0	.	4455;4580;4647;11879;10646	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-5	.;.;.;TITIN_HUMAN;.	G	10952;4455;4647;4580;4455;841	ENSP00000343764:V10952G;ENSP00000434586:V4455G;ENSP00000340554:V4647G;ENSP00000352154:V4580G	ENSP00000340554:V4647G	V	-	2	0	TTN	179214287	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.337000	0.59310	2.223000	0.72356	0.482000	0.46254	GTT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.299	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	46	0	A	NM_133378	Missense_Mutation	179506042	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	25.86	43	15	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179528404	179528404	+	Intron	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:179528404T>C	ENST00000591111.1	-	154	34489				TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K12161R|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCGCTTTCTTTTCAGGAAC	0.403																																																	0													305.0	309.0	308.0					2																	179528404		876	1991	2867	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34265-4883A>G	2.37:g.179528404T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K12161R	ENST00000591111.1	37	c.36482		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.84|15.84	2.952886|2.952886	0.53293|0.53293	.|.	.|.	ENSG00000155657|ENSG00000155657	ENST00000541862;ENST00000392423|ENST00000425332	.|.	.|.	.|.	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	.|.	.|.	.|.	.|.	T|T	0.70290|0.70290	0.3207|0.3207	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.60160|.	0.987|.	P|.	0.54544|.	0.755|.	T|T	0.70230|0.70230	-0.4929|-0.4929	7|4	0.37606|.	T|.	0.19|.	.|.	14.5739|14.5739	0.68232|0.68232	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	435|.	Q71S18|.	.|.	R|G	435;287|225	.|.	ENSP00000376219:K287R|.	K|R	-|-	2|1	0|2	TTN|TTN	179236649|179236649	0.303000|0.303000	0.24463|0.24463	1.000000|1.000000	0.80357|0.80357	0.220000|0.220000	0.24768|0.24768	5.071000|5.071000	0.64382|0.64382	1.906000|1.906000	0.55180|0.55180	0.374000|0.374000	0.22700|0.22700	AAG|AGA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	113	0	T	NM_133378		179528404	-1	tier1	-	no_errors	ENST00000589042	ensembl	human	putative	74_37	missense	25.16	119	40	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179614100	179614100	+	Intron	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:179614100T>C	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.T4343A			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTTATGGTTCTTGAAGCA	0.423																																																	0													91.0	98.0	96.0					2																	179614100		2203	4296	6499	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3750A>G	2.37:g.179614100T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T4343A	ENST00000591111.1	37	c.13027		2	.	.	.	.	.	.	.	.	.	.	T	12.70	2.015980	0.35606	.	.	ENSG00000155657	ENST00000360870	T	0.55930	0.49	6.08	-1.86	0.07760	.	.	.	.	.	T	0.21841	0.0526	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19844	-1.0293	9	0.08837	T	0.75	.	2.2423	0.04023	0.3017:0.3871:0.0929:0.2183	.	4343	Q8WZ42-6	.	A	4343	ENSP00000354117:T4343A	ENSP00000354117:T4343A	T	-	1	0	TTN	179322345	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.011000	0.12721	-0.534000	0.06315	-1.537000	0.00914	ACC	TTN	-	NULL	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	58	0	T	NM_133378		179614100	-1	tier1	-	no_errors	ENST00000360870	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179666955	179666955	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:179666955C>T	ENST00000591111.1	-	3	429	c.205G>A	c.(205-207)Gcc>Acc	p.A69T	TTN_ENST00000460472.2_Missense_Mutation_p.A69T|TTN_ENST00000359218.5_Missense_Mutation_p.A69T|TTN_ENST00000342175.6_Missense_Mutation_p.A69T|TTN_ENST00000342992.6_Missense_Mutation_p.A69T|TTN_ENST00000589042.1_Missense_Mutation_p.A69T|TTN_ENST00000360870.5_Missense_Mutation_p.A69T			Q8WZ42	TITIN_HUMAN	titin	32681	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAGTCACGGCGGGGATCGTC	0.547																																																	0													142.0	127.0	132.0					2																	179666955		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.205G>A	2.37:g.179666955C>T	ENSP00000465570:p.Ala69Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A69T	ENST00000591111.1	37	c.205		2	.	.	.	.	.	.	.	.	.	.	C	16.03	3.008294	0.54361	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.25717	0.0626	N	0.16266	0.395	0.33215	D	0.553945	B;P;P;P;P	0.46784	0.372;0.634;0.634;0.634;0.884	B;B;B;B;B	0.39503	0.049;0.049;0.049;0.049;0.301	T	0.38243	-0.9670	9	0.87932	D	0	.	7.0681	0.25164	0.146:0.7154:0.0:0.1387	.	69;69;69;69;69	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	T	69	ENSP00000343764:A69T;ENSP00000434586:A69T;ENSP00000340554:A69T;ENSP00000352154:A69T;ENSP00000354117:A69T	ENSP00000340554:A69T	A	-	1	0	TTN	179375200	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.749000	0.47492	2.707000	0.92482	0.655000	0.94253	GCC	TTN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.547	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	90	0	C	NM_133378		179666955	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	12.86	61	9	SNP	1.000	T
TUBGCP2	10844	genome.wustl.edu	37	10	135103368	135103368	+	Silent	SNP	C	C	T	rs369343734		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:135103368C>T	ENST00000252936.3	-	8	1359	c.1320G>A	c.(1318-1320)ccG>ccA	p.P440P	TUBGCP2_ENST00000368563.2_Silent_p.P440P|TUBGCP2_ENST00000417178.2_Silent_p.P310P|TUBGCP2_ENST00000368562.1_Silent_p.P33P|TUBGCP2_ENST00000543663.1_Silent_p.P468P			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	440					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.P440P(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCAGGAAGGACGGGATCTGCT	0.607																																																	1	Substitution - coding silent(1)	large_intestine(1)						C		0,4406		0,0,2203	262.0	162.0	196.0		1320	-9.1	0.3	10		196	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TUBGCP2	NM_006659.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		440/903	135103368	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1320G>A	10.37:g.135103368C>T			B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	pfam_TUBGCP,superfamily_Ocr	p.P468	ENST00000252936.3	37	c.1404	CCDS7676.1	10																																																																																			TUBGCP2	-	pfam_TUBGCP,superfamily_Ocr	ENSG00000130640		0.607	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	-	0.00	107	0	C			135103368	-1	tier1	-	no_errors	ENST00000543663	ensembl	human	known	74_37	silent	13.51	64	10	SNP	0.014	T
TYR	7299	genome.wustl.edu	37	11	88924562	88924562	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:88924562T>G	ENST00000263321.5	+	2	1514	c.1012T>G	c.(1012-1014)Ttc>Gtc	p.F338V	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	338					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	AGCTGCCAATTTCAGCTTTAG	0.378																																																	0													102.0	105.0	104.0					11																	88924562		2201	4299	6500	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1012T>G	11.37:g.88924562T>G	ENSP00000263321:p.Phe338Val		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.F338V	ENST00000263321.5	37	c.1012	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	T	14.18	2.458019	0.43634	.	.	ENSG00000077498	ENST00000263321	D	0.97256	-4.31	5.59	5.59	0.84812	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.299519	0.42964	D	0.000638	D	0.97043	0.9034	M	0.75447	2.3	0.37406	D	0.913042	P	0.47484	0.896	P	0.48368	0.575	D	0.98586	1.0652	9	.	.	.	.	15.7689	0.78149	0.0:0.0:0.0:1.0	.	338	P14679	TYRO_HUMAN	V	338	ENSP00000263321:F338V	.	F	+	1	0	TYR	88564210	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.011000	0.49567	2.134000	0.65973	0.533000	0.62120	TTC	TYR	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre	ENSG00000077498		0.378	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	-	0.00	61	0	T	NM_000372		88924562	+1	tier1	-	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	G
UBASH3B	84959	genome.wustl.edu	37	11	122650316	122650316	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr11:122650316T>G	ENST00000284273.5	+	4	889	c.514T>G	c.(514-516)Ttc>Gtc	p.F172V		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	172					negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		GTCGTCCAACTTCATCGGCCT	0.567																																																	0													98.0	94.0	95.0					11																	122650316		2202	4299	6501	SO:0001583	missense	0			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.514T>G	11.37:g.122650316T>G	ENSP00000284273:p.Phe172Val		Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_SH3_domain,superfamily_RNA_ligase/cNuc_Pdiesterase,smart_UBA/transl_elong_EF1B_N_euk,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.F172V	ENST00000284273.5	37	c.514	CCDS31694.1	11	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885780	0.72410	.	.	ENSG00000154127	ENST00000284273	T	0.30182	1.54	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	M	0.72118	2.19	0.58432	D	0.999999	B	0.34241	0.444	B	0.38880	0.284	T	0.41822	-0.9487	10	0.87932	D	0	-2.9795	15.0349	0.71738	0.0:0.0:0.0:1.0	.	172	Q8TF42	UBS3B_HUMAN	V	172	ENSP00000284273:F172V	ENSP00000284273:F172V	F	+	1	0	UBASH3B	122155526	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.232000	0.72313	1.947000	0.56498	0.528000	0.53228	TTC	UBASH3B	-	superfamily_RNA_ligase/cNuc_Pdiesterase	ENSG00000154127		0.567	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBASH3B	HGNC	protein_coding	OTTHUMT00000387499.1	-	0.00	40	0	T	NM_032873		122650316	+1	tier1	-	no_errors	ENST00000284273	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	G
UBE3A	7337	genome.wustl.edu	37	15	25616050	25616050	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:25616050G>A	ENST00000397954.2	-	4	1279	c.1280C>T	c.(1279-1281)cCc>cTc	p.P427L	UBE3A_ENST00000428984.2_Missense_Mutation_p.P404L|UBE3A_ENST00000438097.1_Missense_Mutation_p.P404L|UBE3A_ENST00000566215.1_Missense_Mutation_p.P404L|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000232165.3_Missense_Mutation_p.P424L			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	427	Interaction with HCV core protein.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		AGTTTCCAGGGGGTCCACTCG	0.438																																																	0													38.0	38.0	38.0					15																	25616050		2203	4299	6502	SO:0001583	missense	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1280C>T	15.37:g.25616050G>A	ENSP00000381045:p.Pro427Leu		A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.P427L	ENST00000397954.2	37	c.1280	CCDS45192.1	15	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629188	0.46944	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	5.58	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.81992	0.4940	L	0.58583	1.82	0.80722	D	1	D;P	0.61697	0.99;0.714	P;B	0.61592	0.891;0.414	T	0.81573	-0.0871	10	0.38643	T	0.18	.	16.5236	0.84324	0.0:0.1309:0.8691:0.0	.	424;427	Q05086-3;Q05086	.;UBE3A_HUMAN	L	424;424;427;404;404	ENSP00000232165:P424L;ENSP00000381045:P427L;ENSP00000411258:P404L;ENSP00000401265:P404L	ENSP00000232165:P424L	P	-	2	0	UBE3A	23167143	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.625000	0.74248	1.344000	0.45657	0.467000	0.42956	CCC	UBE3A	-	pirsf_Ubiquitin-protein_ligase_E6-AP	ENSG00000114062		0.438	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	-	0.00	57	0	G	NM_000462		25616050	-1	tier1	-	no_errors	ENST00000397954	ensembl	human	known	74_37	missense	24.49	37	12	SNP	1.000	A
UBE3C	9690	genome.wustl.edu	37	7	157046813	157046813	+	Missense_Mutation	SNP	A	A	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:157046813A>G	ENST00000348165.5	+	20	3220	c.2860A>G	c.(2860-2862)Atg>Gtg	p.M954V		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	954	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GTGGCTCCGAATGTTTGATCA	0.517																																																	0													55.0	53.0	54.0					7																	157046813		2203	4300	6503	SO:0001583	missense	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2860A>G	7.37:g.157046813A>G	ENSP00000309198:p.Met954Val		A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.M954V	ENST00000348165.5	37	c.2860	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	A	16.60	3.167939	0.57476	.	.	ENSG00000009335	ENST00000348165	T	0.56275	0.47	5.31	5.31	0.75309	HECT (4);	0.071673	0.85682	D	0.000000	T	0.56949	0.2020	L	0.48935	1.535	0.80722	D	1	P;P	0.36110	0.537;0.537	P;P	0.45406	0.479;0.479	T	0.60791	-0.7193	10	0.66056	D	0.02	.	15.5565	0.76200	1.0:0.0:0.0:0.0	.	954;807	Q15386;B4DHJ9	UBE3C_HUMAN;.	V	954	ENSP00000309198:M954V	ENSP00000309198:M954V	M	+	1	0	UBE3C	156739574	1.000000	0.71417	0.928000	0.36995	0.898000	0.52572	8.813000	0.91963	2.143000	0.66587	0.533000	0.62120	ATG	UBE3C	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000009335		0.517	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1		0.00	54	0	A	NM_014671		157046813	+1			no_errors	ENST00000348165	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.998	G
UBR3	130507	genome.wustl.edu	37	2	170753079	170753079	+	Missense_Mutation	SNP	T	T	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:170753079T>A	ENST00000272793.5	+	8	1349	c.1299T>A	c.(1297-1299)agT>agA	p.S433R	UBR3_ENST00000418381.1_Missense_Mutation_p.S433R			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	433					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TGAAGAAAAGTCATGAATCAG	0.343																																																	0													130.0	106.0	113.0					2																	170753079		692	1591	2283	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1299T>A	2.37:g.170753079T>A	ENSP00000272793:p.Ser433Arg		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S433R	ENST00000272793.5	37	c.1299		2	.	.	.	.	.	.	.	.	.	.	T	21.1	4.099649	0.76983	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.31510	1.49;1.49	5.43	1.84	0.25277	.	.	.	.	.	T	0.46870	0.1415	M	0.65975	2.015	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.33599	-0.9862	9	0.54805	T	0.06	.	6.8206	0.23855	0.0:0.4838:0.0:0.5162	.	433	Q6ZT12	UBR3_HUMAN	R	433	ENSP00000272793:S433R;ENSP00000396068:S433R	ENSP00000272793:S433R	S	+	3	2	UBR3	170461325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.171000	0.50824	0.381000	0.24851	0.482000	0.46254	AGT	UBR3	-	NULL	ENSG00000144357		0.343	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	-	0.00	80	0	T	NM_172070		170753079	+1	tier1	-	no_errors	ENST00000272793	ensembl	human	known	74_37	missense	11.43	62	8	SNP	1.000	A
UGT1A5	54579	genome.wustl.edu	37	2	234622057	234622057	+	Silent	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:234622057C>T	ENST00000373414.3	+	1	420	c.420C>T	c.(418-420)caC>caT	p.H140H	UGT1A1_ENST00000608381.1_Silent_p.H140H|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A6_ENST00000373424.1_Intron			P35504	UD15_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A5	140						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		TGATCAGGCACCTGCATGCTA	0.448																																																	0													214.0	208.0	210.0					2																	234622057		2203	4300	6503	SO:0001819	synonymous_variant	0			M84129	CCDS33404.1	2q37	2010-03-05	2005-07-20		ENSG00000240224	ENSG00000240224		"""UDP glucuronosyltransferases"""	12537	other	complex locus constituent		606430	"""UDP glycosyltransferase 1 family, polypeptide A5"""			9295054, 1339448	Standard	NM_019078		Approved	UGT1E		P35504	OTTHUMG00000059120	ENST00000373414.3:c.420C>T	2.37:g.234622057C>T			B8K294	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.H140	ENST00000373414.3	37	c.420	CCDS33404.1	2																																																																																			UGT1A5	-	pfam_UDP_glucos_trans	ENSG00000240224		0.448	UGT1A5-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A5	HGNC	protein_coding	OTTHUMT00000130985.1	-	0.00	94	0	C	NM_019078		234622057	+1	tier1	-	no_errors	ENST00000373414	ensembl	human	known	74_37	silent	12.63	83	12	SNP	0.000	T
UNC13C	440279	genome.wustl.edu	37	15	54838937	54838937	+	Missense_Mutation	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:54838937A>C	ENST00000260323.11	+	26	5714	c.5714A>C	c.(5713-5715)aAa>aCa	p.K1905T	UNC13C_ENST00000537900.1_Missense_Mutation_p.K1903T|UNC13C_ENST00000545554.1_Missense_Mutation_p.K1905T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1905	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTCTCAGCAAAAATCTGTGAG	0.294																																																	0													28.0	24.0	25.0					15																	54838937		1703	3930	5633	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5714A>C	15.37:g.54838937A>C	ENSP00000260323:p.Lys1905Thr		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.K1905T	ENST00000260323.11	37	c.5714	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	13.96	2.394233	0.42410	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.19105	2.17;2.17;2.17	5.59	5.59	0.84812	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.101106	0.64402	D	0.000002	T	0.34629	0.0904	L	0.38175	1.15	0.54753	D	0.999985	D	0.89917	1.0	D	0.87578	0.998	T	0.04360	-1.0957	10	0.18710	T	0.47	.	14.9504	0.71067	1.0:0.0:0.0:0.0	.	1905	Q8NB66	UN13C_HUMAN	T	1905;1905;1903	ENSP00000260323:K1905T;ENSP00000438156:K1905T;ENSP00000442569:K1903T	ENSP00000260323:K1905T	K	+	2	0	UNC13C	52626229	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.043000	0.76572	2.125000	0.65367	0.459000	0.35465	AAA	UNC13C	-	pfam_Munc13_subgr_dom-2	ENSG00000137766		0.294	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	211	0	A	NM_173166		54838937	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	34.73	109	58	SNP	1.000	C
UNC80	285175	genome.wustl.edu	37	2	210808234	210808234	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:210808234T>C	ENST00000439458.1	+	44	6928	c.6848T>C	c.(6847-6849)tTt>tCt	p.F2283S	UNC80_ENST00000272845.6_Missense_Mutation_p.F2278S	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2283					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTCCTGGAATTTCCTGTAAGT	0.443																																																	0													77.0	64.0	68.0					2																	210808234		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6848T>C	2.37:g.210808234T>C	ENSP00000391088:p.Phe2283Ser		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.F2283S	ENST00000439458.1	37	c.6848	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867872	0.72065	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.62105	0.05;0.05	6.06	6.06	0.98353	.	0.047972	0.85682	D	0.000000	T	0.47655	0.1457	N	0.22421	0.69	0.80722	D	1	P	0.39216	0.664	B	0.34652	0.187	T	0.44967	-0.9293	10	0.22109	T	0.4	-18.5086	16.6093	0.84858	0.0:0.0:0.0:1.0	.	2283	Q8N2C7	UNC80_HUMAN	S	2283;2278	ENSP00000391088:F2283S;ENSP00000272845:F2278S	ENSP00000272845:F2278S	F	+	2	0	UNC80	210516479	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.779000	0.85648	2.324000	0.78689	0.533000	0.62120	TTT	UNC80	-	NULL	ENSG00000144406		0.443	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	8	0	T	NM_182587		210808234	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	52.17	11	12	SNP	1.000	C
UPK3B	80761	genome.wustl.edu	37	7	76140306	76140307	+	Frame_Shift_Del	DEL	TG	TG	-	rs141065157	byFrequency	TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:76140306_76140307delTG	ENST00000257632.5	+	1	465_466	c.337_338delTG	c.(337-339)tgtfs	p.C113fs	UPK3B_ENST00000419923.2_Frame_Shift_Del_p.C113fs|UPK3B_ENST00000394849.1_Frame_Shift_Del_p.C58fs|UPK3B_ENST00000443097.2_Frame_Shift_Del_p.C58fs|UPK3B_ENST00000448265.3_Frame_Shift_Del_p.C113fs|UPK3B_ENST00000334348.3_Frame_Shift_Del_p.C58fs			Q9BT76	UPK3B_HUMAN	uroplakin 3B	113					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GCAGCCGCGCTGTGTCTTCGAT	0.644																																																	0																																										SO:0001589	frameshift_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.337_338delTG	7.37:g.76140308_76140309delTG	ENSP00000257632:p.Cys113fs		A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Frame_Shift_Del	DEL	NULL	p.V114fs	ENST00000257632.5	37	c.337_338	CCDS5588.1	7																																																																																			UPK3B	-	NULL	ENSG00000243566		0.644	UPK3B-002	KNOWN	basic|CCDS	protein_coding	UPK3B	HGNC	protein_coding	OTTHUMT00000313978.2		0.00	136	0	TG	NM_030570		76140307	+1	tier1		no_errors	ENST00000257632	ensembl	human	known	74_37	frame_shift_del	17.81	120	26	DEL	1.000:1.000	-
USP24	23358	genome.wustl.edu	37	1	55557744	55557744	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:55557744G>T	ENST00000294383.6	-	54	6505	c.6506C>A	c.(6505-6507)gCt>gAt	p.A2169D	USP24_ENST00000407756.1_Missense_Mutation_p.A2009D	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2169					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GAATTGAATAGCAAGCTGTAA	0.363																																																	0													96.0	92.0	93.0					1																	55557744		1845	4087	5932	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6506C>A	1.37:g.55557744G>T	ENSP00000294383:p.Ala2169Asp		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.A2009D	ENST00000294383.6	37	c.6026	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	G	33	5.225076	0.95173	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.03772	3.81;3.83	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.21921	0.0528	L	0.61218	1.895	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.00005	-1.2535	10	0.87932	D	0	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	2009	B7WPF4	.	D	2169;2009	ENSP00000294383:A2169D;ENSP00000385700:A2009D	ENSP00000294383:A2169D	A	-	2	0	USP24	55330332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.229000	0.95273	2.857000	0.98124	0.650000	0.86243	GCT	USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.363	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	-	0.00	109	0	G			55557744	-1	tier1	-	no_errors	ENST00000407756	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215990382	215990382	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:215990382delG	ENST00000307340.3	-	48	9913	c.9527delC	c.(9526-9528)cctfs	p.P3176fs	USH2A_ENST00000366943.2_Frame_Shift_Del_p.P3176fs	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3176	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATAGATTCAGGTTTTTGACA	0.403										HNSCC(13;0.011)																																							0													167.0	151.0	156.0					1																	215990382		2203	4299	6502	SO:0001589	frameshift_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9527delC	1.37:g.215990382delG	ENSP00000305941:p.Pro3176fs		Q5VVM9|Q6S362|Q9NS27	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P3176fs	ENST00000307340.3	37	c.9527	CCDS31025.1	1																																																																																			USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000042781		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	45	0	G	NM_007123		215990382	-1	tier1		no_errors	ENST00000366943	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.001	-
URB2	9816	genome.wustl.edu	37	1	229772378	229772378	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:229772378G>T	ENST00000258243.2	+	4	2154	c.2018G>T	c.(2017-2019)tGc>tTc	p.C673F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	673						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GGTACATATTGCTTAGAACAG	0.443																																																	0													159.0	170.0	166.0					1																	229772378		2203	4300	6503	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2018G>T	1.37:g.229772378G>T	ENSP00000258243:p.Cys673Phe		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.C673F	ENST00000258243.2	37	c.2018	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466768	0.26335	.	.	ENSG00000135763	ENST00000258243	T	0.35421	1.31	5.12	5.12	0.69794	.	0.157883	0.56097	D	0.000023	T	0.53110	0.1776	M	0.67953	2.075	0.58432	D	0.999997	D	0.65815	0.995	P	0.62298	0.9	T	0.51387	-0.8712	9	.	.	.	-17.3162	12.3251	0.55007	0.0779:0.0:0.9221:0.0	.	673	Q14146	URB2_HUMAN	F	673	ENSP00000258243:C673F	.	C	+	2	0	URB2	227839001	1.000000	0.71417	0.913000	0.36048	0.048000	0.14542	5.039000	0.64185	2.558000	0.86282	0.585000	0.79938	TGC	URB2	-	NULL	ENSG00000135763		0.443	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1		0.00	60	0	G	NM_014777		229772378	+1			no_errors	ENST00000258243	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
USP43	124739	genome.wustl.edu	37	17	9578207	9578207	+	Splice_Site	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr17:9578207G>T	ENST00000285199.7	+	4	836		c.e4-1		USP43_ENST00000570827.2_Splice_Site|USP43_ENST00000570475.1_Splice_Site	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						CACCCTCACAGATCTTCCTTG	0.468																																																	0													285.0	274.0	277.0					17																	9578207		2041	4209	6250	SO:0001630	splice_region_variant	0			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.741-1G>T	17.37:g.9578207G>T			A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Splice_Site	SNP	-	e4-1	ENST00000285199.7	37	c.741-1	CCDS45610.1	17	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257382	0.59321	.	.	ENSG00000154914	ENST00000285199	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4732	0.61292	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP43	9518932	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	8.893000	0.92498	1.747000	0.51819	0.467000	0.42956	.	USP43	-	-	ENSG00000154914		0.468	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	HGNC	protein_coding	OTTHUMT00000439855.3	-	0.00	77	0	G	NM_153210	Intron	9578207	+1	tier1	-	no_errors	ENST00000285199	ensembl	human	known	74_37	splice_site	5.88	64	4	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82837805	82837805	+	Missense_Mutation	SNP	A	A	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr5:82837805A>T	ENST00000265077.3	+	8	9548	c.8983A>T	c.(8983-8985)Agt>Tgt	p.S2995C	VCAN_ENST00000343200.5_Missense_Mutation_p.S2008C|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2995	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCCTTGGCTAAGTCCACAGAC	0.502																																																	0													53.0	55.0	54.0					5																	82837805		2203	4300	6503	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8983A>T	5.37:g.82837805A>T	ENSP00000265077:p.Ser2995Cys		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.S2995C	ENST00000265077.3	37	c.8983	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	11.75	1.732087	0.30684	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.27402	1.67;1.67	5.64	0.354	0.16063	.	0.633338	0.15573	N	0.255355	T	0.33789	0.0875	L	0.29908	0.895	0.09310	N	1	D;D	0.76494	0.999;0.998	D;P	0.69654	0.965;0.818	T	0.10222	-1.0639	10	0.54805	T	0.06	.	4.2337	0.10615	0.417:0.3381:0.2449:0.0	.	2008;2995	P13611-2;P13611	.;CSPG2_HUMAN	C	2995;2008	ENSP00000265077:S2995C;ENSP00000340062:S2008C	ENSP00000265077:S2995C	S	+	1	0	VCAN	82873561	0.035000	0.19736	0.068000	0.19968	0.005000	0.04900	0.759000	0.26461	0.065000	0.16485	0.533000	0.62120	AGT	VCAN	-	NULL	ENSG00000038427		0.502	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	43	0	A	NM_004385		82837805	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	missense	33.33	22	11	SNP	0.000	T
VPS4A	27183	genome.wustl.edu	37	16	69349993	69349993	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr16:69349993C>T	ENST00000254950.11	+	2	260	c.104C>T	c.(103-105)gCg>gTg	p.A35V	RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.A59V	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				TACCAGCATGCGGTGGAGTAC	0.592																																																	0													66.0	73.0	70.0					16																	69349993		2110	4226	6336	SO:0001583	missense	0			AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.104C>T	16.37:g.69349993C>T	ENSP00000254950:p.Ala35Val			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.A35V	ENST00000254950.11	37	c.104	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.050030	0.97236	.	.	ENSG00000132612	ENST00000254950	T	0.81330	-1.48	5.86	5.86	0.93980	MIT (2);	0.000000	0.85682	D	0.000000	D	0.91389	0.7283	H	0.95402	3.665	0.80722	D	1	D	0.60160	0.987	P	0.54590	0.756	D	0.93463	0.6812	10	0.87932	D	0	-19.6358	18.958	0.92668	0.0:1.0:0.0:0.0	.	35	Q9UN37	VPS4A_HUMAN	V	35	ENSP00000254950:A35V	ENSP00000254950:A35V	A	+	2	0	VPS4A	67907494	1.000000	0.71417	0.967000	0.41034	0.954000	0.61252	7.814000	0.86154	2.775000	0.95449	0.655000	0.94253	GCG	VPS4A	-	pfam_MIT,smart_MIT	ENSG00000132612		0.592	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	-	0.00	55	0	C	NM_013245		69349993	+1	tier1	-	no_errors	ENST00000254950	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	T
VWA5B1	127731	genome.wustl.edu	37	1	20640980	20640980	+	Missense_Mutation	SNP	C	C	T	rs374632705		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:20640980C>T	ENST00000375079.2	+	4	654	c.458C>T	c.(457-459)aCg>aTg	p.T153M	VWA5B1_ENST00000289815.8_Missense_Mutation_p.T153M|VWA5B1_ENST00000289825.4_5'UTR|RP4-745E8.2_ENST00000444923.1_RNA|VWA5B1_ENST00000375083.4_Missense_Mutation_p.T153M	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	153						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						GAGCTCCCAACGCTGCCCAGC	0.622																																																	0													42.0	42.0	42.0					1																	20640980		692	1591	2283	SO:0001583	missense	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.458C>T	1.37:g.20640980C>T	ENSP00000364220:p.Thr153Met		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.T153M	ENST00000375079.2	37	c.458		1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647275	0.87958	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.06933	3.57;3.24;3.56	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.33381	0.0861	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.03945	-1.0990	10	0.87932	D	0	-10.8229	18.1375	0.89624	0.0:1.0:0.0:0.0	.	153;153	Q5TIE3;Q5TIE3-2	VW5B1_HUMAN;.	M	153	ENSP00000289815:T153M;ENSP00000364224:T153M;ENSP00000364220:T153M	ENSP00000289815:T153M	T	+	2	0	VWA5B1	20513567	1.000000	0.71417	0.255000	0.24374	0.858000	0.48976	5.579000	0.67457	2.647000	0.89833	0.467000	0.42956	ACG	VWA5B1	-	NULL	ENSG00000158816		0.622	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4		0.00	81	0	C	XM_001722222		20640980	+1			no_errors	ENST00000289815	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.993	T
WBSCR17	64409	genome.wustl.edu	37	7	70800605	70800605	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:70800605T>C	ENST00000333538.5	+	2	942	c.308T>C	c.(307-309)cTt>cCt	p.L103P	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	103					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCGGCTACTCTTTCCCCGGCT	0.463																																																	0													43.0	47.0	46.0					7																	70800605		2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.308T>C	7.37:g.70800605T>C	ENSP00000329654:p.Leu103Pro		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L103P	ENST00000333538.5	37	c.308	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	T	19.27	3.795139	0.70452	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.60299	0.2;1.54	4.89	4.89	0.63831	.	1.277870	0.05336	N	0.529261	T	0.80099	0.4561	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67356	-0.5691	10	0.87932	D	0	.	13.8154	0.63287	0.0:0.0:0.0:1.0	.	103	Q6IS24	GLTL3_HUMAN	P	103;81	ENSP00000329654:L103P;ENSP00000392019:L81P	ENSP00000329654:L103P	L	+	2	0	WBSCR17	70438541	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	7.525000	0.81892	2.045000	0.60652	0.402000	0.26972	CTT	WBSCR17	-	NULL	ENSG00000185274		0.463	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	142	0	T	NM_022479		70800605	+1	tier1	-	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	22.42	128	37	SNP	1.000	C
WBSCR17	64409	genome.wustl.edu	37	7	71175905	71175905	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:71175905T>G	ENST00000333538.5	+	10	2294	c.1660T>G	c.(1660-1662)Ttc>Gtc	p.F554V	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	554	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GCGCTGGAACTTCATCCAGGT	0.617																																																	0													44.0	40.0	42.0					7																	71175905		2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1660T>G	7.37:g.71175905T>G	ENSP00000329654:p.Phe554Val		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.F554V	ENST00000333538.5	37	c.1660	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	T	22.4	4.290191	0.80914	.	.	ENSG00000185274	ENST00000333538	T	0.26957	1.7	5.28	5.28	0.74379	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	T	0.54062	0.1835	M	0.87682	2.9	0.54753	D	0.999981	D	0.61697	0.99	D	0.64776	0.929	T	0.61840	-0.6980	10	0.62326	D	0.03	.	14.1904	0.65635	0.0:0.0:0.0:1.0	.	554	Q6IS24	GLTL3_HUMAN	V	554	ENSP00000329654:F554V	ENSP00000329654:F554V	F	+	1	0	WBSCR17	70813841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.363000	0.59473	2.217000	0.71921	0.533000	0.62120	TTC	WBSCR17	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000185274		0.617	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	29	0	T	NM_022479		71175905	+1	tier1	-	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	39.62	32	21	SNP	1.000	G
WDR11	55717	genome.wustl.edu	37	10	122668423	122668424	+	3'UTR	INS	-	-	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:122668423_122668424insC	ENST00000263461.6	+	0	4119_4120				WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						CGTTGGTCTCAGAAAGAACGTG	0.361																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.*199->C	10.37:g.122668423_122668424insC			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	INS	-	NULL	ENST00000263461.6	37	NULL	CCDS7619.1	10																																																																																			WDR11	-	-	ENSG00000120008		0.361	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2		0.00	93	0	-			122668424	+1	tier1		no_errors	ENST00000604509	ensembl	human	known	74_37	rna	15.79	80	15	INS	0.000:0.000	C
WDR11	55717	genome.wustl.edu	37	10	122668424	122668424	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:122668424G>A	ENST00000263461.6	+	0	4120				WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GTTGGTCTCAGAAAGAACGTG	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.*199G>A	10.37:g.122668424G>A			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	SNP	-	NULL	ENST00000263461.6	37	NULL	CCDS7619.1	10																																																																																			WDR11	-	-	ENSG00000120008		0.363	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	-	0.00	92	0	G			122668424	+1	tier1	-	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	16.84	78	16	SNP	0.000	A
WDR11	55717	genome.wustl.edu	37	10	122668428	122668428	+	3'UTR	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr10:122668428G>A	ENST00000263461.6	+	0	4124				WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GTCTCAGAAAGAACGTGAATG	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.*203G>A	10.37:g.122668428G>A			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	SNP	-	NULL	ENST00000263461.6	37	NULL	CCDS7619.1	10																																																																																			WDR11	-	-	ENSG00000120008		0.348	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	-	0.00	97	0	G			122668428	+1	tier1	-	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	19.59	78	19	SNP	0.000	A
WDR72	256764	genome.wustl.edu	37	15	54003588	54003588	+	Missense_Mutation	SNP	T	T	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:54003588T>C	ENST00000396328.1	-	8	1041	c.802A>G	c.(802-804)Aga>Gga	p.R268G	WDR72_ENST00000557913.1_Missense_Mutation_p.R267G|WDR72_ENST00000559418.1_Missense_Mutation_p.R268G|WDR72_ENST00000360509.5_Missense_Mutation_p.R268G	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	268										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		ATGAGGATTCTGTGAGCAGCA	0.423																																																	0													122.0	110.0	114.0					15																	54003588		2194	4293	6487	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.802A>G	15.37:g.54003588T>C	ENSP00000379619:p.Arg268Gly		Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R268G	ENST00000396328.1	37	c.802	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	T	18.54	3.646862	0.67358	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.44881	0.91;0.91	5.5	4.31	0.51392	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62660	0.2446	M	0.74258	2.255	0.44469	D	0.997402	D	0.89917	1.0	D	0.83275	0.996	T	0.66881	-0.5811	10	0.72032	D	0.01	.	12.4175	0.55502	0.0:0.0:0.1391:0.8609	.	268	Q3MJ13	WDR72_HUMAN	G	268	ENSP00000379619:R268G;ENSP00000353699:R268G	ENSP00000353699:R268G	R	-	1	2	WDR72	51790880	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.501000	0.53325	2.221000	0.72209	0.528000	0.53228	AGA	WDR72	-	superfamily_WD40_repeat_dom	ENSG00000166415		0.423	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	-	0.00	55	0	T	NM_182758		54003588	-1	tier1	-	no_errors	ENST00000360509	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	C
XIRP1	165904	genome.wustl.edu	37	3	39226622	39226622	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:39226622G>T	ENST00000340369.3	-	2	4543	c.4315C>A	c.(4315-4317)Cag>Aag	p.Q1439K	XIRP1_ENST00000421646.1_Missense_Mutation_p.Q122K|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1439					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GGGCCCCACTGTGGTGAGGTG	0.627																																																	0													54.0	63.0	60.0					3																	39226622		2203	4300	6503	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4315C>A	3.37:g.39226622G>T	ENSP00000343140:p.Gln1439Lys		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.Q1439K	ENST00000340369.3	37	c.4315	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896845	0.52121	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.21361	3.83;2.01	4.42	2.61	0.31194	.	28.544400	0.00166	U	0.000002	T	0.20047	0.0482	L	0.54323	1.7	0.09310	N	1	B	0.30068	0.267	B	0.25140	0.058	T	0.33033	-0.9884	10	0.07482	T	0.82	.	7.34	0.26632	0.2118:0.0:0.7882:0.0	.	1439	Q702N8	XIRP1_HUMAN	K	1439;122	ENSP00000343140:Q1439K;ENSP00000391645:Q122K	ENSP00000343140:Q1439K	Q	-	1	0	XIRP1	39201626	0.425000	0.25498	0.000000	0.03702	0.000000	0.00434	4.227000	0.58612	0.583000	0.29574	-0.136000	0.14681	CAG	XIRP1	-	NULL	ENSG00000168334		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1		0.00	70	0	G	XM_093522		39226622	-1			no_errors	ENST00000340369	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.003	T
XIRP2	129446	genome.wustl.edu	37	2	168115371	168115371	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr2:168115371C>G	ENST00000409728.1	+	11	2503	c.2414C>G	c.(2413-2415)tCg>tGg	p.S805W	XIRP2_ENST00000420519.1_Missense_Mutation_p.S805W|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409605.1_Missense_Mutation_p.S550W|XIRP2_ENST00000409043.1_Missense_Mutation_p.S772W|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.S772W|XIRP2_ENST00000295237.9_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	94					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S805L(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGACTTATTCGAGGAATGTA	0.418																																																	1	Substitution - Missense(1)	large_intestine(1)											41.0	40.0	41.0					2																	168115371		1839	4092	5931	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2414C>G	2.37:g.168115371C>G	ENSP00000386619:p.Ser805Trp		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S805W	ENST00000409728.1	37	c.2414	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	C	9.775	1.173802	0.21704	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	D;D;D;D;D	0.85629	-1.91;-1.9;-1.91;-1.9;-2.01	5.67	4.8	0.61643	.	.	.	.	.	D	0.91747	0.7390	.	.	.	0.36047	D	0.840506	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	D	0.94689	0.7872	8	0.87932	D	0	.	12.7213	0.57144	0.0:0.9241:0.0:0.0759	.	772;805	A4UGR9-4;A4UGR9-6	.;.	W	772;805;772;805;550	ENSP00000386454:S772W;ENSP00000386619:S805W;ENSP00000386724:S772W;ENSP00000415541:S805W;ENSP00000386981:S550W	ENSP00000386454:S772W	S	+	2	0	XIRP2	167823617	0.012000	0.17670	0.008000	0.14137	0.111000	0.19643	1.835000	0.39181	1.408000	0.46895	0.561000	0.74099	TCG	XIRP2	-	NULL	ENSG00000163092		0.418	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	24	0	C	NM_152381		168115371	+1	tier1	-	no_errors	ENST00000420519	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.061	G
TSIX	9383	genome.wustl.edu	37	X	73040638	73040638	+	lincRNA	SNP	G	G	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chrX:73040638G>C	ENST00000604411.1	+	0	28599				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		AGACTCAAAAGAGATTCTGCA	0.358																																																	0													32.0	31.0	31.0					X																	73040638		875	1991	2866			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73040638G>C				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.358	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	-	0.00	54	0	G	NR_003255		73040638	-1	tier1	-	no_errors	ENST00000416330	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.001	C
XKR5	389610	genome.wustl.edu	37	8	6669805	6669805	+	RNA	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr8:6669805G>T	ENST00000518724.1	-	0	1126							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		AGCCCTGCCAGATGTCTGTGG	0.473																																																	0													23.0	23.0	23.0					8																	6669805		1856	4057	5913			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6669805G>T			Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.473	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	-	0.00	46	0	G	NM_207411		6669805	-1	tier1	-	no_errors	ENST00000405979	ensembl	human	known	74_37	rna	5.71	66	4	SNP	0.991	T
ZFR2	23217	genome.wustl.edu	37	19	3819165	3819165	+	Silent	SNP	C	C	T	rs558923847		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:3819165C>T	ENST00000262961.4	-	12	1819	c.1809G>A	c.(1807-1809)acG>acA	p.T603T		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	603	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCTCCTGCTCCGTGGGGTAGA	0.726													C|||	1	0.000199681	0.0	0.0	5008	,	,		14995	0.0		0.0	False		,,,				2504	0.001																0													20.0	24.0	23.0					19																	3819165		2013	4150	6163	SO:0001819	synonymous_variant	0			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1809G>A	19.37:g.3819165C>T				Silent	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.T603	ENST00000262961.4	37	c.1809	CCDS45921.1	19																																																																																			ZFR2	-	NULL	ENSG00000105278		0.726	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	-	0.00	27	0	C	NM_015174		3819165	-1	tier1	-	no_errors	ENST00000262961	ensembl	human	known	74_37	silent	30.00	7	3	SNP	0.508	T
XRCC1	7515	genome.wustl.edu	37	19	44056236	44056236	+	Nonsense_Mutation	SNP	G	G	A	rs574450911		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:44056236G>A	ENST00000262887.5	-	9	1562	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*	L34079.3_ENST00000597119.1_RNA|XRCC1_ENST00000543982.1_Nonsense_Mutation_p.R308*			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	339	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				GCCTTATCTCGCAGCTCGGAG	0.657								Other BER factors																																									0													88.0	85.0	86.0					19																	44056236		2203	4300	6503	SO:0001587	stop_gained	0			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1015C>T	19.37:g.44056236G>A	ENSP00000262887:p.Arg339*		Q6IBS4|Q9HCB1	Nonsense_Mutation	SNP	pfam_Xrcc1_N,pfam_BRCT_dom,superfamily_Galactose-bd-like,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.R339*	ENST00000262887.5	37	c.1015	CCDS12624.1	19	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685109	0.88639	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982;ENST00000538738	.	.	.	4.7	4.7	0.59300	.	0.118724	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0145	15.5193	0.75854	0.0:0.0:1.0:0.0	.	.	.	.	X	353;339;308;339	.	ENSP00000262887:R339X	R	-	1	2	XRCC1	48748076	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	4.482000	0.60257	2.601000	0.87937	0.561000	0.74099	CGA	XRCC1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000073050		0.657	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	HGNC	protein_coding	OTTHUMT00000463194.1	-	0.00	144	0	G	NM_006297		44056236	-1	tier1	-	no_errors	ENST00000262887	ensembl	human	known	74_37	nonsense	21.14	97	26	SNP	1.000	A
ZIC4	84107	genome.wustl.edu	37	3	147104282	147104282	+	3'UTR	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:147104282A>C	ENST00000383075.3	-	0	3881				ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000425731.3_3'UTR|ZIC4_ENST00000525172.2_3'UTR|ZIC4-AS1_ENST00000462168.1_RNA	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						ATCAGGAAGAACATTTTGCAG	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*2364T>G	3.37:g.147104282A>C			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.333	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	45	0	A			147104282	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	15.79	32	6	SNP	1.000	C
ZIC4	84107	genome.wustl.edu	37	3	147124453	147124453	+	5'UTR	DEL	T	T	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr3:147124453delT	ENST00000383075.3	-	0	194				ZIC4_ENST00000425731.3_5'Flank|ZIC4_ENST00000484399.1_5'Flank|ZIC1_ENST00000282928.4_5'Flank|ZIC4_ENST00000473123.1_5'Flank|ZIC4_ENST00000491672.1_5'UTR|ZIC4_ENST00000525172.2_5'Flank	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AACCCACAACTTTTTTTTTTC	0.448																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-319A>-	3.37:g.147124453delT			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	DEL	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.448	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1		0.00	37	0	T			147124453	-1	tier1		no_errors	ENST00000464144	ensembl	human	putative	74_37	rna	11.36	39	5	DEL	1.000	-
ZNF106	64397	genome.wustl.edu	37	15	42740536	42740536	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr15:42740536delT	ENST00000263805.4	-	3	3126	c.2800delA	c.(2800-2802)aggfs	p.R935fs	ZNF106_ENST00000565611.1_Frame_Shift_Del_p.R120fs|ZNF106_ENST00000565380.1_Frame_Shift_Del_p.R163fs	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	935					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTATGTCGCCTTTGGGTAGCA	0.483																																																	0													198.0	199.0	199.0					15																	42740536		2203	4299	6502	SO:0001589	frameshift_variant	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.2800delA	15.37:g.42740536delT	ENSP00000263805:p.Arg935fs		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R934fs	ENST00000263805.4	37	c.2800	CCDS32208.1	15																																																																																			ZNF106	-	NULL	ENSG00000103994		0.483	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF106	HGNC	protein_coding	OTTHUMT00000422587.1		0.00	23	0	T	NM_022473		42740536	-1	tier1		no_errors	ENST00000263805	ensembl	human	known	74_37	frame_shift_del	7.14	26	2	DEL	0.467	-
ZNF347	84671	genome.wustl.edu	37	19	53644920	53644920	+	Silent	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:53644920G>A	ENST00000334197.7	-	5	1229	c.1161C>T	c.(1159-1161)agC>agT	p.S387S	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Silent_p.S388S|ZNF347_ENST00000452676.2_Silent_p.S388S	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GGATAGCTAAGCTTGAACGAG	0.413																																					Melanoma(64;205 1597 17324 45721)												0													98.0	100.0	99.0					19																	53644920		2203	4300	6503	SO:0001819	synonymous_variant	0			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1161C>T	19.37:g.53644920G>A			B3KU77|B9EG59|G5E9N4|Q8TCN1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S388	ENST00000334197.7	37	c.1164	CCDS33097.1	19																																																																																			ZNF347	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197937		0.413	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1		0.00	78	0	G	NM_032584		53644920	-1			no_errors	ENST00000452676	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.000	A
ZNF407	55628	genome.wustl.edu	37	18	72775418	72775418	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:72775418C>T	ENST00000299687.5	+	8	5741	c.5741C>T	c.(5740-5742)aCg>aTg	p.T1914M		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1914					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GTCATCGCCACGAGTCAGAGC	0.706																																																	0													12.0	15.0	14.0					18																	72775418		2180	4265	6445	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5741C>T	18.37:g.72775418C>T	ENSP00000299687:p.Thr1914Met		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.T1914M	ENST00000299687.5	37	c.5741	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292118	0.23564	.	.	ENSG00000215421	ENST00000299687	T	0.14022	2.54	4.83	4.83	0.62350	.	.	.	.	.	T	0.21186	0.0510	L	0.40543	1.245	0.28869	N	0.89509	D	0.76494	0.999	P	0.53185	0.72	T	0.32107	-0.9919	9	0.87932	D	0	.	11.4498	0.50145	0.0:0.9175:0.0:0.0825	.	1914	Q9C0G0	ZN407_HUMAN	M	1914	ENSP00000299687:T1914M	ENSP00000299687:T1914M	T	+	2	0	ZNF407	70904406	0.959000	0.32827	0.000000	0.03702	0.007000	0.05969	5.335000	0.65929	-1.715000	0.01389	-2.223000	0.00295	ACG	ZNF407	-	NULL	ENSG00000215421		0.706	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	-	0.00	86	0	C	NM_017757		72775418	+1	tier1	-	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.000	T
ZNF407	55628	genome.wustl.edu	37	18	72776180	72776180	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:72776180C>T	ENST00000299687.5	+	8	6503	c.6503C>T	c.(6502-6504)aCg>aTg	p.T2168M		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAGGGCACCACGCACTACATC	0.657																																																	0													22.0	28.0	26.0					18																	72776180		2152	4260	6412	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6503C>T	18.37:g.72776180C>T	ENSP00000299687:p.Thr2168Met		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.T2168M	ENST00000299687.5	37	c.6503	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	c	12.27	1.887942	0.33348	.	.	ENSG00000215421	ENST00000299687	T	0.20598	2.06	4.63	4.63	0.57726	.	.	.	.	.	T	0.48768	0.1518	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.32161	-0.9917	9	0.87932	D	0	.	17.4935	0.87711	0.0:1.0:0.0:0.0	.	2168	Q9C0G0	ZN407_HUMAN	M	2168	ENSP00000299687:T2168M	ENSP00000299687:T2168M	T	+	2	0	ZNF407	70905168	0.995000	0.38212	0.044000	0.18714	0.188000	0.23474	4.352000	0.59404	-2.757000	0.00371	-0.461000	0.05368	ACG	ZNF407	-	NULL	ENSG00000215421		0.657	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	-	0.00	60	0	C	NM_017757		72776180	+1	tier1	-	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.031	T
ZNF441	126068	genome.wustl.edu	37	19	11891521	11891521	+	Missense_Mutation	SNP	C	C	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:11891521C>G	ENST00000357901.4	+	4	984	c.882C>G	c.(880-882)agC>agG	p.S294R	ZNF441_ENST00000454339.2_Missense_Mutation_p.S227R	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATCTTGGAAGCTTTCAAAGAC	0.388																																																	0													100.0	101.0	101.0					19																	11891521		2203	4300	6503	SO:0001583	missense	0			AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.882C>G	19.37:g.11891521C>G	ENSP00000350576:p.Ser294Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S294R	ENST00000357901.4	37	c.882	CCDS12266.2	19	.	.	.	.	.	.	.	.	.	.	-	14.63	2.593284	0.46214	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.15952	2.38;2.38	1.18	0.0583	0.14327	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15696	0.0378	L	0.57130	1.785	0.09310	N	1	B	0.28605	0.217	B	0.33295	0.161	T	0.35724	-0.9777	9	0.21014	T	0.42	.	5.3775	0.16174	0.0:0.6377:0.0:0.3623	.	294	Q8N8Z8	ZN441_HUMAN	R	250;294;227	ENSP00000350576:S294R;ENSP00000403738:S227R	ENSP00000350576:S294R	S	+	3	2	ZNF441	11752521	0.000000	0.05858	0.002000	0.10522	0.831000	0.47069	-1.864000	0.01650	0.073000	0.16731	0.298000	0.19748	AGC	ZNF441	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197044		0.388	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF441	HGNC	protein_coding	OTTHUMT00000335273.3	-	0.00	87	0	C	NM_152355		11891521	+1	tier1	-	no_errors	ENST00000357901	ensembl	human	known	74_37	missense	18.27	85	19	SNP	0.005	G
ZNF429	353088	genome.wustl.edu	37	19	21719663	21719663	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:21719663T>G	ENST00000358491.4	+	4	1016	c.808T>G	c.(808-810)Tca>Gca	p.S270A	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	270				Missing (in Ref. 2; AAP30884 and 3; AAK01422). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TAGCAGGTACTCAACCCTTAC	0.388																																																	0													39.0	43.0	42.0					19																	21719663		2138	4274	6412	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.808T>G	19.37:g.21719663T>G	ENSP00000351280:p.Ser270Ala		A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S270A	ENST00000358491.4	37	c.808	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	10.19	1.283076	0.23392	.	.	ENSG00000197013	ENST00000358491	T	0.07327	3.2	0.876	-1.6	0.08426	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07458	0.0188	M	0.62016	1.91	0.09310	N	1	B	0.27229	0.172	B	0.18871	0.023	T	0.36672	-0.9738	9	0.44086	T	0.13	.	2.284	0.04122	0.2493:0.0:0.2477:0.5029	.	270	Q86V71	ZN429_HUMAN	A	270	ENSP00000351280:S270A	ENSP00000351280:S270A	S	+	1	0	ZNF429	21511503	0.000000	0.05858	0.053000	0.19242	0.053000	0.15095	-1.868000	0.01644	0.251000	0.21505	0.248000	0.18094	TCA	ZNF429	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197013		0.388	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	-	0.00	43	0	T	NM_001001415		21719663	+1	tier1	-	no_errors	ENST00000358491	ensembl	human	novel	74_37	missense	35.94	41	23	SNP	0.000	G
ZNF492	57615	genome.wustl.edu	37	19	22848044	22848044	+	Silent	SNP	A	A	C			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:22848044A>C	ENST00000456783.2	+	4	1817	c.1573A>C	c.(1573-1575)Aga>Cga	p.R525R	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	525					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CAAATATAAAAGAAATTGTGC	0.323																																																	0													20.0	19.0	19.0					19																	22848044		1771	4016	5787	SO:0001819	synonymous_variant	0			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1573A>C	19.37:g.22848044A>C			Q08EI7|Q08EI8	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R525	ENST00000456783.2	37	c.1573	CCDS46032.1	19																																																																																			ZNF492	-	NULL	ENSG00000229676		0.323	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	-	0.00	56	0	A	NM_020855		22848044	+1	tier1	-	no_errors	ENST00000456783	ensembl	human	known	74_37	silent	15.91	37	7	SNP	0.429	C
ZNF496	84838	genome.wustl.edu	37	1	247486494	247486494	+	Missense_Mutation	SNP	G	G	A	rs148779406		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr1:247486494G>A	ENST00000294753.4	-	5	1077	c.613C>T	c.(613-615)Cgg>Tgg	p.R205W	ZNF496_ENST00000366498.2_Missense_Mutation_p.R205W	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	205					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			TGTGTGTCCCGCACATTCTCT	0.537																																																	0								G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	80.0	73.0	75.0		613	0.3	0.0	1	dbSNP_134	75	0,8600		0,0,4300	yes	missense	ZNF496	NM_032752.1	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	205/588	247486494	2,13004	2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.613C>T	1.37:g.247486494G>A	ENSP00000294753:p.Arg205Trp		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R205W	ENST00000294753.4	37	c.613	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459253	0.63401	4.54E-4	0.0	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.08634	3.07;3.16	3.87	0.267	0.15622	.	0.665977	0.13893	N	0.355457	T	0.12817	0.0311	L	0.27053	0.805	0.09310	N	1	D;D	0.89917	1.0;0.999	D;P	0.74674	0.984;0.853	T	0.15838	-1.0423	10	0.72032	D	0.01	-13.5204	5.1148	0.14829	0.0:0.1119:0.4504:0.4377	.	205;205	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	W	205	ENSP00000294753:R205W;ENSP00000355454:R205W	ENSP00000294753:R205W	R	-	1	2	ZNF496	245553117	0.011000	0.17503	0.034000	0.17996	0.721000	0.41392	0.128000	0.15810	0.028000	0.15324	-0.397000	0.06425	CGG	ZNF496	-	NULL	ENSG00000162714		0.537	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	36	0	G	NM_032752		247486494	-1	tier1	rs148779406	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	23.53	25	8	SNP	0.043	A
ZNF516	9658	genome.wustl.edu	37	18	74154913	74154913	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr18:74154913C>T	ENST00000443185.2	-	3	415	c.98G>A	c.(97-99)tGc>tAc	p.C33Y	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	33					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GCAGGTGTGGCAGGTAGCCTT	0.657																																																	0													38.0	47.0	44.0					18																	74154913		2178	4273	6451	SO:0001583	missense	0			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.98G>A	18.37:g.74154913C>T	ENSP00000394757:p.Cys33Tyr			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C33Y	ENST00000443185.2	37	c.98		18	.	.	.	.	.	.	.	.	.	.	C	8.140	0.784999	0.16189	.	.	ENSG00000101493	ENST00000443185;ENST00000532857	T;T	0.06528	3.29;3.29	4.75	3.86	0.44501	.	0.158047	0.44285	D	0.000477	T	0.05410	0.0143	.	.	.	0.09310	N	1	P	0.51653	0.947	B	0.41374	0.355	T	0.35674	-0.9779	9	0.38643	T	0.18	-26.6264	6.9968	0.24786	0.3305:0.5896:0.0:0.08	.	33	Q92618	ZN516_HUMAN	Y	33	ENSP00000394757:C33Y;ENSP00000446211:C33Y	ENSP00000394757:C33Y	C	-	2	0	ZNF516	72283901	0.852000	0.29690	0.323000	0.25347	0.081000	0.17604	2.297000	0.43593	1.089000	0.41292	0.561000	0.74099	TGC	ZNF516	-	NULL	ENSG00000101493		0.657	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	HGNC	protein_coding			0.00	55	0	C	NM_014643		74154913	-1			no_errors	ENST00000443185	ensembl	human	known	74_37	missense	6.35	58	4	SNP	0.003	T
ZNF66	7617	genome.wustl.edu	37	19	20989285	20989285	+	Silent	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:20989285T>G	ENST00000344519.8	+	4	902	c.879T>G	c.(877-879)gtT>gtG	p.V293V	ZNF66_ENST00000425625.1_Silent_p.V339V|AC010329.1_ENST00000582722.1_RNA			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GTGGCAAAGTTTTTAAGTACC	0.393																																																	0																																										SO:0001819	synonymous_variant	0			M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.879T>G	19.37:g.20989285T>G			I3L4P5|Q15939	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V293	ENST00000344519.8	37	c.879		19																																																																																			ZNF66	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160229		0.393	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	ZNF66	HGNC	protein_coding	OTTHUMT00000395955.2	-	0.00	40	0	T	NG_023377		20989285	+1	tier1	-	no_errors	ENST00000344519	ensembl	human	known	74_37	silent	29.63	38	16	SNP	0.006	G
ZNF667	63934	genome.wustl.edu	37	19	56952705	56952705	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:56952705T>G	ENST00000504904.3	-	7	2378	c.1659A>C	c.(1657-1659)aaA>aaC	p.K553N	ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000292069.6_Missense_Mutation_p.K553N|ZNF667_ENST00000342634.3_Missense_Mutation_p.K681N			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	553					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		ATTCATAGGGTTTCTCTCCAG	0.408																																																	0													102.0	95.0	97.0					19																	56952705		2203	4300	6503	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1659A>C	19.37:g.56952705T>G	ENSP00000439402:p.Lys553Asn		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K681N	ENST00000504904.3	37	c.2043	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627045	0.66901	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518;ENST00000360227	T;T;T	0.26067	1.76;1.76;1.76	4.81	-4.78	0.03209	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.159985	0.29239	N	0.012725	T	0.42787	0.1218	M	0.70595	2.14	0.29063	N	0.883768	D;D	0.76494	0.997;0.999	D;D	0.68943	0.961;0.961	T	0.46843	-0.9162	10	0.87932	D	0	-14.4903	14.35	0.66694	0.0:0.6005:0.0:0.3995	.	681;553	E7EPS0;Q5HYK9	.;ZN667_HUMAN	N	681;553;553;335;268	ENSP00000344699:K681N;ENSP00000439402:K553N;ENSP00000292069:K553N	ENSP00000292069:K553N	K	-	3	2	ZNF667	61644517	0.000000	0.05858	0.941000	0.38009	0.982000	0.71751	-2.102000	0.01343	-1.048000	0.03238	0.533000	0.62120	AAA	ZNF667	-	pfscan_Znf_C2H2	ENSG00000198046		0.408	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	63	0	T	NM_022103		56952705	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	26.09	51	18	SNP	0.885	G
ZNF679	168417	genome.wustl.edu	37	7	63727240	63727240	+	Missense_Mutation	SNP	G	G	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:63727240G>T	ENST00000421025.1	+	5	1498	c.1229G>T	c.(1228-1230)tGt>tTt	p.C410F	ZNF679_ENST00000255746.4_Missense_Mutation_p.C410F	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						CCCTACAAATGTGAATAATGT	0.348																																																	0													17.0	16.0	16.0					7																	63727240		692	1590	2282	SO:0001583	missense	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.1229G>T	7.37:g.63727240G>T	ENSP00000416809:p.Cys410Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C410F	ENST00000421025.1	37	c.1229	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258040	0.39896	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.39229	1.09;1.09	0.819	0.819	0.18785	.	.	.	.	.	T	0.70334	0.3212	H	0.97540	4.025	0.36554	D	0.872011	D	0.89917	1.0	D	0.91635	0.999	T	0.70857	-0.4758	9	0.87932	D	0	.	4.7943	0.13265	0.0:0.0:1.0:0.0	.	410	Q8IYX0	ZN679_HUMAN	F	410	ENSP00000416809:C410F;ENSP00000255746:C410F	ENSP00000255746:C410F	C	+	2	0	ZNF679	63364675	1.000000	0.71417	0.294000	0.24946	0.295000	0.27426	4.933000	0.63484	0.191000	0.20236	0.194000	0.17425	TGT	ZNF679	-	NULL	ENSG00000197123		0.348	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	-	0.00	67	0	G	NM_153363		63727240	+1	tier1	-	no_errors	ENST00000255746	ensembl	human	known	74_37	missense	20.25	63	16	SNP	0.877	T
ZNF726	730087	genome.wustl.edu	37	19	24116573	24116573	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:24116573T>G	ENST00000594466.1	+	4	1760	c.1655T>G	c.(1654-1656)cTt>cGt	p.L552R	ZNF726_ENST00000322487.7_Missense_Mutation_p.L552R|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000334589.5_Intron	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCCTCAAATCTTAGTACACAT	0.353																																																	0																																										SO:0001583	missense	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.1655T>G	19.37:g.24116573T>G	ENSP00000471516:p.Leu552Arg		M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L552R	ENST00000594466.1	37	c.1655	CCDS59372.1	19	.	.	.	.	.	.	.	.	.	.	t	9.197	1.027530	0.19512	.	.	ENSG00000213967	ENST00000322487	T	0.53640	0.61	0.814	0.814	0.18756	.	.	.	.	.	T	0.43389	0.1245	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41251	-0.9519	6	0.87932	D	0	.	5.4337	0.16469	0.0:0.0:0.0:1.0	.	.	.	.	R	552	ENSP00000317125:L552R	ENSP00000317125:L552R	L	+	2	0	ZNF726	23908413	0.204000	0.23447	0.328000	0.25416	0.326000	0.28443	2.741000	0.47426	0.158000	0.19367	0.156000	0.16432	CTT	ZNF726	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213967		0.353	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF726	HGNC	protein_coding	OTTHUMT00000466443.1	-	0.00	27	0	T	XM_001715134		24116573	+1	tier1	-	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	35.19	35	19	SNP	0.040	G
ZNF831	128611	genome.wustl.edu	37	20	57767078	57767078	+	Missense_Mutation	SNP	G	G	A			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr20:57767078G>A	ENST00000371030.2	+	1	1004	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	335							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCCGAGGGCCGGCTGCGGAAG	0.726																																																	0													12.0	14.0	13.0					20																	57767078		1724	3876	5600	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1004G>A	20.37:g.57767078G>A	ENSP00000360069:p.Arg335Gln		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R335Q	ENST00000371030.2	37	c.1004	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	G	15.26	2.782213	0.49891	.	.	ENSG00000124203	ENST00000371030	T	0.04083	3.71	5.4	2.02	0.26589	.	.	.	.	.	T	0.02304	0.0071	N	0.22421	0.69	0.23645	N	0.997218	P	0.40834	0.73	B	0.24541	0.054	T	0.46428	-0.9192	9	0.23302	T	0.38	-6.3691	5.2893	0.15717	0.581:0.0:0.419:0.0	.	335	Q5JPB2	ZN831_HUMAN	Q	335	ENSP00000360069:R335Q	ENSP00000360069:R335Q	R	+	2	0	ZNF831	57200473	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	2.022000	0.41030	0.654000	0.30846	-0.136000	0.14681	CGG	ZNF831	-	NULL	ENSG00000124203		0.726	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	35	0	G	NM_178457		57767078	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	18.52	22	5	SNP	1.000	A
ZNF98	148198	genome.wustl.edu	37	19	22585671	22585671	+	Missense_Mutation	SNP	T	T	G			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:22585671T>G	ENST00000357774.5	-	3	294	c.173A>C	c.(172-174)aAg>aCg	p.K58T	ZNF98_ENST00000601553.1_Missense_Mutation_p.K58T	NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CAGGTCTGGCTTAGAGGCAGC	0.398																																																	0													81.0	86.0	85.0					19																	22585671		2184	4294	6478	SO:0001583	missense	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.173A>C	19.37:g.22585671T>G	ENSP00000350418:p.Lys58Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K58T	ENST00000357774.5	37	c.173	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	13.90	2.376408	0.42105	.	.	ENSG00000197360	ENST00000357774	T	0.00922	5.54	0.476	0.476	0.16779	Krueppel-associated box (3);	.	.	.	.	T	0.01661	0.0053	M	0.78637	2.42	0.21184	N	0.999766	B	0.34290	0.447	B	0.34242	0.178	T	0.35176	-0.9799	8	0.87932	D	0	.	.	.	.	.	58	A6NK75	ZNF98_HUMAN	T	58	ENSP00000350418:K58T	ENSP00000350418:K58T	K	-	2	0	ZNF98	22377511	0.297000	0.24408	0.830000	0.32933	0.960000	0.62799	1.242000	0.32755	0.447000	0.26695	0.248000	0.18094	AAG	ZNF98	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197360		0.398	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	81	0	T	NM_001098626		22585671	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	30.60	93	41	SNP	0.839	G
ZPBP	11055	genome.wustl.edu	37	7	50121488	50121488	+	Silent	SNP	C	C	T	rs144577669		TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr7:50121488C>T	ENST00000046087.2	-	3	285	c.216G>A	c.(214-216)gcG>gcA	p.A72A	ZPBP_ENST00000419417.1_Silent_p.A72A	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	72					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					GCATGACATACGCTTTCACTG	0.353																																																	0								T	,	1,4403	824.7+/-416.5	0,1,2201	116.0	106.0	109.0		216,216	-7.5	0.9	7	dbSNP_134	109	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	ZPBP	NM_001159878.1,NM_007009.2	,	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	,	72/351,72/352	50121488	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	0			D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.216G>A	7.37:g.50121488C>T			A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Silent	SNP	pfam_Sp38-bd,pfscan_Ig-like_dom	p.A72	ENST00000046087.2	37	c.216	CCDS5509.1	7																																																																																			ZPBP	-	pfscan_Ig-like_dom	ENSG00000042813		0.353	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP	HGNC	protein_coding	OTTHUMT00000251374.1	-	0.00	45	0	C	NM_007009		50121488	-1	tier1	rs144577669	no_errors	ENST00000046087	ensembl	human	known	74_37	silent	16.39	51	10	SNP	0.765	T
ZSCAN5B	342933	genome.wustl.edu	37	19	56701744	56701744	+	Missense_Mutation	SNP	C	C	T			TCGA-2H-A9GR-01A-12D-A37C-09	TCGA-2H-A9GR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	122ce68f-739f-4847-bb70-254c1c862092	db7e7534-137c-4892-abae-b339e839e605	g.chr19:56701744C>T	ENST00000586855.2	-	5	1253	c.940G>A	c.(940-942)Gaa>Aaa	p.E314K	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.E314K			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	314					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GGTGTGGCTTCTCCTTGAGGC	0.552																																																	0													105.0	110.0	109.0					19																	56701744		2203	4300	6503	SO:0001583	missense	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.940G>A	19.37:g.56701744C>T	ENSP00000466072:p.Glu314Lys			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E314K	ENST00000586855.2	37	c.940	CCDS46203.1	19	.	.	.	.	.	.	.	.	.	.	C	4.970	0.180095	0.09443	.	.	ENSG00000197213	ENST00000358992	T	0.05855	3.38	0.97	-0.151	0.13411	.	.	.	.	.	T	0.04137	0.0115	L	0.36672	1.1	0.09310	N	1	B	0.23937	0.094	B	0.19666	0.026	T	0.47209	-0.9135	9	0.07325	T	0.83	.	5.308	0.15815	0.0:0.7758:0.0:0.2242	.	314	A6NJL1	ZSA5B_HUMAN	K	314	ENSP00000351883:E314K	ENSP00000351883:E314K	E	-	1	0	ZSCAN5B	61393556	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.007000	0.03667	-0.003000	0.14444	0.306000	0.20318	GAA	ZSCAN5B	-	NULL	ENSG00000197213		0.552	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	-	0.00	102	0	C	NM_001080456		56701744	-1	tier1	-	no_errors	ENST00000358992	ensembl	human	known	74_37	missense	30.68	60	27	SNP	0.000	T
