#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACAD9	28976	genome.wustl.edu	37	3	128614245	128614245	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:128614245G>T	ENST00000308982.7	+	4	520	c.439G>T	c.(439-441)Gct>Tct	p.A147S		NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	147						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						AGCGCACCAGGCTATTGGCCT	0.562																																																	0													113.0	92.0	99.0					3																	128614245		2203	4300	6503	SO:0001583	missense	0			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.439G>T	3.37:g.128614245G>T	ENSP00000312618:p.Ala147Ser		D3DNB8|Q8WXX3	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.A147S	ENST00000308982.7	37	c.439	CCDS3053.1	3	.	.	.	.	.	.	.	.	.	.	G	7.231	0.599344	0.13939	.	.	ENSG00000177646	ENST00000308982;ENST00000514336;ENST00000334167	D;D	0.99683	-6.39;-6.39	5.46	3.63	0.41609	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.050353	0.85682	N	0.000000	D	0.95465	0.8527	N	0.00408	-1.53	0.58432	D	0.999997	B;B	0.19817	0.002;0.039	B;B	0.23275	0.006;0.045	D	0.93719	0.7031	10	0.02654	T	1	.	13.0109	0.58731	0.0:0.0:0.7071:0.2929	.	24;147	Q9H9W4;Q9H845	.;ACAD9_HUMAN	S	147;159;14	ENSP00000312618:A147S;ENSP00000423758:A159S	ENSP00000312618:A147S	A	+	1	0	ACAD9	130096935	1.000000	0.71417	0.996000	0.52242	0.939000	0.58152	3.167000	0.50793	0.762000	0.33152	0.655000	0.94253	GCT	ACAD9	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom	ENSG00000177646		0.562	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD9	HGNC	protein_coding	OTTHUMT00000358405.1		0.00	32	0	G	NM_014049		128614245	+1			no_errors	ENST00000308982	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
ABCF3	55324	genome.wustl.edu	37	3	183907232	183907232	+	Splice_Site	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:183907232G>A	ENST00000429586.2	+	12	1298		c.e12+1		ABCF3_ENST00000292808.5_Splice_Site|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3						defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTACCTGCAGGTGAGTGCCTG	0.592																																																	0													78.0	74.0	76.0					3																	183907232		2203	4300	6503	SO:0001630	splice_region_variant	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1113+1G>A	3.37:g.183907232G>A			A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Splice_Site	SNP	-	e12+1	ENST00000429586.2	37	c.1113+1	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483918	0.63962	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7803	0.85562	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCF3	185389926	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.926000	0.92839	2.205000	0.71048	0.467000	0.42956	.	ABCF3	-	-	ENSG00000161204		0.592	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	-	0.00	26	0	G	NM_018358	Intron	183907232	+1	tier1	-	no_errors	ENST00000429586	ensembl	human	known	74_37	splice_site	17.91	55	12	SNP	1.000	A
ABCF3	55324	genome.wustl.edu	37	3	183907232	183907232	+	Splice_Site	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:183907232G>A	ENST00000429586.2	+	12	1298		c.e12+1		ABCF3_ENST00000292808.5_Splice_Site|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3						defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTACCTGCAGGTGAGTGCCTG	0.592																																																	0													78.0	74.0	76.0					3																	183907232		2203	4300	6503	SO:0001630	splice_region_variant	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1113+1G>A	3.37:g.183907232G>A			A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Splice_Site	SNP	-	e12+1	ENST00000429586.2	37	c.1113+1	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483918	0.63962	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7803	0.85562	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCF3	185389926	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.926000	0.92839	2.205000	0.71048	0.467000	0.42956	.	ABCF3	-	-	ENSG00000161204		0.592	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	-	0.00	35	0	G	NM_018358	Intron	183907232	+1	tier1	-	no_errors	ENST00000429586	ensembl	human	known	74_37	splice_site	17.91	55	12	SNP	1.000	A
ACOXL	55289	genome.wustl.edu	37	2	111542371	111542371	+	Silent	SNP	G	G	A	rs375666693		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:111542371G>A	ENST00000389811.4	+	3	362	c.138G>A	c.(136-138)gcG>gcA	p.A46A	ACOXL_ENST00000439055.1_Silent_p.A46A|ACOXL_ENST00000340561.4_Silent_p.A46A			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	46					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TCTCCATGGCGGACATGGCCA	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		15526	0.001		0.0	False		,,,				2504	0.0																0								G		1,3811		0,1,1905	56.0	59.0	58.0		138	-9.4	0.0	2		58	0,8278		0,0,4139	no	coding-synonymous	ACOXL	NM_001142807.1		0,1,6044	AA,AG,GG		0.0,0.0262,0.0083		46/581	111542371	1,12089	1906	4139	6045	SO:0001819	synonymous_variant	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.138G>A	2.37:g.111542371G>A			A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Silent	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	p.A46	ENST00000389811.4	37	c.138		2																																																																																			ACOXL	-	superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	ENSG00000153093		0.483	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	ACOXL	HGNC	protein_coding	OTTHUMT00000254024.2	-	0.00	29	0	G	NM_018308		111542371	+1	tier1	-	no_errors	ENST00000439055	ensembl	human	known	74_37	silent	40.43	28	19	SNP	0.003	A
ADAD1	132612	genome.wustl.edu	37	4	123333900	123333900	+	Silent	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:123333900T>C	ENST00000296513.2	+	10	1370	c.1185T>C	c.(1183-1185)ctT>ctC	p.L395L	ADAD1_ENST00000388724.2_Silent_p.L384L|ADAD1_ENST00000388725.2_Silent_p.L377L	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	395	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GGGAAGTGCTTGGTGTACAGG	0.413																																																	0													240.0	227.0	231.0					4																	123333900		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1185T>C	4.37:g.123333900T>C			A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.L395	ENST00000296513.2	37	c.1185	CCDS34058.1	4																																																																																			ADAD1	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000164113		0.413	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	-	0.00	35	0	T	NM_139243		123333900	+1	tier1	-	no_errors	ENST00000296513	ensembl	human	known	74_37	silent	21.21	26	7	SNP	0.998	C
ADAD1	132612	genome.wustl.edu	37	4	123333900	123333900	+	Silent	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:123333900T>C	ENST00000296513.2	+	10	1370	c.1185T>C	c.(1183-1185)ctT>ctC	p.L395L	ADAD1_ENST00000388724.2_Silent_p.L384L|ADAD1_ENST00000388725.2_Silent_p.L377L	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	395	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						GGGAAGTGCTTGGTGTACAGG	0.413																																																	0													240.0	227.0	231.0					4																	123333900		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.1185T>C	4.37:g.123333900T>C			A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.L395	ENST00000296513.2	37	c.1185	CCDS34058.1	4																																																																																			ADAD1	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000164113		0.413	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	-	0.00	47	0	T	NM_139243		123333900	+1	tier1	-	no_errors	ENST00000296513	ensembl	human	known	74_37	silent	21.21	26	7	SNP	0.998	C
ADAMTS20	80070	genome.wustl.edu	37	12	43925975	43925975	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:43925975G>A	ENST00000389420.3	-	3	476	c.477C>T	c.(475-477)aaC>aaT	p.N159N	ADAMTS20_ENST00000553158.1_Silent_p.N159N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	159					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AATATTCACCGTTCTGTCCTT	0.338																																																	0													127.0	131.0	130.0					12																	43925975		2202	4300	6502	SO:0001819	synonymous_variant	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.477C>T	12.37:g.43925975G>A			A6NNC9|J3QT00	Silent	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.N159	ENST00000389420.3	37	c.477	CCDS31778.2	12																																																																																			ADAMTS20	-	pfam_Peptidase_M12B_N	ENSG00000173157		0.338	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	36	0	G	NM_025003		43925975	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	silent	29.79	33	14	SNP	1.000	A
ADAMTS20	80070	genome.wustl.edu	37	12	43925975	43925975	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:43925975G>A	ENST00000389420.3	-	3	476	c.477C>T	c.(475-477)aaC>aaT	p.N159N	ADAMTS20_ENST00000553158.1_Silent_p.N159N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	159					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AATATTCACCGTTCTGTCCTT	0.338																																																	0													127.0	131.0	130.0					12																	43925975		2202	4300	6502	SO:0001819	synonymous_variant	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.477C>T	12.37:g.43925975G>A			A6NNC9|J3QT00	Silent	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.N159	ENST00000389420.3	37	c.477	CCDS31778.2	12																																																																																			ADAMTS20	-	pfam_Peptidase_M12B_N	ENSG00000173157		0.338	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	40	0	G	NM_025003		43925975	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	silent	29.79	33	14	SNP	1.000	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18680353	18680353	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:18680353G>A	ENST00000380548.4	+	11	1519	c.1180G>A	c.(1180-1182)Ggg>Agg	p.G394R	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.G394R|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.G377R|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.G394R	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	394	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CTCGTGTGGGGGGGGCATCCA	0.592																																																	0													54.0	50.0	51.0					9																	18680353		2203	4300	6503	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1180G>A	9.37:g.18680353G>A	ENSP00000369921:p.Gly394Arg		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.G394R	ENST00000380548.4	37	c.1180	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.364107	0.95877	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380566;ENST00000276935	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	6.17	6.17	0.99709	.	.	.	.	.	T	0.68430	0.3000	L	0.58354	1.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.986	T	0.67130	-0.5748	9	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	394;377	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	R	394;394;377;394	ENSP00000369921:G394R;ENSP00000327887:G394R;ENSP00000369940:G377R;ENSP00000276935:G394R	ENSP00000276935:G394R	G	+	1	0	ADAMTSL1	18670353	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.807000	0.99171	2.941000	0.99782	0.655000	0.94253	GGG	ADAMTSL1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.592	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	27	0	G			18680353	+1	tier1	-	no_errors	ENST00000327883	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18680353	18680353	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:18680353G>A	ENST00000380548.4	+	11	1519	c.1180G>A	c.(1180-1182)Ggg>Agg	p.G394R	ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.G394R|ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.G377R|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.G394R	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	394	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CTCGTGTGGGGGGGGCATCCA	0.592																																																	0													54.0	50.0	51.0					9																	18680353		2203	4300	6503	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1180G>A	9.37:g.18680353G>A	ENSP00000369921:p.Gly394Arg		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.G394R	ENST00000380548.4	37	c.1180	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.364107	0.95877	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380566;ENST00000276935	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	6.17	6.17	0.99709	.	.	.	.	.	T	0.68430	0.3000	L	0.58354	1.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.986	T	0.67130	-0.5748	9	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	394;377	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	R	394;394;377;394	ENSP00000369921:G394R;ENSP00000327887:G394R;ENSP00000369940:G377R;ENSP00000276935:G394R	ENSP00000276935:G394R	G	+	1	0	ADAMTSL1	18670353	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.807000	0.99171	2.941000	0.99782	0.655000	0.94253	GGG	ADAMTSL1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.592	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	64	0	G			18680353	+1	tier1	-	no_errors	ENST00000327883	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	A
ADAR	103	genome.wustl.edu	37	1	154560661	154560661	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:154560661G>T	ENST00000368474.4	-	11	3158	c.2959C>A	c.(2959-2961)Cgc>Agc	p.R987S	ADAR_ENST00000292205.5_Missense_Mutation_p.R1030S|ADAR_ENST00000368471.3_Missense_Mutation_p.R692S	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	987	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GGGTAGTGGCGGGATTCTGTG	0.547																																																	0													202.0	189.0	193.0					1																	154560661		2203	4300	6503	SO:0001583	missense	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2959C>A	1.37:g.154560661G>T	ENSP00000357459:p.Arg987Ser		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.R1030S	ENST00000368474.4	37	c.3088	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291579	0.40494	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.14266	2.72;2.72;2.52;2.72	5.44	4.48	0.54585	Adenosine deaminase/editase (3);	0.543163	0.17956	N	0.156345	T	0.11153	0.0272	L	0.41492	1.28	0.25380	N	0.988624	P;P;D	0.76494	0.87;0.931;0.999	B;P;D	0.85130	0.433;0.697;0.997	T	0.12451	-1.0547	10	0.29301	T	0.29	-5.2876	5.5149	0.16900	0.0803:0.1359:0.6434:0.1404	.	942;961;987	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	S	1030;987;692;956	ENSP00000292205:R1030S;ENSP00000357459:R987S;ENSP00000357456:R692S;ENSP00000431794:R956S	ENSP00000292205:R1030S	R	-	1	0	ADAR	152827285	0.992000	0.36948	0.986000	0.45419	0.348000	0.29142	1.918000	0.40006	1.193000	0.43086	-0.355000	0.07637	CGC	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000160710		0.547	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	-	0.00	48	0	G	NM_001111		154560661	-1	tier1	-	no_errors	ENST00000292205	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.600	T
ADAR	103	genome.wustl.edu	37	1	154560661	154560661	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:154560661G>T	ENST00000368474.4	-	11	3158	c.2959C>A	c.(2959-2961)Cgc>Agc	p.R987S	ADAR_ENST00000292205.5_Missense_Mutation_p.R1030S|ADAR_ENST00000368471.3_Missense_Mutation_p.R692S	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	987	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GGGTAGTGGCGGGATTCTGTG	0.547																																																	0													202.0	189.0	193.0					1																	154560661		2203	4300	6503	SO:0001583	missense	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2959C>A	1.37:g.154560661G>T	ENSP00000357459:p.Arg987Ser		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.R1030S	ENST00000368474.4	37	c.3088	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291579	0.40494	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.14266	2.72;2.72;2.52;2.72	5.44	4.48	0.54585	Adenosine deaminase/editase (3);	0.543163	0.17956	N	0.156345	T	0.11153	0.0272	L	0.41492	1.28	0.25380	N	0.988624	P;P;D	0.76494	0.87;0.931;0.999	B;P;D	0.85130	0.433;0.697;0.997	T	0.12451	-1.0547	10	0.29301	T	0.29	-5.2876	5.5149	0.16900	0.0803:0.1359:0.6434:0.1404	.	942;961;987	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	S	1030;987;692;956	ENSP00000292205:R1030S;ENSP00000357459:R987S;ENSP00000357456:R692S;ENSP00000431794:R956S	ENSP00000292205:R1030S	R	-	1	0	ADAR	152827285	0.992000	0.36948	0.986000	0.45419	0.348000	0.29142	1.918000	0.40006	1.193000	0.43086	-0.355000	0.07637	CGC	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000160710		0.547	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	-	0.00	65	0	G	NM_001111		154560661	-1	tier1	-	no_errors	ENST00000292205	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.600	T
ADORA2A	135	genome.wustl.edu	37	22	24836880	24836880	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:24836880C>A	ENST00000337539.7	+	3	1121	c.662C>A	c.(661-663)gCa>gAa	p.A221E	ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A_ENST00000496497.1_3'UTR|ADORA2A-AS1_ENST00000543438.1_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	221					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	GGGGAGCGGGCACGGTCCACA	0.622																																																	0													142.0	140.0	141.0					22																	24836880		2203	4300	6503	SO:0001583	missense	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.662C>A	22.37:g.24836880C>A	ENSP00000336630:p.Ala221Glu		B2R7E0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt,prints_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.A221E	ENST00000337539.7	37	c.662	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	C	5.488	0.275005	0.10403	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.38887	1.11;1.11	5.13	5.13	0.70059	GPCR, rhodopsin-like superfamily (1);	0.539758	0.20761	N	0.086165	T	0.29716	0.0742	N	0.11818	0.18	0.21802	N	0.999532	B	0.19817	0.039	B	0.25405	0.06	T	0.14008	-1.0488	10	0.29301	T	0.29	-4.8694	17.5681	0.87926	0.0:1.0:0.0:0.0	.	221	P29274	AA2AR_HUMAN	E	221	ENSP00000414802:A221E;ENSP00000336630:A221E	ENSP00000336630:A221E	A	+	2	0	ADORA2A	23166880	0.830000	0.29337	0.007000	0.13788	0.097000	0.18754	7.598000	0.82745	2.385000	0.81259	0.462000	0.41574	GCA	ADORA2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt	ENSG00000128271		0.622	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	-	0.00	22	0	C	NM_000675		24836880	+1	tier1	-	no_errors	ENST00000337539	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.350	A
AGAP5	729092	genome.wustl.edu	37	10	75435611	75435611	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:75435611C>T	ENST00000374094.4	-	8	847	c.807G>A	c.(805-807)ccG>ccA	p.P269P	AGAP5_ENST00000443782.2_Silent_p.P246P|RP11-464F9.1_ENST00000399449.3_RNA|RP11-464F9.21_ENST00000607450.1_RNA	NM_001144000.1	NP_001137472.1	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 5	269					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.P246P(2)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(5)|skin(1)	12						CATGATTCTCCGGGGCTTTCC	0.537																																																	2	Substitution - coding silent(2)	lung(2)											3.0	4.0	4.0					10																	75435611		86	574	660	SO:0001819	synonymous_variant	0				CCDS44439.1	10q22.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000172650	ENSG00000172650		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23467	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 2"""	CTGLF2			Standard	NM_001144000		Approved	Em:AC073389.1	uc009xri.3	A6NIR3	OTTHUMG00000018473	ENST00000374094.4:c.807G>A	10.37:g.75435611C>T			A8MSN5	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.P269	ENST00000374094.4	37	c.807	CCDS44439.1	10																																																																																			AGAP5	-	NULL	ENSG00000172650		0.537	AGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP5	HGNC	protein_coding		-	0.00	187	0	C	XM_001132585		75435611	-1	tier1	-	no_errors	ENST00000374094	ensembl	human	known	74_37	silent	40.62	209	143	SNP	1.000	T
ALG13	79868	genome.wustl.edu	37	X	110928199	110928199	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:110928199G>T	ENST00000394780.3	+	3	263	c.251G>T	c.(250-252)gGa>gTa	p.G84V	ALG13_ENST00000251943.4_5'UTR|ALG13_ENST00000371979.3_Missense_Mutation_p.G84V	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	84	Glycosyltransferase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						GTAGGTGCAGGAAGCTGTTTG	0.363																																																	0													171.0	180.0	177.0					X																	110928199		2203	4300	6503	SO:0001583	missense	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.251G>T	X.37:g.110928199G>T	ENSP00000378260:p.Gly84Val		B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	pfam_Glyco_trans_28_C	p.G84V	ENST00000394780.3	37	c.251	CCDS55477.1	X	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689298	0.88735	.	.	ENSG00000101901	ENST00000371979;ENST00000486353;ENST00000394780	T;T;T	0.80824	-1.42;-1.42;-1.42	6.17	6.17	0.99709	Glycosyl transferase, family 28, C-terminal (1);	.	.	.	.	D	0.90717	0.7087	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.985	D	0.91154	0.4955	8	0.87932	D	0	.	19.3367	0.94322	0.0:0.0:1.0:0.0	.	6;84;84	Q9NP73-3;Q9NP73;Q9NP73-2	.;ALG13_HUMAN;.	V	84	ENSP00000361047:G84V;ENSP00000426892:G84V;ENSP00000378260:G84V	ENSP00000361047:G84V	G	+	2	0	ALG13	110814855	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.892000	0.92491	2.618000	0.88619	0.600000	0.82982	GGA	ALG13	-	pfam_Glyco_trans_28_C	ENSG00000101901		0.363	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	-	0.00	46	0	G	NM_018466		110928199	+1	tier1	-	no_errors	ENST00000371979	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
ALG13	79868	genome.wustl.edu	37	X	110928199	110928199	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:110928199G>T	ENST00000394780.3	+	3	263	c.251G>T	c.(250-252)gGa>gTa	p.G84V	ALG13_ENST00000251943.4_5'UTR|ALG13_ENST00000371979.3_Missense_Mutation_p.G84V	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	84	Glycosyltransferase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						GTAGGTGCAGGAAGCTGTTTG	0.363																																																	0													171.0	180.0	177.0					X																	110928199		2203	4300	6503	SO:0001583	missense	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.251G>T	X.37:g.110928199G>T	ENSP00000378260:p.Gly84Val		B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	pfam_Glyco_trans_28_C	p.G84V	ENST00000394780.3	37	c.251	CCDS55477.1	X	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689298	0.88735	.	.	ENSG00000101901	ENST00000371979;ENST00000486353;ENST00000394780	T;T;T	0.80824	-1.42;-1.42;-1.42	6.17	6.17	0.99709	Glycosyl transferase, family 28, C-terminal (1);	.	.	.	.	D	0.90717	0.7087	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.985	D	0.91154	0.4955	8	0.87932	D	0	.	19.3367	0.94322	0.0:0.0:1.0:0.0	.	6;84;84	Q9NP73-3;Q9NP73;Q9NP73-2	.;ALG13_HUMAN;.	V	84	ENSP00000361047:G84V;ENSP00000426892:G84V;ENSP00000378260:G84V	ENSP00000361047:G84V	G	+	2	0	ALG13	110814855	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.892000	0.92491	2.618000	0.88619	0.600000	0.82982	GGA	ALG13	-	pfam_Glyco_trans_28_C	ENSG00000101901		0.363	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	-	0.00	72	0	G	NM_018466		110928199	+1	tier1	-	no_errors	ENST00000371979	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46515719	46515719	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:46515719C>T	ENST00000458649.2	-	10	2793	c.2375G>A	c.(2374-2376)cGc>cAc	p.R792H	AMBRA1_ENST00000298834.3_Missense_Mutation_p.R732H|AMBRA1_ENST00000314845.3_Missense_Mutation_p.R702H|AMBRA1_ENST00000529963.1_5'UTR|AMBRA1_ENST00000533727.1_Missense_Mutation_p.R673H|AMBRA1_ENST00000534300.1_Missense_Mutation_p.R732H|AMBRA1_ENST00000426438.1_Missense_Mutation_p.R763H|AMBRA1_ENST00000528950.1_Missense_Mutation_p.R763H			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	792					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CCGGGCATTGCGTGGAGCTCG	0.488																																																	0													55.0	49.0	51.0					11																	46515719		2201	4299	6500	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2375G>A	11.37:g.46515719C>T	ENSP00000415327:p.Arg792His		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R792H	ENST00000458649.2	37	c.2375		11	.	.	.	.	.	.	.	.	.	.	C	33	5.219222	0.95139	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.92665	0.7669	L	0.29908	0.895	0.38626	D	0.951262	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.83275	0.996;0.994;0.994;0.994;0.996;0.994	D	0.94380	0.7604	10	0.87932	D	0	.	18.8277	0.92124	0.0:1.0:0.0:0.0	.	792;763;732;673;795;702	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	H	702;673;732;763;732;792;763	ENSP00000318313:R702H;ENSP00000433372:R673H;ENSP00000431926:R732H;ENSP00000410899:R763H;ENSP00000298834:R732H;ENSP00000415327:R792H;ENSP00000433945:R763H	ENSP00000298834:R732H	R	-	2	0	AMBRA1	46472295	1.000000	0.71417	0.991000	0.47740	0.980000	0.70556	7.105000	0.77031	2.522000	0.85027	0.650000	0.86243	CGC	AMBRA1	-	NULL	ENSG00000110497		0.488	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	41	0	C	NM_017749		46515719	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46515719	46515719	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:46515719C>T	ENST00000458649.2	-	10	2793	c.2375G>A	c.(2374-2376)cGc>cAc	p.R792H	AMBRA1_ENST00000298834.3_Missense_Mutation_p.R732H|AMBRA1_ENST00000314845.3_Missense_Mutation_p.R702H|AMBRA1_ENST00000529963.1_5'UTR|AMBRA1_ENST00000533727.1_Missense_Mutation_p.R673H|AMBRA1_ENST00000534300.1_Missense_Mutation_p.R732H|AMBRA1_ENST00000426438.1_Missense_Mutation_p.R763H|AMBRA1_ENST00000528950.1_Missense_Mutation_p.R763H			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	792					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CCGGGCATTGCGTGGAGCTCG	0.488																																																	0													55.0	49.0	51.0					11																	46515719		2201	4299	6500	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2375G>A	11.37:g.46515719C>T	ENSP00000415327:p.Arg792His		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R792H	ENST00000458649.2	37	c.2375		11	.	.	.	.	.	.	.	.	.	.	C	33	5.219222	0.95139	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.92665	0.7669	L	0.29908	0.895	0.38626	D	0.951262	D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.83275	0.996;0.994;0.994;0.994;0.996;0.994	D	0.94380	0.7604	10	0.87932	D	0	.	18.8277	0.92124	0.0:1.0:0.0:0.0	.	792;763;732;673;795;702	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	H	702;673;732;763;732;792;763	ENSP00000318313:R702H;ENSP00000433372:R673H;ENSP00000431926:R732H;ENSP00000410899:R763H;ENSP00000298834:R732H;ENSP00000415327:R792H;ENSP00000433945:R763H	ENSP00000298834:R732H	R	-	2	0	AMBRA1	46472295	1.000000	0.71417	0.991000	0.47740	0.980000	0.70556	7.105000	0.77031	2.522000	0.85027	0.650000	0.86243	CGC	AMBRA1	-	NULL	ENSG00000110497		0.488	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	56	0	C	NM_017749		46515719	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	T
AMOT	154796	genome.wustl.edu	37	X	112048235	112048235	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:112048235G>T	ENST00000524145.1	-	6	1790	c.1716C>A	c.(1714-1716)atC>atA	p.I572I	AMOT_ENST00000371959.3_Silent_p.I572I|AMOT_ENST00000304758.1_Silent_p.I163I|AMOT_ENST00000371958.1_Silent_p.I340I|AMOT_ENST00000371962.1_Silent_p.I340I			Q4VCS5	AMOT_HUMAN	angiomotin	572					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CTCGGATTTCGATGTGTCGTC	0.527																																																	0													275.0	227.0	243.0					X																	112048235		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1716C>A	X.37:g.112048235G>T			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.I572	ENST00000524145.1	37	c.1716	CCDS48154.1	X																																																																																			AMOT	-	NULL	ENSG00000126016		0.527	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	53	0	G	NM_133265		112048235	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	silent	29.51	43	18	SNP	0.809	T
AMOT	154796	genome.wustl.edu	37	X	112048235	112048235	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:112048235G>T	ENST00000524145.1	-	6	1790	c.1716C>A	c.(1714-1716)atC>atA	p.I572I	AMOT_ENST00000371959.3_Silent_p.I572I|AMOT_ENST00000304758.1_Silent_p.I163I|AMOT_ENST00000371958.1_Silent_p.I340I|AMOT_ENST00000371962.1_Silent_p.I340I			Q4VCS5	AMOT_HUMAN	angiomotin	572					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CTCGGATTTCGATGTGTCGTC	0.527																																																	0													275.0	227.0	243.0					X																	112048235		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1716C>A	X.37:g.112048235G>T			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.I572	ENST00000524145.1	37	c.1716	CCDS48154.1	X																																																																																			AMOT	-	NULL	ENSG00000126016		0.527	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	83	0	G	NM_133265		112048235	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	silent	29.51	43	18	SNP	0.809	T
ANKRD23	200539	genome.wustl.edu	37	2	97507832	97507833	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:97507832_97507833delTG	ENST00000318357.4	-	3	305_306	c.264_265delCA	c.(262-267)cacagafs	p.HR88fs	ANKRD23_ENST00000476975.1_5'UTR|ANKRD23_ENST00000418232.1_Frame_Shift_Del_p.HR88fs|ANKRD23_ENST00000331001.2_Frame_Shift_Del_p.HR88fs	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	88					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						GGGGGGACTCTGTGTCTCAGTC	0.525																																																	0																																										SO:0001589	frameshift_variant	0				CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.264_265delCA	2.37:g.97507834_97507835delTG	ENSP00000321679:p.His88fs		Q711K7|Q8NAJ7	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H88fs	ENST00000318357.4	37	c.265_264	CCDS2027.1	2																																																																																			ANKRD23	-	NULL	ENSG00000163126		0.525	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD23	HGNC	protein_coding	OTTHUMT00000252956.1		0.00	61	0	TG	NM_144994		97507833	-1	tier1		no_errors	ENST00000318357	ensembl	human	known	74_37	frame_shift_del	22.12	81	23	DEL	0.830:0.775	-
ANKRD23	200539	genome.wustl.edu	37	2	97507832	97507833	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:97507832_97507833delTG	ENST00000318357.4	-	3	305_306	c.264_265delCA	c.(262-267)cacagafs	p.HR88fs	ANKRD23_ENST00000476975.1_5'UTR|ANKRD23_ENST00000418232.1_Frame_Shift_Del_p.HR88fs|ANKRD23_ENST00000331001.2_Frame_Shift_Del_p.HR88fs	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	88					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						GGGGGGACTCTGTGTCTCAGTC	0.525																																																	0																																										SO:0001589	frameshift_variant	0				CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.264_265delCA	2.37:g.97507834_97507835delTG	ENSP00000321679:p.His88fs		Q711K7|Q8NAJ7	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H88fs	ENST00000318357.4	37	c.265_264	CCDS2027.1	2																																																																																			ANKRD23	-	NULL	ENSG00000163126		0.525	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD23	HGNC	protein_coding	OTTHUMT00000252956.1		0.00	78	0	TG	NM_144994		97507833	-1	tier1		no_errors	ENST00000318357	ensembl	human	known	74_37	frame_shift_del	22.12	81	23	DEL	0.830:0.775	-
ANKRD30B	374860	genome.wustl.edu	37	18	14851558	14851558	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr18:14851558G>T	ENST00000358984.4	+	36	3438	c.3258G>T	c.(3256-3258)atG>atT	p.M1086I		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1086										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAAATTGCATGTTGAAAAAGG	0.308																																																	0													5.0	8.0	7.0					18																	14851558		673	1521	2194	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3258G>T	18.37:g.14851558G>T	ENSP00000351875:p.Met1086Ile		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1086I	ENST00000358984.4	37	c.3258	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	2.833	-0.242132	0.05906	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15017	2.46	1.48	1.48	0.22813	.	.	.	.	.	T	0.11239	0.0274	L	0.42245	1.32	0.09310	N	0.999997	P;P	0.46020	0.797;0.871	B;B	0.34722	0.064;0.188	T	0.20371	-1.0277	9	0.46703	T	0.11	.	5.7324	0.18047	0.0:0.3445:0.6555:0.0	.	1171;1086	Q9BXX2;F8WAG3	AN30B_HUMAN;.	I	1086;480;506	ENSP00000351875:M1086I	ENSP00000277669:M506I	M	+	3	0	ANKRD30B	14841558	0.019000	0.18553	0.645000	0.29479	0.343000	0.28985	-0.448000	0.06820	1.139000	0.42245	0.173000	0.16961	ATG	ANKRD30B	-	NULL	ENSG00000180777		0.308	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	45	0	G	NM_001145029		14851558	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	5.88	63	4	SNP	0.930	T
ANKRD30B	374860	genome.wustl.edu	37	18	14851558	14851558	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr18:14851558G>T	ENST00000358984.4	+	36	3438	c.3258G>T	c.(3256-3258)atG>atT	p.M1086I		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1086										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAAATTGCATGTTGAAAAAGG	0.308																																																	0													5.0	8.0	7.0					18																	14851558		673	1521	2194	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3258G>T	18.37:g.14851558G>T	ENSP00000351875:p.Met1086Ile		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1086I	ENST00000358984.4	37	c.3258	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	2.833	-0.242132	0.05906	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15017	2.46	1.48	1.48	0.22813	.	.	.	.	.	T	0.11239	0.0274	L	0.42245	1.32	0.09310	N	0.999997	P;P	0.46020	0.797;0.871	B;B	0.34722	0.064;0.188	T	0.20371	-1.0277	9	0.46703	T	0.11	.	5.7324	0.18047	0.0:0.3445:0.6555:0.0	.	1171;1086	Q9BXX2;F8WAG3	AN30B_HUMAN;.	I	1086;480;506	ENSP00000351875:M1086I	ENSP00000277669:M506I	M	+	3	0	ANKRD30B	14841558	0.019000	0.18553	0.645000	0.29479	0.343000	0.28985	-0.448000	0.06820	1.139000	0.42245	0.173000	0.16961	ATG	ANKRD30B	-	NULL	ENSG00000180777		0.308	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	47	0	G	NM_001145029		14851558	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	5.88	63	4	SNP	0.930	T
ANKRD36BP2	645784	genome.wustl.edu	37	2	89102628	89102629	+	RNA	DEL	TG	TG	-	rs143444338|rs570826603|rs1905666	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:89102628_89102629delTG	ENST00000393525.3	+	0	3102_3103									ankyrin repeat domain 36B pseudogene 2																		TTTATACATATGTTTTTTTCTT	0.248														1638	0.327077	0.3321	0.3012	5008	,	,		21192	0.3065		0.334	False		,,,				2504	0.3528																0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89102628_89102629delTG				RNA	DEL	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.248	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1		0.00	20	0	TG			89102629	+1			no_errors	ENST00000393525	ensembl	human	known	74_37	rna	19.18	59	14	DEL	0.002:0.002	0
ANKRD53	79998	genome.wustl.edu	37	2	71211838	71211838	+	Missense_Mutation	SNP	G	G	A	rs545687883	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:71211838G>A	ENST00000360589.3	+	6	1035	c.1001G>A	c.(1000-1002)cGg>cAg	p.R334Q	ANKRD53_ENST00000272421.6_3'UTR|ANKRD53_ENST00000441349.1_3'UTR|ANKRD53_ENST00000457410.1_Missense_Mutation_p.R300Q|AC007040.11_ENST00000606025.1_Intron	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	334										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						AAGCAAGCCCGGGCCACCGCC	0.587											OREG0014687	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													51.0	59.0	57.0					2																	71211838		692	1591	2283	SO:0001583	missense	0			BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.1001G>A	2.37:g.71211838G>A	ENSP00000353796:p.Arg334Gln	1128	Q8IYP8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R334Q	ENST00000360589.3	37	c.1001	CCDS46321.1	2	.	.	.	.	.	.	.	.	.	.	G	3.861	-0.029918	0.07543	.	.	ENSG00000144031	ENST00000457410;ENST00000360589	T;T	0.63255	0.05;-0.03	4.6	-2.59	0.06209	.	1.910350	0.02603	N	0.101241	T	0.34745	0.0908	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.26326	-1.0106	10	0.07813	T	0.8	-0.5391	5.5927	0.17309	0.4989:0.1423:0.3588:0.0	.	334	Q8N9V6	ANR53_HUMAN	Q	300;334	ENSP00000407004:R300Q;ENSP00000353796:R334Q	ENSP00000353796:R334Q	R	+	2	0	ANKRD53	71065346	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.192000	0.03052	-0.693000	0.05121	-1.224000	0.01588	CGG	ANKRD53	-	NULL	ENSG00000144031		0.587	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD53	HGNC	protein_coding	OTTHUMT00000330275.2	-	0.00	61	0	G	NM_024933		71211838	+1	tier1	-	no_errors	ENST00000360589	ensembl	human	putative	74_37	missense	18.89	73	17	SNP	0.000	A
ANKRD53	79998	genome.wustl.edu	37	2	71211838	71211838	+	Missense_Mutation	SNP	G	G	A	rs545687883	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:71211838G>A	ENST00000360589.3	+	6	1035	c.1001G>A	c.(1000-1002)cGg>cAg	p.R334Q	ANKRD53_ENST00000272421.6_3'UTR|ANKRD53_ENST00000441349.1_3'UTR|ANKRD53_ENST00000457410.1_Missense_Mutation_p.R300Q|AC007040.11_ENST00000606025.1_Intron	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	334										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						AAGCAAGCCCGGGCCACCGCC	0.587											OREG0014687	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													51.0	59.0	57.0					2																	71211838		692	1591	2283	SO:0001583	missense	0			BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.1001G>A	2.37:g.71211838G>A	ENSP00000353796:p.Arg334Gln	1128	Q8IYP8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R334Q	ENST00000360589.3	37	c.1001	CCDS46321.1	2	.	.	.	.	.	.	.	.	.	.	G	3.861	-0.029918	0.07543	.	.	ENSG00000144031	ENST00000457410;ENST00000360589	T;T	0.63255	0.05;-0.03	4.6	-2.59	0.06209	.	1.910350	0.02603	N	0.101241	T	0.34745	0.0908	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.26326	-1.0106	10	0.07813	T	0.8	-0.5391	5.5927	0.17309	0.4989:0.1423:0.3588:0.0	.	334	Q8N9V6	ANR53_HUMAN	Q	300;334	ENSP00000407004:R300Q;ENSP00000353796:R334Q	ENSP00000353796:R334Q	R	+	2	0	ANKRD53	71065346	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.192000	0.03052	-0.693000	0.05121	-1.224000	0.01588	CGG	ANKRD53	-	NULL	ENSG00000144031		0.587	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD53	HGNC	protein_coding	OTTHUMT00000330275.2	-	0.00	74	0	G	NM_024933		71211838	+1	tier1	-	no_errors	ENST00000360589	ensembl	human	putative	74_37	missense	18.89	73	17	SNP	0.000	A
ANO7	50636	genome.wustl.edu	37	2	242149770	242149770	+	Missense_Mutation	SNP	G	G	T	rs148053897		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:242149770G>T	ENST00000274979.8	+	14	1685	c.1582G>T	c.(1582-1584)Gtg>Ttg	p.V528L	ANO7_ENST00000402430.3_Missense_Mutation_p.V527L	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	528					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CATGGCCATCGTGGTGTCCAG	0.677																																																	0													111.0	88.0	96.0					2																	242149770		2203	4300	6503	SO:0001583	missense	0			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1582G>T	2.37:g.242149770G>T	ENSP00000274979:p.Val528Leu		Q6IWH6	Missense_Mutation	SNP	pfam_Anoctamin	p.V528L	ENST00000274979.8	37	c.1582	CCDS33423.1	2	.	.	.	.	.	.	.	.	.	.	G	3.450	-0.112191	0.06881	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.63744	-0.06;-0.06	3.38	-3.41	0.04839	.	1.183530	0.06297	N	0.700150	T	0.33030	0.0849	N	0.05330	-0.07	0.21697	N	0.999589	B	0.10296	0.003	B	0.12837	0.008	T	0.10590	-1.0623	10	0.20046	T	0.44	.	2.0883	0.03650	0.2899:0.1491:0.4221:0.1389	.	528	Q6IWH7	ANO7_HUMAN	L	528;527	ENSP00000274979:V528L;ENSP00000385418:V527L	ENSP00000274979:V528L	V	+	1	0	ANO7	241798443	0.000000	0.05858	0.296000	0.24974	0.650000	0.38633	-1.448000	0.02394	-0.503000	0.06586	-0.802000	0.03209	GTG	ANO7	-	pfam_Anoctamin	ENSG00000146205		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	HGNC	protein_coding	OTTHUMT00000323509.1	-	0.00	28	0	G	NM_001001891		242149770	+1	tier1	-	no_errors	ENST00000274979	ensembl	human	known	74_37	missense	51.52	16	17	SNP	0.724	T
ARGFX	503582	genome.wustl.edu	37	3	121305141	121305141	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:121305141G>T	ENST00000334384.3	+	4	652	c.642G>T	c.(640-642)gtG>gtT	p.V214V		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		AGAGGCTGGTGGCCTCGGTTC	0.463																																																	0													125.0	126.0	126.0					3																	121305141		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.642G>T	3.37:g.121305141G>T				Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V214	ENST00000334384.3	37	c.642	CCDS33834.1	3																																																																																			ARGFX	-	NULL	ENSG00000186103		0.463	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGFX	HGNC	protein_coding	OTTHUMT00000355096.2	-	0.00	63	0	G	NM_001012659		121305141	+1	tier1	-	no_errors	ENST00000334384	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.164	T
ARHGAP19	84986	genome.wustl.edu	37	10	98985868	98985868	+	3'UTR	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:98985868C>T	ENST00000358531.4	-	0	1524				ARHGAP19-SLIT1_ENST00000316676.8_Intron|ARHGAP19_ENST00000371027.1_3'UTR|ARHGAP19-SLIT1_ENST00000453547.2_Intron|ARHGAP19_ENST00000355366.5_Intron|ARHGAP19_ENST00000487035.1_5'UTR	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		TAGGAGACAACTCTGGATCCT	0.418																																																	0													86.0	82.0	83.0					10																	98985868		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.*11G>A	10.37:g.98985868C>T			A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	RNA	SNP	-	NULL	ENST00000358531.4	37	NULL	CCDS7454.2	10																																																																																			ARHGAP19	-	-	ENSG00000213390		0.418	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP19	HGNC	protein_coding	OTTHUMT00000049647.2	-	0.00	23	0	C	NM_032900		98985868	-1	tier1	-	no_errors	ENST00000487035	ensembl	human	known	74_37	rna	27.66	34	13	SNP	0.015	T
ARHGAP19	84986	genome.wustl.edu	37	10	98985868	98985868	+	3'UTR	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:98985868C>T	ENST00000358531.4	-	0	1524				ARHGAP19-SLIT1_ENST00000316676.8_Intron|ARHGAP19_ENST00000371027.1_3'UTR|ARHGAP19-SLIT1_ENST00000453547.2_Intron|ARHGAP19_ENST00000355366.5_Intron|ARHGAP19_ENST00000487035.1_5'UTR	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		TAGGAGACAACTCTGGATCCT	0.418																																																	0													86.0	82.0	83.0					10																	98985868		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.*11G>A	10.37:g.98985868C>T			A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	RNA	SNP	-	NULL	ENST00000358531.4	37	NULL	CCDS7454.2	10																																																																																			ARHGAP19	-	-	ENSG00000213390		0.418	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP19	HGNC	protein_coding	OTTHUMT00000049647.2	-	0.00	25	0	C	NM_032900		98985868	-1	tier1	-	no_errors	ENST00000487035	ensembl	human	known	74_37	rna	27.66	34	13	SNP	0.015	T
ARHGEF2	9181	genome.wustl.edu	37	1	155936636	155936636	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:155936636G>A	ENST00000361247.4	-	3	350	c.251C>T	c.(250-252)gCc>gTc	p.A84V	ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A84V|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A57V|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A85V|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A129V|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A57V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	84					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGTACAGTTGGCGAGGGTGTC	0.597																																					Melanoma(178;35 2768 6610 28839)												0													200.0	158.0	172.0					1																	155936636		2203	4300	6503	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.251C>T	1.37:g.155936636G>A	ENSP00000354837:p.Ala84Val		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.A85V	ENST00000361247.4	37	c.254	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420981	0.83559	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83	4.93	4.93	0.64822	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.000000	0.43260	D	0.000598	D	0.83087	0.5178	L	0.54323	1.7	0.39076	D	0.960814	P;P;D;P	0.57257	0.672;0.892;0.979;0.934	B;P;P;P	0.51135	0.313;0.459;0.628;0.66	D	0.83423	0.0034	10	0.42905	T	0.14	-25.0149	15.6876	0.77424	0.0:0.0:1.0:0.0	.	129;129;84;84	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	V	57;84;85;57;129;57;84	ENSP00000315325:A57V;ENSP00000354837:A84V;ENSP00000357298:A85V;ENSP00000357299:A57V;ENSP00000314787:A84V	ENSP00000314787:A84V	A	-	2	0	ARHGEF2	154203260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.754000	0.91642	2.551000	0.86045	0.655000	0.94253	GCC	ARHGEF2	-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000116584		0.597	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	-	0.00	15	0	G	NM_004723		155936636	-1	tier1	-	no_errors	ENST00000368315	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	A
ARHGEF2	9181	genome.wustl.edu	37	1	155936636	155936636	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:155936636G>A	ENST00000361247.4	-	3	350	c.251C>T	c.(250-252)gCc>gTc	p.A84V	ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A84V|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A57V|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A85V|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A129V|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A57V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	84					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGTACAGTTGGCGAGGGTGTC	0.597																																					Melanoma(178;35 2768 6610 28839)												0													200.0	158.0	172.0					1																	155936636		2203	4300	6503	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.251C>T	1.37:g.155936636G>A	ENSP00000354837:p.Ala84Val		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.A85V	ENST00000361247.4	37	c.254	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420981	0.83559	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83	4.93	4.93	0.64822	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.000000	0.43260	D	0.000598	D	0.83087	0.5178	L	0.54323	1.7	0.39076	D	0.960814	P;P;D;P	0.57257	0.672;0.892;0.979;0.934	B;P;P;P	0.51135	0.313;0.459;0.628;0.66	D	0.83423	0.0034	10	0.42905	T	0.14	-25.0149	15.6876	0.77424	0.0:0.0:1.0:0.0	.	129;129;84;84	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	V	57;84;85;57;129;57;84	ENSP00000315325:A57V;ENSP00000354837:A84V;ENSP00000357298:A85V;ENSP00000357299:A57V;ENSP00000314787:A84V	ENSP00000314787:A84V	A	-	2	0	ARHGEF2	154203260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.754000	0.91642	2.551000	0.86045	0.655000	0.94253	GCC	ARHGEF2	-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000116584		0.597	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	-	0.00	30	0	G	NM_004723		155936636	-1	tier1	-	no_errors	ENST00000368315	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	A
ARMS2	387715	genome.wustl.edu	37	10	124214282	124214282	+	Silent	SNP	G	G	T	rs200123144		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:124214282G>T	ENST00000528446.1	+	1	114	c.39G>T	c.(37-39)gcG>gcT	p.A13A		NM_001099667.1	NP_001093137.1	P0C7Q2	ARMS2_HUMAN	age-related maculopathy susceptibility 2	13					retina homeostasis (GO:0001895)	mitochondrion (GO:0005739)|photoreceptor inner segment (GO:0001917)				ovary(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TAACTGAGGCGGAGGGGAAAG	0.572																																																	0													113.0	119.0	117.0					10																	124214282		2049	4193	6242	SO:0001819	synonymous_variant	0			BC066349	CCDS53585.1	10q26.13	2013-01-23			ENSG00000254636	ENSG00000254636			32685	protein-coding gene	gene with protein product		611313				16080115, 16174643	Standard	NM_001099667		Approved	LOC387715, ARMD8	uc001lgi.3	P0C7Q2	OTTHUMG00000048232	ENST00000528446.1:c.39G>T	10.37:g.124214282G>T			B2Y7I5	Silent	SNP	NULL	p.A13	ENST00000528446.1	37	c.39	CCDS53585.1	10																																																																																			ARMS2	-	NULL	ENSG00000254636		0.572	ARMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMS2	HGNC	protein_coding	OTTHUMT00000109727.2	-	0.00	44	0	G			124214282	+1	tier1	-	no_errors	ENST00000528446	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.000	T
ASPM	259266	genome.wustl.edu	37	1	197093437	197093437	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:197093437G>T	ENST00000367409.4	-	13	3449	c.3193C>A	c.(3193-3195)Caa>Aaa	p.Q1065K	ASPM_ENST00000367408.1_Missense_Mutation_p.Q315K|ASPM_ENST00000294732.7_Missense_Mutation_p.Q1065K	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1065					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCCTTTAATTGATCTAAGTTA	0.264																																																	0													53.0	56.0	55.0					1																	197093437		2197	4274	6471	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3193C>A	1.37:g.197093437G>T	ENSP00000356379:p.Gln1065Lys		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.Q1065K	ENST00000367409.4	37	c.3193	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041566	0.75732	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.59502	0.26;0.26;0.26	5.53	2.37	0.29283	Calponin homology domain (1);	0.259107	0.33309	N	0.005057	T	0.64305	0.2586	L	0.53729	1.69	0.40456	D	0.980197	P;D	0.57899	0.666;0.981	B;P	0.54924	0.162;0.764	T	0.66752	-0.5844	10	0.36615	T	0.2	.	16.4412	0.83901	0.0:0.3699:0.6301:0.0	.	1065;1065	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	K	1065;1065;315	ENSP00000356379:Q1065K;ENSP00000294732:Q1065K;ENSP00000356378:Q315K	ENSP00000294732:Q1065K	Q	-	1	0	ASPM	195360060	1.000000	0.71417	0.985000	0.45067	0.988000	0.76386	4.614000	0.61183	0.781000	0.33589	0.585000	0.79938	CAA	ASPM	-	superfamily_CH-domain,superfamily_ARM-type_fold	ENSG00000066279		0.264	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1		0.00	25	0	G	NM_018136		197093437	-1			no_errors	ENST00000367409	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.943	T
ATP2C2	9914	genome.wustl.edu	37	16	84485637	84485637	+	Nonsense_Mutation	SNP	G	G	T	rs199755716		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:84485637G>T	ENST00000262429.4	+	18	1860	c.1771G>T	c.(1771-1773)Gag>Tag	p.E591*	ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Nonsense_Mutation_p.E591*	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	591					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GGTTCTCTCCGAGTCTGGTGT	0.612																																																	0													75.0	82.0	80.0					16																	84485637		2020	4184	6204	SO:0001587	stop_gained	0			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1771G>T	16.37:g.84485637G>T	ENSP00000262429:p.Glu591*		B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.E591*	ENST00000262429.4	37	c.1771	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.632760	0.96682	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	4.97	1.85	0.25348	.	0.271259	0.30227	N	0.010104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	7.4519	0.27244	0.1577:0.1441:0.6981:0.0	.	.	.	.	X	591;591;440	.	ENSP00000262429:E591X	E	+	1	0	ATP2C2	83043138	0.070000	0.21116	0.000000	0.03702	0.592000	0.36648	1.390000	0.34464	0.491000	0.27793	0.491000	0.48974	GAG	ATP2C2	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMR1	ENSG00000064270		0.612	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	HGNC	protein_coding	OTTHUMT00000433404.1	-	0.00	40	0	G	NM_014861		84485637	+1	tier1	-	no_errors	ENST00000262429	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.000	T
ATP2C2	9914	genome.wustl.edu	37	16	84485637	84485637	+	Nonsense_Mutation	SNP	G	G	T	rs199755716		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:84485637G>T	ENST00000262429.4	+	18	1860	c.1771G>T	c.(1771-1773)Gag>Tag	p.E591*	ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Nonsense_Mutation_p.E591*	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	591					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GGTTCTCTCCGAGTCTGGTGT	0.612																																																	0													75.0	82.0	80.0					16																	84485637		2020	4184	6204	SO:0001587	stop_gained	0			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1771G>T	16.37:g.84485637G>T	ENSP00000262429:p.Glu591*		B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.E591*	ENST00000262429.4	37	c.1771	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.632760	0.96682	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	4.97	1.85	0.25348	.	0.271259	0.30227	N	0.010104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	7.4519	0.27244	0.1577:0.1441:0.6981:0.0	.	.	.	.	X	591;591;440	.	ENSP00000262429:E591X	E	+	1	0	ATP2C2	83043138	0.070000	0.21116	0.000000	0.03702	0.592000	0.36648	1.390000	0.34464	0.491000	0.27793	0.491000	0.48974	GAG	ATP2C2	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMR1	ENSG00000064270		0.612	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	HGNC	protein_coding	OTTHUMT00000433404.1	-	0.00	46	0	G	NM_014861		84485637	+1	tier1	-	no_errors	ENST00000262429	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.000	T
ATP8A2	51761	genome.wustl.edu	37	13	26411318	26411318	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:26411318G>T	ENST00000381655.2	+	29	2914	c.2772G>T	c.(2770-2772)ccG>ccT	p.P924P	ATP8A2_ENST00000255283.8_Silent_p.P859P|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	884					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CCGCTTTGCCGCCCTTCACTC	0.498																																																	0													119.0	116.0	117.0					13																	26411318		1908	4126	6034	SO:0001819	synonymous_variant	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2772G>T	13.37:g.26411318G>T			Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.P924	ENST00000381655.2	37	c.2772	CCDS41873.1	13																																																																																			ATP8A2	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000132932		0.498	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2		0.00	54	0	G	NM_016529		26411318	+1			no_errors	ENST00000381655	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.006	T
BCL9	607	genome.wustl.edu	37	1	147084715	147084715	+	Silent	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:147084715T>C	ENST00000234739.3	+	5	827	c.87T>C	c.(85-87)cgT>cgC	p.R29R	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	29					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					TGATGGTCCGTCCCCCTACAG	0.502			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													87.0	90.0	89.0					1																	147084715		2203	4300	6503	SO:0001819	synonymous_variant	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.87T>C	1.37:g.147084715T>C			Q5T489	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.R29	ENST00000234739.3	37	c.87	CCDS30833.1	1																																																																																			BCL9	-	NULL	ENSG00000116128		0.502	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1		0.00	51	0	T	NM_004326		147084715	+1			no_errors	ENST00000234739	ensembl	human	known	74_37	silent	5.56	68	4	SNP	1.000	C
BMPER	168667	genome.wustl.edu	37	7	34014313	34014313	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:34014313G>T	ENST00000297161.2	+	7	867		c.e7-1		BMPER_ENST00000426693.1_Splice_Site	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator						blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTGCTTTCCAGGCTGTGTGTT	0.483																																																	0													259.0	234.0	243.0					7																	34014313		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.494-1G>T	7.37:g.34014313G>T			A8K1P8|Q8TF36	Splice_Site	SNP	-	e6-1	ENST00000297161.2	37	c.494-1	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	G	9.515	1.106893	0.20714	.	.	ENSG00000164619	ENST00000297161;ENST00000426693;ENST00000436222	.	.	.	5.33	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2728	0.60170	0.0782:0.0:0.9218:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BMPER	33980838	1.000000	0.71417	0.941000	0.38009	0.026000	0.11368	5.339000	0.65953	1.379000	0.46325	0.655000	0.94253	.	BMPER	-	-	ENSG00000164619		0.483	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	-	0.00	44	0	G	NM_133468	Intron	34014313	+1	tier1	-	no_errors	ENST00000297161	ensembl	human	known	74_37	splice_site	36.71	50	29	SNP	1.000	T
BMPER	168667	genome.wustl.edu	37	7	34014313	34014313	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:34014313G>T	ENST00000297161.2	+	7	867		c.e7-1		BMPER_ENST00000426693.1_Splice_Site	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator						blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTGCTTTCCAGGCTGTGTGTT	0.483																																																	0													259.0	234.0	243.0					7																	34014313		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.494-1G>T	7.37:g.34014313G>T			A8K1P8|Q8TF36	Splice_Site	SNP	-	e6-1	ENST00000297161.2	37	c.494-1	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	G	9.515	1.106893	0.20714	.	.	ENSG00000164619	ENST00000297161;ENST00000426693;ENST00000436222	.	.	.	5.33	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2728	0.60170	0.0782:0.0:0.9218:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BMPER	33980838	1.000000	0.71417	0.941000	0.38009	0.026000	0.11368	5.339000	0.65953	1.379000	0.46325	0.655000	0.94253	.	BMPER	-	-	ENSG00000164619		0.483	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	-	0.00	74	0	G	NM_133468	Intron	34014313	+1	tier1	-	no_errors	ENST00000297161	ensembl	human	known	74_37	splice_site	36.71	50	29	SNP	1.000	T
C11orf16	56673	genome.wustl.edu	37	11	8947409	8947409	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:8947409G>T	ENST00000326053.5	-	5	911	c.805C>A	c.(805-807)Cac>Aac	p.H269N	C11orf16_ENST00000525780.1_Missense_Mutation_p.H269N|C11orf16_ENST00000528998.1_5'Flank	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	269										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GCATGATGGTGGCAGAGAGGG	0.612																																																	0													73.0	72.0	73.0					11																	8947409		2201	4296	6497	SO:0001583	missense	0			AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.805C>A	11.37:g.8947409G>T	ENSP00000318999:p.His269Asn		Q53FB2|Q8N6Y9	Missense_Mutation	SNP	NULL	p.H269N	ENST00000326053.5	37	c.805	CCDS7794.1	11	.	.	.	.	.	.	.	.	.	.	G	3.715	-0.058658	0.07317	.	.	ENSG00000176029	ENST00000525780;ENST00000326053	T;T	0.36520	1.29;1.25	6.07	2.19	0.27852	.	1.441280	0.03770	N	0.259645	T	0.31199	0.0789	L	0.40543	1.245	0.09310	N	1	P;P	0.37276	0.589;0.589	B;B	0.38378	0.272;0.272	T	0.16129	-1.0413	10	0.27785	T	0.31	-28.6123	4.9235	0.13882	0.3499:0.1443:0.5058:0.0	.	269;269	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	N	269	ENSP00000436818:H269N;ENSP00000318999:H269N	ENSP00000318999:H269N	H	-	1	0	C11orf16	8903985	0.000000	0.05858	0.009000	0.14445	0.108000	0.19459	0.161000	0.16481	0.163000	0.19507	-0.136000	0.14681	CAC	C11orf16	-	NULL	ENSG00000176029		0.612	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf16	HGNC	protein_coding	OTTHUMT00000385626.1		0.00	35	0	G	NM_020643		8947409	-1			no_errors	ENST00000326053	ensembl	human	known	74_37	missense	5.97	62	4	SNP	0.001	T
C12orf73	728568	genome.wustl.edu	37	12	104345185	104345185	+	3'UTR	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:104345185G>T	ENST00000378090.4	-	0	537				C12orf73_ENST00000547975.1_3'UTR|C12orf73_ENST00000543740.2_5'UTR|C12orf73_ENST00000549478.1_3'UTR|C12orf73_ENST00000553183.1_3'UTR	NM_001135570.1	NP_001129042.1	Q69YU5	CL073_HUMAN	chromosome 12 open reading frame 73							extracellular region (GO:0005576)				prostate(1)	1						AACATCCACTGAGCACCTCCT	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK024037	CCDS44964.1	12q23.3	2008-10-01			ENSG00000204954	ENSG00000204954			34450	protein-coding gene	gene with protein product							Standard	NM_001135570		Approved	FLJ13975, DKFZp547P055	uc009zuj.2	Q69YU5		ENST00000378090.4:c.*116C>A	12.37:g.104345185G>T				RNA	SNP	-	NULL	ENST00000378090.4	37	NULL	CCDS44964.1	12																																																																																			C12orf73	-	-	ENSG00000204954		0.323	C12orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf73	HGNC	protein_coding	OTTHUMT00000407361.1	-	0.00	22	0	G	NM_001135570		104345185	-1	tier1	-	no_errors	ENST00000543740	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.001	T
C8A	731	genome.wustl.edu	37	1	57373691	57373691	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:57373691G>T	ENST00000361249.3	+	9	1381	c.1285G>T	c.(1285-1287)Ggc>Tgc	p.G429C		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	429	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						TGGCAGTTCTGGCTGGAGCGG	0.493																																																	0													141.0	133.0	136.0					1																	57373691		2203	4300	6503	SO:0001583	missense	0			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1285G>T	1.37:g.57373691G>T	ENSP00000354458:p.Gly429Cys		A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.G429C	ENST00000361249.3	37	c.1285	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356948	0.61293	.	.	ENSG00000157131	ENST00000361249	D	0.84516	-1.86	6.03	5.12	0.69794	Membrane attack complex component/perforin (MACPF) domain (3);	0.729350	0.13658	N	0.371793	D	0.90618	0.7058	M	0.77103	2.36	0.09310	N	1	D	0.76494	0.999	D	0.68192	0.956	T	0.82129	-0.0610	10	0.62326	D	0.03	-5.9437	6.725	0.23350	0.0694:0.1291:0.6676:0.134	.	429	P07357	CO8A_HUMAN	C	429	ENSP00000354458:G429C	ENSP00000354458:G429C	G	+	1	0	C8A	57146279	0.074000	0.21230	0.724000	0.30704	0.274000	0.26718	2.639000	0.46570	1.539000	0.49286	0.557000	0.71058	GGC	C8A	-	pfam_MACPF,smart_MACPF	ENSG00000157131		0.493	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	HGNC	protein_coding	OTTHUMT00000022890.1		0.00	38	0	G	NM_000562		57373691	+1			no_errors	ENST00000361249	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.010	T
C1orf61	10485	genome.wustl.edu	37	1	156377214	156377214	+	Intron	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:156377214C>A	ENST00000368243.1	-	6	422				C1orf61_ENST00000488498.2_5'UTR	NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61							nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TCCCTGGAGACCCATCTCCCA	0.438																																																	0																																										SO:0001627	intron_variant	0				CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.306-225G>T	1.37:g.156377214C>A			B1ALL5|B1ALL8	RNA	SNP	-	NULL	ENST00000368243.1	37	NULL	CCDS1142.1	1																																																																																			C1orf61	-	-	ENSG00000125462		0.438	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf61	HGNC	protein_coding	OTTHUMT00000075988.1	-	0.00	28	0	C	NM_006365		156377214	-1	tier1	-	no_errors	ENST00000488498	ensembl	human	known	74_37	rna	37.14	22	13	SNP	0.060	A
C1orf61	10485	genome.wustl.edu	37	1	156377214	156377214	+	Intron	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:156377214C>A	ENST00000368243.1	-	6	422				C1orf61_ENST00000488498.2_5'UTR	NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61							nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TCCCTGGAGACCCATCTCCCA	0.438																																																	0																																										SO:0001627	intron_variant	0				CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.306-225G>T	1.37:g.156377214C>A			B1ALL5|B1ALL8	RNA	SNP	-	NULL	ENST00000368243.1	37	NULL	CCDS1142.1	1																																																																																			C1orf61	-	-	ENSG00000125462		0.438	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf61	HGNC	protein_coding	OTTHUMT00000075988.1	-	0.00	38	0	C	NM_006365		156377214	-1	tier1	-	no_errors	ENST00000488498	ensembl	human	known	74_37	rna	37.14	22	13	SNP	0.060	A
CACNA1C	775	genome.wustl.edu	37	12	2717687	2717687	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:2717687C>A	ENST00000347598.4	+	28	3427	c.3427C>A	c.(3427-3429)Cgc>Agc	p.R1143S	CACNA1C_ENST00000399634.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R1123S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R1143S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R1148S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R1123S|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R1123S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R1123S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1143	Dihydropyridine binding. {ECO:0000250}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R1123G(1)|p.R658G(1)|p.R1173G(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTGCTGTACCGCTCCATCGA	0.577																																																	3	Substitution - Missense(3)	prostate(3)											51.0	48.0	49.0					12																	2717687		2203	4300	6503	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3427C>A	12.37:g.2717687C>A	ENSP00000266376:p.Arg1143Ser		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.R1123S	ENST00000347598.4	37	c.3367	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016154	0.75161	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98313	-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86;-4.86	4.74	4.74	0.60224	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97974	0.9333	L	0.37897	1.145	0.58432	D	0.999999	D;D;D;D;D;D;D;P;P;D;D;B;D;D;D;D;P;D;B;D;D;D;D;D;D	0.76494	0.999;0.999;0.983;0.998;0.999;0.999;0.998;0.942;0.756;0.999;0.998;0.237;0.998;0.999;0.998;0.997;0.804;0.999;0.389;0.997;0.999;0.999;0.999;0.992;0.999	D;D;P;D;D;D;D;P;P;D;D;B;D;D;D;D;B;D;B;D;D;D;D;D;D	0.91635	0.993;0.997;0.866;0.993;0.997;0.997;0.998;0.79;0.733;0.997;0.994;0.113;0.998;0.997;0.999;0.986;0.176;0.997;0.07;0.986;0.997;0.997;0.96;0.979;0.996	D	0.98080	1.0403	10	0.59425	D	0.04	.	14.2034	0.65719	0.1588:0.8412:0.0:0.0	.	1123;1120;1143;1123;1123;1123;1123;1123;1123;1143;1123;1094;1143;1123;1123;1123;1123;1123;1123;1123;1123;1123;1123;1123;1123	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	1148;1123;1123;1123;1123;1123;1123;1123;1123;1123;1143;1143;1123;1123;1123;1123;1123;1123;1123;1123;1123;1123;1123;964	ENSP00000336982:R1148S;ENSP00000382563:R1123S;ENSP00000437936:R1123S;ENSP00000382552:R1123S;ENSP00000382547:R1123S;ENSP00000382506:R1123S;ENSP00000382530:R1123S;ENSP00000382546:R1123S;ENSP00000382500:R1123S;ENSP00000382549:R1123S;ENSP00000266376:R1143S;ENSP00000382515:R1143S;ENSP00000382510:R1123S;ENSP00000341092:R1123S;ENSP00000382537:R1123S;ENSP00000329877:R1123S;ENSP00000382557:R1123S;ENSP00000385724:R1123S;ENSP00000382512:R1123S;ENSP00000382542:R1123S;ENSP00000382526:R1123S;ENSP00000385896:R1123S;ENSP00000382504:R1123S	ENSP00000323129:R964S	R	+	1	0	CACNA1C	2587948	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.465000	0.53064	2.618000	0.88619	0.655000	0.94253	CGC	CACNA1C	-	pfam_Ion_trans_dom	ENSG00000151067		0.577	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1		0.00	23	0	C	NM_000719		2717687	+1			no_errors	ENST00000399634	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
CACNA1D	776	genome.wustl.edu	37	3	53808636	53808636	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:53808636G>T	ENST00000350061.5	+	34	4644	c.4133G>T	c.(4132-4134)aGa>aTa	p.R1378I	CACNA1D_ENST00000422281.2_Missense_Mutation_p.R1363I|CACNA1D_ENST00000288139.4_Missense_Mutation_p.R1398I|CACNA1D_ENST00000540742.1_Missense_Mutation_p.R270I	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1378					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.R1398K(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTTGCCATGAGAGATAACAAC	0.448																																																	1	Substitution - Missense(1)	cervix(1)											116.0	117.0	117.0					3																	53808636		2203	4300	6503	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4133G>T	3.37:g.53808636G>T	ENSP00000288133:p.Arg1378Ile		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.R1398I	ENST00000350061.5	37	c.4193	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222969	0.39300	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99	6.06	3.3	0.37823	Ion transport (1);	0.189943	0.46442	D	0.000285	D	0.95677	0.8594	L	0.38649	1.16	0.80722	D	1	B;B;B;B;B	0.26120	0.142;0.0;0.06;0.06;0.117	B;B;B;B;B	0.32090	0.14;0.003;0.038;0.038;0.086	D	0.93994	0.7269	10	0.40728	T	0.16	.	10.9318	0.47222	0.2376:0.0:0.7624:0.0	.	1363;270;1071;1378;1398	B0FYA3;F5H313;Q59GD8;Q01668;Q01668-2	.;.;.;CAC1D_HUMAN;.	I	1378;1398;1363;1071;270	ENSP00000288133:R1378I;ENSP00000288139:R1398I;ENSP00000409174:R1363I;ENSP00000418014:R1071I;ENSP00000438229:R270I	ENSP00000288139:R1398I	R	+	2	0	CACNA1D	53783676	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.575000	0.36493	1.582000	0.49881	-0.137000	0.14449	AGA	CACNA1D	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000157388		0.448	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1		0.00	43	0	G	NM_000720		53808636	+1			no_errors	ENST00000288139	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
CASP5	838	genome.wustl.edu	37	11	104872776	104872776	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:104872776G>A	ENST00000260315.3	-	5	695	c.696C>T	c.(694-696)gaC>gaT	p.D232D	CASP5_ENST00000531367.1_Silent_p.D90D|CASP5_ENST00000418434.1_Silent_p.D90D|CASP5_ENST00000526056.1_Silent_p.D245D|CASP5_ENST00000444749.2_Silent_p.D174D|CASP5_ENST00000393141.2_Silent_p.D245D|CASP5_ENST00000393139.2_3'UTR			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	232					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.D245D(1)|p.D216D(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GATTCTTTTCGTCAACCACAG	0.453																																																	2	Substitution - coding silent(2)	kidney(2)											149.0	127.0	135.0					11																	104872776		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.696C>T	11.37:g.104872776G>A			B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Silent	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.D245	ENST00000260315.3	37	c.735	CCDS8328.2	11																																																																																			CASP5	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000137757		0.453	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	HGNC	protein_coding	OTTHUMT00000109397.2	-	0.00	41	0	G	NM_004347		104872776	-1	tier1	-	no_errors	ENST00000393141	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.000	A
CASP5	838	genome.wustl.edu	37	11	104872776	104872776	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:104872776G>A	ENST00000260315.3	-	5	695	c.696C>T	c.(694-696)gaC>gaT	p.D232D	CASP5_ENST00000531367.1_Silent_p.D90D|CASP5_ENST00000418434.1_Silent_p.D90D|CASP5_ENST00000526056.1_Silent_p.D245D|CASP5_ENST00000444749.2_Silent_p.D174D|CASP5_ENST00000393141.2_Silent_p.D245D|CASP5_ENST00000393139.2_3'UTR			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	232					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.D245D(1)|p.D216D(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GATTCTTTTCGTCAACCACAG	0.453																																																	2	Substitution - coding silent(2)	kidney(2)											149.0	127.0	135.0					11																	104872776		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.696C>T	11.37:g.104872776G>A			B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Silent	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.D245	ENST00000260315.3	37	c.735	CCDS8328.2	11																																																																																			CASP5	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000137757		0.453	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	HGNC	protein_coding	OTTHUMT00000109397.2	-	0.00	66	0	G	NM_004347		104872776	-1	tier1	-	no_errors	ENST00000393141	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.000	A
CASP8	841	genome.wustl.edu	37	2	202137430	202137431	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:202137430_202137431delAA	ENST00000432109.2	+	5	670_671	c.481_482delAA	c.(481-483)aaafs	p.K161fs	CASP8_ENST00000392258.3_Frame_Shift_Del_p.K161fs|CASP8_ENST00000264275.5_Frame_Shift_Del_p.K193fs|CASP8_ENST00000392259.2_Frame_Shift_Del_p.K161fs|CASP8_ENST00000392266.3_Frame_Shift_Del_p.K161fs|CASP8_ENST00000358485.4_Frame_Shift_Del_p.K220fs|CASP8_ENST00000264274.9_Frame_Shift_Del_p.K161fs|CASP8_ENST00000323492.7_Frame_Shift_Del_p.K161fs	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	161	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GGACATCCTGAAAAGAGTCTGT	0.441										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0																																										SO:0001589	frameshift_variant	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.481_482delAA	2.37:g.202137432_202137433delAA	ENSP00000412523:p.Lys161fs		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Frame_Shift_Del	DEL	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R221fs	ENST00000432109.2	37	c.658_659	CCDS2342.1	2																																																																																			CASP8	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED	ENSG00000064012		0.441	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2		0.00	48	0	AA	NM_001228		202137431	+1	tier1		no_errors	ENST00000358485	ensembl	human	known	74_37	frame_shift_del	43.55	35	27	DEL	0.994:0.984	-
CASP8	841	genome.wustl.edu	37	2	202137430	202137431	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:202137430_202137431delAA	ENST00000432109.2	+	5	670_671	c.481_482delAA	c.(481-483)aaafs	p.K161fs	CASP8_ENST00000392258.3_Frame_Shift_Del_p.K161fs|CASP8_ENST00000264275.5_Frame_Shift_Del_p.K193fs|CASP8_ENST00000392259.2_Frame_Shift_Del_p.K161fs|CASP8_ENST00000392266.3_Frame_Shift_Del_p.K161fs|CASP8_ENST00000358485.4_Frame_Shift_Del_p.K220fs|CASP8_ENST00000264274.9_Frame_Shift_Del_p.K161fs|CASP8_ENST00000323492.7_Frame_Shift_Del_p.K161fs	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	161	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GGACATCCTGAAAAGAGTCTGT	0.441										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0																																										SO:0001589	frameshift_variant	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.481_482delAA	2.37:g.202137432_202137433delAA	ENSP00000412523:p.Lys161fs		O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Frame_Shift_Del	DEL	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R221fs	ENST00000432109.2	37	c.658_659	CCDS2342.1	2																																																																																			CASP8	-	pfam_DED,superfamily_DEATH-like_dom,smart_DED,pfscan_DED	ENSG00000064012		0.441	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2		0.00	61	0	AA	NM_001228		202137431	+1	tier1		no_errors	ENST00000358485	ensembl	human	known	74_37	frame_shift_del	43.55	35	27	DEL	0.994:0.984	-
CCDC170	80129	genome.wustl.edu	37	6	151859407	151859407	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:151859407G>T	ENST00000239374.7	+	3	513	c.414G>T	c.(412-414)aaG>aaT	p.K138N	CCDC170_ENST00000544131.1_3'UTR|CCDC170_ENST00000367290.5_Missense_Mutation_p.K138N	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	138																	AATTAAAGAAGAAAGTTGTAG	0.348																																																	0													58.0	50.0	53.0					6																	151859407		1829	4078	5907	SO:0001583	missense	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.414G>T	6.37:g.151859407G>T	ENSP00000239374:p.Lys138Asn		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.K138N	ENST00000239374.7	37	c.414	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523084	0.44866	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.08546	3.08;3.08	5.68	3.89	0.44902	.	0.178511	0.47093	D	0.000250	T	0.05227	0.0139	M	0.75447	2.3	0.35774	D	0.821127	P	0.39782	0.688	B	0.38562	0.276	T	0.18650	-1.0330	10	0.34782	T	0.22	-22.1113	9.0725	0.36502	0.22:0.0:0.78:0.0	.	138	Q8IYT3	CF097_HUMAN	N	138	ENSP00000239374:K138N;ENSP00000356259:K138N	ENSP00000239374:K138N	K	+	3	2	C6orf97	151901100	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	2.209000	0.42806	1.405000	0.46838	0.655000	0.94253	AAG	CCDC170	-	NULL	ENSG00000120262		0.348	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2		0.00	39	0	G	NM_025059		151859407	+1			no_errors	ENST00000367290	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CCDC85A	114800	genome.wustl.edu	37	2	56420423	56420423	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:56420423A>T	ENST00000407595.2	+	2	1590	c.1088A>T	c.(1087-1089)aAa>aTa	p.K363I	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	363	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAGCACCTCAAACAACATTAT	0.637																																																	0													26.0	31.0	29.0					2																	56420423		2157	4273	6430	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1088A>T	2.37:g.56420423A>T	ENSP00000384040:p.Lys363Ile			Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.K363I	ENST00000407595.2	37	c.1088	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313347	0.60414	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.18	5.18	0.71444	.	0.261937	0.40640	N	0.001060	T	0.62792	0.2457	L	0.44542	1.39	0.80722	D	1	D	0.67145	0.996	P	0.59703	0.862	T	0.65841	-0.6070	9	0.72032	D	0.01	-35.2096	9.5458	0.39279	0.9209:0.0:0.0791:0.0	.	363	Q96PX6	CC85A_HUMAN	I	363	.	ENSP00000384040:K363I	K	+	2	0	CCDC85A	56273927	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.847000	0.69451	1.956000	0.56807	0.377000	0.23210	AAA	CCDC85A	-	NULL	ENSG00000055813		0.637	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	-	0.00	27	0	A			56420423	+1	tier1	-	no_errors	ENST00000407595	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	T
CCDC85A	114800	genome.wustl.edu	37	2	56420423	56420423	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:56420423A>T	ENST00000407595.2	+	2	1590	c.1088A>T	c.(1087-1089)aAa>aTa	p.K363I	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	363	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAGCACCTCAAACAACATTAT	0.637																																																	0													26.0	31.0	29.0					2																	56420423		2157	4273	6430	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1088A>T	2.37:g.56420423A>T	ENSP00000384040:p.Lys363Ile			Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.K363I	ENST00000407595.2	37	c.1088	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313347	0.60414	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.18	5.18	0.71444	.	0.261937	0.40640	N	0.001060	T	0.62792	0.2457	L	0.44542	1.39	0.80722	D	1	D	0.67145	0.996	P	0.59703	0.862	T	0.65841	-0.6070	9	0.72032	D	0.01	-35.2096	9.5458	0.39279	0.9209:0.0:0.0791:0.0	.	363	Q96PX6	CC85A_HUMAN	I	363	.	ENSP00000384040:K363I	K	+	2	0	CCDC85A	56273927	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.847000	0.69451	1.956000	0.56807	0.377000	0.23210	AAA	CCDC85A	-	NULL	ENSG00000055813		0.637	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	-	0.00	46	0	A			56420423	+1	tier1	-	no_errors	ENST00000407595	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	T
CCP110	9738	genome.wustl.edu	37	16	19547487	19547487	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:19547487G>T	ENST00000381396.5	+	4	743	c.496G>T	c.(496-498)Gaa>Taa	p.E166*	CCP110_ENST00000396208.2_Nonsense_Mutation_p.E166*|CCP110_ENST00000396212.2_Nonsense_Mutation_p.E166*	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	166	CEP97 binding.				cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TAGAGATTCAGAAGGATTTAA	0.383																																																	0													93.0	99.0	97.0					16																	19547487		2197	4300	6497	SO:0001587	stop_gained	0			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.496G>T	16.37:g.19547487G>T	ENSP00000370803:p.Glu166*		B7WP23|O43335|Q68DV9|Q8NE13	Nonsense_Mutation	SNP	NULL	p.E166*	ENST00000381396.5	37	c.496	CCDS55992.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.024786	0.97211	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	.	.	.	5.74	4.78	0.61160	.	0.249901	0.34750	N	0.003718	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-13.5397	10.2806	0.43537	0.0702:0.1365:0.7933:0.0	.	.	.	.	X	166	.	ENSP00000370803:E166X	E	+	1	0	CCP110	19454988	0.998000	0.40836	0.154000	0.22540	0.994000	0.84299	3.045000	0.49838	1.409000	0.46915	-0.165000	0.13383	GAA	CCP110	-	NULL	ENSG00000103540		0.383	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	-	0.00	74	0	G	NM_014711		19547487	+1	tier1	-	no_errors	ENST00000381396	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	0.504	T
CCP110	9738	genome.wustl.edu	37	16	19547487	19547487	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:19547487G>T	ENST00000381396.5	+	4	743	c.496G>T	c.(496-498)Gaa>Taa	p.E166*	CCP110_ENST00000396208.2_Nonsense_Mutation_p.E166*|CCP110_ENST00000396212.2_Nonsense_Mutation_p.E166*	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	166	CEP97 binding.				cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TAGAGATTCAGAAGGATTTAA	0.383																																																	0													93.0	99.0	97.0					16																	19547487		2197	4300	6497	SO:0001587	stop_gained	0			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.496G>T	16.37:g.19547487G>T	ENSP00000370803:p.Glu166*		B7WP23|O43335|Q68DV9|Q8NE13	Nonsense_Mutation	SNP	NULL	p.E166*	ENST00000381396.5	37	c.496	CCDS55992.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.024786	0.97211	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	.	.	.	5.74	4.78	0.61160	.	0.249901	0.34750	N	0.003718	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-13.5397	10.2806	0.43537	0.0702:0.1365:0.7933:0.0	.	.	.	.	X	166	.	ENSP00000370803:E166X	E	+	1	0	CCP110	19454988	0.998000	0.40836	0.154000	0.22540	0.994000	0.84299	3.045000	0.49838	1.409000	0.46915	-0.165000	0.13383	GAA	CCP110	-	NULL	ENSG00000103540		0.383	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	-	0.00	79	0	G	NM_014711		19547487	+1	tier1	-	no_errors	ENST00000381396	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	0.504	T
CD109	135228	genome.wustl.edu	37	6	74497121	74497121	+	Silent	SNP	C	C	T	rs143756315		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:74497121C>T	ENST00000287097.5	+	21	2614	c.2502C>T	c.(2500-2502)gtC>gtT	p.V834V	CD109_ENST00000437994.2_Silent_p.V834V|CD109_ENST00000422508.2_Silent_p.V757V			Q6YHK3	CD109_HUMAN	CD109 molecule	834					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTATCACAGTCACAGCTCTTT	0.448																																																	0								C	,,	1,4405	2.1+/-5.4	0,1,2202	114.0	110.0	111.0		2502,2271,2502	-1.3	0.2	6	dbSNP_134	111	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CD109	NM_001159587.1,NM_001159588.1,NM_133493.3	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	834/1429,757/1369,834/1446	74497121	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2502C>T	6.37:g.74497121C>T			A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V834	ENST00000287097.5	37	c.2502	CCDS4982.1	6																																																																																			CD109	-	NULL	ENSG00000156535		0.448	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	-	0.00	36	0	C	NM_133493		74497121	+1	tier1	rs143756315	no_errors	ENST00000287097	ensembl	human	known	74_37	silent	25.40	47	16	SNP	0.997	T
CD109	135228	genome.wustl.edu	37	6	74497121	74497121	+	Silent	SNP	C	C	T	rs143756315		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:74497121C>T	ENST00000287097.5	+	21	2614	c.2502C>T	c.(2500-2502)gtC>gtT	p.V834V	CD109_ENST00000437994.2_Silent_p.V834V|CD109_ENST00000422508.2_Silent_p.V757V			Q6YHK3	CD109_HUMAN	CD109 molecule	834					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTATCACAGTCACAGCTCTTT	0.448																																																	0								C	,,	1,4405	2.1+/-5.4	0,1,2202	114.0	110.0	111.0		2502,2271,2502	-1.3	0.2	6	dbSNP_134	111	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CD109	NM_001159587.1,NM_001159588.1,NM_133493.3	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	834/1429,757/1369,834/1446	74497121	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2502C>T	6.37:g.74497121C>T			A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V834	ENST00000287097.5	37	c.2502	CCDS4982.1	6																																																																																			CD109	-	NULL	ENSG00000156535		0.448	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	-	0.00	58	0	C	NM_133493		74497121	+1	tier1	rs143756315	no_errors	ENST00000287097	ensembl	human	known	74_37	silent	25.40	47	16	SNP	0.997	T
CDH18	1016	genome.wustl.edu	37	5	19747230	19747230	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:19747230C>A	ENST00000507958.1	-	6	1334	c.344G>T	c.(343-345)aGc>aTc	p.S115I	CDH18_ENST00000382275.1_Missense_Mutation_p.S115I|CDH18_ENST00000511273.1_Missense_Mutation_p.S115I|CDH18_ENST00000502796.1_Missense_Mutation_p.S115I|CDH18_ENST00000274170.4_Missense_Mutation_p.S115I|CDH18_ENST00000506372.1_Missense_Mutation_p.S115I			Q13634	CAD18_HUMAN	cadherin 18, type 2	115	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TCTGTCTAGGCTTTTTGTTGA	0.438																																																	0													237.0	212.0	220.0					5																	19747230		2203	4300	6503	SO:0001583	missense	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.344G>T	5.37:g.19747230C>A	ENSP00000425093:p.Ser115Ile		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S115I	ENST00000507958.1	37	c.344	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046228	0.75846	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.23	5.23	0.72850	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	L	0.45352	1.415	0.50632	D	0.999889	D;D	0.69078	0.993;0.997	D;D	0.68621	0.959;0.943	T	0.57573	-0.7788	9	.	.	.	.	17.3587	0.87344	0.0:1.0:0.0:0.0	.	115;115	B4DHG6;Q13634	.;CAD18_HUMAN	I	115;115;115;115;115;115;61;115	ENSP00000371710:S115I;ENSP00000425093:S115I;ENSP00000274170:S115I;ENSP00000424931:S115I;ENSP00000422138:S115I;ENSP00000427383:S61I;ENSP00000425854:S115I	.	S	-	2	0	CDH18	19782987	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.545000	0.60698	2.441000	0.82636	0.591000	0.81541	AGC	CDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000145526		0.438	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	-	0.00	26	0	C	NM_004934		19747230	-1	tier1	-	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	A
CDH23	64072	genome.wustl.edu	37	10	73553088	73553088	+	Missense_Mutation	SNP	G	G	A	rs55947063		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:73553088G>A	ENST00000224721.6	+	47	6423	c.6418G>A	c.(6418-6420)Gag>Aag	p.E2140K	CDH23_ENST00000398788.3_5'Flank	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2135	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CATCGACAGAGAGGAGCAGGA	0.582																																																	0													68.0	74.0	72.0					10																	73553088		2094	4229	6323	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6418G>A	10.37:g.73553088G>A	ENSP00000224721:p.Glu2140Lys		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E2140K	ENST00000224721.6	37	c.6418		10	.	.	.	.	.	.	.	.	.	.	G	36	5.722752	0.96847	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.32	5.32	0.75619	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87132	0.6101	H	0.94620	3.56	0.80722	D	1	D	0.59357	0.985	D	0.71656	0.974	D	0.90385	0.4391	9	0.66056	D	0.02	.	19.0063	0.92852	0.0:0.0:1.0:0.0	.	2135	Q9H251	CAD23_HUMAN	K	2140;2135;2138	.	ENSP00000224721:E2140K	E	+	1	0	CDH23	73223094	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.827000	0.99397	2.484000	0.83849	0.650000	0.86243	GAG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.582	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	39	0	G	NM_052836		73553088	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	13.79	25	4	SNP	1.000	A
CDH23	64072	genome.wustl.edu	37	10	73553088	73553088	+	Missense_Mutation	SNP	G	G	A	rs55947063		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:73553088G>A	ENST00000224721.6	+	47	6423	c.6418G>A	c.(6418-6420)Gag>Aag	p.E2140K	CDH23_ENST00000398788.3_5'Flank	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2135	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CATCGACAGAGAGGAGCAGGA	0.582																																																	0													68.0	74.0	72.0					10																	73553088		2094	4229	6323	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6418G>A	10.37:g.73553088G>A	ENSP00000224721:p.Glu2140Lys		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E2140K	ENST00000224721.6	37	c.6418		10	.	.	.	.	.	.	.	.	.	.	G	36	5.722752	0.96847	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721	.	.	.	5.32	5.32	0.75619	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.87132	0.6101	H	0.94620	3.56	0.80722	D	1	D	0.59357	0.985	D	0.71656	0.974	D	0.90385	0.4391	9	0.66056	D	0.02	.	19.0063	0.92852	0.0:0.0:1.0:0.0	.	2135	Q9H251	CAD23_HUMAN	K	2140;2135;2138	.	ENSP00000224721:E2140K	E	+	1	0	CDH23	73223094	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.827000	0.99397	2.484000	0.83849	0.650000	0.86243	GAG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.582	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	42	0	G	NM_052836		73553088	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	13.79	25	4	SNP	1.000	A
CDH5	1003	genome.wustl.edu	37	16	66426285	66426285	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:66426285G>T	ENST00000341529.3	+	7	1364	c.1216G>T	c.(1216-1218)Gga>Tga	p.G406*	CDH5_ENST00000563425.2_Missense_Mutation_p.G406W	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GCATAGCATTGGGTAAGGGGG	0.557																																																	0													83.0	84.0	84.0					16																	66426285		2201	4300	6501	SO:0001630	splice_region_variant	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.1217+1G>T	16.37:g.66426285G>T			Q4VAI5|Q4VAI6	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G406*	ENST00000341529.3	37	c.1216	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.487660	0.96323	.	.	ENSG00000179776	ENST00000341529;ENST00000539262	.	.	.	5.62	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6218	0.17461	0.3634:0.0:0.6366:0.0	.	.	.	.	X	406;147	.	ENSP00000344115:G406X	G	+	1	0	CDH5	64983786	0.991000	0.36638	0.976000	0.42696	0.561000	0.35649	2.557000	0.45871	1.340000	0.45581	0.655000	0.94253	GGA	CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000179776		0.557	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1		0.00	27	0	G	NM_001795	Nonsense_Mutation	66426285	+1			no_errors	ENST00000341529	ensembl	human	known	74_37	nonsense	5.17	55	3	SNP	1.000	T
CDH3	1001	genome.wustl.edu	37	16	68712181	68712181	+	Splice_Site	SNP	G	G	T	rs370724082		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:68712181G>T	ENST00000264012.4	+	4	934		c.e4+1		CDH3_ENST00000581171.1_Splice_Site|CDH3_ENST00000429102.2_Splice_Site	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)						adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		ACTGAATCAGGTACGACTGTG	0.522																																																	2	Unknown(2)	breast(2)											93.0	89.0	91.0					16																	68712181		2198	4300	6498	SO:0001630	splice_region_variant	0			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.390+1G>T	16.37:g.68712181G>T			B2R6F4|Q05DI6	Splice_Site	SNP	-	e4+1	ENST00000264012.4	37	c.390+1	CCDS10868.1	16	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015887	0.54468	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8859	0.88854	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH3	67269682	1.000000	0.71417	1.000000	0.80357	0.485000	0.33311	8.743000	0.91592	2.822000	0.97130	0.650000	0.86243	.	CDH3	-	-	ENSG00000062038		0.522	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH3	HGNC	protein_coding	OTTHUMT00000268896.2	-	0.00	29	0	G	NM_001793	Intron	68712181	+1	tier1	-	no_errors	ENST00000264012	ensembl	human	known	74_37	splice_site	8.33	43	4	SNP	1.000	T
CDH3	1001	genome.wustl.edu	37	16	68712181	68712181	+	Splice_Site	SNP	G	G	T	rs370724082		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:68712181G>T	ENST00000264012.4	+	4	934		c.e4+1		CDH3_ENST00000581171.1_Splice_Site|CDH3_ENST00000429102.2_Splice_Site	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)						adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		ACTGAATCAGGTACGACTGTG	0.522																																																	2	Unknown(2)	breast(2)											93.0	89.0	91.0					16																	68712181		2198	4300	6498	SO:0001630	splice_region_variant	0			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.390+1G>T	16.37:g.68712181G>T			B2R6F4|Q05DI6	Splice_Site	SNP	-	e4+1	ENST00000264012.4	37	c.390+1	CCDS10868.1	16	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015887	0.54468	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8859	0.88854	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH3	67269682	1.000000	0.71417	1.000000	0.80357	0.485000	0.33311	8.743000	0.91592	2.822000	0.97130	0.650000	0.86243	.	CDH3	-	-	ENSG00000062038		0.522	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH3	HGNC	protein_coding	OTTHUMT00000268896.2	-	0.00	46	0	G	NM_001793	Intron	68712181	+1	tier1	-	no_errors	ENST00000264012	ensembl	human	known	74_37	splice_site	8.33	43	4	SNP	1.000	T
CDH7	1005	genome.wustl.edu	37	18	63511205	63511205	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr18:63511205C>T	ENST00000397968.2	+	7	1565	c.1139C>T	c.(1138-1140)cCc>cTc	p.P380L	CDH7_ENST00000323011.3_Missense_Mutation_p.P380L|CDH7_ENST00000536984.2_Missense_Mutation_p.P380L	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	380	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTCTCTTCACCCTTGTACCCT	0.507																																																	0													182.0	151.0	162.0					18																	63511205		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1139C>T	18.37:g.63511205C>T	ENSP00000381058:p.Pro380Leu		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P380L	ENST00000397968.2	37	c.1139	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669587	0.29693	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.60920	0.15;0.15;0.15	4.97	3.1	0.35709	Cadherin (2);Cadherin-like (1);	0.209904	0.39475	N	0.001342	T	0.47322	0.1439	L	0.50993	1.605	0.37177	D	0.903317	B;B	0.22604	0.001;0.072	B;B	0.20577	0.003;0.03	T	0.51702	-0.8672	10	0.42905	T	0.14	.	7.7976	0.29156	0.0:0.5469:0.3532:0.0999	.	380;380	F5H5X9;Q9ULB5	.;CADH7_HUMAN	L	380	ENSP00000319166:P380L;ENSP00000443030:P380L;ENSP00000381058:P380L	ENSP00000319166:P380L	P	+	2	0	CDH7	61662185	0.068000	0.21057	0.011000	0.14972	0.839000	0.47603	1.779000	0.38624	1.296000	0.44742	0.655000	0.94253	CCC	CDH7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000081138		0.507	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	90	0	C	NM_033646		63511205	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	23.08	80	24	SNP	0.325	T
CDH7	1005	genome.wustl.edu	37	18	63511205	63511205	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr18:63511205C>T	ENST00000397968.2	+	7	1565	c.1139C>T	c.(1138-1140)cCc>cTc	p.P380L	CDH7_ENST00000323011.3_Missense_Mutation_p.P380L|CDH7_ENST00000536984.2_Missense_Mutation_p.P380L	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	380	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTCTCTTCACCCTTGTACCCT	0.507																																																	0													182.0	151.0	162.0					18																	63511205		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1139C>T	18.37:g.63511205C>T	ENSP00000381058:p.Pro380Leu		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P380L	ENST00000397968.2	37	c.1139	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669587	0.29693	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.60920	0.15;0.15;0.15	4.97	3.1	0.35709	Cadherin (2);Cadherin-like (1);	0.209904	0.39475	N	0.001342	T	0.47322	0.1439	L	0.50993	1.605	0.37177	D	0.903317	B;B	0.22604	0.001;0.072	B;B	0.20577	0.003;0.03	T	0.51702	-0.8672	10	0.42905	T	0.14	.	7.7976	0.29156	0.0:0.5469:0.3532:0.0999	.	380;380	F5H5X9;Q9ULB5	.;CADH7_HUMAN	L	380	ENSP00000319166:P380L;ENSP00000443030:P380L;ENSP00000381058:P380L	ENSP00000319166:P380L	P	+	2	0	CDH7	61662185	0.068000	0.21057	0.011000	0.14972	0.839000	0.47603	1.779000	0.38624	1.296000	0.44742	0.655000	0.94253	CCC	CDH7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000081138		0.507	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	93	0	C	NM_033646		63511205	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	23.08	80	24	SNP	0.325	T
CDK13	8621	genome.wustl.edu	37	7	40102486	40102486	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:40102486G>A	ENST00000181839.4	+	8	3267	c.2662G>A	c.(2662-2664)Gaa>Aaa	p.E888K	CDK13_ENST00000340829.5_Missense_Mutation_p.E888K|CDK13_ENST00000484589.1_3'UTR	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	888	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GCTACTGGGAGAAGAACGATA	0.368																																																	0													283.0	291.0	288.0					7																	40102486		2203	4300	6503	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2662G>A	7.37:g.40102486G>A	ENSP00000181839:p.Glu888Lys		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E888K	ENST00000181839.4	37	c.2662	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	.	25.9	4.682459	0.88542	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.64991	-0.13;-0.13	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.66376	0.2783	N	0.13272	0.32	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.80764	0.977;0.994;0.975	T	0.64952	-0.6286	8	.	.	.	-18.1848	19.8265	0.96619	0.0:0.0:1.0:0.0	.	274;888;888	Q9BVE2;Q14004-2;Q14004	.;.;CDK13_HUMAN	K	888	ENSP00000181839:E888K;ENSP00000340557:E888K	.	E	+	1	0	CDK13	40069011	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.835000	0.99442	2.770000	0.95276	0.563000	0.77884	GAA	CDK13	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000065883		0.368	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2		0.00	56	0	G	NM_003718		40102486	+1			no_errors	ENST00000181839	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
CHCHD4	131474	genome.wustl.edu	37	3	14163429	14163429	+	Intron	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:14163429C>A	ENST00000396914.3	-	1	204				CHCHD4_ENST00000295767.5_Nonsense_Mutation_p.G17*	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4						'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						TCCTCAGCTCCAGCTCTGTGG	0.463																																																	0													122.0	99.0	107.0					3																	14163429		2203	4300	6503	SO:0001627	intron_variant	0			BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.22+2725G>T	3.37:g.14163429C>A			A8K3Z9|Q96AI2|Q96MY6	Nonsense_Mutation	SNP	pfam_CHCH	p.G17*	ENST00000396914.3	37	c.49	CCDS43054.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262962	0.80358	.	.	ENSG00000163528	ENST00000295767	.	.	.	0.597	-0.446	0.12238	.	0.343862	0.33813	U	0.004537	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	.	.	.	.	.	.	.	X	17	.	ENSP00000295767:G17X	G	-	1	0	CHCHD4	14138430	0.000000	0.05858	0.030000	0.17652	0.263000	0.26337	-0.615000	0.05597	-0.253000	0.09514	0.313000	0.20887	GGA	CHCHD4	-	NULL	ENSG00000163528		0.463	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD4	HGNC	protein_coding	OTTHUMT00000340423.1	-	0.00	29	0	C	NM_144636		14163429	-1	tier1	-	no_errors	ENST00000295767	ensembl	human	known	74_37	nonsense	8.70	42	4	SNP	0.043	A
CHD8	57680	genome.wustl.edu	37	14	21894322	21894322	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:21894322G>T	ENST00000557364.1	-	5	1944	c.1681C>A	c.(1681-1683)Cag>Aag	p.Q561K	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.Q282K|CHD8_ENST00000399982.2_Missense_Mutation_p.Q561K			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	561					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.Q561*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CGAGGTGACTGTGCAGGCATG	0.388																																																	1	Substitution - Nonsense(1)	prostate(1)											117.0	103.0	107.0					14																	21894322		1912	4140	6052	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1681C>A	14.37:g.21894322G>T	ENSP00000451601:p.Gln561Lys		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q561K	ENST00000557364.1	37	c.1681	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606441	0.28623	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.73258	-0.73;-0.73;-0.73	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000011	T	0.57784	0.2077	N	0.22421	0.69	0.39375	D	0.966154	B	0.21452	0.056	B	0.20955	0.032	T	0.54912	-0.8222	10	0.12103	T	0.63	-13.9116	18.349	0.90331	0.0:0.0:1.0:0.0	.	282	Q9HCK8-2	.	K	282;561;281;561	ENSP00000406288:Q282K;ENSP00000382863:Q561K;ENSP00000451601:Q561K	ENSP00000262707:Q281K	Q	-	1	0	CHD8	20964162	0.958000	0.32768	0.997000	0.53966	0.996000	0.88848	4.079000	0.57613	2.625000	0.88918	0.591000	0.81541	CAG	CHD8	-	NULL	ENSG00000100888		0.388	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1		0.00	23	0	G	NM_020920		21894322	-1			no_errors	ENST00000399982	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.990	T
CHEK2	11200	genome.wustl.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	T	C	rs142470496	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:29091840T>C	ENST00000405598.1	-	12	1308	c.1117A>G	c.(1117-1119)Aag>Gag	p.K373E	CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	9	Substitution - Missense(9)	kidney(4)|prostate(2)|endometrium(1)|stomach(1)|central_nervous_system(1)																																								SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1117A>G	22.37:g.29091840T>C	ENSP00000386087:p.Lys373Glu		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_dom	p.K416E	ENST00000405598.1	37	c.1246	CCDS13843.1	22	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754336	0.69648	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	T;T;T;T;T;T;T;T;T	0.54071	0.9;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.9	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043710	0.85682	D	0.000000	T	0.56292	0.1975	N	0.11756	0.17	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.998;0.998;0.993;0.991	P;D;D;D;D;P	0.74674	0.905;0.984;0.943;0.969;0.923;0.896	T	0.64769	-0.6329	10	0.87932	D	0	-1.7726	15.4726	0.75453	0.0:0.0:0.0:1.0	.	282;152;373;344;373;416	O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	E	344;282;152;373;373;373;416;282;344	ENSP00000329012:K344E;ENSP00000372021:K282E;ENSP00000442458:K152E;ENSP00000329178:K373E;ENSP00000385747:K373E;ENSP00000386087:K373E;ENSP00000372023:K416E;ENSP00000384919:K282E;ENSP00000384835:K344E	ENSP00000329178:K373E	K	-	1	0	CHEK2	27421840	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	4.270000	0.58896	2.248000	0.74166	0.528000	0.53228	AAG	CHEK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183765		0.418	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1		0.00	51	0	T	NM_001005735		29091840	-1			no_errors	ENST00000382580	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	C
CLASP2	23122	genome.wustl.edu	37	3	33618714	33618714	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:33618714G>T	ENST00000480013.1	-	18	2142	c.1691C>A	c.(1690-1692)cCc>cAc	p.P564H	CLASP2_ENST00000359576.5_Intron|CLASP2_ENST00000307312.7_Intron|CLASP2_ENST00000461133.3_Intron|CLASP2_ENST00000539981.1_Intron|CLASP2_ENST00000399362.4_Intron|CLASP2_ENST00000468888.2_Intron	NM_001207044.1	NP_001193973.1	O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	564	Interaction with microtubules, MAPRE1 and MAPRE3.|Ser-rich.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ATACACTTCGGGGGCGTAGAG	0.433																																																	0													67.0	62.0	64.0					3																	33618714		876	1991	2867	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000480013.1:c.1691C>A	3.37:g.33618714G>T	ENSP00000417518:p.Pro564His		Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.P564H	ENST00000480013.1	37	c.1691		3	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683975	0.88639	.	.	ENSG00000163539	ENST00000480013;ENST00000475576	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	T	0.56514	0.1990	N	0.19112	0.55	0.80722	D	1	.	.	.	.	.	.	T	0.48725	-0.9010	6	0.27785	T	0.31	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	.	.	.	H	564;67	.	ENSP00000417666:P67H	P	-	2	0	CLASP2	33593718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.601000	0.98297	2.873000	0.98535	0.561000	0.74099	CCC	CLASP2	-	superfamily_ARM-type_fold	ENSG00000163539		0.433	CLASP2-003	KNOWN	basic|appris_candidate	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000356445.1	-	0.00	65	0	G	NM_001207044		33618714	-1	tier1	-	no_errors	ENST00000480013	ensembl	human	known	74_37	missense	6.38	88	6	SNP	1.000	T
CLASP2	23122	genome.wustl.edu	37	3	33618714	33618714	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:33618714G>T	ENST00000480013.1	-	18	2142	c.1691C>A	c.(1690-1692)cCc>cAc	p.P564H	CLASP2_ENST00000359576.5_Intron|CLASP2_ENST00000307312.7_Intron|CLASP2_ENST00000461133.3_Intron|CLASP2_ENST00000539981.1_Intron|CLASP2_ENST00000399362.4_Intron|CLASP2_ENST00000468888.2_Intron	NM_001207044.1	NP_001193973.1	O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	564	Interaction with microtubules, MAPRE1 and MAPRE3.|Ser-rich.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ATACACTTCGGGGGCGTAGAG	0.433																																																	0													67.0	62.0	64.0					3																	33618714		876	1991	2867	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000480013.1:c.1691C>A	3.37:g.33618714G>T	ENSP00000417518:p.Pro564His		Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.P564H	ENST00000480013.1	37	c.1691		3	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683975	0.88639	.	.	ENSG00000163539	ENST00000480013;ENST00000475576	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	T	0.56514	0.1990	N	0.19112	0.55	0.80722	D	1	.	.	.	.	.	.	T	0.48725	-0.9010	6	0.27785	T	0.31	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	.	.	.	H	564;67	.	ENSP00000417666:P67H	P	-	2	0	CLASP2	33593718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.601000	0.98297	2.873000	0.98535	0.561000	0.74099	CCC	CLASP2	-	superfamily_ARM-type_fold	ENSG00000163539		0.433	CLASP2-003	KNOWN	basic|appris_candidate	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000356445.1	-	0.00	90	0	G	NM_001207044		33618714	-1	tier1	-	no_errors	ENST00000480013	ensembl	human	known	74_37	missense	6.38	88	6	SNP	1.000	T
CLASP2	23122	genome.wustl.edu	37	3	33648229	33648229	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:33648229G>T	ENST00000468888.2	-	16	1597	c.1551C>A	c.(1549-1551)aaC>aaA	p.N517K	CLASP2_ENST00000359576.5_Missense_Mutation_p.N516K|CLASP2_ENST00000333778.6_Missense_Mutation_p.N293K|CLASP2_ENST00000307312.7_Missense_Mutation_p.N5K|CLASP2_ENST00000461133.3_Missense_Mutation_p.N283K|CLASP2_ENST00000539981.1_Missense_Mutation_p.N268K|CLASP2_ENST00000399362.4_Missense_Mutation_p.N516K|CLASP2_ENST00000313350.6_Missense_Mutation_p.N289K|CLASP2_ENST00000480013.1_Missense_Mutation_p.N283K|CLASP2_ENST00000487200.1_Missense_Mutation_p.N289K			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	283	Interaction with microtubules, MAPRE1 and MAPRE3.|Ser-rich.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						CAGGAAAGTGGTTTCTAAGAC	0.353																																																	0													138.0	136.0	137.0					3																	33648229		1834	4075	5909	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.1551C>A	3.37:g.33648229G>T	ENSP00000419974:p.Asn517Lys		Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.N516K	ENST00000468888.2	37	c.1548		3	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380453	0.42207	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000539981;ENST00000480013;ENST00000461133;ENST00000313350;ENST00000487200;ENST00000333778	T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.05	4.17	0.49024	Armadillo-type fold (1);CLASP N-terminal domain (1);	0.094681	0.64402	D	0.000001	T	0.24314	0.0589	N	0.20881	0.62	0.41420	D	0.98779	B;P;P;B;B	0.48998	0.249;0.918;0.578;0.048;0.187	B;P;B;B;B	0.46685	0.281;0.524;0.388;0.052;0.152	T	0.10314	-1.0635	10	0.02654	T	1	-17.7277	10.5233	0.44931	0.1703:0.0:0.8297:0.0	.	293;283;289;289;516	E7ENG2;O75122;B3KR06;O75122-2;F5H604	.;CLAP2_HUMAN;.;.;.	K	517;516;516;5;268;283;283;289;289;293	ENSP00000419974:N517K;ENSP00000382297:N516K;ENSP00000352581:N516K;ENSP00000439039:N268K;ENSP00000417518:N283K;ENSP00000419305:N283K;ENSP00000324364:N289K;ENSP00000418939:N289K;ENSP00000327760:N293K	ENSP00000304743:N5K	N	-	3	2	CLASP2	33623233	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.201000	0.32259	1.255000	0.44051	0.655000	0.94253	AAC	CLASP2	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold	ENSG00000163539		0.353	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000344320.4		0.00	20	0	G	NM_001207044		33648229	-1			no_errors	ENST00000399362	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
CLMN	79789	genome.wustl.edu	37	14	95662883	95662883	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:95662883G>T	ENST00000298912.4	-	10	2773	c.2660C>A	c.(2659-2661)tCc>tAc	p.S887Y	CLMN_ENST00000556441.1_5'Flank|CLMN_ENST00000557215.1_5'Flank	NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	887					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTCATCTGAGGATTGAACACT	0.398																																																	0													181.0	152.0	162.0					14																	95662883		2203	4300	6503	SO:0001583	missense	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2660C>A	14.37:g.95662883G>T	ENSP00000298912:p.Ser887Tyr		B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.S887Y	ENST00000298912.4	37	c.2660	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953898	0.34471	.	.	ENSG00000165959	ENST00000298912	D	0.93133	-3.17	5.42	4.42	0.53409	.	0.000000	0.36200	N	0.002733	D	0.92916	0.7746	M	0.62723	1.935	0.80722	D	1	D	0.59767	0.986	P	0.53649	0.731	D	0.91723	0.5390	10	0.52906	T	0.07	.	6.1231	0.20164	0.1593:0.0:0.8407:0.0	.	887	Q96JQ2	CLMN_HUMAN	Y	887	ENSP00000298912:S887Y	ENSP00000298912:S887Y	S	-	2	0	CLMN	94732636	1.000000	0.71417	0.995000	0.50966	0.650000	0.38633	3.141000	0.50593	2.552000	0.86080	0.561000	0.74099	TCC	CLMN	-	NULL	ENSG00000165959		0.398	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2		0.00	58	0	G			95662883	-1			no_errors	ENST00000298912	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.996	T
COL12A1	1303	genome.wustl.edu	37	6	75860877	75860877	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:75860877C>G	ENST00000322507.8	-	21	4436	c.4127G>C	c.(4126-4128)tGt>tCt	p.C1376S	COL12A1_ENST00000483888.2_Missense_Mutation_p.C1376S|COL12A1_ENST00000345356.6_Missense_Mutation_p.C212S|COL12A1_ENST00000416123.2_Missense_Mutation_p.C1376S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1376					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GACACTGTTACACAAATTAAT	0.428																																																	0													153.0	147.0	149.0					6																	75860877		1898	4119	6017	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4127G>C	6.37:g.75860877C>G	ENSP00000325146:p.Cys1376Ser		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.C1376S	ENST00000322507.8	37	c.4127	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229671	0.79688	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.6	5.6	0.85130	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.90556	0.7040	M	0.87038	2.855	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.83275	0.996;0.993	D	0.91362	0.5112	10	0.72032	D	0.01	.	19.601	0.95561	0.0:1.0:0.0:0.0	.	212;1376	Q99715-2;Q99715	.;COCA1_HUMAN	S	1376;1376;212;1376;1376	ENSP00000325146:C1376S;ENSP00000305147:C212S;ENSP00000412864:C1376S;ENSP00000421216:C1376S	ENSP00000325146:C1376S	C	-	2	0	COL12A1	75917597	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.487000	0.81328	2.631000	0.89168	0.655000	0.94253	TGT	COL12A1	-	smart_VWF_A	ENSG00000111799		0.428	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	64	0	C	NM_004370		75860877	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	26.76	52	19	SNP	1.000	G
COL12A1	1303	genome.wustl.edu	37	6	75860877	75860877	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:75860877C>G	ENST00000322507.8	-	21	4436	c.4127G>C	c.(4126-4128)tGt>tCt	p.C1376S	COL12A1_ENST00000483888.2_Missense_Mutation_p.C1376S|COL12A1_ENST00000345356.6_Missense_Mutation_p.C212S|COL12A1_ENST00000416123.2_Missense_Mutation_p.C1376S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1376					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GACACTGTTACACAAATTAAT	0.428																																																	0													153.0	147.0	149.0					6																	75860877		1898	4119	6017	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4127G>C	6.37:g.75860877C>G	ENSP00000325146:p.Cys1376Ser		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.C1376S	ENST00000322507.8	37	c.4127	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229671	0.79688	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.6	5.6	0.85130	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.90556	0.7040	M	0.87038	2.855	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.83275	0.996;0.993	D	0.91362	0.5112	10	0.72032	D	0.01	.	19.601	0.95561	0.0:1.0:0.0:0.0	.	212;1376	Q99715-2;Q99715	.;COCA1_HUMAN	S	1376;1376;212;1376;1376	ENSP00000325146:C1376S;ENSP00000305147:C212S;ENSP00000412864:C1376S;ENSP00000421216:C1376S	ENSP00000325146:C1376S	C	-	2	0	COL12A1	75917597	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.487000	0.81328	2.631000	0.89168	0.655000	0.94253	TGT	COL12A1	-	smart_VWF_A	ENSG00000111799		0.428	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	88	0	C	NM_004370		75860877	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	26.76	52	19	SNP	1.000	G
COL6A5	256076	genome.wustl.edu	37	3	130107894	130107894	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:130107894G>A	ENST00000432398.2	+	6	2827	c.2333G>A	c.(2332-2334)aGc>aAc	p.S778N	COL6A5_ENST00000265379.6_Missense_Mutation_p.S778N	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	778	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AGTGGGGATAGCAGCCTAGTT	0.428																																																	0													192.0	162.0	171.0					3																	130107894		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2333G>A	3.37:g.130107894G>A	ENSP00000390895:p.Ser778Asn		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S778N	ENST00000432398.2	37	c.2333		3	.	.	.	.	.	.	.	.	.	.	G	2.042	-0.419919	0.04734	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.77877	-1.13;-1.13	5.48	2.62	0.31277	.	.	.	.	.	T	0.61148	0.2324	N	0.17594	0.5	0.09310	N	1	B	0.12013	0.005	B	0.22152	0.038	T	0.53187	-0.8474	9	0.56958	D	0.05	.	5.3238	0.15895	0.27:0.2226:0.5074:0.0	.	778	A8TX70-2	.	N	778	ENSP00000390895:S778N;ENSP00000265379:S778N	ENSP00000265379:S778N	S	+	2	0	COL6A5	131590584	0.000000	0.05858	0.014000	0.15608	0.167000	0.22549	0.209000	0.17435	0.674000	0.31244	0.650000	0.86243	AGC	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.428	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding			0.00	17	0	G	NM_153264		130107894	+1			no_errors	ENST00000265379	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.000	A
COLGALT2	23127	genome.wustl.edu	37	1	183920226	183920226	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:183920226G>A	ENST00000361927.4	-	8	1422	c.1051C>T	c.(1051-1053)Cgc>Tgc	p.R351C	COLGALT2_ENST00000367520.3_Missense_Mutation_p.R88C|COLGALT2_ENST00000546159.1_Missense_Mutation_p.R351C	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	351					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										TCCTTTCTGCGTTTGAGGTTT	0.418																																																	0													208.0	205.0	206.0					1																	183920226		2203	4300	6503	SO:0001583	missense	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1051C>T	1.37:g.183920226G>A	ENSP00000354960:p.Arg351Cys		O60327|Q9BZR0	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.R351C	ENST00000361927.4	37	c.1051	CCDS1360.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428149	0.83667	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367520	D;D	0.82255	-1.59;-1.59	5.51	4.54	0.55810	.	0.000000	0.85682	D	0.000000	D	0.92811	0.7714	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74023	0.97;0.977;0.982	D	0.94314	0.7548	10	0.87932	D	0	-10.8033	14.7671	0.69648	0.0:0.0:0.8548:0.1452	.	351;351;88	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	C	351;351;88	ENSP00000439112:R351C;ENSP00000354960:R351C	ENSP00000354960:R351C	R	-	1	0	GLT25D2	182186849	1.000000	0.71417	0.989000	0.46669	0.887000	0.51463	4.457000	0.60088	2.579000	0.87056	0.563000	0.77884	CGC	COLGALT2	-	pfam_Glyco_trans_25	ENSG00000198756		0.418	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT2	HGNC	protein_coding	OTTHUMT00000086128.1	-	0.00	26	0	G	NM_015101		183920226	-1	tier1	-	no_errors	ENST00000361927	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
COLGALT2	23127	genome.wustl.edu	37	1	183920226	183920226	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:183920226G>A	ENST00000361927.4	-	8	1422	c.1051C>T	c.(1051-1053)Cgc>Tgc	p.R351C	COLGALT2_ENST00000367520.3_Missense_Mutation_p.R88C|COLGALT2_ENST00000546159.1_Missense_Mutation_p.R351C	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	351					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										TCCTTTCTGCGTTTGAGGTTT	0.418																																																	0													208.0	205.0	206.0					1																	183920226		2203	4300	6503	SO:0001583	missense	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1051C>T	1.37:g.183920226G>A	ENSP00000354960:p.Arg351Cys		O60327|Q9BZR0	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.R351C	ENST00000361927.4	37	c.1051	CCDS1360.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428149	0.83667	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367520	D;D	0.82255	-1.59;-1.59	5.51	4.54	0.55810	.	0.000000	0.85682	D	0.000000	D	0.92811	0.7714	M	0.94021	3.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74023	0.97;0.977;0.982	D	0.94314	0.7548	10	0.87932	D	0	-10.8033	14.7671	0.69648	0.0:0.0:0.8548:0.1452	.	351;351;88	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	C	351;351;88	ENSP00000439112:R351C;ENSP00000354960:R351C	ENSP00000354960:R351C	R	-	1	0	GLT25D2	182186849	1.000000	0.71417	0.989000	0.46669	0.887000	0.51463	4.457000	0.60088	2.579000	0.87056	0.563000	0.77884	CGC	COLGALT2	-	pfam_Glyco_trans_25	ENSG00000198756		0.418	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT2	HGNC	protein_coding	OTTHUMT00000086128.1	-	0.00	41	0	G	NM_015101		183920226	-1	tier1	-	no_errors	ENST00000361927	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
CPA5	93979	genome.wustl.edu	37	7	129986353	129986353	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:129986353G>A	ENST00000485477.1	+	2	1156	c.27G>A	c.(25-27)acG>acA	p.T9T	snoU13_ENST00000459205.1_RNA|CPA5_ENST00000466363.2_Silent_p.T9T|CPA5_ENST00000461828.1_Silent_p.T9T|CPA5_ENST00000393213.3_Silent_p.T9T|CPA5_ENST00000474905.1_Silent_p.T9T|CPA5_ENST00000431780.2_Silent_p.T9T|CPA5_ENST00000355388.3_Silent_p.T9T			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	9						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GAGGCGGGACGCGCCCTGGGC	0.627																																																	0													78.0	83.0	81.0					7																	129986353		2203	4300	6503	SO:0001819	synonymous_variant	0			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.27G>A	7.37:g.129986353G>A			G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.T9	ENST00000485477.1	37	c.27	CCDS5819.1	7																																																																																			CPA5	-	NULL	ENSG00000158525		0.627	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA5	HGNC	protein_coding	OTTHUMT00000349712.1	-	0.00	16	0	G	NM_001127441		129986353	+1	tier1	-	no_errors	ENST00000355388	ensembl	human	known	74_37	silent	34.29	23	12	SNP	0.000	A
CPA5	93979	genome.wustl.edu	37	7	129986353	129986353	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:129986353G>A	ENST00000485477.1	+	2	1156	c.27G>A	c.(25-27)acG>acA	p.T9T	snoU13_ENST00000459205.1_RNA|CPA5_ENST00000466363.2_Silent_p.T9T|CPA5_ENST00000461828.1_Silent_p.T9T|CPA5_ENST00000393213.3_Silent_p.T9T|CPA5_ENST00000474905.1_Silent_p.T9T|CPA5_ENST00000431780.2_Silent_p.T9T|CPA5_ENST00000355388.3_Silent_p.T9T			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	9						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GAGGCGGGACGCGCCCTGGGC	0.627																																																	0													78.0	83.0	81.0					7																	129986353		2203	4300	6503	SO:0001819	synonymous_variant	0			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.27G>A	7.37:g.129986353G>A			G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.T9	ENST00000485477.1	37	c.27	CCDS5819.1	7																																																																																			CPA5	-	NULL	ENSG00000158525		0.627	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA5	HGNC	protein_coding	OTTHUMT00000349712.1	-	0.00	32	0	G	NM_001127441		129986353	+1	tier1	-	no_errors	ENST00000355388	ensembl	human	known	74_37	silent	34.29	23	12	SNP	0.000	A
CRK	1398	genome.wustl.edu	37	17	1340045	1340045	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:1340045G>T	ENST00000300574.2	-	2	786	c.646C>A	c.(646-648)Ccg>Acg	p.P216T	CRK_ENST00000398970.5_Intron|CRK_ENST00000572145.1_Intron|CRK_ENST00000574295.1_Intron	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog	216					activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)	p.P216S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		CCAGGCTCCGGCCCACCCAGT	0.597																																																	1	Substitution - Missense(1)	prostate(1)											66.0	65.0	65.0					17																	1340045		2203	4300	6503	SO:0001583	missense	0			D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.646C>A	17.37:g.1340045G>T	ENSP00000300574:p.Pro216Thr		A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH2,smart_SH3_domain,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.P216T	ENST00000300574.2	37	c.646	CCDS11002.1	17	.	.	.	.	.	.	.	.	.	.	G	13.49	2.254105	0.39896	.	.	ENSG00000167193	ENST00000300574	T	0.41065	1.01	6.04	6.04	0.98038	Src homology-3 domain (2);	0.000000	0.85682	D	0.000000	T	0.40398	0.1115	L	0.55990	1.75	0.80722	D	1	B	0.12013	0.005	B	0.17722	0.019	T	0.25117	-1.0141	10	0.11794	T	0.64	-6.269	18.073	0.89417	0.0:0.0:1.0:0.0	.	216	P46108	CRK_HUMAN	T	216	ENSP00000300574:P216T	ENSP00000300574:P216T	P	-	1	0	CRK	1286795	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.743000	0.62110	2.873000	0.98535	0.561000	0.74099	CCG	CRK	-	superfamily_SH3_domain	ENSG00000167193		0.597	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRK	HGNC	protein_coding	OTTHUMT00000206679.1		0.00	33	0	G	NM_016823		1340045	-1			no_errors	ENST00000300574	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34123643	34123643	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:34123643C>G	ENST00000373380.1	-	6	1189	c.969G>C	c.(967-969)caG>caC	p.Q323H	CSMD2_ENST00000373381.4_Missense_Mutation_p.Q1450H|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1410						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGGGTCACACTGGAACACTG	0.597																																																	0													121.0	112.0	115.0					1																	34123643		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.969G>C	1.37:g.34123643C>G	ENSP00000362478:p.Gln323His		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Q1450H	ENST00000373380.1	37	c.4350		1	.	.	.	.	.	.	.	.	.	.	c	25.9	4.687600	0.88639	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.65178	-0.14;-0.14	5.78	4.86	0.63082	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	L	0.42632	1.34	0.80722	D	1	D;D;D	0.67145	0.982;0.996;0.984	D;D;D	0.74348	0.926;0.983;0.95	T	0.71203	-0.4662	10	0.51188	T	0.08	.	14.3628	0.66785	0.0:0.9277:0.0:0.0723	.	323;1410;1450	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	H	1450;323	ENSP00000362479:Q1450H;ENSP00000362478:Q323H	ENSP00000241312:Q1410H	Q	-	3	2	CSMD2	33896230	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.609000	0.46317	2.737000	0.93849	0.558000	0.71614	CAG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.597	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4		0.00	10	0	C	NM_052896		34123643	-1			no_errors	ENST00000373381	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	G
CYB5R1	51706	genome.wustl.edu	37	1	202932829	202932829	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:202932829G>A	ENST00000367249.4	-	7	660	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	CYB5R1_ENST00000497655.1_5'UTR	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	196					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.R196W(1)		breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	AGGATGGCCCGGATCAGCTGT	0.517																																																	1	Substitution - Missense(1)	ovary(1)											127.0	106.0	113.0					1																	202932829		2203	4300	6503	SO:0001583	missense	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.586C>T	1.37:g.202932829G>A	ENSP00000356218:p.Arg196Trp		A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	p.R196W	ENST00000367249.4	37	c.586	CCDS1431.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284167	0.80803	.	.	ENSG00000159348	ENST00000367249	D	0.87571	-2.27	5.93	5.01	0.66863	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.351913	0.26026	N	0.026782	D	0.94450	0.8214	H	0.94698	3.57	0.50632	D	0.999884	D	0.76494	0.999	D	0.62955	0.909	D	0.95382	0.8474	10	0.87932	D	0	-5.8142	12.6473	0.56742	0.0795:0.0:0.9205:0.0	.	196	Q9UHQ9	NB5R1_HUMAN	W	196	ENSP00000356218:R196W	ENSP00000356218:R196W	R	-	1	2	CYB5R1	201199452	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	5.838000	0.69388	1.503000	0.48686	0.655000	0.94253	CGG	CYB5R1	-	pfam_OxRdtase_FAD/NAD-bd,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	ENSG00000159348		0.517	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	-	0.00	56	0	G	NM_016243		202932829	-1	tier1	-	no_errors	ENST00000367249	ensembl	human	known	74_37	missense	31.00	69	31	SNP	1.000	A
CYB5R1	51706	genome.wustl.edu	37	1	202932829	202932829	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:202932829G>A	ENST00000367249.4	-	7	660	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W	CYB5R1_ENST00000497655.1_5'UTR	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	196					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.R196W(1)		breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	AGGATGGCCCGGATCAGCTGT	0.517																																																	1	Substitution - Missense(1)	ovary(1)											127.0	106.0	113.0					1																	202932829		2203	4300	6503	SO:0001583	missense	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.586C>T	1.37:g.202932829G>A	ENSP00000356218:p.Arg196Trp		A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	p.R196W	ENST00000367249.4	37	c.586	CCDS1431.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284167	0.80803	.	.	ENSG00000159348	ENST00000367249	D	0.87571	-2.27	5.93	5.01	0.66863	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.351913	0.26026	N	0.026782	D	0.94450	0.8214	H	0.94698	3.57	0.50632	D	0.999884	D	0.76494	0.999	D	0.62955	0.909	D	0.95382	0.8474	10	0.87932	D	0	-5.8142	12.6473	0.56742	0.0795:0.0:0.9205:0.0	.	196	Q9UHQ9	NB5R1_HUMAN	W	196	ENSP00000356218:R196W	ENSP00000356218:R196W	R	-	1	2	CYB5R1	201199452	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	5.838000	0.69388	1.503000	0.48686	0.655000	0.94253	CGG	CYB5R1	-	pfam_OxRdtase_FAD/NAD-bd,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	ENSG00000159348		0.517	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	-	0.00	95	0	G	NM_016243		202932829	-1	tier1	-	no_errors	ENST00000367249	ensembl	human	known	74_37	missense	31.00	69	31	SNP	1.000	A
CYP2G1P	22952	genome.wustl.edu	37	19	41397873	41397874	+	Intron	DNP	CT	CT	AC			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:41397873_41397874CT>AC	ENST00000601627.1	+	2	119				CYP2G1P_ENST00000252909.4_RNA																							AGCCCCTCCTCTTGTGTTTTCC	0.48																																																	0																																										SO:0001627	intron_variant	0																														Exception_encountered	19.37:g.41397873_41397874delinsAC				RNA	SNP	-	NULL	ENST00000601627.1	37	NULL		19																																																																																			CYP2G1P	-	-	ENSG00000130612		0.480	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	CYP2G1P	HGNC	protein_coding	OTTHUMT00000463921.1	-	0.00	14|15	0	C|T			41397873|41397874	+1	tier1	-	no_errors	ENST00000252909	ensembl	human	known	74_37	rna	31.58	13	6	SNP	0.002|0.000	A|C
DCAF7	10238	genome.wustl.edu	37	17	61670951	61670951	+	3'UTR	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:61670951T>C	ENST00000310827.4	+	0	5663				DCAF7_ENST00000577702.1_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						CCAGTGATTATGAACATGTGA	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*4417T>C	17.37:g.61670951T>C			B4E039|D3DU14|O15491|Q9DAE4	RNA	SNP	-	NULL	ENST00000310827.4	37	NULL		17																																																																																			DCAF7	-	-	ENSG00000136485		0.358	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	HGNC	protein_coding		-	0.00	10	0	T	NM_005828		61670951	+1	tier1	-	no_errors	ENST00000577702	ensembl	human	known	74_37	rna	18.52	22	5	SNP	0.213	C
DCAF7	10238	genome.wustl.edu	37	17	61670951	61670951	+	3'UTR	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:61670951T>C	ENST00000310827.4	+	0	5663				DCAF7_ENST00000577702.1_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						CCAGTGATTATGAACATGTGA	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*4417T>C	17.37:g.61670951T>C			B4E039|D3DU14|O15491|Q9DAE4	RNA	SNP	-	NULL	ENST00000310827.4	37	NULL		17																																																																																			DCAF7	-	-	ENSG00000136485		0.358	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	HGNC	protein_coding		-	0.00	12	0	T	NM_005828		61670951	+1	tier1	-	no_errors	ENST00000577702	ensembl	human	known	74_37	rna	18.52	22	5	SNP	0.213	C
DCHS1	8642	genome.wustl.edu	37	11	6648765	6648765	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:6648765G>T	ENST00000299441.3	-	14	5916	c.5505C>A	c.(5503-5505)ctC>ctA	p.L1835L		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1835	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGTGGCACTGAGAGCTGGCT	0.592																																																	0													33.0	24.0	27.0					11																	6648765		2201	4296	6497	SO:0001819	synonymous_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5505C>A	11.37:g.6648765G>T			O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1835	ENST00000299441.3	37	c.5505	CCDS7771.1	11																																																																																			DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.592	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	17	0	G	NM_003737		6648765	-1	tier1	-	no_errors	ENST00000299441	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.995	T
DCHS1	8642	genome.wustl.edu	37	11	6648765	6648765	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:6648765G>T	ENST00000299441.3	-	14	5916	c.5505C>A	c.(5503-5505)ctC>ctA	p.L1835L		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1835	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGTGGCACTGAGAGCTGGCT	0.592																																																	0													33.0	24.0	27.0					11																	6648765		2201	4296	6497	SO:0001819	synonymous_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5505C>A	11.37:g.6648765G>T			O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1835	ENST00000299441.3	37	c.5505	CCDS7771.1	11																																																																																			DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.592	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	20	0	G	NM_003737		6648765	-1	tier1	-	no_errors	ENST00000299441	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.995	T
DGAT1	8694	genome.wustl.edu	37	8	145540826	145540827	+	Intron	DEL	CA	CA	-	rs201213845		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr8:145540826_145540827delCA	ENST00000332324.4	-	14	1434				GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_5'UTR	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1						acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGTTCCACATCACACACACACA	0.569																																																	0																																										SO:0001627	intron_variant	0			AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.1160+22TG>-	8.37:g.145540836_145540837delCA			B2RWQ2|D3DWL6|Q96BB8	RNA	DEL	-	NULL	ENST00000332324.4	37	NULL	CCDS6420.1	8																																																																																			DGAT1	-	-	ENSG00000185000		0.569	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT1	HGNC	protein_coding	OTTHUMT00000382059.3		0.00	36	0	CA	NM_012079		145540827	-1	tier1		no_errors	ENST00000527438	ensembl	human	putative	74_37	rna	7.50	37	3	DEL	0.000:0.001	-
DISP1	84976	genome.wustl.edu	37	1	223116506	223116506	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:223116506C>A	ENST00000284476.6	+	2	505	c.341C>A	c.(340-342)tCg>tAg	p.S114*	DISP1_ENST00000495684.1_Intron|DISP1_ENST00000360254.2_Nonsense_Mutation_p.S114*	NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	114					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.S114L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		GCTTTGGCCTCGTGTTGCATG	0.542																																																	1	Substitution - Missense(1)	large_intestine(1)											140.0	113.0	122.0					1																	223116506		2203	4300	6503	SO:0001587	stop_gained	0			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.341C>A	1.37:g.223116506C>A	ENSP00000284476:p.Ser114*		Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Nonsense_Mutation	SNP	NULL	p.S114*	ENST00000284476.6	37	c.341	CCDS1536.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.096557	0.97281	.	.	ENSG00000154309	ENST00000360254;ENST00000284476	.	.	.	5.62	5.62	0.85841	.	0.462710	0.21498	N	0.073575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0437	19.6445	0.95771	0.0:1.0:0.0:0.0	.	.	.	.	X	114	.	ENSP00000284476:S114X	S	+	2	0	DISP1	221183129	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.596000	0.67570	2.652000	0.90054	0.650000	0.86243	TCG	DISP1	-	NULL	ENSG00000154309		0.542	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1		0.00	8	0	C	NM_032890		223116506	+1			no_errors	ENST00000360254	ensembl	human	putative	74_37	nonsense	5.13	37	2	SNP	0.998	A
DNAH12	201625	genome.wustl.edu	37	3	57327764	57327764	+	3'UTR	DEL	T	T	-	rs370335542		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:57327764delT	ENST00000351747.2	-	0	9504				ASB14_ENST00000487349.1_5'Flank|ASB14_ENST00000389601.3_5'Flank|DNAH12_ENST00000462713.1_5'UTR	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GTAGGACAGGTTTTTTTTTTT	0.328																																																	0													11.0	13.0	13.0					3																	57327764		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.*45A>-	3.37:g.57327764delT			A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	RNA	DEL	-	NULL	ENST00000351747.2	37	NULL		3																																																																																			DNAH12	-	-	ENSG00000174844		0.328	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding			0.00	11	0	T	NM_178504		57327764	-1	tier1		no_errors	ENST00000462713	ensembl	human	known	74_37	rna	11.11	24	3	DEL	0.000	-
DNAH5	1767	genome.wustl.edu	37	5	13809266	13809266	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:13809266G>T	ENST00000265104.4	-	46	7743	c.7639C>A	c.(7639-7641)Cag>Aag	p.Q2547K		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2547					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGTATTCCTGGGTACGCGTG	0.448									Kartagener syndrome																																								0													165.0	154.0	158.0					5																	13809266		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7639C>A	5.37:g.13809266G>T	ENSP00000265104:p.Gln2547Lys		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q2547K	ENST00000265104.4	37	c.7639	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	7.157	0.584964	0.13749	.	.	ENSG00000039139	ENST00000265104	T	0.21543	2.0	5.91	4.12	0.48240	.	0.154134	0.56097	D	0.000027	T	0.18002	0.0432	L	0.29908	0.895	0.28193	N	0.927678	B	0.02656	0.0	B	0.06405	0.002	T	0.06552	-1.0820	10	0.34782	T	0.22	.	17.0343	0.86470	0.0:0.8106:0.1894:0.0	.	2547	Q8TE73	DYH5_HUMAN	K	2547	ENSP00000265104:Q2547K	ENSP00000265104:Q2547K	Q	-	1	0	DNAH5	13862266	1.000000	0.71417	0.650000	0.29550	0.163000	0.22366	4.365000	0.59486	0.825000	0.34637	0.655000	0.94253	CAG	DNAH5	-	NULL	ENSG00000039139		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	53	0	G	NM_001369		13809266	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.998	T
DNAH5	1767	genome.wustl.edu	37	5	13809266	13809266	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:13809266G>T	ENST00000265104.4	-	46	7743	c.7639C>A	c.(7639-7641)Cag>Aag	p.Q2547K		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2547					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGTATTCCTGGGTACGCGTG	0.448									Kartagener syndrome																																								0													165.0	154.0	158.0					5																	13809266		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7639C>A	5.37:g.13809266G>T	ENSP00000265104:p.Gln2547Lys		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q2547K	ENST00000265104.4	37	c.7639	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	7.157	0.584964	0.13749	.	.	ENSG00000039139	ENST00000265104	T	0.21543	2.0	5.91	4.12	0.48240	.	0.154134	0.56097	D	0.000027	T	0.18002	0.0432	L	0.29908	0.895	0.28193	N	0.927678	B	0.02656	0.0	B	0.06405	0.002	T	0.06552	-1.0820	10	0.34782	T	0.22	.	17.0343	0.86470	0.0:0.8106:0.1894:0.0	.	2547	Q8TE73	DYH5_HUMAN	K	2547	ENSP00000265104:Q2547K	ENSP00000265104:Q2547K	Q	-	1	0	DNAH5	13862266	1.000000	0.71417	0.650000	0.29550	0.163000	0.22366	4.365000	0.59486	0.825000	0.34637	0.655000	0.94253	CAG	DNAH5	-	NULL	ENSG00000039139		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	57	0	G	NM_001369		13809266	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.998	T
DNAH9	1770	genome.wustl.edu	37	17	11711078	11711078	+	Missense_Mutation	SNP	C	C	A	rs370070428		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:11711078C>A	ENST00000262442.4	+	44	8518	c.8450C>A	c.(8449-8451)cCg>cAg	p.P2817Q	DNAH9_ENST00000454412.2_Missense_Mutation_p.P2817Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2817	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTGGAGTCCCCGCGGGGAAAT	0.512																																																	0													95.0	87.0	90.0					17																	11711078		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8450C>A	17.37:g.11711078C>A	ENSP00000262442:p.Pro2817Gln		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2817Q	ENST00000262442.4	37	c.8450	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162343	0.78226	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.58940	0.3;0.3	5.52	5.52	0.82312	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.058549	0.64402	D	0.000001	D	0.84009	0.5378	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88605	0.3152	10	0.87932	D	0	.	19.4865	0.95030	0.0:1.0:0.0:0.0	.	2817	Q9NYC9	DYH9_HUMAN	Q	2817;2817;1399	ENSP00000262442:P2817Q;ENSP00000414874:P2817Q	ENSP00000262442:P2817Q	P	+	2	0	DNAH9	11651803	1.000000	0.71417	0.912000	0.35992	0.755000	0.42902	6.017000	0.70805	2.605000	0.88082	0.644000	0.83932	CCG	DNAH9	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000007174		0.512	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	25	0	C	NM_001372		11711078	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	A
DNAH9	1770	genome.wustl.edu	37	17	11711078	11711078	+	Missense_Mutation	SNP	C	C	A	rs370070428		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:11711078C>A	ENST00000262442.4	+	44	8518	c.8450C>A	c.(8449-8451)cCg>cAg	p.P2817Q	DNAH9_ENST00000454412.2_Missense_Mutation_p.P2817Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2817	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTGGAGTCCCCGCGGGGAAAT	0.512																																																	0													95.0	87.0	90.0					17																	11711078		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8450C>A	17.37:g.11711078C>A	ENSP00000262442:p.Pro2817Gln		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2817Q	ENST00000262442.4	37	c.8450	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162343	0.78226	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.58940	0.3;0.3	5.52	5.52	0.82312	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.058549	0.64402	D	0.000001	D	0.84009	0.5378	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88605	0.3152	10	0.87932	D	0	.	19.4865	0.95030	0.0:1.0:0.0:0.0	.	2817	Q9NYC9	DYH9_HUMAN	Q	2817;2817;1399	ENSP00000262442:P2817Q;ENSP00000414874:P2817Q	ENSP00000262442:P2817Q	P	+	2	0	DNAH9	11651803	1.000000	0.71417	0.912000	0.35992	0.755000	0.42902	6.017000	0.70805	2.605000	0.88082	0.644000	0.83932	CCG	DNAH9	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000007174		0.512	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	36	0	C	NM_001372		11711078	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.999	A
DNAJB7	150353	genome.wustl.edu	37	22	41257207	41257207	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:41257207G>T	ENST00000307221.4	-	1	923	c.792C>A	c.(790-792)gaC>gaA	p.D264E	XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000482652.1_Intron|XPNPEP3_ENST00000357137.4_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	264							chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						CCTCATCATTGTCCACGAAAG	0.423																																																	0													132.0	124.0	127.0					22																	41257207		2203	4300	6503	SO:0001583	missense	0			AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.792C>A	22.37:g.41257207G>T	ENSP00000307197:p.Asp264Glu		Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_ConA-like_lec_gl_sf,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.D264E	ENST00000307221.4	37	c.792	CCDS14008.1	22	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.404369	0.01155	.	.	ENSG00000172404	ENST00000307221	T	0.59772	0.24	4.48	-1.46	0.08800	.	2.655720	0.01795	N	0.032537	T	0.39963	0.1098	L	0.39397	1.21	0.09310	N	0.999999	B	0.17667	0.023	B	0.21151	0.033	T	0.12578	-1.0542	10	0.02654	T	1	.	0.9714	0.01416	0.1784:0.1539:0.3517:0.316	.	264	Q7Z6W7	DNJB7_HUMAN	E	264	ENSP00000307197:D264E	ENSP00000307197:D264E	D	-	3	2	DNAJB7	39587153	0.008000	0.16893	0.008000	0.14137	0.069000	0.16628	0.242000	0.18087	-0.113000	0.11958	0.591000	0.81541	GAC	DNAJB7	-	NULL	ENSG00000172404		0.423	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB7	HGNC	protein_coding	OTTHUMT00000321765.1	-	0.00	52	0	G	NM_145174		41257207	-1	tier1	-	no_errors	ENST00000307221	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.009	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299973	102299973	+	RNA	SNP	T	T	C	rs368838103		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:102299973T>C	ENST00000561463.1	+	0	8019									DNM1 pseudogene 47																		GTCCAACCTGTACTCGCGTGG	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299973T>C				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	53	0	T	NG_009149		102299973	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	10.48	94	11	SNP	1.000	C
DYNLT3	6990	genome.wustl.edu	37	X	37706325	37706325	+	Intron	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:37706325C>T	ENST00000378578.4	-	1	157				DYNLT3_ENST00000378581.3_Intron|DYNLT3_ENST00000432389.2_Missense_Mutation_p.V7I|TM4SF2_ENST00000465127.1_Intron	NM_006520.2	NP_006511.1	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	motor activity (GO:0003774)			endometrium(1)|lung(1)|skin(1)	3						GCCACCAGGACCCCGAGACTC	0.627																																																	0																																										SO:0001627	intron_variant	0			U02556	CCDS14243.1	Xp21	2013-01-18	2005-11-25	2005-11-25	ENSG00000165169	ENSG00000165169		"""Cytoplasmic dyneins"""	11694	protein-coding gene	gene with protein product		300302	"""t-complex-associated-testis-expressed 1-like"""	TCTE1L		8004092	Standard	NM_006520		Approved	TCTEX1L	uc004dds.3	P51808	OTTHUMG00000033172	ENST00000378578.4:c.30+408G>A	X.37:g.37706325C>T			Q6ICS3	Missense_Mutation	SNP	pfam_Tctex	p.V7I	ENST00000378578.4	37	c.19	CCDS14243.1	X	.	.	.	.	.	.	.	.	.	.	C	1.493	-0.554036	0.03996	.	.	ENSG00000165169	ENST00000432389	.	.	.	3.33	1.5	0.22942	.	.	.	.	.	T	0.22781	0.0550	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25916	-1.0118	5	0.21014	T	0.42	.	5.2218	0.15373	0.0:0.7112:0.0:0.2888	.	.	.	.	I	7	.	ENSP00000402695:V7I	V	-	1	0	DYNLT3	37591269	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.253000	0.18296	0.252000	0.21531	0.436000	0.28706	GTC	DYNLT3	-	NULL	ENSG00000165169		0.627	DYNLT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNLT3	HGNC	protein_coding	OTTHUMT00000080876.1	-	0.00	43	0	C	NM_006520		37706325	-1	tier1	-	no_errors	ENST00000432389	ensembl	human	known	74_37	missense	26.14	65	23	SNP	0.000	T
DYNLT3	6990	genome.wustl.edu	37	X	37706325	37706325	+	Intron	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:37706325C>T	ENST00000378578.4	-	1	157				DYNLT3_ENST00000378581.3_Intron|DYNLT3_ENST00000432389.2_Missense_Mutation_p.V7I|TM4SF2_ENST00000465127.1_Intron	NM_006520.2	NP_006511.1	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	motor activity (GO:0003774)			endometrium(1)|lung(1)|skin(1)	3						GCCACCAGGACCCCGAGACTC	0.627																																																	0																																										SO:0001627	intron_variant	0			U02556	CCDS14243.1	Xp21	2013-01-18	2005-11-25	2005-11-25	ENSG00000165169	ENSG00000165169		"""Cytoplasmic dyneins"""	11694	protein-coding gene	gene with protein product		300302	"""t-complex-associated-testis-expressed 1-like"""	TCTE1L		8004092	Standard	NM_006520		Approved	TCTEX1L	uc004dds.3	P51808	OTTHUMG00000033172	ENST00000378578.4:c.30+408G>A	X.37:g.37706325C>T			Q6ICS3	Missense_Mutation	SNP	pfam_Tctex	p.V7I	ENST00000378578.4	37	c.19	CCDS14243.1	X	.	.	.	.	.	.	.	.	.	.	C	1.493	-0.554036	0.03996	.	.	ENSG00000165169	ENST00000432389	.	.	.	3.33	1.5	0.22942	.	.	.	.	.	T	0.22781	0.0550	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25916	-1.0118	5	0.21014	T	0.42	.	5.2218	0.15373	0.0:0.7112:0.0:0.2888	.	.	.	.	I	7	.	ENSP00000402695:V7I	V	-	1	0	DYNLT3	37591269	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.253000	0.18296	0.252000	0.21531	0.436000	0.28706	GTC	DYNLT3	-	NULL	ENSG00000165169		0.627	DYNLT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNLT3	HGNC	protein_coding	OTTHUMT00000080876.1	-	0.00	80	0	C	NM_006520		37706325	-1	tier1	-	no_errors	ENST00000432389	ensembl	human	known	74_37	missense	26.14	65	23	SNP	0.000	T
DYRK3	8444	genome.wustl.edu	37	1	206821626	206821626	+	Missense_Mutation	SNP	C	C	A	rs200531359		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:206821626C>A	ENST00000367109.2	+	3	1251	c.1083C>A	c.(1081-1083)ttC>ttA	p.F361L	DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367106.1_Missense_Mutation_p.F341L|DYRK3_ENST00000367108.3_Missense_Mutation_p.F341L	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	361	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CCAGCTGTTTCGAGTACCAGA	0.448																																					Melanoma(164;427 2622 26826 51707)												0													88.0	96.0	93.0					1																	206821626		2203	4300	6503	SO:0001583	missense	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.1083C>A	1.37:g.206821626C>A	ENSP00000356076:p.Phe361Leu		D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F361L	ENST00000367109.2	37	c.1083	CCDS30999.1	1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442350	0.43326	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000367106	T;T;T	0.63580	-0.05;-0.05;-0.05	5.3	-7.49	0.01355	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	L	0.28608	0.87	0.58432	D	0.999999	B;P	0.37398	0.231;0.593	B;B	0.40285	0.325;0.218	T	0.47959	-0.9076	10	0.39692	T	0.17	.	16.712	0.85388	0.0:0.2615:0.0:0.7385	.	361;341	O43781;O43781-2	DYRK3_HUMAN;.	L	361;341;341	ENSP00000356076:F361L;ENSP00000356075:F341L;ENSP00000356073:F341L	ENSP00000356073:F341L	F	+	3	2	DYRK3	204888249	0.001000	0.12720	0.733000	0.30861	0.868000	0.49771	-1.404000	0.02494	-1.437000	0.01967	-0.272000	0.10252	TTC	DYRK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000143479		0.448	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1		0.00	19	0	C	NM_003582		206821626	+1			no_errors	ENST00000367109	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.482	A
EBF1	1879	genome.wustl.edu	37	5	158125829	158125830	+	3'UTR	INS	-	-	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:158125829_158125830insA	ENST00000313708.6	-	0	2347_2348				EBF1_ENST00000517373.1_3'UTR|EBF1_ENST00000380654.4_3'UTR|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1						multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAATTAAGCTTAAAAAAAAAAA	0.297			T	HMGA2	lipoma																																			Dom	yes		5	5q34	1879	early B-cell factor 1		M	0																																										SO:0001624	3_prime_UTR_variant	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.*290->T	5.37:g.158125840_158125840dupA			Q8IW11	RNA	INS	-	NULL	ENST00000313708.6	37	NULL	CCDS4343.1	5																																																																																			EBF1	-	-	ENSG00000164330		0.297	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1		0.00	26	0	-	NM_024007		158125830	-1	tier1		no_errors	ENST00000518323	ensembl	human	known	74_37	rna	9.80	46	5	INS	0.815:0.002	A
EDC4	23644	genome.wustl.edu	37	16	67912946	67912946	+	Silent	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:67912946T>C	ENST00000358933.5	+	12	1613	c.1374T>C	c.(1372-1374)ccT>ccC	p.P458P	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	458					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TCACCCACCCTGTGCTGAGCT	0.597																																																	0													57.0	47.0	50.0					16																	67912946		2198	4300	6498	SO:0001819	synonymous_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1374T>C	16.37:g.67912946T>C			A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P458	ENST00000358933.5	37	c.1374	CCDS10849.1	16																																																																																			EDC4	-	NULL	ENSG00000038358		0.597	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2		0.00	19	0	T	NM_014329		67912946	+1			no_errors	ENST00000358933	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.708	C
EDEM1	9695	genome.wustl.edu	37	3	5241344	5241344	+	Missense_Mutation	SNP	A	A	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:5241344A>C	ENST00000256497.4	+	3	783	c.650A>C	c.(649-651)aAa>aCa	p.K217T	EDEM1_ENST00000445686.1_Missense_Mutation_p.K22T	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	217					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TCATTTGACAAAGATTCCACC	0.338																																																	0													93.0	90.0	91.0					3																	5241344		2203	4300	6503	SO:0001583	missense	0			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.650A>C	3.37:g.5241344A>C	ENSP00000256497:p.Lys217Thr		A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.K217T	ENST00000256497.4	37	c.650	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	A	13.27	2.188406	0.38609	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.71698	-0.59;-0.59	5.19	-1.49	0.08718	.	0.094127	0.64402	D	0.000001	T	0.53802	0.1819	L	0.47016	1.485	0.58432	D	0.999999	B	0.15930	0.015	B	0.16289	0.015	T	0.26503	-1.0101	10	0.15499	T	0.54	-9.5058	6.8391	0.23953	0.568:0.1163:0.3156:0.0	.	217	Q92611	EDEM1_HUMAN	T	217;22	ENSP00000256497:K217T;ENSP00000394099:K22T	ENSP00000256497:K217T	K	+	2	0	EDEM1	5216344	1.000000	0.71417	0.981000	0.43875	0.963000	0.63663	1.928000	0.40104	-0.538000	0.06281	-1.080000	0.02220	AAA	EDEM1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000134109		0.338	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	-	0.00	67	0	A	NM_014674		5241344	+1	tier1	-	no_errors	ENST00000256497	ensembl	human	known	74_37	missense	34.31	67	35	SNP	0.999	C
EDEM1	9695	genome.wustl.edu	37	3	5241344	5241344	+	Missense_Mutation	SNP	A	A	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:5241344A>C	ENST00000256497.4	+	3	783	c.650A>C	c.(649-651)aAa>aCa	p.K217T	EDEM1_ENST00000445686.1_Missense_Mutation_p.K22T	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	217					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TCATTTGACAAAGATTCCACC	0.338																																																	0													93.0	90.0	91.0					3																	5241344		2203	4300	6503	SO:0001583	missense	0			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.650A>C	3.37:g.5241344A>C	ENSP00000256497:p.Lys217Thr		A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.K217T	ENST00000256497.4	37	c.650	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	A	13.27	2.188406	0.38609	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.71698	-0.59;-0.59	5.19	-1.49	0.08718	.	0.094127	0.64402	D	0.000001	T	0.53802	0.1819	L	0.47016	1.485	0.58432	D	0.999999	B	0.15930	0.015	B	0.16289	0.015	T	0.26503	-1.0101	10	0.15499	T	0.54	-9.5058	6.8391	0.23953	0.568:0.1163:0.3156:0.0	.	217	Q92611	EDEM1_HUMAN	T	217;22	ENSP00000256497:K217T;ENSP00000394099:K22T	ENSP00000256497:K217T	K	+	2	0	EDEM1	5216344	1.000000	0.71417	0.981000	0.43875	0.963000	0.63663	1.928000	0.40104	-0.538000	0.06281	-1.080000	0.02220	AAA	EDEM1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000134109		0.338	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	-	0.00	89	0	A	NM_014674		5241344	+1	tier1	-	no_errors	ENST00000256497	ensembl	human	known	74_37	missense	34.31	67	35	SNP	0.999	C
EMC10	284361	genome.wustl.edu	37	19	50985132	50985132	+	Intron	DEL	G	G	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:50985132delG	ENST00000334976.6	+	7	724				CTD-2545M3.2_ENST00000598194.1_RNA|EMC10_ENST00000376918.3_Frame_Shift_Del_p.L231fs|EMC10_ENST00000598585.1_Intron	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10							ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.A234fs*56(1)									ACATCATCCTGGGGGGGGCCG	0.736																																																	1	Insertion - Frameshift(1)	large_intestine(1)							,	77,52,3703		3,0,71,2,48,1792					,	3.7	1.0			8	210,155,7453		5,1,199,6,142,3556	no	intron,codingComplex	C19orf63	NM_206538.2,NM_175063.4	,	8,1,270,8,190,5348	A1A1,A1A2,A1R,A2A2,A2R,RR		4.6687,3.3664,4.2403	,	,		287,207,11156				SO:0001627	intron_variant	0			BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.679-274G>-	19.37:g.50985132delG			Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Frame_Shift_Del	DEL	NULL	p.A234fs	ENST00000334976.6	37	c.693	CCDS12796.1	19																																																																																			EMC10	-	NULL	ENSG00000161671		0.736	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC10	HGNC	protein_coding	OTTHUMT00000464760.2		0.00	33	0	G	NM_175063		50985132	+1	tier1		no_errors	ENST00000376918	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	1.000	-
AP001482.1	0	genome.wustl.edu	37	11	88845972	88845972	+	RNA	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:88845972T>C	ENST00000408203.1	+	0	95																											catacatatatatatatatat	0.219																																																	0																																												0																															11.37:g.88845972T>C				RNA	SNP	-	NULL	ENST00000408203.1	37	NULL		11																																																																																			AP001482.1	-	-	ENSG00000221130		0.219	AP001482.1-201	NOVEL	basic	miRNA	ENSG00000221130	Clone_based_ensembl_gene	miRNA		-	0.00	39	0	T			88845972	+1	tier1	-	no_errors	ENST00000408203	ensembl	human	novel	74_37	rna	7.81	59	5	SNP	0.081	C
SGMS1-AS1	104355295	genome.wustl.edu	37	10	52389979	52389979	+	RNA	SNP	C	C	A	rs537777133	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:52389979C>A	ENST00000443374.2	+	0	1168				RP11-50E11.3_ENST00000609579.1_RNA																							ATAGTCTCCCCGTAGGCCTTC	0.393																																																	0																																												0																															10.37:g.52389979C>A				RNA	SNP	-	NULL	ENST00000443374.2	37	NULL		10																																																																																			RP11-50E11.3	-	-	ENSG00000226200		0.393	RP11-50E11.3-001	KNOWN	basic	antisense	ENSG00000226200	Clone_based_vega_gene	antisense	OTTHUMT00000048071.2	-	0.00	42	0	C			52389979	+1	tier1	-	no_errors	ENST00000443374	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.184	A
SGMS1-AS1	104355295	genome.wustl.edu	37	10	52389979	52389979	+	RNA	SNP	C	C	A	rs537777133	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:52389979C>A	ENST00000443374.2	+	0	1168				RP11-50E11.3_ENST00000609579.1_RNA																							ATAGTCTCCCCGTAGGCCTTC	0.393																																																	0																																												0																															10.37:g.52389979C>A				RNA	SNP	-	NULL	ENST00000443374.2	37	NULL		10																																																																																			RP11-50E11.3	-	-	ENSG00000226200		0.393	RP11-50E11.3-001	KNOWN	basic	antisense	ENSG00000226200	Clone_based_vega_gene	antisense	OTTHUMT00000048071.2	-	0.00	60	0	C			52389979	+1	tier1	-	no_errors	ENST00000443374	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.184	A
MCFD2	90411	genome.wustl.edu	37	2	47134824	47134824	+	Intron	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:47134824T>C	ENST00000409105.1	-	4	489				MCFD2_ENST00000409147.1_Intron|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409913.1_Intron|MCFD2_ENST00000493804.1_Intron|MCFD2_ENST00000409973.1_Intron|MCFD2_ENST00000319466.4_Intron|MCFD2_ENST00000409800.1_Intron|MCFD2_ENST00000444761.2_Intron|MCFD2_ENST00000409218.1_Intron|MCFD2_ENST00000409207.1_Intron	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	atgcgagccatcatgcccagT	0.493																																																	0																																										SO:0001627	intron_variant	0			AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.309+124A>G	2.37:g.47134824T>C			A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	RNA	SNP	-	NULL	ENST00000409105.1	37	NULL	CCDS33192.1	2																																																																																			AC016722.4	-	-	ENSG00000228925		0.493	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000228925	Clone_based_vega_gene	protein_coding	OTTHUMT00000329518.1	-	0.00	14	0	T	NM_139279		47134824	+1	tier1	-	no_errors	ENST00000429761	ensembl	human	known	74_37	rna	16.67	30	6	SNP	0.211	C
MCFD2	90411	genome.wustl.edu	37	2	47134824	47134824	+	Intron	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:47134824T>C	ENST00000409105.1	-	4	489				MCFD2_ENST00000409147.1_Intron|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409913.1_Intron|MCFD2_ENST00000493804.1_Intron|MCFD2_ENST00000409973.1_Intron|MCFD2_ENST00000319466.4_Intron|MCFD2_ENST00000409800.1_Intron|MCFD2_ENST00000444761.2_Intron|MCFD2_ENST00000409218.1_Intron|MCFD2_ENST00000409207.1_Intron	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	atgcgagccatcatgcccagT	0.493																																																	0																																										SO:0001627	intron_variant	0			AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.309+124A>G	2.37:g.47134824T>C			A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	RNA	SNP	-	NULL	ENST00000409105.1	37	NULL	CCDS33192.1	2																																																																																			AC016722.4	-	-	ENSG00000228925		0.493	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000228925	Clone_based_vega_gene	protein_coding	OTTHUMT00000329518.1	-	0.00	28	0	T	NM_139279		47134824	+1	tier1	-	no_errors	ENST00000429761	ensembl	human	known	74_37	rna	16.67	30	6	SNP	0.211	C
RP11-782C8.2	0	genome.wustl.edu	37	1	143210585	143210585	+	lincRNA	SNP	G	G	A	rs202055740|rs375062908		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:143210585G>A	ENST00000412204.2	-	0	485				RP11-782C8.1_ENST00000438000.1_lincRNA																							ACACACACACGCACACCAGAG	0.284																																																	0																																												0																															1.37:g.143210585G>A				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.284	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	24	0	G			143210585	-1	tier1	rs202055740	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	18.87	43	10	SNP	0.000	A
RP11-782C8.2	0	genome.wustl.edu	37	1	143210585	143210585	+	lincRNA	SNP	G	G	A	rs202055740|rs375062908		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:143210585G>A	ENST00000412204.2	-	0	485				RP11-782C8.1_ENST00000438000.1_lincRNA																							ACACACACACGCACACCAGAG	0.284																																																	0																																												0																															1.37:g.143210585G>A				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.284	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	35	0	G			143210585	-1	tier1	rs202055740	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	18.87	43	10	SNP	0.000	A
FAM27B	100133121	genome.wustl.edu	37	9	67793687	67793688	+	Intron	INS	-	-	CACA	rs369028109|rs62543667		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:67793687_67793688insCACA	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		acacacacactcacacacacac	0.53																																																	0																																										SO:0001627	intron_variant	0					9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+208->TGTG	9.37:g.67793692_67793695dupCACA				RNA	INS	-	NULL	ENST00000377484.3	37	NULL		9																																																																																			RP11-12A20.7	-	-	ENSG00000236233		0.530	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	Clone_based_vega_gene	protein_coding	OTTHUMT00000037106.1		0.00	9	0	-	NR_027422		67793688	+1	tier1		no_errors	ENST00000315762	ensembl	human	known	74_37	rna	37.50	5	3	INS	0.071:0.072	CACA
BHMG1	388553	genome.wustl.edu	37	19	46260508	46260508	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:46260508G>T	ENST00000457052.2	+	9	1401	c.985G>T	c.(985-987)Gcc>Tcc	p.A329S																								TTGGCTCCCTGCCTGGACCCC	0.557																																																	0																																										SO:0001583	missense	0																														ENST00000457052.2:c.985G>T	19.37:g.46260508G>T	ENSP00000402674:p.Ala329Ser			Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.A329S	ENST00000457052.2	37	c.985		19	.	.	.	.	.	.	.	.	.	.	.	7.354	0.623413	0.14193	.	.	ENSG00000237452	ENST00000457052	D	0.97404	-4.37	4.69	2.56	0.30785	.	.	.	.	.	D	0.96470	0.8848	.	.	.	.	.	.	.	.	.	.	.	.	D	0.96682	0.9504	5	0.87932	D	0	.	6.9604	0.24593	0.2069:0.0:0.7931:0.0	.	.	.	.	S	329	ENSP00000402674:A329S	ENSP00000402674:A329S	A	+	1	0	AC074212.3	50952348	0.852000	0.29690	0.140000	0.22221	0.426000	0.31534	1.221000	0.32503	0.588000	0.29660	0.561000	0.74099	GCC	AC074212.3	-	NULL	ENSG00000237452		0.557	AC074212.3-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000237452	Clone_based_vega_gene	protein_coding	OTTHUMT00000343318.3	-	0.00	35	0	G			46260508	+1	tier1	-	no_errors	ENST00000457052	ensembl	human	putative	74_37	missense	13.04	20	3	SNP	0.337	T
BHMG1	388553	genome.wustl.edu	37	19	46262720	46262720	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:46262720C>A	ENST00000457052.2	+	11	1633	c.1217C>A	c.(1216-1218)gCc>gAc	p.A406D																								TCACCTTCAGCCTACACGCAG	0.542																																																	0																																										SO:0001583	missense	0																														ENST00000457052.2:c.1217C>A	19.37:g.46262720C>A	ENSP00000402674:p.Ala406Asp			Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.A406D	ENST00000457052.2	37	c.1217		19	.	.	.	.	.	.	.	.	.	.	c	11.00	1.510143	0.27036	.	.	ENSG00000237452	ENST00000457052	D	0.97089	-4.24	4.01	2.95	0.34219	.	.	.	.	.	D	0.96950	0.9004	.	.	.	.	.	.	.	.	.	.	.	.	D	0.98959	1.0797	5	0.87932	D	0	.	9.3619	0.38201	0.2316:0.7684:0.0:0.0	.	.	.	.	D	406	ENSP00000402674:A406D	ENSP00000402674:A406D	A	+	2	0	AC074212.3	50954560	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	0.173000	0.16724	0.953000	0.37825	0.563000	0.77884	GCC	AC074212.3	-	NULL	ENSG00000237452		0.542	AC074212.3-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000237452	Clone_based_vega_gene	protein_coding	OTTHUMT00000343318.3	-	0.00	38	0	C			46262720	+1	tier1	-	no_errors	ENST00000457052	ensembl	human	putative	74_37	missense	34.00	32	17	SNP	0.021	A
BHMG1	388553	genome.wustl.edu	37	19	46262720	46262720	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:46262720C>A	ENST00000457052.2	+	11	1633	c.1217C>A	c.(1216-1218)gCc>gAc	p.A406D																								TCACCTTCAGCCTACACGCAG	0.542																																																	0																																										SO:0001583	missense	0																														ENST00000457052.2:c.1217C>A	19.37:g.46262720C>A	ENSP00000402674:p.Ala406Asp			Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.A406D	ENST00000457052.2	37	c.1217		19	.	.	.	.	.	.	.	.	.	.	c	11.00	1.510143	0.27036	.	.	ENSG00000237452	ENST00000457052	D	0.97089	-4.24	4.01	2.95	0.34219	.	.	.	.	.	D	0.96950	0.9004	.	.	.	.	.	.	.	.	.	.	.	.	D	0.98959	1.0797	5	0.87932	D	0	.	9.3619	0.38201	0.2316:0.7684:0.0:0.0	.	.	.	.	D	406	ENSP00000402674:A406D	ENSP00000402674:A406D	A	+	2	0	AC074212.3	50954560	0.000000	0.05858	0.008000	0.14137	0.002000	0.02628	0.173000	0.16724	0.953000	0.37825	0.563000	0.77884	GCC	AC074212.3	-	NULL	ENSG00000237452		0.542	AC074212.3-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000237452	Clone_based_vega_gene	protein_coding	OTTHUMT00000343318.3	-	0.00	46	0	C			46262720	+1	tier1	-	no_errors	ENST00000457052	ensembl	human	putative	74_37	missense	34.00	32	17	SNP	0.021	A
RP5-947P14.1	0	genome.wustl.edu	37	1	106623839	106623839	+	lincRNA	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:106623839G>A	ENST00000437803.1	+	0	165																											CAGATGGGCCGCGTCTGCTGC	0.612																																																	0																																												0																															1.37:g.106623839G>A				RNA	SNP	-	NULL	ENST00000437803.1	37	NULL		1																																																																																			RP5-947P14.1	-	-	ENSG00000237480		0.612	RP5-947P14.1-001	KNOWN	basic	lincRNA	ENSG00000237480	Clone_based_vega_gene	lincRNA	OTTHUMT00000030361.1	-	0.00	38	0	G			106623839	+1	tier1	-	no_errors	ENST00000429608	ensembl	human	known	74_37	rna	12.50	56	8	SNP	0.981	A
RP5-947P14.1	0	genome.wustl.edu	37	1	106623839	106623839	+	lincRNA	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:106623839G>A	ENST00000437803.1	+	0	165																											CAGATGGGCCGCGTCTGCTGC	0.612																																																	0																																												0																															1.37:g.106623839G>A				RNA	SNP	-	NULL	ENST00000437803.1	37	NULL		1																																																																																			RP5-947P14.1	-	-	ENSG00000237480		0.612	RP5-947P14.1-001	KNOWN	basic	lincRNA	ENSG00000237480	Clone_based_vega_gene	lincRNA	OTTHUMT00000030361.1	-	0.00	53	0	G			106623839	+1	tier1	-	no_errors	ENST00000429608	ensembl	human	known	74_37	rna	12.50	56	8	SNP	0.981	A
IL9RP3	729486	genome.wustl.edu	37	16	81862	81862	+	RNA	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:81862C>T	ENST00000568710.1	-	0	370																											AGGGCACGTTCTGGTAGAAGA	0.587																																																	0																																												0																															16.37:g.81862C>T				RNA	SNP	-	NULL	ENST00000568710.1	37	NULL		16																																																																																			Z84812.4	-	-	ENSG00000260803		0.587	Z84812.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000260803	Clone_based_vega_gene	processed_transcript	OTTHUMT00000420570.1	-	0.00	164	0	C			81862	-1	tier1	-	no_errors	ENST00000568710	ensembl	human	known	74_37	rna	29.09	78	32	SNP	0.057	T
IL9RP3	729486	genome.wustl.edu	37	16	81862	81862	+	RNA	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:81862C>T	ENST00000568710.1	-	0	370																											AGGGCACGTTCTGGTAGAAGA	0.587																																																	0																																												0																															16.37:g.81862C>T				RNA	SNP	-	NULL	ENST00000568710.1	37	NULL		16																																																																																			Z84812.4	-	-	ENSG00000260803		0.587	Z84812.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000260803	Clone_based_vega_gene	processed_transcript	OTTHUMT00000420570.1	-	0.00	82	0	C			81862	-1	tier1	-	no_errors	ENST00000568710	ensembl	human	known	74_37	rna	29.09	78	32	SNP	0.057	T
PIEZO1	9780	genome.wustl.edu	37	16	88785881	88785881	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:88785881G>T	ENST00000301015.9	-	44	6718				PIEZO1_ENST00000327397.7_Intron|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						AGCCCTGGGAGGGCCTCCAGC	0.677																																																	0																																										SO:0001627	intron_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.6471+100C>A	16.37:g.88785881G>T			A6NHT9|A7E2B7|Q0KKZ9	RNA	SNP	-	NULL	ENST00000301015.9	37	NULL	CCDS54058.1	16																																																																																			RP5-1142A6.9	-	-	ENSG00000260121		0.677	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000260121	Clone_based_vega_gene	protein_coding	OTTHUMT00000345699.4	-	0.00	27	0	G	NM_014745		88785881	+1	tier1	-	no_errors	ENST00000564984	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.001	T
PIEZO1	9780	genome.wustl.edu	37	16	88785881	88785881	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:88785881G>T	ENST00000301015.9	-	44	6718				PIEZO1_ENST00000327397.7_Intron|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						AGCCCTGGGAGGGCCTCCAGC	0.677																																																	0																																										SO:0001627	intron_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.6471+100C>A	16.37:g.88785881G>T			A6NHT9|A7E2B7|Q0KKZ9	RNA	SNP	-	NULL	ENST00000301015.9	37	NULL	CCDS54058.1	16																																																																																			RP5-1142A6.9	-	-	ENSG00000260121		0.677	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000260121	Clone_based_vega_gene	protein_coding	OTTHUMT00000345699.4	-	0.00	32	0	G	NM_014745		88785881	+1	tier1	-	no_errors	ENST00000564984	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.001	T
AGAP11	119385	genome.wustl.edu	37	10	88743656	88743656	+	RNA	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:88743656G>T	ENST00000433214.2	+	0	322																											TACATAGACTGCCATGAACTA	0.313																																																	0																																												0																															10.37:g.88743656G>T				RNA	SNP	-	NULL	ENST00000433214.2	37	NULL		10																																																																																			RP11-96C23.5	-	-	ENSG00000271880		0.313	RP11-96C23.5-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000271880	Clone_based_vega_gene	processed_transcript	OTTHUMT00000049192.3	-	0.00	20	0	G			88743656	+1	tier1	-	no_errors	ENST00000433214	ensembl	human	known	74_37	rna	18.42	30	7	SNP	0.005	T
AGAP11	119385	genome.wustl.edu	37	10	88743656	88743656	+	RNA	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:88743656G>T	ENST00000433214.2	+	0	322																											TACATAGACTGCCATGAACTA	0.313																																																	0																																												0																															10.37:g.88743656G>T				RNA	SNP	-	NULL	ENST00000433214.2	37	NULL		10																																																																																			RP11-96C23.5	-	-	ENSG00000271880		0.313	RP11-96C23.5-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000271880	Clone_based_vega_gene	processed_transcript	OTTHUMT00000049192.3	-	0.00	21	0	G			88743656	+1	tier1	-	no_errors	ENST00000433214	ensembl	human	known	74_37	rna	18.42	30	7	SNP	0.005	T
EPN1	29924	genome.wustl.edu	37	19	56200681	56200681	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56200681G>A	ENST00000270460.6	+	5	933	c.622G>A	c.(622-624)Gag>Aag	p.E208K	EPN1_ENST00000411543.2_Intron|EPN1_ENST00000085079.7_Intron|EPN1_ENST00000591743.1_3'UTR	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	208					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		CTGCGGCCCCGAGGACGACGC	0.667																																																	0													29.0	30.0	30.0					19																	56200681		692	1591	2283	SO:0001583	missense	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.622G>A	19.37:g.56200681G>A	ENSP00000270460:p.Glu208Lys		Q86ST3|Q9HA18	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_Ubiquitin-int_motif,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.E208K	ENST00000270460.6	37	c.622	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177842	0.57692	.	.	ENSG00000063245	ENST00000270460;ENST00000544375	T	0.17370	2.28	4.58	4.58	0.56647	Ubiquitin interacting motif (3);	0.147062	0.44902	D	0.000418	T	0.24661	0.0598	L	0.47716	1.5	0.80722	D	1	P;D	0.58970	0.95;0.984	B;P	0.51453	0.414;0.67	T	0.01702	-1.1292	10	0.23302	T	0.38	.	16.5143	0.84295	0.0:0.0:1.0:0.0	.	169;208	B4DU91;Q9Y6I3	.;EPN1_HUMAN	K	208;169	ENSP00000270460:E208K	ENSP00000270460:E208K	E	+	1	0	EPN1	60892493	1.000000	0.71417	0.985000	0.45067	0.922000	0.55478	7.342000	0.79310	2.274000	0.75844	0.462000	0.41574	GAG	EPN1	-	pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000063245		0.667	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	-	0.00	33	0	G	NM_013333		56200681	+1	tier1	-	no_errors	ENST00000270460	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.994	A
EPN1	29924	genome.wustl.edu	37	19	56200681	56200681	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56200681G>A	ENST00000270460.6	+	5	933	c.622G>A	c.(622-624)Gag>Aag	p.E208K	EPN1_ENST00000411543.2_Intron|EPN1_ENST00000085079.7_Intron|EPN1_ENST00000591743.1_3'UTR	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	208					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		CTGCGGCCCCGAGGACGACGC	0.667																																																	0													29.0	30.0	30.0					19																	56200681		692	1591	2283	SO:0001583	missense	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.622G>A	19.37:g.56200681G>A	ENSP00000270460:p.Glu208Lys		Q86ST3|Q9HA18	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_Ubiquitin-int_motif,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.E208K	ENST00000270460.6	37	c.622	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177842	0.57692	.	.	ENSG00000063245	ENST00000270460;ENST00000544375	T	0.17370	2.28	4.58	4.58	0.56647	Ubiquitin interacting motif (3);	0.147062	0.44902	D	0.000418	T	0.24661	0.0598	L	0.47716	1.5	0.80722	D	1	P;D	0.58970	0.95;0.984	B;P	0.51453	0.414;0.67	T	0.01702	-1.1292	10	0.23302	T	0.38	.	16.5143	0.84295	0.0:0.0:1.0:0.0	.	169;208	B4DU91;Q9Y6I3	.;EPN1_HUMAN	K	208;169	ENSP00000270460:E208K	ENSP00000270460:E208K	E	+	1	0	EPN1	60892493	1.000000	0.71417	0.985000	0.45067	0.922000	0.55478	7.342000	0.79310	2.274000	0.75844	0.462000	0.41574	GAG	EPN1	-	pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000063245		0.667	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	-	0.00	70	0	G	NM_013333		56200681	+1	tier1	-	no_errors	ENST00000270460	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.994	A
ERC2	26059	genome.wustl.edu	37	3	56183042	56183042	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:56183042T>C	ENST00000288221.6	-	5	1523	c.1268A>G	c.(1267-1269)gAg>gGg	p.E423G		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	423						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTTGTAAACCTCAATTTGTTT	0.388																																																	0													184.0	179.0	180.0					3																	56183042		1875	4102	5977	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1268A>G	3.37:g.56183042T>C	ENSP00000288221:p.Glu423Gly		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.E423G	ENST00000288221.6	37	c.1268	CCDS46851.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.8|23.8	4.453587|4.453587	0.84209|0.84209	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	T|.	0.58652|.	0.32|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.046806|.	0.85682|.	D|.	0.000000|.	T|T	0.76758|0.76758	0.4032|0.4032	M|M	0.77616|0.77616	2.38|2.38	0.52099|0.52099	D|D	0.999946|0.999946	D|.	0.62365|.	0.991|.	D|.	0.74023|.	0.982|.	T|T	0.77222|0.77222	-0.2667|-0.2667	10|5	0.62326|.	D|.	0.03|.	-20.6707|-20.6707	16.542|16.542	0.84395|0.84395	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	423|.	O15083|.	ERC2_HUMAN|.	G|G	423|62	ENSP00000288221:E423G|.	ENSP00000288221:E423G|.	E|R	-|-	2|1	0|2	ERC2|ERC2	56158082|56158082	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	8.040000|8.040000	0.89188|0.89188	2.304000|2.304000	0.77564|0.77564	0.528000|0.528000	0.53228|0.53228	GAG|AGG	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000187672		0.388	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	42	0	T	NM_015576		56183042	-1	tier1	-	no_errors	ENST00000288221	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	C
ERCC6L2	375748	genome.wustl.edu	37	9	98735292	98735292	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:98735292C>A	ENST00000407474.3	+	1	715	c.202C>A	c.(202-204)Cca>Aca	p.P68T				Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	1098					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CACTTTTATTCCAAGAAAACC	0.318																																																	0													37.0	39.0	38.0					9																	98735292		2201	4298	6499	SO:0001583	missense	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000407474.3:c.202C>A	9.37:g.98735292C>A	ENSP00000384365:p.Pro68Thr		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	NULL	p.P68T	ENST00000407474.3	37	c.202		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.752|8.752	0.921504|0.921504	0.17982|0.17982	.|.	.|.	ENSG00000182150|ENSG00000182150	ENST00000320486|ENST00000407474	.|.	.|.	.|.	5.49|5.49	2.55|2.55	0.30701|0.30701	.|.	.|.	.|.	.|.	.|.	T|T	0.35219|0.35219	0.0924|0.0924	.|.	.|.	.|.	0.19575|0.19575	N|N	0.999964|0.999964	.|P	.|0.52842	.|0.956	.|P	.|0.51016	.|0.656	T|T	0.13308|0.13308	-1.0514|-1.0514	4|7	.|0.19147	.|T	.|0.46	.|.	9.0656|9.0656	0.36460|0.36460	0.0:0.7631:0.0:0.2369|0.0:0.7631:0.0:0.2369	.|.	.|68	.|A4D997	.|CI102_HUMAN	L|T	58|68	.|.	.|ENSP00000384365:P68T	F|P	+|+	3|1	2|0	C9orf102|C9orf102	97775113|97775113	0.000000|0.000000	0.05858|0.05858	0.402000|0.402000	0.26371|0.26371	0.408000|0.408000	0.30992|0.30992	-0.057000|-0.057000	0.11768|0.11768	0.378000|0.378000	0.24764|0.24764	0.650000|0.650000	0.86243|0.86243	TTC|CCA	ERCC6L2	-	NULL	ENSG00000182150		0.318	ERCC6L2-201	KNOWN	basic	protein_coding	ERCC6L2	HGNC	protein_coding		-	0.00	47	0	C	NM_001010895		98735292	+1	tier1	-	no_errors	ENST00000407474	ensembl	human	known	74_37	missense	7.06	79	6	SNP	0.628	A
ERCC6L2	375748	genome.wustl.edu	37	9	98735292	98735292	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:98735292C>A	ENST00000407474.3	+	1	715	c.202C>A	c.(202-204)Cca>Aca	p.P68T				Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	1098					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CACTTTTATTCCAAGAAAACC	0.318																																																	0													37.0	39.0	38.0					9																	98735292		2201	4298	6499	SO:0001583	missense	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000407474.3:c.202C>A	9.37:g.98735292C>A	ENSP00000384365:p.Pro68Thr		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	NULL	p.P68T	ENST00000407474.3	37	c.202		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.752|8.752	0.921504|0.921504	0.17982|0.17982	.|.	.|.	ENSG00000182150|ENSG00000182150	ENST00000320486|ENST00000407474	.|.	.|.	.|.	5.49|5.49	2.55|2.55	0.30701|0.30701	.|.	.|.	.|.	.|.	.|.	T|T	0.35219|0.35219	0.0924|0.0924	.|.	.|.	.|.	0.19575|0.19575	N|N	0.999964|0.999964	.|P	.|0.52842	.|0.956	.|P	.|0.51016	.|0.656	T|T	0.13308|0.13308	-1.0514|-1.0514	4|7	.|0.19147	.|T	.|0.46	.|.	9.0656|9.0656	0.36460|0.36460	0.0:0.7631:0.0:0.2369|0.0:0.7631:0.0:0.2369	.|.	.|68	.|A4D997	.|CI102_HUMAN	L|T	58|68	.|.	.|ENSP00000384365:P68T	F|P	+|+	3|1	2|0	C9orf102|C9orf102	97775113|97775113	0.000000|0.000000	0.05858|0.05858	0.402000|0.402000	0.26371|0.26371	0.408000|0.408000	0.30992|0.30992	-0.057000|-0.057000	0.11768|0.11768	0.378000|0.378000	0.24764|0.24764	0.650000|0.650000	0.86243|0.86243	TTC|CCA	ERCC6L2	-	NULL	ENSG00000182150		0.318	ERCC6L2-201	KNOWN	basic	protein_coding	ERCC6L2	HGNC	protein_coding		-	0.00	55	0	C	NM_001010895		98735292	+1	tier1	-	no_errors	ENST00000407474	ensembl	human	known	74_37	missense	7.06	79	6	SNP	0.628	A
EVL	51466	genome.wustl.edu	37	14	100603921	100603921	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:100603921G>T	ENST00000402714.2	+	10	1569	c.965G>T	c.(964-966)gGc>gTc	p.G322V	EVL_ENST00000544450.2_Missense_Mutation_p.G328V|EVL_ENST00000392920.3_Missense_Mutation_p.G324V			Q9UI08	EVL_HUMAN	Enah/Vasp-like	322	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				ACAGAGGCTGGCCGGAAGCCC	0.602																																																	0													58.0	69.0	65.0					14																	100603921		2203	4300	6503	SO:0001583	missense	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.965G>T	14.37:g.100603921G>T	ENSP00000384720:p.Gly322Val		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.G324V	ENST00000402714.2	37	c.971		14	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048717	0.36181	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000554695	T;T;T	0.68624	-0.34;-0.31;-0.33	4.73	4.73	0.59995	.	0.617718	0.15498	N	0.259192	T	0.56702	0.2003	L	0.35414	1.06	0.58432	D	0.999999	P;B;P	0.47191	0.761;0.441;0.891	B;B;B	0.40506	0.315;0.139;0.331	T	0.54892	-0.8225	10	0.16896	T	0.51	-2.9831	17.6886	0.88263	0.0:0.0:1.0:0.0	.	328;324;322	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	V	322;328;324;287;139	ENSP00000384720:G322V;ENSP00000437904:G328V;ENSP00000376652:G324V	ENSP00000376652:G324V	G	+	2	0	EVL	99673674	1.000000	0.71417	0.985000	0.45067	0.710000	0.40934	5.394000	0.66285	2.163000	0.67991	0.561000	0.74099	GGC	EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.602	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	47	0	G			100603921	+1	tier1	-	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	30.00	42	18	SNP	0.998	T
EVL	51466	genome.wustl.edu	37	14	100603921	100603921	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:100603921G>T	ENST00000402714.2	+	10	1569	c.965G>T	c.(964-966)gGc>gTc	p.G322V	EVL_ENST00000544450.2_Missense_Mutation_p.G328V|EVL_ENST00000392920.3_Missense_Mutation_p.G324V			Q9UI08	EVL_HUMAN	Enah/Vasp-like	322	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				ACAGAGGCTGGCCGGAAGCCC	0.602																																																	0													58.0	69.0	65.0					14																	100603921		2203	4300	6503	SO:0001583	missense	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.965G>T	14.37:g.100603921G>T	ENSP00000384720:p.Gly322Val		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.G324V	ENST00000402714.2	37	c.971		14	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048717	0.36181	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000554695	T;T;T	0.68624	-0.34;-0.31;-0.33	4.73	4.73	0.59995	.	0.617718	0.15498	N	0.259192	T	0.56702	0.2003	L	0.35414	1.06	0.58432	D	0.999999	P;B;P	0.47191	0.761;0.441;0.891	B;B;B	0.40506	0.315;0.139;0.331	T	0.54892	-0.8225	10	0.16896	T	0.51	-2.9831	17.6886	0.88263	0.0:0.0:1.0:0.0	.	328;324;322	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	V	322;328;324;287;139	ENSP00000384720:G322V;ENSP00000437904:G328V;ENSP00000376652:G324V	ENSP00000376652:G324V	G	+	2	0	EVL	99673674	1.000000	0.71417	0.985000	0.45067	0.710000	0.40934	5.394000	0.66285	2.163000	0.67991	0.561000	0.74099	GGC	EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.602	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	82	0	G			100603921	+1	tier1	-	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	30.00	42	18	SNP	0.998	T
EVX1	2128	genome.wustl.edu	37	7	27284773	27284773	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:27284773C>T	ENST00000496902.4	+	2	1020	c.534C>T	c.(532-534)agC>agT	p.S178S	EVX1_ENST00000222761.3_Missense_Mutation_p.A160V|EVX1_ENST00000535619.1_5'UTR|EVX1-AS_ENST00000519218.1_RNA|EVX1-AS_ENST00000517726.1_RNA|EVX1-AS_ENST00000519050.1_RNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	178					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						TGGCGTGCAGCGCCAGTGACC	0.672																																																	0													39.0	43.0	42.0					7																	27284773		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.534C>T	7.37:g.27284773C>T			A4D199|B4DQJ0	Missense_Mutation	SNP	NULL	p.A160V	ENST00000496902.4	37	c.479	CCDS5413.1	7	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541584	0.45280	.	.	ENSG00000106038	ENST00000222761	.	.	.	5.41	1.61	0.23674	.	.	.	.	.	T	0.46190	0.1380	.	.	.	0.80722	D	1	B	0.21821	0.061	B	0.13407	0.009	T	0.34925	-0.9809	7	0.87932	D	0	-28.4442	8.6258	0.33888	0.0:0.6387:0.0:0.3613	.	160	F8W9J5	.	V	160	.	ENSP00000222761:A160V	A	+	2	0	EVX1	27251298	0.999000	0.42202	0.998000	0.56505	0.995000	0.86356	0.609000	0.24238	0.021000	0.15133	0.462000	0.41574	GCG	EVX1	-	NULL	ENSG00000106038		0.672	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVX1	HGNC	protein_coding	OTTHUMT00000358750.3	-	0.00	43	0	C			27284773	+1	tier1	-	no_errors	ENST00000222761	ensembl	human	putative	74_37	missense	35.71	36	20	SNP	0.999	T
F13B	2165	genome.wustl.edu	37	1	197026309	197026309	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:197026309G>T	ENST00000367412.1	-	7	1048	c.1005C>A	c.(1003-1005)gcC>gcA	p.A335A		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	335	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						GTTCCTCACAGGCTACCTTCT	0.398																																																	0													79.0	76.0	77.0					1																	197026309		2203	4300	6503	SO:0001819	synonymous_variant	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1005C>A	1.37:g.197026309G>T			A8K3E5|Q5VYL5	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.A335	ENST00000367412.1	37	c.1005	CCDS1388.1	1																																																																																			F13B	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143278		0.398	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2		0.00	18	0	G	NM_001994		197026309	-1			no_errors	ENST00000367412	ensembl	human	known	74_37	silent	7.50	37	3	SNP	0.018	T
FAM155A	728215	genome.wustl.edu	37	13	108518661	108518661	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:108518661T>C	ENST00000375915.2	-	1	422	c.284A>G	c.(283-285)cAg>cGg	p.Q95R		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	95	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ctgccgccgctgctgctgctg	0.731																																																	0													8.0	11.0	10.0					13																	108518661		1836	3781	5617	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.284A>G	13.37:g.108518661T>C	ENSP00000365080:p.Gln95Arg		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.Q95R	ENST00000375915.2	37	c.284	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	T	0.110	-1.140286	0.01728	.	.	ENSG00000204442	ENST00000375915	T	0.57436	0.4	5.23	3.12	0.35913	Armadillo-like helical (1);	0.660669	0.12437	N	0.469027	T	0.30417	0.0764	N	0.25332	0.735	0.19300	N	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.27806	-1.0063	10	0.07030	T	0.85	.	3.3913	0.07290	0.0:0.517:0.2156:0.2674	.	95	B1AL88	F155A_HUMAN	R	95	ENSP00000365080:Q95R	ENSP00000365080:Q95R	Q	-	2	0	FAM155A	107316662	0.206000	0.23470	1.000000	0.80357	0.982000	0.71751	0.127000	0.15790	1.195000	0.43115	-0.181000	0.13052	CAG	FAM155A	-	NULL	ENSG00000204442		0.731	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2		0.00	27	0	T	NM_001080396		108518661	-1			no_errors	ENST00000375915	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.996	C
FAM182B	728882	genome.wustl.edu	37	20	25848629	25848629	+	5'UTR	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:25848629C>T	ENST00000478164.1	-	0	157				FAM182B_ENST00000376404.2_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						gctgggatgccgtgctgcttc	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	0					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.-835G>A	20.37:g.25848629C>T			Q4G0Q1	RNA	SNP	-	NULL	ENST00000478164.1	37	NULL		20																																																																																			FAM182B	-	-	ENSG00000175170		0.667	FAM182B-005	KNOWN	basic	processed_transcript	FAM182B	HGNC	protein_coding	OTTHUMT00000316665.1	-	0.00	49	0	C	NR_026714		25848629	-1	tier1	-	no_errors	ENST00000424021	ensembl	human	known	74_37	rna	11.90	74	10	SNP	0.002	T
FAM19A2	338811	genome.wustl.edu	37	12	62147482	62147485	+	Frame_Shift_Del	DEL	AGAC	AGAC	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	AGAC	AGAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:62147482_62147485delAGAC	ENST00000416284.3	-	4	1886_1889	c.302_305delGTCT	c.(301-306)tgtctafs	p.CL101fs	FAM19A2_ENST00000550003.1_Frame_Shift_Del_p.CL4fs|FAM19A2_ENST00000551619.1_Frame_Shift_Del_p.CL101fs|FAM19A2_ENST00000551449.1_Intron	NM_178539.4	NP_848634.1	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A2	101						cytoplasm (GO:0005737)				endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	15			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		TTCTCCCTCTAGACATGGCTGCAT	0.407																																																	0																																										SO:0001589	frameshift_variant	0			AY325115	CCDS8962.1	12q14.1	2012-10-03			ENSG00000198673	ENSG00000198673			21589	protein-coding gene	gene with protein product						15028294	Standard	NM_178539		Approved	TAFA-2	uc001sqw.3	Q8N3H0	OTTHUMG00000170207	ENST00000416284.3:c.302_305delGTCT	12.37:g.62147482_62147485delAGAC	ENSP00000393987:p.Cys101fs		B3KVV4|Q4G0R9|Q68DK0|Q6GTX6	Frame_Shift_Del	DEL	pfam_Chemokine-like_FAM19A2	p.C101fs	ENST00000416284.3	37	c.305_302	CCDS8962.1	12																																																																																			FAM19A2	-	pfam_Chemokine-like_FAM19A2	ENSG00000198673		0.407	FAM19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A2	HGNC	protein_coding	OTTHUMT00000407967.2		0.00	56	0	AGAC	NM_178539		62147485	-1	tier1		no_errors	ENST00000416284	ensembl	human	known	74_37	frame_shift_del	23.64	42	13	DEL	1.000:1.000:1.000:1.000	-
FAM228B	375190	genome.wustl.edu	37	2	24392364	24392365	+	3'UTR	INS	-	-	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:24392364_24392365insA	ENST00000407625.1	+	0	1214_1215				RP11-507M3.1_ENST00000584973.1_Intron|AC008073.7_ENST00000428344.1_RNA|FAM228B_ENST00000420135.2_3'UTR|AC008073.7_ENST00000438414.1_RNA	NM_001145710.1	NP_001139182.1	P0C875	F228B_HUMAN	family with sequence similarity 228, member B																		GTCCTGTCTCTAAAAAAAAAGC	0.406																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS74491.1	2p23.3	2012-07-04			ENSG00000219626	ENSG00000219626			24736	protein-coding gene	gene with protein product							Standard	NM_001145710		Approved		uc010ykl.2	P0C875	OTTHUMG00000151901	ENST00000407625.1:c.*169->A	2.37:g.24392373_24392373dupA				RNA	INS	-	NULL	ENST00000407625.1	37	NULL		2																																																																																			FAM228B	-	-	ENSG00000219626		0.406	FAM228B-007	NOVEL	basic|appris_candidate	protein_coding	FAM228B	HGNC	protein_coding	OTTHUMT00000324328.1		0.00	10	0	-	NM_001145710		24392365	+1	tier1		no_errors	ENST00000468799	ensembl	human	known	74_37	rna	10.00	18	2	INS	0.000:0.000	A
FAM228B	375190	genome.wustl.edu	37	2	24392364	24392365	+	3'UTR	INS	-	-	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:24392364_24392365insA	ENST00000407625.1	+	0	1214_1215				RP11-507M3.1_ENST00000584973.1_Intron|AC008073.7_ENST00000428344.1_RNA|FAM228B_ENST00000420135.2_3'UTR|AC008073.7_ENST00000438414.1_RNA	NM_001145710.1	NP_001139182.1	P0C875	F228B_HUMAN	family with sequence similarity 228, member B																		GTCCTGTCTCTAAAAAAAAAGC	0.406																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS74491.1	2p23.3	2012-07-04			ENSG00000219626	ENSG00000219626			24736	protein-coding gene	gene with protein product							Standard	NM_001145710		Approved		uc010ykl.2	P0C875	OTTHUMG00000151901	ENST00000407625.1:c.*169->A	2.37:g.24392373_24392373dupA				RNA	INS	-	NULL	ENST00000407625.1	37	NULL		2																																																																																			FAM228B	-	-	ENSG00000219626		0.406	FAM228B-007	NOVEL	basic|appris_candidate	protein_coding	FAM228B	HGNC	protein_coding	OTTHUMT00000324328.1		0.00	12	0	-	NM_001145710		24392365	+1	tier1		no_errors	ENST00000468799	ensembl	human	known	74_37	rna	10.00	18	2	INS	0.000:0.000	A
FAM65C	140876	genome.wustl.edu	37	20	49218951	49218951	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:49218951G>A	ENST00000327979.2	-	13	1716	c.1305C>T	c.(1303-1305)caC>caT	p.H435H	FAM65C_ENST00000535356.1_Silent_p.H439H|FAM65C_ENST00000045083.2_Silent_p.H435H			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	435								p.H435H(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAATGGAGGCGTGGGGACCGA	0.652																																																	1	Substitution - coding silent(1)	lung(1)											31.0	33.0	32.0					20																	49218951		2144	4209	6353	SO:0001819	synonymous_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1305C>T	20.37:g.49218951G>A			Q5QPB6|Q9NQQ2	Silent	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.H439	ENST00000327979.2	37	c.1317	CCDS13431.2	20																																																																																			FAM65C	-	NULL	ENSG00000042062		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	44	0	G			49218951	-1	tier1	-	no_errors	ENST00000535356	ensembl	human	known	74_37	silent	23.94	54	17	SNP	0.000	A
FAM65C	140876	genome.wustl.edu	37	20	49218951	49218951	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:49218951G>A	ENST00000327979.2	-	13	1716	c.1305C>T	c.(1303-1305)caC>caT	p.H435H	FAM65C_ENST00000535356.1_Silent_p.H439H|FAM65C_ENST00000045083.2_Silent_p.H435H			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	435								p.H435H(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAATGGAGGCGTGGGGACCGA	0.652																																																	1	Substitution - coding silent(1)	lung(1)											31.0	33.0	32.0					20																	49218951		2144	4209	6353	SO:0001819	synonymous_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1305C>T	20.37:g.49218951G>A			Q5QPB6|Q9NQQ2	Silent	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.H439	ENST00000327979.2	37	c.1317	CCDS13431.2	20																																																																																			FAM65C	-	NULL	ENSG00000042062		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	63	0	G			49218951	-1	tier1	-	no_errors	ENST00000535356	ensembl	human	known	74_37	silent	23.94	54	17	SNP	0.000	A
FAM71E2	284418	genome.wustl.edu	37	19	55870036	55870036	+	Missense_Mutation	SNP	T	T	C	rs541752025		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:55870036T>C	ENST00000424985.3	-	9	2393	c.2200A>G	c.(2200-2202)Atg>Gtg	p.M734V	CTD-2105E13.6_ENST00000591954.3_Silent_p.Q283Q	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	734										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						GAAGCCATCATTGACGTGGCC	0.622																																																	0													35.0	40.0	38.0					19																	55870036		692	1591	2283	SO:0001583	missense	0			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2200A>G	19.37:g.55870036T>C	ENSP00000398617:p.Met734Val		Q8ND99	Missense_Mutation	SNP	pfam_DUF3699	p.M734V	ENST00000424985.3	37	c.2200		19	.	.	.	.	.	.	.	.	.	.	N	1.060	-0.673294	0.03403	.	.	ENSG00000180043	ENST00000424985	T	0.11169	2.8	3.53	-5.08	0.02929	.	.	.	.	.	T	0.03348	0.0097	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43376	-0.9395	9	0.02654	T	1	.	5.8018	0.18417	0.0:0.46:0.2928:0.2471	.	734	Q8N5Q1	F71E2_HUMAN	V	734	ENSP00000398617:M734V	ENSP00000398617:M734V	M	-	1	0	FAM71E2	60561848	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.765000	0.00188	-1.074000	0.03132	-0.728000	0.03583	ATG	FAM71E2	-	NULL	ENSG00000180043		0.622	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	-	0.00	33	0	T	NM_001145402		55870036	-1	tier1	-	no_errors	ENST00000424985	ensembl	human	novel	74_37	missense	23.81	48	15	SNP	0.000	C
FGF12	2257	genome.wustl.edu	37	3	192125875	192125875	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:192125875G>A	ENST00000454309.2	-	1	963	c.138C>T	c.(136-138)ctC>ctT	p.L46L	FGF12_ENST00000445105.2_Intron|FGF12_ENST00000450716.1_Intron|FGF12_ENST00000430714.1_Intron|FGF12_ENST00000264730.3_Intron	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	46					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.L46L(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TGAACACCCCGAGGACGTGCC	0.687																																																	1	Substitution - coding silent(1)	lung(1)											74.0	85.0	82.0					3																	192125875		2198	4277	6475	SO:0001819	synonymous_variant	0			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.138C>T	3.37:g.192125875G>A			B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Silent	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.L46	ENST00000454309.2	37	c.138	CCDS3301.1	3																																																																																			FGF12	-	NULL	ENSG00000114279		0.687	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF12	HGNC	protein_coding	OTTHUMT00000343160.1	-	0.00	57	0	G	NM_021032		192125875	-1	tier1	-	no_errors	ENST00000454309	ensembl	human	known	74_37	silent	18.10	86	19	SNP	1.000	A
FGF12	2257	genome.wustl.edu	37	3	192125875	192125875	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:192125875G>A	ENST00000454309.2	-	1	963	c.138C>T	c.(136-138)ctC>ctT	p.L46L	FGF12_ENST00000445105.2_Intron|FGF12_ENST00000450716.1_Intron|FGF12_ENST00000430714.1_Intron|FGF12_ENST00000264730.3_Intron	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	46					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)	p.L46L(1)		endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TGAACACCCCGAGGACGTGCC	0.687																																																	1	Substitution - coding silent(1)	lung(1)											74.0	85.0	82.0					3																	192125875		2198	4277	6475	SO:0001819	synonymous_variant	0			U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.138C>T	3.37:g.192125875G>A			B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Silent	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.L46	ENST00000454309.2	37	c.138	CCDS3301.1	3																																																																																			FGF12	-	NULL	ENSG00000114279		0.687	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF12	HGNC	protein_coding	OTTHUMT00000343160.1	-	0.00	60	0	G	NM_021032		192125875	-1	tier1	-	no_errors	ENST00000454309	ensembl	human	known	74_37	silent	18.10	86	19	SNP	1.000	A
FMNL3	91010	genome.wustl.edu	37	12	50044560	50044560	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:50044560G>T	ENST00000293590.5	-	17	2132	c.1899C>A	c.(1897-1899)gcC>gcA	p.A633A	FMNL3_ENST00000352151.5_Silent_p.A582A|FMNL3_ENST00000335154.5_Silent_p.A633A|FMNL3_ENST00000550488.1_Silent_p.A633A			Q8IVF7	FMNL3_HUMAN	formin-like 3	633	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						TCACCTTGCTGGCAGCTTTTT	0.522																																																	0													123.0	118.0	120.0					12																	50044560		2009	4179	6188	SO:0001819	synonymous_variant	0			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1899C>A	12.37:g.50044560G>T			B0JZA7|Q6ZRJ1	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.A633	ENST00000293590.5	37	c.1899		12																																																																																			FMNL3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000161791		0.522	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	HGNC	protein_coding			0.00	25	0	G	NM_175736		50044560	-1			no_errors	ENST00000293590	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	T
FNDC3A	22862	genome.wustl.edu	37	13	49765251	49765251	+	Missense_Mutation	SNP	G	G	T	rs374043677		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:49765251G>T	ENST00000492622.2	+	18	2350	c.2045G>T	c.(2044-2046)cGa>cTa	p.R682L	FNDC3A_ENST00000541916.1_Missense_Mutation_p.R682L|FNDC3A_ENST00000398316.3_Missense_Mutation_p.R626L	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	682	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		ATACAGTTACGATGGGGTAAT	0.413																																																	0													69.0	78.0	75.0					13																	49765251		2203	4300	6503	SO:0001583	missense	0			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.2045G>T	13.37:g.49765251G>T	ENSP00000417257:p.Arg682Leu		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R682L	ENST00000492622.2	37	c.2045	CCDS41886.1	13	.	.	.	.	.	.	.	.	.	.	G	14.57	2.573542	0.45902	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.58060	0.36;0.36;0.36	5.18	5.18	0.71444	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.130447	0.34046	N	0.004320	T	0.41305	0.1153	L	0.35542	1.07	0.58432	D	0.999993	B;B	0.19445	0.036;0.023	B;B	0.22386	0.023;0.039	T	0.23261	-1.0193	10	0.32370	T	0.25	-5.0021	11.5296	0.50601	0.082:0.0:0.918:0.0	.	626;682	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	L	682;618;682;626	ENSP00000417257:R682L;ENSP00000441831:R682L;ENSP00000381362:R626L	ENSP00000338579:R618L	R	+	2	0	FNDC3A	48663252	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.001000	0.70685	2.573000	0.86826	0.655000	0.94253	CGA	FNDC3A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000102531		0.413	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3A	HGNC	protein_coding	OTTHUMT00000354845.2	-	0.00	46	0	G	NM_014923		49765251	+1	tier1	-	no_errors	ENST00000492622	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	52	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	G
FUK	197258	genome.wustl.edu	37	16	70504248	70504248	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:70504248G>T	ENST00000288078.6	+	11	1219	c.987G>T	c.(985-987)atG>atT	p.M329I	FUK_ENST00000378912.2_Missense_Mutation_p.M361I|FUK_ENST00000571514.1_5'UTR	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	329						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				ACAGCTACATGACCTCCTCAG	0.622																																																	0													103.0	116.0	111.0					16																	70504248		2103	4218	6321	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.987G>T	16.37:g.70504248G>T	ENSP00000288078:p.Met329Ile		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.M361I	ENST00000288078.6	37	c.1083	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160415	0.57368	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.26660	1.72;1.72	5.74	5.74	0.90152	L-fucokinase (1);	0.173402	0.53938	D	0.000046	T	0.30417	0.0764	M	0.61703	1.905	0.80722	D	1	B;B	0.21821	0.056;0.061	B;B	0.24848	0.056;0.056	T	0.05321	-1.0892	10	0.20519	T	0.43	-21.9916	17.7061	0.88310	0.0:0.0:1.0:0.0	.	361;329	Q8N0W3-2;Q8N0W3	.;FUK_HUMAN	I	329;361	ENSP00000288078:M329I;ENSP00000368192:M361I	ENSP00000288078:M329I	M	+	3	0	FUK	69061749	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.538000	0.53597	2.723000	0.93209	0.655000	0.94253	ATG	FUK	-	pfam_Fucokinase	ENSG00000157353		0.622	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2		0.00	19	0	G	NM_145059		70504248	+1			no_errors	ENST00000378912	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
G6PC3	92579	genome.wustl.edu	37	17	42153360	42153360	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:42153360G>T	ENST00000269097.4	+	6	1221	c.990G>T	c.(988-990)tgG>tgT	p.W330C		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	330					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TCGTGCCCTGGGCAGTGCACA	0.572																																																	0													134.0	125.0	128.0					17																	42153360		2203	4300	6503	SO:0001583	missense	0			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.990G>T	17.37:g.42153360G>T	ENSP00000269097:p.Trp330Cys		Q8WU15	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	p.W330C	ENST00000269097.4	37	c.990	CCDS11476.1	17	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800192	0.31869	.	.	ENSG00000141349	ENST00000269097	D	0.82711	-1.64	5.18	5.18	0.71444	.	0.064016	0.64402	D	0.000004	D	0.85517	0.5715	L	0.46157	1.445	0.58432	D	0.999997	D	0.76494	0.999	D	0.64321	0.924	D	0.84987	0.0892	10	0.52906	T	0.07	0.1863	9.5843	0.39506	0.0926:0.0:0.9074:0.0	.	330	Q9BUM1	G6PC3_HUMAN	C	330	ENSP00000269097:W330C	ENSP00000269097:W330C	W	+	3	0	G6PC3	39508886	1.000000	0.71417	0.964000	0.40570	0.178000	0.23041	1.624000	0.37018	2.701000	0.92244	0.655000	0.94253	TGG	G6PC3	-	pirsf_Glucose-6-phosphatase	ENSG00000141349		0.572	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G6PC3	HGNC	protein_coding	OTTHUMT00000457675.1	-	0.00	33	0	G	NM_138387		42153360	+1	tier1	-	no_errors	ENST00000269097	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.926	T
G6PC3	92579	genome.wustl.edu	37	17	42153360	42153360	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:42153360G>T	ENST00000269097.4	+	6	1221	c.990G>T	c.(988-990)tgG>tgT	p.W330C		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	330					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TCGTGCCCTGGGCAGTGCACA	0.572																																																	0													134.0	125.0	128.0					17																	42153360		2203	4300	6503	SO:0001583	missense	0			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.990G>T	17.37:g.42153360G>T	ENSP00000269097:p.Trp330Cys		Q8WU15	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	p.W330C	ENST00000269097.4	37	c.990	CCDS11476.1	17	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800192	0.31869	.	.	ENSG00000141349	ENST00000269097	D	0.82711	-1.64	5.18	5.18	0.71444	.	0.064016	0.64402	D	0.000004	D	0.85517	0.5715	L	0.46157	1.445	0.58432	D	0.999997	D	0.76494	0.999	D	0.64321	0.924	D	0.84987	0.0892	10	0.52906	T	0.07	0.1863	9.5843	0.39506	0.0926:0.0:0.9074:0.0	.	330	Q9BUM1	G6PC3_HUMAN	C	330	ENSP00000269097:W330C	ENSP00000269097:W330C	W	+	3	0	G6PC3	39508886	1.000000	0.71417	0.964000	0.40570	0.178000	0.23041	1.624000	0.37018	2.701000	0.92244	0.655000	0.94253	TGG	G6PC3	-	pirsf_Glucose-6-phosphatase	ENSG00000141349		0.572	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G6PC3	HGNC	protein_coding	OTTHUMT00000457675.1	-	0.00	35	0	G	NM_138387		42153360	+1	tier1	-	no_errors	ENST00000269097	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.926	T
GABRG3	2567	genome.wustl.edu	37	15	27572012	27572012	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:27572012C>A	ENST00000333743.6	+	4	581	c.327C>A	c.(325-327)ttC>ttA	p.F109L	GABRG3_ENST00000555083.1_Missense_Mutation_p.F109L	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	109					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.F109F(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCCTTCGATTCAACAGCACAA	0.423																																					NSCLC(114;800 1656 7410 37729 45293)												1	Substitution - coding silent(1)	kidney(1)											157.0	156.0	156.0					15																	27572012		1984	4196	6180	SO:0001583	missense	0				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.327C>A	15.37:g.27572012C>A	ENSP00000331912:p.Phe109Leu		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F109L	ENST00000333743.6	37	c.327	CCDS45195.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428026	0.83667	.	.	ENSG00000182256	ENST00000333743;ENST00000555083;ENST00000554696	D;D;D	0.82167	-1.58;-1.58;-1.58	5.75	3.86	0.44501	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052742	0.85682	D	0.000000	D	0.90215	0.6941	M	0.86178	2.8	0.42803	D	0.993933	P;P	0.51147	0.942;0.929	P;P	0.62435	0.902;0.702	D	0.91659	0.5341	10	0.87932	D	0	.	12.197	0.54303	0.0:0.86:0.0:0.14	.	109;109	Q99928;G3V594	GBRG3_HUMAN;.	L	109;109;51	ENSP00000331912:F109L;ENSP00000452244:F109L;ENSP00000451862:F51L	ENSP00000331912:F109L	F	+	3	2	GABRG3	25154758	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.437000	0.34991	1.435000	0.47434	0.650000	0.86243	TTC	GABRG3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000182256		0.423	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2		0.00	27	0	C			27572012	+1			no_errors	ENST00000333743	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	A
GART	2618	genome.wustl.edu	37	21	34877881	34877881	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr21:34877881G>T	ENST00000381831.3	-	20	2975	c.2712C>A	c.(2710-2712)gtC>gtA	p.V904V	GART_ENST00000381839.3_Silent_p.V904V|GART_ENST00000381815.4_Silent_p.V904V|GART_ENST00000543717.1_Silent_p.V456V	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	904	GART.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	TCCACTTTTGGACAAAGGGGC	0.393																																																	0													84.0	81.0	82.0					21																	34877881		2203	4300	6503	SO:0001819	synonymous_variant	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2712C>A	21.37:g.34877881G>T			A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C_dom,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth_N_dom,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.V904	ENST00000381831.3	37	c.2712	CCDS13627.1	21																																																																																			GART	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,tigrfam_PurN_trans	ENSG00000159131		0.393	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3		0.00	21	0	G	NM_000819		34877881	-1			no_errors	ENST00000381815	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.980	T
GIGYF1	64599	genome.wustl.edu	37	7	100285684	100285684	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100285684G>T	ENST00000275732.5	-	2	1294	c.85C>A	c.(85-87)Cct>Act	p.P29T	GIGYF1_ENST00000471340.2_5'UTR	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	29					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GGCATGGCAGGGGACGGGGGT	0.632																																																	0													76.0	73.0	74.0					7																	100285684		2203	4300	6503	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.85C>A	7.37:g.100285684G>T	ENSP00000275732:p.Pro29Thr		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.P29T	ENST00000275732.5	37	c.85	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	23.7	4.447961	0.84101	.	.	ENSG00000146830	ENST00000275732	D	0.85171	-1.95	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.92306	0.7559	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92603	0.6093	10	0.59425	D	0.04	-8.7149	16.9692	0.86294	0.0:0.0:1.0:0.0	.	29	O75420	PERQ1_HUMAN	T	29	ENSP00000275732:P29T	ENSP00000275732:P29T	P	-	1	0	GIGYF1	100123620	1.000000	0.71417	0.986000	0.45419	0.517000	0.34286	9.174000	0.94824	2.597000	0.87782	0.563000	0.77884	CCT	GIGYF1	-	NULL	ENSG00000146830		0.632	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2		0.00	23	0	G	NM_022574		100285684	-1			no_errors	ENST00000275732	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
GLI2	2736	genome.wustl.edu	37	2	121744178	121744178	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:121744178C>A	ENST00000452319.1	+	13	2341	c.2281C>A	c.(2281-2283)Ctc>Atc	p.L761I	GLI2_ENST00000314490.11_Missense_Mutation_p.L433I|GLI2_ENST00000361492.4_Missense_Mutation_p.L761I					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GCTGCCTCCCCTCCCGGGAAG	0.607																																																	0													58.0	61.0	60.0					2																	121744178		2203	4300	6503	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.2281C>A	2.37:g.121744178C>A	ENSP00000390436:p.Leu761Ile			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L761I	ENST00000452319.1	37	c.2281	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	C	11.10	1.538184	0.27475	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;T	0.92249	-3.0;-3.0;2.01	4.98	4.03	0.46877	.	0.049434	0.85682	D	0.000000	T	0.78413	0.4279	N	0.02916	-0.46	0.39432	D	0.967106	B;B;B;B	0.12013	0.005;0.003;0.005;0.001	B;B;B;B	0.17979	0.003;0.01;0.02;0.003	T	0.73433	-0.3984	10	0.14252	T	0.57	.	10.7046	0.45948	0.3755:0.6245:0.0:0.0	.	761;416;416;433	P10070;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.	I	761;761;433	ENSP00000390436:L761I;ENSP00000354586:L761I;ENSP00000312694:L433I	ENSP00000312694:L433I	L	+	1	0	GLI2	121460648	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.688000	0.74557	2.582000	0.87167	0.655000	0.94253	CTC	GLI2	-	NULL	ENSG00000074047		0.607	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	-	0.00	32	0	C	NM_005270		121744178	+1	tier1	-	no_errors	ENST00000361492	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
GIGYF2	26058	genome.wustl.edu	37	2	233651859	233651859	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:233651859G>T	ENST00000409547.1	+	11	843		c.e11-1		GIGYF2_ENST00000373566.3_Splice_Site|GIGYF2_ENST00000409196.3_Splice_Site|GIGYF2_ENST00000409480.1_Splice_Site|GIGYF2_ENST00000409451.3_Splice_Site|GIGYF2_ENST00000452341.2_Splice_Site|GIGYF2_ENST00000373563.4_Splice_Site	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2						adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TTTCTTTATAGGGAGACCAAA	0.398																																																	0													61.0	63.0	63.0					2																	233651859		2203	4300	6503	SO:0001630	splice_region_variant	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.533-1G>T	2.37:g.233651859G>T			A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Splice_Site	SNP	-	e8-1	ENST00000409547.1	37	c.599-1	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	18.81	3.704067	0.68615	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000445650;ENST00000452341;ENST00000421778	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0345	0.97552	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GIGYF2	233360103	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	3.486000	0.53215	2.797000	0.96272	0.655000	0.94253	.	GIGYF2	-	-	ENSG00000204120		0.398	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2		0.00	34	0	G	NM_001103146	Intron	233651859	+1			no_errors	ENST00000373566	ensembl	human	known	74_37	splice_site	5.26	54	3	SNP	1.000	T
GLIPR2	152007	genome.wustl.edu	37	9	36147790	36147790	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:36147790A>T	ENST00000377960.4	+	2	55	c.21A>T	c.(19-21)aaA>aaT	p.K7N	GLIPR2_ENST00000396613.3_3'UTR|GLIPR2_ENST00000474050.1_3'UTR|GLIPR2_ENST00000377959.1_Missense_Mutation_p.K7N	NM_022343.2	NP_071738.1	Q9H4G4	GAPR1_HUMAN	GLI pathogenesis-related 2	7					positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(3)	10						CAGCTTCCAAACAGTTTCATA	0.498																																																	0													237.0	241.0	239.0					9																	36147790		2203	4300	6503	SO:0001583	missense	0			AY039756	CCDS6598.1, CCDS69595.1, CCDS75832.1, CCDS75833.1	9p13.3	2008-08-15	2008-08-15	2008-08-15	ENSG00000122694	ENSG00000122694			18007	protein-coding gene	gene with protein product		607141	"""chromosome 9 open reading frame 19"""	C9orf19		12137952, 11865038	Standard	NM_022343		Approved	GAPR-1	uc003zyz.3	Q9H4G4	OTTHUMG00000019900	ENST00000377960.4:c.21A>T	9.37:g.36147790A>T	ENSP00000367196:p.Lys7Asn		Q5VZR1|Q8N2S6|Q8WWC9|Q8WX36	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.K7N	ENST00000377960.4	37	c.21	CCDS6598.1	9	.	.	.	.	.	.	.	.	.	.	A	17.25	3.342663	0.61073	.	.	ENSG00000122694	ENST00000377959;ENST00000377960	T;T	0.46063	0.88;2.5	5.25	1.98	0.26296	CAP domain (2);	0.138816	0.64402	D	0.000004	T	0.47967	0.1474	L	0.46614	1.455	0.80722	D	1	D;D;D;B	0.67145	0.995;0.996;0.996;0.027	P;D;D;B	0.66196	0.729;0.942;0.942;0.012	T	0.30179	-0.9987	10	0.33141	T	0.24	-9.5954	6.4641	0.21971	0.3762:0.0:0.6238:0.0	.	7;204;7;7	B4DQC5;D3DRP5;Q9H4G4;Q5VZR0	.;.;GAPR1_HUMAN;.	N	7	ENSP00000367195:K7N;ENSP00000367196:K7N	ENSP00000367195:K7N	K	+	3	2	GLIPR2	36137790	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	0.941000	0.29005	0.089000	0.17243	-0.379000	0.06801	AAA	GLIPR2	-	superfamily_CAP_domain	ENSG00000122694		0.498	GLIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR2	HGNC	protein_coding	OTTHUMT00000052414.1	-	0.00	22	0	A	NM_022343		36147790	+1	tier1	-	no_errors	ENST00000377960	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	T
GLYATL1	92292	genome.wustl.edu	37	11	58714634	58714634	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:58714634T>C	ENST00000317391.4	+	4	414	c.74T>C	c.(73-75)cTg>cCg	p.L25P	GLYATL1_ENST00000300079.5_Intron|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	25						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	CCTGAGTCCCTGAAGGTCAGG	0.507																																																	0																																										SO:0001583	missense	0			AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.74T>C	11.37:g.58714634T>C	ENSP00000322223:p.Leu25Pro		A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.L25P	ENST00000317391.4	37	c.74	CCDS55768.1	11	.	.	.	.	.	.	.	.	.	.	.	16.46	3.128364	0.56721	.	.	ENSG00000166840	ENST00000525608;ENST00000444580;ENST00000317391;ENST00000532726	T;T;T	0.25414	1.8;1.8;1.8	2.73	0.262	0.15597	Glycine N-acyltransferase, N-terminal (1);	.	.	.	.	T	0.40645	0.1125	M	0.82323	2.585	0.09310	N	0.999999	P	0.38440	0.631	P	0.50378	0.639	T	0.40156	-0.9578	9	0.87932	D	0	.	4.5584	0.12149	0.0:0.3274:0.0:0.6726	.	25	Q969I3	GLYL1_HUMAN	P	25	ENSP00000433716:L25P;ENSP00000322223:L25P;ENSP00000436116:L25P	ENSP00000322223:L25P	L	+	2	0	GLYATL1	58471210	0.000000	0.05858	0.002000	0.10522	0.818000	0.46254	-0.090000	0.11163	-0.170000	0.10816	0.338000	0.21704	CTG	GLYATL1	-	pfam_Glycine_N-acyltransferase_N	ENSG00000166840		0.507	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	HGNC	protein_coding	OTTHUMT00000393783.1	-	0.00	25	0	T	NM_080661		58714634	+1	tier1	-	no_errors	ENST00000317391	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.006	C
GLYATL1	92292	genome.wustl.edu	37	11	58714634	58714634	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:58714634T>C	ENST00000317391.4	+	4	414	c.74T>C	c.(73-75)cTg>cCg	p.L25P	GLYATL1_ENST00000300079.5_Intron|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	25						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	CCTGAGTCCCTGAAGGTCAGG	0.507																																																	0																																										SO:0001583	missense	0			AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.74T>C	11.37:g.58714634T>C	ENSP00000322223:p.Leu25Pro		A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.L25P	ENST00000317391.4	37	c.74	CCDS55768.1	11	.	.	.	.	.	.	.	.	.	.	.	16.46	3.128364	0.56721	.	.	ENSG00000166840	ENST00000525608;ENST00000444580;ENST00000317391;ENST00000532726	T;T;T	0.25414	1.8;1.8;1.8	2.73	0.262	0.15597	Glycine N-acyltransferase, N-terminal (1);	.	.	.	.	T	0.40645	0.1125	M	0.82323	2.585	0.09310	N	0.999999	P	0.38440	0.631	P	0.50378	0.639	T	0.40156	-0.9578	9	0.87932	D	0	.	4.5584	0.12149	0.0:0.3274:0.0:0.6726	.	25	Q969I3	GLYL1_HUMAN	P	25	ENSP00000433716:L25P;ENSP00000322223:L25P;ENSP00000436116:L25P	ENSP00000322223:L25P	L	+	2	0	GLYATL1	58471210	0.000000	0.05858	0.002000	0.10522	0.818000	0.46254	-0.090000	0.11163	-0.170000	0.10816	0.338000	0.21704	CTG	GLYATL1	-	pfam_Glycine_N-acyltransferase_N	ENSG00000166840		0.507	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	HGNC	protein_coding	OTTHUMT00000393783.1	-	0.00	43	0	T	NM_080661		58714634	+1	tier1	-	no_errors	ENST00000317391	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.006	C
GNAI2	2771	genome.wustl.edu	37	3	50296411	50296411	+	3'UTR	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:50296411C>A	ENST00000313601.6	+	0	2088				GNAI2_ENST00000491100.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA|GNAI2_ENST00000536647.1_3'UTR|GNAI2_ENST00000266027.5_3'UTR	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GCAAGCCCCCCCCCAGCCCCC	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*636C>A	3.37:g.50296411C>A			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	SNP	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.957418	0.00465	.	.	ENSG00000114353	ENST00000540560	.	.	.	2.19	0.115	0.14643	.	.	.	.	.	T	0.35128	0.0921	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.37686	-0.9695	5	0.87932	D	0	.	2.8901	0.05674	0.3003:0.533:0.0:0.1667	.	.	.	.	H	351	.	ENSP00000439958:P351H	P	+	2	0	GNAI2	50271415	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.604000	0.05667	0.006000	0.14734	-0.274000	0.10170	CCC	GNAI2	-	-	ENSG00000114353		0.498	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1	-	0.00	16	0	C	NM_002070		50296411	+1	tier1	-	no_errors	ENST00000491100	ensembl	human	known	74_37	rna	28.57	25	10	SNP	0.000	A
GNAI2	2771	genome.wustl.edu	37	3	50296411	50296411	+	3'UTR	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:50296411C>A	ENST00000313601.6	+	0	2088				GNAI2_ENST00000491100.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA|GNAI2_ENST00000536647.1_3'UTR|GNAI2_ENST00000266027.5_3'UTR	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GCAAGCCCCCCCCCAGCCCCC	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*636C>A	3.37:g.50296411C>A			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	SNP	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.957418	0.00465	.	.	ENSG00000114353	ENST00000540560	.	.	.	2.19	0.115	0.14643	.	.	.	.	.	T	0.35128	0.0921	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.37686	-0.9695	5	0.87932	D	0	.	2.8901	0.05674	0.3003:0.533:0.0:0.1667	.	.	.	.	H	351	.	ENSP00000439958:P351H	P	+	2	0	GNAI2	50271415	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.604000	0.05667	0.006000	0.14734	-0.274000	0.10170	CCC	GNAI2	-	-	ENSG00000114353		0.498	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1	-	0.00	25	0	C	NM_002070		50296411	+1	tier1	-	no_errors	ENST00000491100	ensembl	human	known	74_37	rna	28.57	25	10	SNP	0.000	A
GNAS	2778	genome.wustl.edu	37	20	57428501	57428501	+	Missense_Mutation	SNP	G	G	A	rs587778390		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:57428501G>A	ENST00000371100.4	+	1	733	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306120.3_5'Flank|GNAS_ENST00000371075.3_Intron|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000313949.7_Intron|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371099.2_Missense_Mutation_p.V61I|GNAS_ENST00000371102.4_Missense_Mutation_p.V61I	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCCATCCCCGTCGAGAATGA	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													21.0	24.0	23.0					20																	57428501		1883	4116	5999	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.181G>A	20.37:g.57428501G>A	ENSP00000360141:p.Val61Ile		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.V61I	ENST00000371100.4	37	c.181	CCDS46622.1	20	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.343714	0.00222	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.88431	-2.38;-2.38	4.42	-8.85	0.00799	.	.	.	.	.	T	0.70500	0.3231	N	0.03115	-0.41	0.42993	D	0.994497	B	0.02656	0.0	B	0.01281	0.0	T	0.51857	-0.8652	9	0.33940	T	0.23	.	12.2115	0.54381	0.2247:0.2022:0.5731:0.0	.	61	Q5JWF2	GNAS1_HUMAN	I	61	ENSP00000360141:V61I;ENSP00000360143:V61I	ENSP00000360140:V61I	V	+	1	0	GNAS	56861896	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-3.235000	0.00546	-3.510000	0.00150	-2.264000	0.00278	GTC	GNAS	-	NULL	ENSG00000087460		0.642	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	-	0.00	16	0	G	NM_000516		57428501	+1	tier1	-	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	25.00	27	9	SNP	0.000	A
GNAS	2778	genome.wustl.edu	37	20	57428501	57428501	+	Missense_Mutation	SNP	G	G	A	rs587778390		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:57428501G>A	ENST00000371100.4	+	1	733	c.181G>A	c.(181-183)Gtc>Atc	p.V61I	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306120.3_5'Flank|GNAS_ENST00000371075.3_Intron|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000313949.7_Intron|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371099.2_Missense_Mutation_p.V61I|GNAS_ENST00000371102.4_Missense_Mutation_p.V61I	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCCATCCCCGTCGAGAATGA	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													21.0	24.0	23.0					20																	57428501		1883	4116	5999	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.181G>A	20.37:g.57428501G>A	ENSP00000360141:p.Val61Ile		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.V61I	ENST00000371100.4	37	c.181	CCDS46622.1	20	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.343714	0.00222	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.88431	-2.38;-2.38	4.42	-8.85	0.00799	.	.	.	.	.	T	0.70500	0.3231	N	0.03115	-0.41	0.42993	D	0.994497	B	0.02656	0.0	B	0.01281	0.0	T	0.51857	-0.8652	9	0.33940	T	0.23	.	12.2115	0.54381	0.2247:0.2022:0.5731:0.0	.	61	Q5JWF2	GNAS1_HUMAN	I	61	ENSP00000360141:V61I;ENSP00000360143:V61I	ENSP00000360140:V61I	V	+	1	0	GNAS	56861896	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-3.235000	0.00546	-3.510000	0.00150	-2.264000	0.00278	GTC	GNAS	-	NULL	ENSG00000087460		0.642	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	-	0.00	31	0	G	NM_000516		57428501	+1	tier1	-	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	25.00	27	9	SNP	0.000	A
GNL3L	54552	genome.wustl.edu	37	X	54578109	54578109	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:54578109C>T	ENST00000336470.4	+	11	1111	c.972C>T	c.(970-972)caC>caT	p.H324H	GNL3L_ENST00000360845.2_Silent_p.H324H	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	324					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						ACTGCGTCCACGTGCAGAAGC	0.627																																																	0													57.0	50.0	52.0					X																	54578109		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.972C>T	X.37:g.54578109C>T				Silent	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.H324	ENST00000336470.4	37	c.972	CCDS14360.1	X																																																																																			GNL3L	-	NULL	ENSG00000130119		0.627	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	-	0.00	52	0	C	NM_019067		54578109	+1	tier1	-	no_errors	ENST00000336470	ensembl	human	known	74_37	silent	35.94	41	23	SNP	0.271	T
GOLPH3L	55204	genome.wustl.edu	37	1	150621108	150621108	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:150621108A>T	ENST00000271732.3	-	5	591	c.547T>A	c.(547-549)Ttt>Att	p.F183I	GOLPH3L_ENST00000540514.1_Missense_Mutation_p.F139I	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	183	Beta-hairpin required for oligomerization. {ECO:0000250}.				Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GTCATGTCAAATAGCAGGAAA	0.418																																																	0													89.0	82.0	84.0					1																	150621108		2203	4300	6503	SO:0001583	missense	0			AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.547T>A	1.37:g.150621108A>T	ENSP00000271732:p.Phe183Ile		B1AN09|B7Z6N3|Q9NVK0	Missense_Mutation	SNP	pfam_GPP34	p.F183I	ENST00000271732.3	37	c.547	CCDS966.1	1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830900	0.91036	.	.	ENSG00000143457	ENST00000271732;ENST00000369003;ENST00000540514;ENST00000427665	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.79108	0.992;0.975	D	0.89151	0.3523	9	0.87932	D	0	-11.1721	14.4689	0.67501	1.0:0.0:0.0:0.0	.	139;183	F5H4M3;Q9H4A5	.;GLP3L_HUMAN	I	183;205;139;205	.	ENSP00000271732:F183I	F	-	1	0	GOLPH3L	148887732	1.000000	0.71417	0.974000	0.42286	0.961000	0.63080	8.761000	0.91691	2.285000	0.76669	0.533000	0.62120	TTT	GOLPH3L	-	pfam_GPP34	ENSG00000143457		0.418	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3L	HGNC	protein_coding	OTTHUMT00000084734.1	-	0.00	16	0	A	NM_018178		150621108	-1	tier1	-	no_errors	ENST00000271732	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.998	T
GOLPH3L	55204	genome.wustl.edu	37	1	150621108	150621108	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:150621108A>T	ENST00000271732.3	-	5	591	c.547T>A	c.(547-549)Ttt>Att	p.F183I	GOLPH3L_ENST00000540514.1_Missense_Mutation_p.F139I	NM_018178.5	NP_060648.2	Q9H4A5	GLP3L_HUMAN	golgi phosphoprotein 3-like	183	Beta-hairpin required for oligomerization. {ECO:0000250}.				Golgi organization (GO:0007030)|positive regulation of protein secretion (GO:0050714)	Golgi membrane (GO:0000139)|trans-Golgi network membrane (GO:0032588)	phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GTCATGTCAAATAGCAGGAAA	0.418																																																	0													89.0	82.0	84.0					1																	150621108		2203	4300	6503	SO:0001583	missense	0			AJ296153	CCDS966.1	1q21	2008-02-05			ENSG00000143457	ENSG00000143457			24882	protein-coding gene	gene with protein product		612208					Standard	NM_018178		Approved	GPP34R	uc001evj.2	Q9H4A5	OTTHUMG00000035009	ENST00000271732.3:c.547T>A	1.37:g.150621108A>T	ENSP00000271732:p.Phe183Ile		B1AN09|B7Z6N3|Q9NVK0	Missense_Mutation	SNP	pfam_GPP34	p.F183I	ENST00000271732.3	37	c.547	CCDS966.1	1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830900	0.91036	.	.	ENSG00000143457	ENST00000271732;ENST00000369003;ENST00000540514;ENST00000427665	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.79108	0.992;0.975	D	0.89151	0.3523	9	0.87932	D	0	-11.1721	14.4689	0.67501	1.0:0.0:0.0:0.0	.	139;183	F5H4M3;Q9H4A5	.;GLP3L_HUMAN	I	183;205;139;205	.	ENSP00000271732:F183I	F	-	1	0	GOLPH3L	148887732	1.000000	0.71417	0.974000	0.42286	0.961000	0.63080	8.761000	0.91691	2.285000	0.76669	0.533000	0.62120	TTT	GOLPH3L	-	pfam_GPP34	ENSG00000143457		0.418	GOLPH3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3L	HGNC	protein_coding	OTTHUMT00000084734.1	-	0.00	22	0	A	NM_018178		150621108	-1	tier1	-	no_errors	ENST00000271732	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.998	T
GPR98	84059	genome.wustl.edu	37	5	90106558	90106558	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:90106558C>A	ENST00000405460.2	+	74	15577	c.15481C>A	c.(15481-15483)Ctc>Atc	p.L5161I	GPR98_ENST00000425867.2_Missense_Mutation_p.L822I	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5161					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CACCACATACCTCAGCACAAG	0.488																																																	0													190.0	188.0	189.0					5																	90106558		2056	4206	6262	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15481C>A	5.37:g.90106558C>A	ENSP00000384582:p.Leu5161Ile		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.L5161I	ENST00000405460.2	37	c.15481	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	0.180	-1.063176	0.01950	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27890	1.71;1.64	5.37	3.59	0.41128	.	0.333086	0.26112	N	0.026271	T	0.19327	0.0464	N	0.22421	0.69	0.09310	N	1	B;B;B	0.25351	0.076;0.016;0.124	B;B;B	0.20384	0.013;0.013;0.029	T	0.16070	-1.0415	9	.	.	.	.	11.4447	0.50116	0.0:0.838:0.0:0.162	.	822;5161;822	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	I	5161;5161;822	ENSP00000384582:L5161I;ENSP00000392618:L822I	.	L	+	1	0	GPR98	90142314	0.001000	0.12720	0.000000	0.03702	0.030000	0.12068	0.672000	0.25187	0.359000	0.24239	-1.119000	0.02030	CTC	GPR98	-	NULL	ENSG00000164199		0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	32	0	C	NM_032119		90106558	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.002	A
GPR98	84059	genome.wustl.edu	37	5	90106558	90106558	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:90106558C>A	ENST00000405460.2	+	74	15577	c.15481C>A	c.(15481-15483)Ctc>Atc	p.L5161I	GPR98_ENST00000425867.2_Missense_Mutation_p.L822I	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5161					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CACCACATACCTCAGCACAAG	0.488																																																	0													190.0	188.0	189.0					5																	90106558		2056	4206	6262	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15481C>A	5.37:g.90106558C>A	ENSP00000384582:p.Leu5161Ile		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.L5161I	ENST00000405460.2	37	c.15481	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	0.180	-1.063176	0.01950	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27890	1.71;1.64	5.37	3.59	0.41128	.	0.333086	0.26112	N	0.026271	T	0.19327	0.0464	N	0.22421	0.69	0.09310	N	1	B;B;B	0.25351	0.076;0.016;0.124	B;B;B	0.20384	0.013;0.013;0.029	T	0.16070	-1.0415	9	.	.	.	.	11.4447	0.50116	0.0:0.838:0.0:0.162	.	822;5161;822	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	I	5161;5161;822	ENSP00000384582:L5161I;ENSP00000392618:L822I	.	L	+	1	0	GPR98	90142314	0.001000	0.12720	0.000000	0.03702	0.030000	0.12068	0.672000	0.25187	0.359000	0.24239	-1.119000	0.02030	CTC	GPR98	-	NULL	ENSG00000164199		0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	35	0	C	NM_032119		90106558	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.002	A
GRIK3	2899	genome.wustl.edu	37	1	37271817	37271817	+	Nonsense_Mutation	SNP	G	G	T	rs373465990		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:37271817G>T	ENST00000373091.3	-	14	2218	c.2202C>A	c.(2200-2202)taC>taA	p.Y734*	GRIK3_ENST00000373093.4_Nonsense_Mutation_p.Y734*	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	734					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TGAGCAGCGCGTAGTCGGCCG	0.607																																																	0													171.0	132.0	145.0					1																	37271817		2203	4300	6503	SO:0001587	stop_gained	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2202C>A	1.37:g.37271817G>T	ENSP00000362183:p.Tyr734*		A9Z1Z8|B1AMS6|Q13004|Q16136	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y734*	ENST00000373091.3	37	c.2202	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.112077	0.97291	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	.	.	.	5.48	1.43	0.22495	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9704	0.41749	0.2762:0.0:0.7238:0.0	.	.	.	.	X	734	.	ENSP00000362183:Y734X	Y	-	3	2	GRIK3	37044404	0.970000	0.33590	0.986000	0.45419	0.795000	0.44927	0.056000	0.14256	0.007000	0.14760	0.549000	0.68633	TAC	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000163873		0.607	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1		0.00	32	0	G	NM_000831		37271817	-1			no_errors	ENST00000373091	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	T
GSN	2934	genome.wustl.edu	37	9	124074856	124074857	+	Intron	INS	-	-	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:124074856_124074857insA	ENST00000373818.4	+	5	885				GSN_ENST00000485767.1_3'UTR|GSN_ENST00000545652.1_Intron|GSN_ENST00000373823.3_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000412819.1_Intron|GSN_ENST00000394353.2_Intron|GSN_ENST00000449733.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000436847.1_Intron|GSN_ENST00000373807.1_Intron	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGAATTTGAGGAAAAAAAAAAA	0.426																																																	0																																										SO:0001627	intron_variant	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.816+90->A	9.37:g.124074867_124074867dupA			A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	INS	-	NULL	ENST00000373818.4	37	NULL	CCDS6828.1	9																																																																																			GSN	-	-	ENSG00000148180		0.426	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	HGNC	protein_coding	OTTHUMT00000053861.1		0.00	13	0	-	NM_000177		124074857	+1	tier1		no_errors	ENST00000485767	ensembl	human	known	74_37	rna	28.57	10	4	INS	0.003:0.000	A
GUCY1A2	2977	genome.wustl.edu	37	11	106558335	106558335	+	Silent	SNP	C	C	T	rs373644440		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:106558335C>T	ENST00000526355.2	-	8	2607	c.2139G>A	c.(2137-2139)tcG>tcA	p.S713S	GUCY1A2_ENST00000282249.2_Silent_p.S744S|GUCY1A2_ENST00000347596.2_Silent_p.S734S	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	713					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.S713S(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TTTTTATTCTCGACGAAGAAA	0.473																																																	1	Substitution - coding silent(1)	large_intestine(1)						C		0,4402		0,0,2201	165.0	162.0	163.0		2139	-4.8	0.9	11		163	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous	GUCY1A2	NM_000855.1		0,2,6497	TT,TC,CC		0.0233,0.0,0.0154		713/733	106558335	2,12996	2201	4298	6499	SO:0001819	synonymous_variant	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.2139G>A	11.37:g.106558335C>T			A1L4C4|B7ZLT5	Silent	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S744	ENST00000526355.2	37	c.2232	CCDS8335.1	11																																																																																			GUCY1A2	-	superfamily_A/G_cyclase	ENSG00000152402		0.473	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	-	0.00	50	0	C			106558335	-1	tier1	-	no_errors	ENST00000282249	ensembl	human	known	74_37	silent	34.62	51	27	SNP	0.594	T
GUCY1A2	2977	genome.wustl.edu	37	11	106558335	106558335	+	Silent	SNP	C	C	T	rs373644440		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:106558335C>T	ENST00000526355.2	-	8	2607	c.2139G>A	c.(2137-2139)tcG>tcA	p.S713S	GUCY1A2_ENST00000282249.2_Silent_p.S744S|GUCY1A2_ENST00000347596.2_Silent_p.S734S	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	713					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.S713S(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TTTTTATTCTCGACGAAGAAA	0.473																																																	1	Substitution - coding silent(1)	large_intestine(1)						C		0,4402		0,0,2201	165.0	162.0	163.0		2139	-4.8	0.9	11		163	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous	GUCY1A2	NM_000855.1		0,2,6497	TT,TC,CC		0.0233,0.0,0.0154		713/733	106558335	2,12996	2201	4298	6499	SO:0001819	synonymous_variant	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.2139G>A	11.37:g.106558335C>T			A1L4C4|B7ZLT5	Silent	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S744	ENST00000526355.2	37	c.2232	CCDS8335.1	11																																																																																			GUCY1A2	-	superfamily_A/G_cyclase	ENSG00000152402		0.473	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	-	0.00	74	0	C			106558335	-1	tier1	-	no_errors	ENST00000282249	ensembl	human	known	74_37	silent	34.62	51	27	SNP	0.594	T
HARBI1	283254	genome.wustl.edu	37	11	46625423	46625423	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:46625423G>T	ENST00000326737.3	-	3	954	c.707C>A	c.(706-708)aCc>aAc	p.T236N		NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	236						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						GTGAAGTGGGGTCATGAGCCA	0.443																																																	0													92.0	80.0	84.0					11																	46625423		2201	4299	6500	SO:0001583	missense	0			AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.707C>A	11.37:g.46625423G>T	ENSP00000317743:p.Thr236Asn		D3DQP9	Missense_Mutation	SNP	pfam_Harbinger_derived_prot_plant	p.T236N	ENST00000326737.3	37	c.707	CCDS7920.1	11	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725019	0.89298	.	.	ENSG00000180423	ENST00000326737	.	.	.	5.47	5.47	0.80525	.	0.050373	0.85682	D	0.000000	D	0.85737	0.5766	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.86894	0.2050	9	0.44086	T	0.13	-8.4559	19.3496	0.94378	0.0:0.0:1.0:0.0	.	236	Q96MB7	HARB1_HUMAN	N	236	.	ENSP00000317743:T236N	T	-	2	0	HARBI1	46581999	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	8.633000	0.90999	2.571000	0.86741	0.655000	0.94253	ACC	HARBI1	-	pfam_Harbinger_derived_prot_plant	ENSG00000180423		0.443	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARBI1	HGNC	protein_coding	OTTHUMT00000390291.1		0.00	10	0	G	NM_173811		46625423	-1			no_errors	ENST00000326737	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
H2AFX	3014	genome.wustl.edu	37	11	118965783	118965783	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:118965783C>A	ENST00000530167.1	-	1	394	c.322G>T	c.(322-324)Gtc>Ttc	p.V108F		NM_002105.2	NP_002096.1	P16104	H2AX_HUMAN	H2A histone family, member X	108					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|nucleosome assembly (GO:0006334)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)	p.V108F(1)		lung(3)	3	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		TTGGGCAGGACGCCTCCCTGG	0.687								Chromatin Structure			OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	lung(1)											81.0	82.0	81.0					11																	118965783		2200	4294	6494	SO:0001583	missense	0			X14850	CCDS8410.1	11q23.3	2011-01-27						"""Histones / Replication-independent"""	4739	protein-coding gene	gene with protein product		601772		H2AX		8076949	Standard	NM_002105		Approved		uc001pvg.3	P16104		ENST00000530167.1:c.322G>T	11.37:g.118965783C>A	ENSP00000434024:p.Val108Phe	1492	Q4ZGJ7|Q6IAS5	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.V108F	ENST00000530167.1	37	c.322	CCDS8410.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.192923	0.94960	.	.	ENSG00000188486	ENST00000530167;ENST00000375167	D;D	0.94046	-3.34;-3.34	5.92	5.92	0.95590	Histone-fold (2);Histone H2A (2);	0.000000	0.53938	D	0.000043	D	0.97123	0.9060	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97250	0.9897	10	0.87932	D	0	.	19.2987	0.94134	0.0:1.0:0.0:0.0	.	108	P16104	H2AX_HUMAN	F	108	ENSP00000434024:V108F;ENSP00000364310:V108F	ENSP00000364310:V108F	V	-	1	0	H2AFX	118470993	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	7.597000	0.82733	2.809000	0.96659	0.655000	0.94253	GTC	H2AFX	-	superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000188486		0.687	H2AFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2AFX	HGNC	protein_coding	OTTHUMT00000388330.2		0.00	48	0	C	NM_002105		118965783	-1			no_errors	ENST00000375167	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
HDLBP	3069	genome.wustl.edu	37	2	242192401	242192401	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:242192401C>G	ENST00000391975.1	-	11	1570	c.1343G>C	c.(1342-1344)aGg>aCg	p.R448T	HDLBP_ENST00000427183.2_Missense_Mutation_p.R415T|HDLBP_ENST00000310931.4_Missense_Mutation_p.R448T|HDLBP_ENST00000476807.1_5'Flank|HDLBP_ENST00000391976.2_Missense_Mutation_p.R448T	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	448	KH 5. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		AATGAGGTGCCTGTGGAACTT	0.572																																																	0													195.0	154.0	168.0					2																	242192401		2203	4300	6503	SO:0001583	missense	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1343G>C	2.37:g.242192401C>G	ENSP00000375836:p.Arg448Thr		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R448T	ENST00000391975.1	37	c.1343	CCDS2547.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	26.9|26.9|26.9	4.781205|4.781205|4.781205	0.90282|0.90282|0.90282	.|.|.	.|.|.	ENSG00000115677|ENSG00000115677|ENSG00000115677	ENST00000453141|ENST00000373292|ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183	.|.|T;T;T;T	.|.|0.32272	.|.|1.46;1.46;1.46;1.46	5.49|5.49|5.49	4.62|4.62|4.62	0.57501|0.57501|0.57501	.|.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.60470|0.60470|0.60470	0.2271|0.2271|0.2271	M|M|M	0.90309|0.90309|0.90309	3.105|3.105|3.105	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D	.|.|0.71674	.|.|0.998;0.998	.|.|D;D	.|.|0.74023	.|.|0.978;0.982	T|T|T	0.66933|0.66933|0.66933	-0.5798|-0.5798|-0.5798	5|5|10	.|.|0.45353	.|.|T	.|.|0.12	-26.1744|-26.1744|-26.1744	12.9947|12.9947|12.9947	0.58640|0.58640|0.58640	0.0:0.9248:0.0:0.0751|0.0:0.9248:0.0:0.0751|0.0:0.9248:0.0:0.0751	.|.|.	.|.|415;448	.|.|E7EM71;Q00341	.|.|.;VIGLN_HUMAN	R|H|T	326|256|448;448;448;415	.|.|ENSP00000375836:R448T;ENSP00000375837:R448T;ENSP00000312042:R448T;ENSP00000399139:R415T	.|.|ENSP00000312042:R448T	G|Q|R	-|-|-	1|3|2	0|2|0	HDLBP|HDLBP|HDLBP	241841074|241841074|241841074	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.988000|0.988000|0.988000	0.46212|0.46212|0.46212	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	7.051000|7.051000|7.051000	0.76627|0.76627|0.76627	1.460000|1.460000|1.460000	0.47911|0.47911|0.47911	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GGC|CAG|AGG	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.572	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	-	0.00	37	0	C	NM_203346		242192401	-1	tier1	-	no_errors	ENST00000310931	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	G
HIST1H1D	3007	genome.wustl.edu	37	6	26234794	26234794	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:26234794delT	ENST00000244534.5	-	1	422	c.368delA	c.(367-369)aagfs	p.K123fs		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	123					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				TGCGCCAGCCTTTTTGGCCTT	0.567																																																	0													52.0	59.0	57.0					6																	26234794		2203	4300	6503	SO:0001589	frameshift_variant	0			M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.368delA	6.37:g.26234794delT	ENSP00000244534:p.Lys123fs		B2R751|Q2M2I2	Frame_Shift_Del	DEL	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K123fs	ENST00000244534.5	37	c.368	CCDS4597.1	6																																																																																			HIST1H1D	-	NULL	ENSG00000124575		0.567	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1D	HGNC	protein_coding	OTTHUMT00000040095.1		0.00	27	0	T	NM_005320		26234794	-1	tier1		no_errors	ENST00000244534	ensembl	human	known	74_37	frame_shift_del	10.71	25	3	DEL	0.994	-
HIST1H2AB	8335	genome.wustl.edu	37	6	26033431	26033432	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:26033431_26033432insT	ENST00000259791.2	-	1	364_365	c.365_366insA	c.(364-366)gagfs	p.E122fs	HIST1H3B_ENST00000244661.2_5'Flank	NM_003513.2	NP_003504.2	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TATGATGGCTCTCAGTTTTCTT	0.485																																																	0																																										SO:0001589	frameshift_variant	0			X00089	CCDS4574.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000137259	ENSG00000278463		"""Histones / Replication-dependent"""	4734	protein-coding gene	gene with protein product		602795	"""H2A histone family, member M"", ""histone 1, H2ab"""	H2AFM		9439656, 9119399, 12408966	Standard	NM_003513		Approved	H2A/m	uc003nft.1	P04908	OTTHUMG00000014420	ENST00000259791.2:c.366dupA	6.37:g.26033432_26033432dupT	ENSP00000259791:p.Glu122fs		P28001|Q76P63	Frame_Shift_Ins	INS	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.S123fs	ENST00000259791.2	37	c.366_365	CCDS4574.1	6																																																																																			HIST1H2AB	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000137259		0.485	HIST1H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AB	HGNC	protein_coding	OTTHUMT00000040082.1		0.00	34	0	-	NM_003513		26033432	-1	tier1		no_errors	ENST00000259791	ensembl	human	known	74_37	frame_shift_ins	26.67	44	16	INS	1.000:1.000	T
HIST1H2AC	8334	genome.wustl.edu	37	6	26124548	26124548	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:26124548C>T	ENST00000602637.1	+	1	118	c.88C>T	c.(88-90)Cga>Tga	p.R30*	HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Nonsense_Mutation_p.R30*|HIST1H2BC_ENST00000314332.5_5'Flank			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	30						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						CCCGGTGGGCCGAGTGCACCG	0.622																																																	0													45.0	46.0	45.0					6																	26124548		2203	4300	6503	SO:0001587	stop_gained	0			Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.88C>T	6.37:g.26124548C>T	ENSP00000473534:p.Arg30*		B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R30*	ENST00000602637.1	37	c.88	CCDS4585.1	6	.	.	.	.	.	.	.	.	.	.	.	17.51	3.406638	0.62399	.	.	ENSG00000180573	ENST00000377791;ENST00000314088	.	.	.	5.6	2.75	0.32379	.	0.000000	0.38720	N	0.001584	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2044	0.65725	0.3912:0.6087:0.0:0.0	.	.	.	.	X	30	.	ENSP00000321389:R30X	R	+	1	2	HIST1H2AC	26232527	0.998000	0.40836	0.721000	0.30653	0.041000	0.13682	3.810000	0.55613	0.353000	0.24079	0.591000	0.81541	CGA	HIST1H2AC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000180573		0.622	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AC	HGNC	protein_coding	OTTHUMT00000468023.1	-	0.00	50	0	C	NM_003512		26124548	+1	tier1	-	no_errors	ENST00000314088	ensembl	human	known	74_37	nonsense	23.33	46	14	SNP	1.000	T
HNRNPL	3191	genome.wustl.edu	37	19	39330958	39330959	+	Frame_Shift_Ins	INS	-	-	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:39330958_39330959insG	ENST00000221419.5	-	8	1376_1377	c.1010_1011insC	c.(1009-1011)ccafs	p.P337fs	AC104534.3_ENST00000594769.1_5'Flank|HNRNPL_ENST00000600873.1_Frame_Shift_Ins_p.P204fs	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	337	Pro-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CGTAGTGAGGTGGGGGGGGCCC	0.668																																																	0																																										SO:0001589	frameshift_variant	0			X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1011dupC	19.37:g.39330966_39330966dupG	ENSP00000221419:p.Pro337fs		A6ND69|A6NIT8|Q9H3P3	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.P338fs	ENST00000221419.5	37	c.1011_1010	CCDS33015.1	19																																																																																			HNRNPL	-	tigrfam_HnRNP-L_PTB	ENSG00000104824		0.668	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	HGNC	protein_coding	OTTHUMT00000462670.1		0.00	20	0	-			39330959	-1	tier1		no_errors	ENST00000221419	ensembl	human	known	74_37	frame_shift_ins	26.98	46	17	INS	1.000:1.000	G
HPSE2	60495	genome.wustl.edu	37	10	100219489	100219489	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:100219489G>T	ENST00000370552.3	-	12	1680	c.1621C>A	c.(1621-1623)Caa>Aaa	p.Q541K	HPSE2_ENST00000370546.1_3'UTR|HPSE2_ENST00000404542.1_Missense_Mutation_p.Q429K|HPSE2_ENST00000370549.1_Missense_Mutation_p.Q483K	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	541					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CCATTCAGTTGCACTGACCTA	0.562																																																	0													40.0	34.0	36.0					10																	100219489		2203	4300	6503	SO:0001583	missense	0			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1621C>A	10.37:g.100219489G>T	ENSP00000359583:p.Gln541Lys		Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.Q541K	ENST00000370552.3	37	c.1621	CCDS7477.1	10	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191797	0.58017	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000404542	D;D;D	0.82711	-1.64;-1.64;-1.64	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.86397	0.5923	L	0.37630	1.12	0.80722	D	1	P;P;P	0.52577	0.954;0.954;0.924	D;D;P	0.67900	0.954;0.954;0.9	T	0.81616	-0.0852	10	0.15066	T	0.55	-9.1916	19.4309	0.94765	0.0:0.0:1.0:0.0	.	429;483;541	Q8WWQ2-4;Q8WWQ2-3;Q8WWQ2	.;.;HPSE2_HUMAN	K	541;483;429	ENSP00000359583:Q541K;ENSP00000359580:Q483K;ENSP00000384384:Q429K	ENSP00000359580:Q483K	Q	-	1	0	HPSE2	100209479	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.304000	0.96190	2.592000	0.87571	0.650000	0.86243	CAA	HPSE2	-	NULL	ENSG00000172987		0.562	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	HGNC	protein_coding	OTTHUMT00000049789.1		0.00	17	0	G	NM_021828		100219489	-1			no_errors	ENST00000370552	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
HSPA2	3306	genome.wustl.edu	37	14	65008192	65008192	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:65008192G>T	ENST00000394709.1	+	2	701	c.625G>T	c.(625-627)Gac>Tac	p.D209Y	HSPA2_ENST00000554883.1_3'UTR|HSPA2_ENST00000247207.6_Missense_Mutation_p.D209Y|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	209					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		TGGCACTTTCGACGTGTCCAT	0.652																																					Pancreas(136;1211 1835 24894 31984 38227)												0													93.0	99.0	97.0					14																	65008192		2203	4300	6503	SO:0001583	missense	0			L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.625G>T	14.37:g.65008192G>T	ENSP00000378199:p.Asp209Tyr		Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.D209Y	ENST00000394709.1	37	c.625	CCDS9766.1	14	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709219	0.68615	.	.	ENSG00000126803	ENST00000394709;ENST00000247207	T;T	0.17213	2.29;2.29	5.22	5.22	0.72569	Heat shock protein 70, conserved site (1);	0.000000	0.53938	U	0.000045	T	0.68979	0.3060	H	0.99976	5.16	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.86583	0.1855	10	0.87932	D	0	-15.6553	18.774	0.91902	0.0:0.0:1.0:0.0	.	209	P54652	HSP72_HUMAN	Y	209	ENSP00000378199:D209Y;ENSP00000247207:D209Y	ENSP00000247207:D209Y	D	+	1	0	HSPA2	64077945	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.869000	0.99810	2.422000	0.82143	0.563000	0.77884	GAC	HSPA2	-	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	ENSG00000126803		0.652	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	HGNC	protein_coding	OTTHUMT00000280651.1	-	0.00	49	0	G			65008192	+1	tier1	-	no_errors	ENST00000247207	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
HSPA9	3313	genome.wustl.edu	37	5	137895634	137895634	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:137895634C>T	ENST00000297185.3	-	11	1454	c.1329G>A	c.(1327-1329)ctG>ctA	p.L443L	HSPA9_ENST00000501917.2_Intron|SNORD63_ENST00000384262.1_RNA|SNORD63_ENST00000411005.1_RNA	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	443					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TACCCAGAGACAGGGGAGTGA	0.498																																																	0													79.0	77.0	78.0					5																	137895634		2203	4300	6503	SO:0001819	synonymous_variant	0			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.1329G>A	5.37:g.137895634C>T			B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,pfam_Carb_kinase_FGGY_C,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	p.L443	ENST00000297185.3	37	c.1329	CCDS4208.1	5																																																																																			HSPA9	-	pfam_Hsp_70_fam,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	ENSG00000113013		0.498	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA9	HGNC	protein_coding	OTTHUMT00000251285.1	-	0.00	56	0	C	NM_004134		137895634	-1	tier1	-	no_errors	ENST00000297185	ensembl	human	known	74_37	silent	25.35	53	18	SNP	0.822	T
HSPA9	3313	genome.wustl.edu	37	5	137895634	137895634	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:137895634C>T	ENST00000297185.3	-	11	1454	c.1329G>A	c.(1327-1329)ctG>ctA	p.L443L	HSPA9_ENST00000501917.2_Intron|SNORD63_ENST00000384262.1_RNA|SNORD63_ENST00000411005.1_RNA	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	443					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TACCCAGAGACAGGGGAGTGA	0.498																																																	0													79.0	77.0	78.0					5																	137895634		2203	4300	6503	SO:0001819	synonymous_variant	0			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.1329G>A	5.37:g.137895634C>T			B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,pfam_Carb_kinase_FGGY_C,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	p.L443	ENST00000297185.3	37	c.1329	CCDS4208.1	5																																																																																			HSPA9	-	pfam_Hsp_70_fam,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	ENSG00000113013		0.498	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA9	HGNC	protein_coding	OTTHUMT00000251285.1	-	0.00	85	0	C	NM_004134		137895634	-1	tier1	-	no_errors	ENST00000297185	ensembl	human	known	74_37	silent	25.35	53	18	SNP	0.822	T
IDS	3423	genome.wustl.edu	37	X	148571894	148571894	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:148571894G>A	ENST00000340855.6	-	7	1166	c.957C>T	c.(955-957)gaC>gaT	p.D319D	IDS_ENST00000541269.1_Silent_p.D108D|IDS_ENST00000370441.4_Silent_p.D319D|IDS_ENST00000422081.2_Silent_p.D108D|IDS_ENST00000490775.1_5'UTR|IDS_ENST00000537071.1_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	319					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GCTGAAGATCGTCCAAAGCAC	0.443																																																	0													106.0	93.0	97.0					X																	148571894		2203	4300	6503	SO:0001819	synonymous_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.957C>T	X.37:g.148571894G>A			D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.D319	ENST00000340855.6	37	c.957	CCDS14685.1	X																																																																																			IDS	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.443	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	-	0.00	43	0	G			148571894	-1	tier1	-	no_errors	ENST00000340855	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.997	A
IDS	3423	genome.wustl.edu	37	X	148571894	148571894	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:148571894G>A	ENST00000340855.6	-	7	1166	c.957C>T	c.(955-957)gaC>gaT	p.D319D	IDS_ENST00000541269.1_Silent_p.D108D|IDS_ENST00000370441.4_Silent_p.D319D|IDS_ENST00000422081.2_Silent_p.D108D|IDS_ENST00000490775.1_5'UTR|IDS_ENST00000537071.1_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	319					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GCTGAAGATCGTCCAAAGCAC	0.443																																																	0													106.0	93.0	97.0					X																	148571894		2203	4300	6503	SO:0001819	synonymous_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.957C>T	X.37:g.148571894G>A			D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.D319	ENST00000340855.6	37	c.957	CCDS14685.1	X																																																																																			IDS	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.443	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	-	0.00	46	0	G			148571894	-1	tier1	-	no_errors	ENST00000340855	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.997	A
IFI16	3428	genome.wustl.edu	37	1	158986377	158986377	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:158986377G>C	ENST00000295809.7	+	4	691	c.436G>C	c.(436-438)Gag>Cag	p.E146Q	IFI16_ENST00000368131.4_Missense_Mutation_p.E146Q|IFI16_ENST00000340979.6_Missense_Mutation_p.E146Q|IFI16_ENST00000448393.2_Missense_Mutation_p.E146Q|IFI16_ENST00000430894.2_Intron|IFI16_ENST00000359709.3_Intron|IFI16_ENST00000368132.3_Missense_Mutation_p.E146Q			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	146	Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TAAGGTGTCCGAGGAACAGAC	0.502																																																	0													98.0	89.0	92.0					1																	158986377		2203	4300	6503	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.436G>C	1.37:g.158986377G>C	ENSP00000295809:p.Glu146Gln		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.E146Q	ENST00000295809.7	37	c.436		1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.347362	0.00219	.	.	ENSG00000163565	ENST00000359709;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132	T;T;T;T;T	0.16196	2.36;3.73;3.74;3.74;3.74	2.42	-4.85	0.03142	.	.	.	.	.	T	0.01061	0.0035	N	0.03050	-0.425	0.09310	N	1	B;B	0.20368	0.044;0.002	B;B	0.24155	0.051;0.004	T	0.32214	-0.9915	9	0.02654	T	1	.	8.9549	0.35812	0.2054:0.6288:0.1658:0.0	.	146;146	Q16666-2;Q16666	.;IF16_HUMAN	Q	146	ENSP00000407052:E146Q;ENSP00000295809:E146Q;ENSP00000342741:E146Q;ENSP00000357113:E146Q;ENSP00000357114:E146Q	ENSP00000295809:E146Q	E	+	1	0	IFI16	157253001	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.806000	0.00758	-3.456000	0.00160	-2.624000	0.00155	GAG	IFI16	-	NULL	ENSG00000163565		0.502	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	39	0	G	NM_005531		158986377	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	9.76	74	8	SNP	0.000	C
IFI16	3428	genome.wustl.edu	37	1	158986377	158986377	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:158986377G>C	ENST00000295809.7	+	4	691	c.436G>C	c.(436-438)Gag>Cag	p.E146Q	IFI16_ENST00000368131.4_Missense_Mutation_p.E146Q|IFI16_ENST00000340979.6_Missense_Mutation_p.E146Q|IFI16_ENST00000448393.2_Missense_Mutation_p.E146Q|IFI16_ENST00000430894.2_Intron|IFI16_ENST00000359709.3_Intron|IFI16_ENST00000368132.3_Missense_Mutation_p.E146Q			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	146	Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TAAGGTGTCCGAGGAACAGAC	0.502																																																	0													98.0	89.0	92.0					1																	158986377		2203	4300	6503	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.436G>C	1.37:g.158986377G>C	ENSP00000295809:p.Glu146Gln		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.E146Q	ENST00000295809.7	37	c.436		1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.347362	0.00219	.	.	ENSG00000163565	ENST00000359709;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132	T;T;T;T;T	0.16196	2.36;3.73;3.74;3.74;3.74	2.42	-4.85	0.03142	.	.	.	.	.	T	0.01061	0.0035	N	0.03050	-0.425	0.09310	N	1	B;B	0.20368	0.044;0.002	B;B	0.24155	0.051;0.004	T	0.32214	-0.9915	9	0.02654	T	1	.	8.9549	0.35812	0.2054:0.6288:0.1658:0.0	.	146;146	Q16666-2;Q16666	.;IF16_HUMAN	Q	146	ENSP00000407052:E146Q;ENSP00000295809:E146Q;ENSP00000342741:E146Q;ENSP00000357113:E146Q;ENSP00000357114:E146Q	ENSP00000295809:E146Q	E	+	1	0	IFI16	157253001	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.806000	0.00758	-3.456000	0.00160	-2.624000	0.00155	GAG	IFI16	-	NULL	ENSG00000163565		0.502	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	68	0	G	NM_005531		158986377	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	9.76	74	8	SNP	0.000	C
IL1RAPL1	11141	genome.wustl.edu	37	X	29417387	29417387	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:29417387G>T	ENST00000378993.1	+	5	1338	c.665G>T	c.(664-666)gGc>gTc	p.G222V	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.G222V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	222	Ig-like C2-type 2.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AAATATGGAGGCTTTGTTGTG	0.323																																																	0													72.0	70.0	70.0					X																	29417387		2202	4292	6494	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.665G>T	X.37:g.29417387G>T	ENSP00000368278:p.Gly222Val		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.G222V	ENST00000378993.1	37	c.665	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	10.59	1.392921	0.25118	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.14266	2.52;2.52	5.75	5.75	0.90469	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.253191	0.38837	N	0.001541	T	0.24353	0.0590	M	0.86864	2.845	0.48901	D	0.999726	B	0.19200	0.034	B	0.25140	0.058	T	0.02991	-1.1085	9	.	.	.	.	13.2804	0.60210	0.0:0.0:0.8314:0.1686	.	222	Q9NZN1	IRPL1_HUMAN	V	222	ENSP00000368278:G222V;ENSP00000305200:G222V	.	G	+	2	0	IL1RAPL1	29327308	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	2.963000	0.49184	2.426000	0.82243	0.523000	0.50628	GGC	IL1RAPL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000169306		0.323	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	126	0	G	NM_014271		29417387	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	missense	22.29	122	35	SNP	1.000	T
IL1RAPL1	11141	genome.wustl.edu	37	X	29417387	29417387	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:29417387G>T	ENST00000378993.1	+	5	1338	c.665G>T	c.(664-666)gGc>gTc	p.G222V	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.G222V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	222	Ig-like C2-type 2.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AAATATGGAGGCTTTGTTGTG	0.323																																																	0													72.0	70.0	70.0					X																	29417387		2202	4292	6494	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.665G>T	X.37:g.29417387G>T	ENSP00000368278:p.Gly222Val		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.G222V	ENST00000378993.1	37	c.665	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	10.59	1.392921	0.25118	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.14266	2.52;2.52	5.75	5.75	0.90469	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.253191	0.38837	N	0.001541	T	0.24353	0.0590	M	0.86864	2.845	0.48901	D	0.999726	B	0.19200	0.034	B	0.25140	0.058	T	0.02991	-1.1085	9	.	.	.	.	13.2804	0.60210	0.0:0.0:0.8314:0.1686	.	222	Q9NZN1	IRPL1_HUMAN	V	222	ENSP00000368278:G222V;ENSP00000305200:G222V	.	G	+	2	0	IL1RAPL1	29327308	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	2.963000	0.49184	2.426000	0.82243	0.523000	0.50628	GGC	IL1RAPL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000169306		0.323	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	97	0	G	NM_014271		29417387	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	missense	22.29	122	35	SNP	1.000	T
IL9	3578	genome.wustl.edu	37	5	135228158	135228158	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:135228158G>T	ENST00000274520.1	-	5	367	c.357C>A	c.(355-357)ggC>ggA	p.G119G		NM_000590.1	NP_000581.1	P15248	IL9_HUMAN	interleukin 9	119					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-5 biosynthetic process (GO:0045407)	extracellular space (GO:0005615)				large_intestine(3)|lung(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCAGCGCGTTGCCTGCCGTGG	0.423																																																	0													74.0	81.0	79.0					5																	135228158		2203	4300	6503	SO:0001819	synonymous_variant	0			S63356	CCDS4189.1	5q31-q35	2008-07-18			ENSG00000145839	ENSG00000145839		"""Interleukins and interleukin receptors"""	6029	protein-coding gene	gene with protein product	"""p40 T-cell and mast cell growth factor"", ""T-cell growth factor p40"", ""p40 cytokine"", ""homolog of mouse T cell and mast cell growth factor 40"""	146931				8379467	Standard	NM_000590		Approved	IL-9, HP40, P40	uc003lbb.1	P15248	OTTHUMG00000129147	ENST00000274520.1:c.357C>A	5.37:g.135228158G>T				Silent	SNP	pfam_IL-7/IL-9_fam,prints_IL-9	p.G119	ENST00000274520.1	37	c.357	CCDS4189.1	5																																																																																			IL9	-	pfam_IL-7/IL-9_fam,prints_IL-9	ENSG00000145839		0.423	IL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL9	HGNC	protein_coding	OTTHUMT00000251210.1		0.00	67	0	G	NM_000590		135228158	-1			no_errors	ENST00000274520	ensembl	human	known	74_37	silent	5.38	88	5	SNP	0.964	T
IST1	9798	genome.wustl.edu	37	16	71961715	71961715	+	Nonstop_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:71961715A>T	ENST00000378799.6	+	10	1456	c.1100A>T	c.(1099-1101)tAg>tTg	p.*367L	PKD1L3_ENST00000534738.1_RNA|IST1_ENST00000538850.1_Nonstop_Mutation_p.*219L|IST1_ENST00000606369.1_Nonstop_Mutation_p.*219L|IST1_ENST00000378798.5_Nonstop_Mutation_p.*336L|IST1_ENST00000544564.1_Nonstop_Mutation_p.*367L|IST1_ENST00000538565.1_3'UTR|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000329908.8_3'UTR|RP11-498D10.6_ENST00000573861.1_RNA|IST1_ENST00000535424.1_Nonstop_Mutation_p.*380L|IST1_ENST00000541571.2_Nonstop_Mutation_p.*367L			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	0					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										AAGAAAACATAGGTCTCTTAA	0.418																																																	0													93.0	99.0	97.0					16																	71961715		2198	4300	6498	SO:0001578	stop_lost	0			BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.1100A>T	16.37:g.71961715A>T	ENSP00000368076:p.*367Leuext*3		A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Nonstop_Mutation	SNP	pfam_DUF292_euk	p.*380L	ENST00000378799.6	37	c.1139	CCDS59272.1	16	.	.	.	.	.	.	.	.	.	.	A	20.2	3.947304	0.73672	.	.	ENSG00000182149	ENST00000535424;ENST00000378799;ENST00000538963;ENST00000538850;ENST00000378798;ENST00000456820	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7919	0.78372	1.0:0.0:0.0:0.0	.	.	.	.	L	380;367;356;219;336;290	.	.	X	+	2	0	KIAA0174	70519216	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.070000	0.76763	2.190000	0.69967	0.528000	0.53228	TAG	IST1	-	NULL	ENSG00000182149		0.418	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IST1	HGNC	protein_coding	OTTHUMT00000269005.2	-	0.00	39	0	A	NM_014761		71961715	+1	tier1	-	no_errors	ENST00000535424	ensembl	human	known	74_37	nonstop	11.90	37	5	SNP	1.000	T
ITGB3	3690	genome.wustl.edu	37	17	45369758	45369758	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:45369758G>T	ENST00000559488.1	+	10	1530	c.1514G>T	c.(1513-1515)cGc>cTc	p.R505L	ITGB3_ENST00000560629.1_Silent_p.S493S|ITGB3_ENST00000435993.2_Missense_Mutation_p.R458L	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	505	Cysteine-rich tandem repeats.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.R458H(1)|p.R505H(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	GAGGACTATCGCCCTTCCCAG	0.627																																																	2	Substitution - Missense(2)	lung(2)											96.0	82.0	87.0					17																	45369758		2203	4300	6503	SO:0001583	missense	0				CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1514G>T	17.37:g.45369758G>T	ENSP00000452786:p.Arg505Leu		A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.R505L	ENST00000559488.1	37	c.1514	CCDS11511.1	17	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612752	0.28712	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.90133	-2.62	5.38	1.08	0.20341	.	0.692467	0.15621	N	0.252910	T	0.76962	0.4061	N	0.04880	-0.145	0.23542	N	0.997454	B	0.28667	0.219	B	0.24006	0.05	T	0.66432	-0.5925	10	0.40728	T	0.16	.	8.848	0.35181	0.384:0.0:0.616:0.0	.	505	P05106	ITB3_HUMAN	L	505;458	ENSP00000407801:R458L	ENSP00000262017:R505L	R	+	2	0	C17orf57	42724757	0.000000	0.05858	0.304000	0.25085	0.884000	0.51177	-0.166000	0.09954	0.258000	0.21686	0.462000	0.41574	CGC	ITGB3	-	pirsf_Integrin_bsu	ENSG00000259207		0.627	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000416111.3		0.00	14	0	G	NM_000212		45369758	+1			no_errors	ENST00000559488	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.493	T
JSRP1	126306	genome.wustl.edu	37	19	2252589	2252589	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:2252589C>T	ENST00000300961.6	-	7	799	c.735G>A	c.(733-735)ccG>ccA	p.P245P	JSRP1_ENST00000586471.2_Silent_p.P245P|MIR4321_ENST00000592276.1_RNA	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	245	Arg-rich.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTCCTTCCGCGGCTTCCCCT	0.701																																																	0													34.0	43.0	40.0					19																	2252589		2199	4298	6497	SO:0001819	synonymous_variant	0			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.735G>A	19.37:g.2252589C>T				Silent	SNP	NULL	p.P245	ENST00000300961.6	37	c.735	CCDS12086.1	19																																																																																			JSRP1	-	NULL	ENSG00000167476		0.701	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	HGNC	protein_coding	OTTHUMT00000451266.2	-	0.00	44	0	C	NM_144616		2252589	-1	tier1	-	no_errors	ENST00000300961	ensembl	human	known	74_37	silent	30.91	38	17	SNP	0.000	T
JSRP1	126306	genome.wustl.edu	37	19	2252589	2252589	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:2252589C>T	ENST00000300961.6	-	7	799	c.735G>A	c.(733-735)ccG>ccA	p.P245P	JSRP1_ENST00000586471.2_Silent_p.P245P|MIR4321_ENST00000592276.1_RNA	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	245	Arg-rich.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTCCTTCCGCGGCTTCCCCT	0.701																																																	0													34.0	43.0	40.0					19																	2252589		2199	4298	6497	SO:0001819	synonymous_variant	0			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.735G>A	19.37:g.2252589C>T				Silent	SNP	NULL	p.P245	ENST00000300961.6	37	c.735	CCDS12086.1	19																																																																																			JSRP1	-	NULL	ENSG00000167476		0.701	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	HGNC	protein_coding	OTTHUMT00000451266.2	-	0.00	56	0	C	NM_144616		2252589	-1	tier1	-	no_errors	ENST00000300961	ensembl	human	known	74_37	silent	30.91	38	17	SNP	0.000	T
JUNB	3726	genome.wustl.edu	37	19	12903518	12903518	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:12903518G>T	ENST00000302754.4	+	1	1209	c.933G>T	c.(931-933)tcG>tcT	p.S311S		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	311	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CGGGGCTGTCGAGTACCGCCG	0.667																																																	0													23.0	24.0	24.0					19																	12903518		2198	4299	6497	SO:0001819	synonymous_variant	0			M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.933G>T	19.37:g.12903518G>T			Q96GH3	Silent	SNP	pfam_JNK,pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.S311	ENST00000302754.4	37	c.933	CCDS12280.1	19																																																																																			JUNB	-	pfam_bZIP,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	ENSG00000171223		0.667	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUNB	HGNC	protein_coding	OTTHUMT00000451015.1		0.00	40	0	G	NM_002229		12903518	+1			no_errors	ENST00000302754	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.849	T
KCNA5	3741	genome.wustl.edu	37	12	5154047	5154047	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:5154047G>C	ENST00000252321.3	+	1	963	c.734G>C	c.(733-735)aGc>aCc	p.S245T		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	245					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	TATCCGGAGAGCTCTGGGTCC	0.582																																																	0													101.0	111.0	108.0					12																	5154047		2203	4300	6503	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.734G>C	12.37:g.5154047G>C	ENSP00000252321:p.Ser245Thr		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S245T	ENST00000252321.3	37	c.734	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705150	0.48412	.	.	ENSG00000130037	ENST00000252321	T	0.65916	-0.18	4.77	4.77	0.60923	.	0.000000	0.85682	U	0.000000	T	0.65144	0.2663	M	0.74647	2.275	0.80722	D	1	B	0.19073	0.033	B	0.22880	0.042	T	0.65944	-0.6045	10	0.54805	T	0.06	.	16.9696	0.86295	0.0:0.0:1.0:0.0	.	245	P22460	KCNA5_HUMAN	T	245	ENSP00000252321:S245T	ENSP00000252321:S245T	S	+	2	0	KCNA5	5024308	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	9.569000	0.98170	2.478000	0.83669	0.561000	0.74099	AGC	KCNA5	-	prints_K_chnl,prints_K_chnl_volt-dep_Kv1	ENSG00000130037		0.582	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	49	0	G	NM_002234		5154047	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	26.56	47	17	SNP	1.000	C
KCNA5	3741	genome.wustl.edu	37	12	5154047	5154047	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:5154047G>C	ENST00000252321.3	+	1	963	c.734G>C	c.(733-735)aGc>aCc	p.S245T		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	245					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	TATCCGGAGAGCTCTGGGTCC	0.582																																																	0													101.0	111.0	108.0					12																	5154047		2203	4300	6503	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.734G>C	12.37:g.5154047G>C	ENSP00000252321:p.Ser245Thr		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S245T	ENST00000252321.3	37	c.734	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705150	0.48412	.	.	ENSG00000130037	ENST00000252321	T	0.65916	-0.18	4.77	4.77	0.60923	.	0.000000	0.85682	U	0.000000	T	0.65144	0.2663	M	0.74647	2.275	0.80722	D	1	B	0.19073	0.033	B	0.22880	0.042	T	0.65944	-0.6045	10	0.54805	T	0.06	.	16.9696	0.86295	0.0:0.0:1.0:0.0	.	245	P22460	KCNA5_HUMAN	T	245	ENSP00000252321:S245T	ENSP00000252321:S245T	S	+	2	0	KCNA5	5024308	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	9.569000	0.98170	2.478000	0.83669	0.561000	0.74099	AGC	KCNA5	-	prints_K_chnl,prints_K_chnl_volt-dep_Kv1	ENSG00000130037		0.582	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	86	0	G	NM_002234		5154047	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	26.56	47	17	SNP	1.000	C
KCNQ4	9132	genome.wustl.edu	37	1	41285870	41285870	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:41285870C>A	ENST00000347132.5	+	7	1061	c.979C>A	c.(979-981)Cag>Aag	p.Q327K	KCNQ4_ENST00000509682.2_Missense_Mutation_p.Q327K|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	327					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCTGAAGGTCCAGGAGCAGCA	0.622																																																	0													45.0	36.0	39.0					1																	41285870		2203	4300	6503	SO:0001583	missense	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.979C>A	1.37:g.41285870C>A	ENSP00000262916:p.Gln327Lys		O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.Q327K	ENST00000347132.5	37	c.979	CCDS456.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.400401|5.400401	0.96030|0.96030	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000443478|ENST00000347132;ENST00000509682	.|D;D	.|0.98914	.|-5.23;-5.19	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.056592	.|0.64402	.|D	.|0.000001	D|D	0.98855|0.98855	0.9613|0.9613	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;P	.|0.71674	.|0.998;0.951	.|D;P	.|0.64776	.|0.929;0.673	D|D	0.99785|0.99785	1.1029|1.1029	5|10	.|0.66056	.|D	.|0.02	-22.2164|-22.2164	16.7408|16.7408	0.85459|0.85459	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|327;327	.|P56696-2;P56696	.|.;KCNQ4_HUMAN	Q|K	222|327	.|ENSP00000262916:Q327K;ENSP00000423756:Q327K	.|ENSP00000262916:Q327K	P|Q	+|+	2|1	0|0	KCNQ4|KCNQ4	41058457|41058457	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.553000|2.553000	0.86117|0.86117	0.655000|0.655000	0.94253|0.94253	CCA|CAG	KCNQ4	-	NULL	ENSG00000117013		0.622	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	-	0.00	25	0	C	NM_004700		41285870	+1	tier1	-	no_errors	ENST00000347132	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	A
KCNQ4	9132	genome.wustl.edu	37	1	41285870	41285870	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:41285870C>A	ENST00000347132.5	+	7	1061	c.979C>A	c.(979-981)Cag>Aag	p.Q327K	KCNQ4_ENST00000509682.2_Missense_Mutation_p.Q327K|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	327					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	CCTGAAGGTCCAGGAGCAGCA	0.622																																																	0													45.0	36.0	39.0					1																	41285870		2203	4300	6503	SO:0001583	missense	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.979C>A	1.37:g.41285870C>A	ENSP00000262916:p.Gln327Lys		O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.Q327K	ENST00000347132.5	37	c.979	CCDS456.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.400401|5.400401	0.96030|0.96030	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000443478|ENST00000347132;ENST00000509682	.|D;D	.|0.98914	.|-5.23;-5.19	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.056592	.|0.64402	.|D	.|0.000001	D|D	0.98855|0.98855	0.9613|0.9613	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;P	.|0.71674	.|0.998;0.951	.|D;P	.|0.64776	.|0.929;0.673	D|D	0.99785|0.99785	1.1029|1.1029	5|10	.|0.66056	.|D	.|0.02	-22.2164|-22.2164	16.7408|16.7408	0.85459|0.85459	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|327;327	.|P56696-2;P56696	.|.;KCNQ4_HUMAN	Q|K	222|327	.|ENSP00000262916:Q327K;ENSP00000423756:Q327K	.|ENSP00000262916:Q327K	P|Q	+|+	2|1	0|0	KCNQ4|KCNQ4	41058457|41058457	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.553000|2.553000	0.86117|0.86117	0.655000|0.655000	0.94253|0.94253	CCA|CAG	KCNQ4	-	NULL	ENSG00000117013		0.622	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	-	0.00	29	0	C	NM_004700		41285870	+1	tier1	-	no_errors	ENST00000347132	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	A
KCTD8	386617	genome.wustl.edu	37	4	44449989	44449989	+	Silent	SNP	G	G	T	rs563973247		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:44449989G>T	ENST00000360029.3	-	1	835	c.552C>A	c.(550-552)gcC>gcA	p.A184A	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	184					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						agggcacggcggccgccgccc	0.736										HNSCC(17;0.042)																																							0													2.0	2.0	2.0					4																	44449989		1537	3033	4570	SO:0001819	synonymous_variant	0			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.552C>A	4.37:g.44449989G>T			A2RU39	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.A184	ENST00000360029.3	37	c.552	CCDS3467.1	4																																																																																			KCTD8	-	NULL	ENSG00000183783		0.736	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD8	HGNC	protein_coding	OTTHUMT00000216868.1		0.00	13	0	G			44449989	-1			no_errors	ENST00000360029	ensembl	human	known	74_37	silent	38.24	21	13	SNP	0.245	T
KDM2B	84678	genome.wustl.edu	37	12	121951122	121951122	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:121951122G>T	ENST00000377071.4	-	10	1203	c.1131C>A	c.(1129-1131)cgC>cgA	p.R377R	KDM2B_ENST00000538046.2_Silent_p.R287R|KDM2B_ENST00000377069.4_Silent_p.R346R|KDM2B_ENST00000536437.1_Silent_p.R260R	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	377					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TGAGGTGGGAGCGCTGGGTCA	0.547																																																	0													73.0	75.0	74.0					12																	121951122		2010	4162	6172	SO:0001819	synonymous_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1131C>A	12.37:g.121951122G>T			A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.R377	ENST00000377071.4	37	c.1131	CCDS41850.1	12																																																																																			KDM2B	-	NULL	ENSG00000089094		0.547	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	-	0.00	59	0	G	NM_032590		121951122	-1	tier1	-	no_errors	ENST00000377071	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.996	T
KIAA1107	23285	genome.wustl.edu	37	1	92642741	92642743	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:92642741_92642743delCAG	ENST00000370378.4	+	5	775_777	c.677_679delCAG	c.(676-681)acagca>aca	p.A231del	KIAA1107_ENST00000409154.4_In_Frame_Del_p.A286del	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	286										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						AGATcagcaacagcagcagcagc	0.433																																																	0										12,2778		4,4,1387						-10.1	0.0			80	36,5210		14,8,2601	no	coding	KIAA1107	NM_015237.2		18,12,3988	A1A1,A1R,RR		0.6862,0.4301,0.5973				48,7988				SO:0001651	inframe_deletion	0			AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.677_679delCAG	1.37:g.92642750_92642752delCAG	ENSP00000359404:p.Ala231del		O14767|Q8N3X7	In_Frame_Del	DEL	NULL	p.A285in_frame_del	ENST00000370378.4	37	c.842_844	CCDS44172.1	1																																																																																			KIAA1107	-	NULL	ENSG00000069712		0.433	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1107	HGNC	protein_coding	OTTHUMT00000028375.3		0.00	24	0	CAG	XM_034086		92642743	+1	tier1		no_errors	ENST00000409154	ensembl	human	known	74_37	in_frame_del	13.64	38	6	DEL	0.001:0.000:0.004	-
KIAA1107	23285	genome.wustl.edu	37	1	92642741	92642743	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:92642741_92642743delCAG	ENST00000370378.4	+	5	775_777	c.677_679delCAG	c.(676-681)acagca>aca	p.A231del	KIAA1107_ENST00000409154.4_In_Frame_Del_p.A286del	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	286										breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						AGATcagcaacagcagcagcagc	0.433																																																	0										12,2778		4,4,1387						-10.1	0.0			80	36,5210		14,8,2601	no	coding	KIAA1107	NM_015237.2		18,12,3988	A1A1,A1R,RR		0.6862,0.4301,0.5973				48,7988				SO:0001651	inframe_deletion	0			AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.677_679delCAG	1.37:g.92642750_92642752delCAG	ENSP00000359404:p.Ala231del		O14767|Q8N3X7	In_Frame_Del	DEL	NULL	p.A285in_frame_del	ENST00000370378.4	37	c.842_844	CCDS44172.1	1																																																																																			KIAA1107	-	NULL	ENSG00000069712		0.433	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1107	HGNC	protein_coding	OTTHUMT00000028375.3		0.00	35	0	CAG	XM_034086		92642743	+1	tier1		no_errors	ENST00000409154	ensembl	human	known	74_37	in_frame_del	13.64	38	6	DEL	0.001:0.000:0.004	-
KIF1B	23095	genome.wustl.edu	37	1	10364302	10364302	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:10364302G>T	ENST00000377086.1	+	22	2317				KIF1B_ENST00000377093.4_Missense_Mutation_p.W1020L|KIF1B_ENST00000377083.1_Missense_Mutation_p.W1020L|KIF1B_ENST00000263934.6_Intron|RN7SL731P_ENST00000584329.1_RNA|KIF1B_ENST00000377081.1_Intron			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CAGTTTCCATGGGGCTCTCAA	0.438																																																	0													143.0	150.0	148.0					1																	10364302		2203	4300	6503	SO:0001627	intron_variant	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2115+6998G>T	1.37:g.10364302G>T			A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.W1020L	ENST00000377086.1	37	c.3059		1	.	.	.	.	.	.	.	.	.	.	G	4.362	0.066748	0.08388	.	.	ENSG00000054523	ENST00000377093;ENST00000377083	T;T	0.71461	-0.57;-0.57	5.72	4.81	0.61882	.	.	.	.	.	T	0.57710	0.2072	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.52177	-0.8610	8	0.13853	T	0.58	.	16.195	0.82021	0.0:0.1475:0.8525:0.0	.	1020	O60333-3	.	L	1020	ENSP00000366297:W1020L;ENSP00000366287:W1020L	ENSP00000366287:W1020L	W	+	2	0	KIF1B	10286889	1.000000	0.71417	0.905000	0.35620	0.971000	0.66376	3.789000	0.55454	1.404000	0.46819	0.655000	0.94253	TGG	KIF1B	-	NULL	ENSG00000054523		0.438	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	56	0	G			10364302	+1	tier1	-	no_errors	ENST00000377083	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KIF1B	23095	genome.wustl.edu	37	1	10364302	10364302	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:10364302G>T	ENST00000377086.1	+	22	2317				KIF1B_ENST00000377093.4_Missense_Mutation_p.W1020L|KIF1B_ENST00000377083.1_Missense_Mutation_p.W1020L|KIF1B_ENST00000263934.6_Intron|RN7SL731P_ENST00000584329.1_RNA|KIF1B_ENST00000377081.1_Intron			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CAGTTTCCATGGGGCTCTCAA	0.438																																																	0													143.0	150.0	148.0					1																	10364302		2203	4300	6503	SO:0001627	intron_variant	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2115+6998G>T	1.37:g.10364302G>T			A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.W1020L	ENST00000377086.1	37	c.3059		1	.	.	.	.	.	.	.	.	.	.	G	4.362	0.066748	0.08388	.	.	ENSG00000054523	ENST00000377093;ENST00000377083	T;T	0.71461	-0.57;-0.57	5.72	4.81	0.61882	.	.	.	.	.	T	0.57710	0.2072	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.52177	-0.8610	8	0.13853	T	0.58	.	16.195	0.82021	0.0:0.1475:0.8525:0.0	.	1020	O60333-3	.	L	1020	ENSP00000366297:W1020L;ENSP00000366287:W1020L	ENSP00000366287:W1020L	W	+	2	0	KIF1B	10286889	1.000000	0.71417	0.905000	0.35620	0.971000	0.66376	3.789000	0.55454	1.404000	0.46819	0.655000	0.94253	TGG	KIF1B	-	NULL	ENSG00000054523		0.438	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	64	0	G			10364302	+1	tier1	-	no_errors	ENST00000377083	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KIF2B	84643	genome.wustl.edu	37	17	51900977	51900977	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:51900977C>T	ENST00000268919.4	+	1	739	c.583C>T	c.(583-585)Cgc>Tgc	p.R195C		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	195					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CGAAGAGTATCGCAGGCACCT	0.577																																																	0													75.0	63.0	67.0					17																	51900977		2203	4300	6503	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.583C>T	17.37:g.51900977C>T	ENSP00000268919:p.Arg195Cys		Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R195C	ENST00000268919.4	37	c.583	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341723	0.61073	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.18338	2.22	5.37	5.37	0.77165	.	0.000000	0.51477	D	0.000095	T	0.41096	0.1144	M	0.68317	2.08	0.47659	D	0.999481	D	0.89917	1.0	D	0.87578	0.998	T	0.13282	-1.0515	10	0.62326	D	0.03	.	15.6128	0.76740	0.0:0.8624:0.1376:0.0	.	195	Q8N4N8	KIF2B_HUMAN	C	195;118	ENSP00000268919:R195C	ENSP00000268919:R195C	R	+	1	0	KIF2B	49255976	1.000000	0.71417	0.968000	0.41197	0.781000	0.44180	2.293000	0.43558	2.659000	0.90383	0.655000	0.94253	CGC	KIF2B	-	superfamily_P-loop_NTPase	ENSG00000141200		0.577	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	-	0.00	28	0	C	NM_032559		51900977	+1	tier1	-	no_errors	ENST00000268919	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
KIF2B	84643	genome.wustl.edu	37	17	51900977	51900977	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:51900977C>T	ENST00000268919.4	+	1	739	c.583C>T	c.(583-585)Cgc>Tgc	p.R195C		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	195					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CGAAGAGTATCGCAGGCACCT	0.577																																																	0													75.0	63.0	67.0					17																	51900977		2203	4300	6503	SO:0001583	missense	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.583C>T	17.37:g.51900977C>T	ENSP00000268919:p.Arg195Cys		Q96MA2|Q9BXG6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R195C	ENST00000268919.4	37	c.583	CCDS32685.1	17	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341723	0.61073	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.18338	2.22	5.37	5.37	0.77165	.	0.000000	0.51477	D	0.000095	T	0.41096	0.1144	M	0.68317	2.08	0.47659	D	0.999481	D	0.89917	1.0	D	0.87578	0.998	T	0.13282	-1.0515	10	0.62326	D	0.03	.	15.6128	0.76740	0.0:0.8624:0.1376:0.0	.	195	Q8N4N8	KIF2B_HUMAN	C	195;118	ENSP00000268919:R195C	ENSP00000268919:R195C	R	+	1	0	KIF2B	49255976	1.000000	0.71417	0.968000	0.41197	0.781000	0.44180	2.293000	0.43558	2.659000	0.90383	0.655000	0.94253	CGC	KIF2B	-	superfamily_P-loop_NTPase	ENSG00000141200		0.577	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	-	0.00	38	0	C	NM_032559		51900977	+1	tier1	-	no_errors	ENST00000268919	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
KIT	3815	genome.wustl.edu	37	4	55564477	55564477	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:55564477G>A	ENST00000288135.5	+	3	462	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	122	Ig-like C2-type 2.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTGTTGACCGCTCCTTGTAT	0.473		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													40.0	36.0	38.0					4																	55564477		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.365G>A	4.37:g.55564477G>A	ENSP00000288135:p.Arg122His		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R122H	ENST00000288135.5	37	c.365	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156258	0.38021	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.76709	-1.04;-1.04	5.56	-3.9	0.04181	Immunoglobulin-like fold (1);	1.290390	0.05271	N	0.517508	T	0.53012	0.1770	N	0.22421	0.69	0.09310	N	1	B;P	0.35807	0.319;0.522	B;B	0.27076	0.024;0.076	T	0.44081	-0.9351	10	0.15499	T	0.54	.	2.695	0.05132	0.146:0.2555:0.442:0.1565	.	122;122	P10721-2;P10721	.;KIT_HUMAN	H	122	ENSP00000288135:R122H;ENSP00000390987:R122H	ENSP00000288135:R122H	R	+	2	0	KIT	55259234	0.000000	0.05858	0.000000	0.03702	0.619000	0.37552	-0.407000	0.07178	-0.156000	0.11079	0.561000	0.74099	CGC	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.473	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1		0.00	39	0	G			55564477	+1			no_errors	ENST00000288135	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.000	A
KLHDC10	23008	genome.wustl.edu	37	7	129756388	129756388	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:129756388G>T	ENST00000335420.5	+	3	491	c.357G>T	c.(355-357)ggG>ggT	p.G119G	KLHDC10_ENST00000495724.1_3'UTR	NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	119						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						AATCGGGAGGGCCTGATAATG	0.488																																																	0													151.0	132.0	139.0					7																	129756388		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.357G>T	7.37:g.129756388G>T			Q86Y99|Q92554	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1	p.G119	ENST00000335420.5	37	c.357	CCDS5815.1	7																																																																																			KLHDC10	-	pfam_Kelch_1	ENSG00000128607		0.488	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC10	HGNC	protein_coding	OTTHUMT00000349347.2	-	0.00	51	0	G			129756388	+1	tier1	-	no_errors	ENST00000335420	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
KLHL1	57626	genome.wustl.edu	37	13	70681620	70681620	+	Missense_Mutation	SNP	T	T	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:70681620T>A	ENST00000377844.4	-	1	971	c.212A>T	c.(211-213)aAg>aTg	p.K71M	ATXN8OS_ENST00000414504.2_RNA|KLHL1_ENST00000545028.1_De_novo_Start_InFrame|ATXN8OS_ENST00000424524.1_RNA	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	71	Ser-rich.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ggaggaagGCTTCTTCCAGAA	0.582																																																	0													86.0	93.0	91.0					13																	70681620		2203	4300	6503	SO:0001583	missense	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.212A>T	13.37:g.70681620T>A	ENSP00000367075:p.Lys71Met		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.K71M	ENST00000377844.4	37	c.212	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	T	12.99	2.102147	0.37048	.	.	ENSG00000150361	ENST00000377844	T	0.77229	-1.08	5.41	5.41	0.78517	.	1.484060	0.04154	N	0.321777	T	0.73369	0.3578	L	0.44542	1.39	0.80722	D	1	P;P	0.38642	0.511;0.641	B;B	0.34722	0.087;0.188	T	0.64816	-0.6318	10	0.87932	D	0	.	9.3726	0.38264	0.0:0.0802:0.0:0.9198	.	71;71	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	M	71	ENSP00000367075:K71M	ENSP00000367075:K71M	K	-	2	0	KLHL1	69579621	1.000000	0.71417	0.994000	0.49952	0.792000	0.44763	3.713000	0.54882	2.062000	0.61559	0.529000	0.55759	AAG	KLHL1	-	NULL	ENSG00000150361		0.582	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	-	0.00	35	0	T	NM_020866		70681620	-1	tier1	-	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	28.57	45	18	SNP	0.982	A
KLHL28	54813	genome.wustl.edu	37	14	45400541	45400541	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:45400541C>A	ENST00000396128.4	-	4	1666	c.1547G>T	c.(1546-1548)aGa>aTa	p.R516I	KLHL28_ENST00000355081.2_Missense_Mutation_p.R530I	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	516								p.R516T(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ATTACCTGTTCTAGGTTCTTT	0.358																																																	1	Substitution - Missense(1)	lung(1)											65.0	61.0	62.0					14																	45400541		2203	4300	6503	SO:0001583	missense	0			AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1547G>T	14.37:g.45400541C>A	ENSP00000379434:p.Arg516Ile		Q0VAL5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R516I	ENST00000396128.4	37	c.1547	CCDS9680.1	14	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682771	0.88542	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	D;D	0.85171	-1.95;-1.95	4.82	4.82	0.62117	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.95560	0.8557	H	0.98426	4.23	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	D	0.97612	1.0130	10	0.87932	D	0	.	17.8685	0.88803	0.0:1.0:0.0:0.0	.	516	Q9NXS3	KLH28_HUMAN	I	516;530	ENSP00000379434:R516I;ENSP00000347193:R530I	ENSP00000347193:R530I	R	-	2	0	KLHL28	44470291	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.411000	0.80078	2.397000	0.81536	0.557000	0.71058	AGA	KLHL28	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000179454		0.358	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3		0.00	36	0	C			45400541	-1			no_errors	ENST00000396128	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	A
KMT2E	55904	genome.wustl.edu	37	7	104717408	104717408	+	Splice_Site	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:104717408A>T	ENST00000311117.3	+	10	1313		c.e10-1		KMT2E_ENST00000334914.7_Splice_Site|KMT2E_ENST00000257745.4_Splice_Site|KMT2E_ENST00000476671.1_Splice_Site|KMT2E_ENST00000334877.4_Splice_Site	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTATGATTTTAGGGTTCAGCT	0.408																																																	0													75.0	73.0	74.0					7																	104717408		2203	4300	6503	SO:0001630	splice_region_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.769-1A>T	7.37:g.104717408A>T			B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Splice_Site	SNP	-	e8-2	ENST00000311117.3	37	c.769-2	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243240	0.79912	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MLL5	104504644	1.000000	0.71417	0.997000	0.53966	0.917000	0.54804	8.654000	0.91092	2.326000	0.78906	0.533000	0.62120	.	KMT2E	-	-	ENSG00000005483		0.408	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1		0.00	18	0	A		Intron	104717408	+1			no_errors	ENST00000257745	ensembl	human	known	74_37	splice_site	6.90	27	2	SNP	1.000	T
KREMEN1	83999	genome.wustl.edu	37	22	29534726	29534726	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:29534726A>G	ENST00000407188.1	+	7	1073	c.1073A>G	c.(1072-1074)tAt>tGt	p.Y358C	KREMEN1_ENST00000327813.5_Missense_Mutation_p.Y360C|KREMEN1_ENST00000400335.4_Missense_Mutation_p.Y360C|KREMEN1_ENST00000400338.2_Missense_Mutation_p.Y360C			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	358					cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						AAAGTCCTCTATGTCATCACC	0.632																																																	0													70.0	81.0	77.0					22																	29534726		2044	4192	6236	SO:0001583	missense	0			AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.1073A>G	22.37:g.29534726A>G	ENSP00000385431:p.Tyr358Cys		B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Missense_Mutation	SNP	pirsf_Kremen,pfam_Kringle,pfam_WSC_carb-bd,pfam_CUB_dom,superfamily_Kringle-like,superfamily_CUB_dom,superfamily_Scorpion_toxin-like,smart_Kringle,smart_WSC_carb-bd_subgr,smart_CUB_dom,pfscan_CUB_dom,pfscan_Kringle,pfscan_WSC_carb-bd	p.Y360C	ENST00000407188.1	37	c.1079	CCDS43000.2	22	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445941	0.84101	.	.	ENSG00000183762	ENST00000400335;ENST00000400338;ENST00000327813;ENST00000407188	T;T;T;T	0.62639	0.09;0.01;0.01;0.01	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000030	T	0.68476	0.3005	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.997	T	0.69045	-0.5249	10	0.44086	T	0.13	.	13.609	0.62065	1.0:0.0:0.0:0.0	.	358;360;360	Q96MU8;Q96MU8-2;Q96MU8-3	KREM1_HUMAN;.;.	C	360;360;360;358	ENSP00000383189:Y360C;ENSP00000383192:Y360C;ENSP00000331242:Y360C;ENSP00000385431:Y358C	ENSP00000331242:Y360C	Y	+	2	0	KREMEN1	27864726	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	7.702000	0.84576	2.172000	0.68678	0.533000	0.62120	TAT	KREMEN1	-	pirsf_Kremen	ENSG00000183762		0.632	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	KREMEN1	HGNC	protein_coding	OTTHUMT00000320947.1	-	0.00	73	0	A			29534726	+1	tier1	-	no_errors	ENST00000327813	ensembl	human	known	74_37	missense	29.29	69	29	SNP	1.000	G
KRT85	3891	genome.wustl.edu	37	12	52757081	52757081	+	Silent	SNP	G	G	A	rs372918365		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:52757081G>A	ENST00000257901.3	-	5	975	c.900C>T	c.(898-900)gaC>gaT	p.D300D	KRT85_ENST00000544265.1_Silent_p.D88D	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	300	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.D300D(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGCAACATCGTCATACTGAG	0.577																																																	1	Substitution - coding silent(1)	endometrium(1)						G		0,4406		0,0,2203	115.0	82.0	93.0		900	-8.6	0.8	12		93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT85	NM_002283.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		300/508	52757081	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.900C>T	12.37:g.52757081G>A			Q9NSB1	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.D300	ENST00000257901.3	37	c.900	CCDS8824.1	12																																																																																			KRT85	-	pfam_IF	ENSG00000135443		0.577	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	-	0.00	38	0	G	NM_002283		52757081	-1	tier1	-	no_errors	ENST00000257901	ensembl	human	known	74_37	silent	39.66	35	23	SNP	0.833	A
KRT85	3891	genome.wustl.edu	37	12	52757081	52757081	+	Silent	SNP	G	G	A	rs372918365		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:52757081G>A	ENST00000257901.3	-	5	975	c.900C>T	c.(898-900)gaC>gaT	p.D300D	KRT85_ENST00000544265.1_Silent_p.D88D	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	300	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.D300D(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGCAACATCGTCATACTGAG	0.577																																																	1	Substitution - coding silent(1)	endometrium(1)						G		0,4406		0,0,2203	115.0	82.0	93.0		900	-8.6	0.8	12		93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT85	NM_002283.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		300/508	52757081	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.900C>T	12.37:g.52757081G>A			Q9NSB1	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.D300	ENST00000257901.3	37	c.900	CCDS8824.1	12																																																																																			KRT85	-	pfam_IF	ENSG00000135443		0.577	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	-	0.00	81	0	G	NM_002283		52757081	-1	tier1	-	no_errors	ENST00000257901	ensembl	human	known	74_37	silent	39.66	35	23	SNP	0.833	A
KRTAP13-2	337959	genome.wustl.edu	37	21	31744209	31744209	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr21:31744209C>T	ENST00000399889.2	-	1	348	c.323G>A	c.(322-324)cGc>cAc	p.R108H		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	108						intermediate filament (GO:0005882)		p.R108P(1)		endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						GCCCAGGGAGCGGCAGCTGCT	0.607																																																	1	Substitution - Missense(1)	lung(1)											48.0	49.0	48.0					21																	31744209		2203	4300	6503	SO:0001583	missense	0			AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.323G>A	21.37:g.31744209C>T	ENSP00000382777:p.Arg108His			Missense_Mutation	SNP	pfam_KRTAP_PMG	p.R108H	ENST00000399889.2	37	c.323	CCDS13589.1	21	.	.	.	.	.	.	.	.	.	.	C	0.766	-0.767386	0.02974	.	.	ENSG00000182816	ENST00000399889	T	0.03358	3.96	4.48	1.15	0.20763	.	1.529090	0.04771	N	0.427941	T	0.03477	0.0100	L	0.37466	1.105	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.48293	-0.9048	10	0.13470	T	0.59	.	3.7238	0.08467	0.0:0.5126:0.1994:0.288	.	108	Q52LG2	KR132_HUMAN	H	108	ENSP00000382777:R108H	ENSP00000382777:R108H	R	-	2	0	KRTAP13-2	30666080	0.000000	0.05858	0.001000	0.08648	0.695000	0.40330	-1.349000	0.02627	0.068000	0.16574	-0.251000	0.11542	CGC	KRTAP13-2	-	pfam_KRTAP_PMG	ENSG00000182816		0.607	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-2	HGNC	protein_coding	OTTHUMT00000128245.1		0.00	34	0	C			31744209	-1			no_errors	ENST00000399889	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.009	T
LAIR2	3904	genome.wustl.edu	37	19	55019195	55019195	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:55019195G>T	ENST00000301202.2	+	3	282	c.160G>T	c.(160-162)Ggg>Tgg	p.G54W	LAIR2_ENST00000351841.2_Missense_Mutation_p.G54W	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	54	Ig-like C2-type.					extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		GGGCCCGGTTGGGGTTCAAAC	0.557																																																	0													91.0	95.0	93.0					19																	55019195		2203	4300	6503	SO:0001583	missense	0			AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.160G>T	19.37:g.55019195G>T	ENSP00000301202:p.Gly54Trp		Q6PEZ4	Missense_Mutation	SNP	smart_Ig_sub	p.G54W	ENST00000301202.2	37	c.160	CCDS12897.1	19	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298210	0.40694	.	.	ENSG00000167618	ENST00000412608;ENST00000452094;ENST00000301202;ENST00000351841	T;T;T	0.23348	1.91;2.69;2.69	3.51	-1.91	0.07641	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.804100	0.03031	N	0.152127	T	0.45458	0.1343	M	0.76002	2.32	0.09310	N	1	P;D;D	0.89917	0.925;1.0;1.0	P;D;D	0.97110	0.852;1.0;1.0	T	0.37407	-0.9707	10	0.66056	D	0.02	.	0.865	0.01202	0.2282:0.1812:0.4054:0.1853	.	48;54;54	C9JFQ0;Q6ISS4-2;Q6ISS4	.;.;LAIR2_HUMAN	W	48;36;54;54	ENSP00000390729:G48W;ENSP00000301202:G54W;ENSP00000301203:G54W	ENSP00000301202:G54W	G	+	1	0	LAIR2	59711007	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.064000	0.14437	-0.334000	0.08463	0.462000	0.41574	GGG	LAIR2	-	smart_Ig_sub	ENSG00000167618		0.557	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR2	HGNC	protein_coding	OTTHUMT00000140801.1	-	0.00	29	0	G			55019195	+1	tier1	-	no_errors	ENST00000301202	ensembl	human	known	74_37	missense	35.14	24	13	SNP	0.000	T
LAMA4	3910	genome.wustl.edu	37	6	112462605	112462605	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:112462605G>T	ENST00000230538.7	-	21	3165	c.2768C>A	c.(2767-2769)cCc>cAc	p.P923H	LAMA4_ENST00000424408.2_Missense_Mutation_p.P916H|LAMA4_ENST00000522006.1_Missense_Mutation_p.P916H|LAMA4_ENST00000389463.4_Missense_Mutation_p.P916H	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	923	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGAACTGACGGGCTTGGAGTC	0.418																																																	0													121.0	120.0	120.0					6																	112462605		2203	4300	6503	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2768C>A	6.37:g.112462605G>T	ENSP00000230538:p.Pro923His		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.P923H	ENST00000230538.7	37	c.2768	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804398	0.90623	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.66	5.66	0.87406	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52283	-0.8596	10	0.59425	D	0.04	.	19.8315	0.96638	0.0:0.0:1.0:0.0	.	923;916	Q16363;Q16363-2	LAMA4_HUMAN;.	H	923;916;916;916	ENSP00000230538:P923H;ENSP00000429488:P916H;ENSP00000374114:P916H;ENSP00000416470:P916H	ENSP00000230538:P923H	P	-	2	0	LAMA4	112569298	1.000000	0.71417	0.995000	0.50966	0.940000	0.58332	9.387000	0.97232	2.682000	0.91365	0.552000	0.68991	CCC	LAMA4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000112769		0.418	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	27	0	G	NM_001105206		112462605	-1	tier1	-	no_errors	ENST00000230538	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
LAMA4	3910	genome.wustl.edu	37	6	112462605	112462605	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:112462605G>T	ENST00000230538.7	-	21	3165	c.2768C>A	c.(2767-2769)cCc>cAc	p.P923H	LAMA4_ENST00000424408.2_Missense_Mutation_p.P916H|LAMA4_ENST00000522006.1_Missense_Mutation_p.P916H|LAMA4_ENST00000389463.4_Missense_Mutation_p.P916H	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	923	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGAACTGACGGGCTTGGAGTC	0.418																																																	0													121.0	120.0	120.0					6																	112462605		2203	4300	6503	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2768C>A	6.37:g.112462605G>T	ENSP00000230538:p.Pro923His		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.P923H	ENST00000230538.7	37	c.2768	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804398	0.90623	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.66	5.66	0.87406	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52283	-0.8596	10	0.59425	D	0.04	.	19.8315	0.96638	0.0:0.0:1.0:0.0	.	923;916	Q16363;Q16363-2	LAMA4_HUMAN;.	H	923;916;916;916	ENSP00000230538:P923H;ENSP00000429488:P916H;ENSP00000374114:P916H;ENSP00000416470:P916H	ENSP00000230538:P923H	P	-	2	0	LAMA4	112569298	1.000000	0.71417	0.995000	0.50966	0.940000	0.58332	9.387000	0.97232	2.682000	0.91365	0.552000	0.68991	CCC	LAMA4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000112769		0.418	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	40	0	G	NM_001105206		112462605	-1	tier1	-	no_errors	ENST00000230538	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
LAMC1	3915	genome.wustl.edu	37	1	183094558	183094558	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:183094558A>T	ENST00000258341.4	+	15	2931	c.2674A>T	c.(2674-2676)Atg>Ttg	p.M892L	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	892	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GTATGGGACCATGAAGCAGCA	0.478																																																	0													144.0	120.0	128.0					1																	183094558		2203	4300	6503	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2674A>T	1.37:g.183094558A>T	ENSP00000258341:p.Met892Leu		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.M892L	ENST00000258341.4	37	c.2674	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	a	12.69	2.014349	0.35511	.	.	ENSG00000135862	ENST00000258341	T	0.50548	0.74	5.64	-0.592	0.11671	EGF-like, laminin (3);	0.430280	0.26662	N	0.023154	T	0.10078	0.0247	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.15066	T	0.55	.	5.9624	0.19307	0.3983:0.0:0.4851:0.1166	.	892	P11047	LAMC1_HUMAN	L	892	ENSP00000258341:M892L	ENSP00000258341:M892L	M	+	1	0	LAMC1	181361181	0.911000	0.30947	0.000000	0.03702	0.183000	0.23260	1.444000	0.35068	-0.396000	0.07703	-0.140000	0.14226	ATG	LAMC1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000135862		0.478	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	-	0.00	40	0	A	NM_002293		183094558	+1	tier1	-	no_errors	ENST00000258341	ensembl	human	known	74_37	missense	32.08	36	17	SNP	0.002	T
LAMC1	3915	genome.wustl.edu	37	1	183094558	183094558	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:183094558A>T	ENST00000258341.4	+	15	2931	c.2674A>T	c.(2674-2676)Atg>Ttg	p.M892L	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	892	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GTATGGGACCATGAAGCAGCA	0.478																																																	0													144.0	120.0	128.0					1																	183094558		2203	4300	6503	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2674A>T	1.37:g.183094558A>T	ENSP00000258341:p.Met892Leu		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.M892L	ENST00000258341.4	37	c.2674	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	a	12.69	2.014349	0.35511	.	.	ENSG00000135862	ENST00000258341	T	0.50548	0.74	5.64	-0.592	0.11671	EGF-like, laminin (3);	0.430280	0.26662	N	0.023154	T	0.10078	0.0247	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.15066	T	0.55	.	5.9624	0.19307	0.3983:0.0:0.4851:0.1166	.	892	P11047	LAMC1_HUMAN	L	892	ENSP00000258341:M892L	ENSP00000258341:M892L	M	+	1	0	LAMC1	181361181	0.911000	0.30947	0.000000	0.03702	0.183000	0.23260	1.444000	0.35068	-0.396000	0.07703	-0.140000	0.14226	ATG	LAMC1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000135862		0.478	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	-	0.00	83	0	A	NM_002293		183094558	+1	tier1	-	no_errors	ENST00000258341	ensembl	human	known	74_37	missense	32.08	36	17	SNP	0.002	T
LAS1L	81887	genome.wustl.edu	37	X	64738220	64738220	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:64738220A>G	ENST00000374811.3	-	12	1614	c.1574T>C	c.(1573-1575)aTt>aCt	p.I525T	LAS1L_ENST00000374807.5_Missense_Mutation_p.I508T|LAS1L_ENST00000374804.5_Missense_Mutation_p.I466T|LAS1L_ENST00000312391.8_3'UTR	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	525					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						AGACTTCCCAATGGGGGAGGC	0.572																																																	0													71.0	68.0	69.0					X																	64738220		2203	4300	6503	SO:0001583	missense	0			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1574T>C	X.37:g.64738220A>G	ENSP00000363944:p.Ile525Thr		A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	pfam_Las1	p.I525T	ENST00000374811.3	37	c.1574	CCDS14381.1	X	.	.	.	.	.	.	.	.	.	.	A	12.57	1.977063	0.34848	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804	.	.	.	4.77	-2.8	0.05823	.	0.798338	0.11254	N	0.583296	T	0.12646	0.0307	N	0.16307	0.4	0.09310	N	1	B;B;B;B	0.14805	0.007;0.003;0.01;0.011	B;B;B;B	0.14023	0.003;0.008;0.006;0.01	T	0.31668	-0.9935	9	0.02654	T	1	.	0.0755	0.00026	0.294:0.1649:0.214:0.3272	.	466;508;525;38	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2;B3KNR6	.;.;LAS1L_HUMAN;.	T	508;525;466	.	ENSP00000363937:I466T	I	-	2	0	LAS1L	64654945	0.000000	0.05858	0.167000	0.22817	0.965000	0.64279	-0.247000	0.08866	-0.234000	0.09782	0.381000	0.24937	ATT	LAS1L	-	NULL	ENSG00000001497		0.572	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAS1L	HGNC	protein_coding	OTTHUMT00000056974.1	-	0.00	36	0	A	NM_031206		64738220	-1	tier1	-	no_errors	ENST00000374811	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.000	G
LAT	27040	genome.wustl.edu	37	16	28997469	28997469	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:28997469C>A	ENST00000360872.5	+	4	255	c.177C>A	c.(175-177)ccC>ccA	p.P59P	LAT_ENST00000566177.1_Silent_p.P59P|LAT_ENST00000395461.3_Silent_p.P95P|LAT_ENST00000564277.1_Silent_p.P59P|RP11-264B17.3_ENST00000569969.1_RNA|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000563964.1_Intron|LAT_ENST00000354453.4_Silent_p.P59P|LAT_ENST00000395456.2_Silent_p.P59P|LAT_ENST00000454369.2_Silent_p.P59P			O43561	LAT_HUMAN	linker for activation of T cells	59					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CGGTTGCCCCCTGGCCACCTG	0.607																																																	0													104.0	100.0	101.0					16																	28997469		2197	4300	6497	SO:0001819	synonymous_variant	0			AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.177C>A	16.37:g.28997469C>A			B7WPI0|C7C5T6|G5E9K3|O43919	Silent	SNP	prints_Linker_for_activat_Tcells_prot	p.P95	ENST00000360872.5	37	c.285	CCDS10647.1	16																																																																																			LAT	-	NULL	ENSG00000213658		0.607	LAT-001	KNOWN	basic|CCDS	protein_coding	LAT	HGNC	protein_coding	OTTHUMT00000254688.2	-	0.00	41	0	C			28997469	+1	tier1	-	no_errors	ENST00000395461	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.000	A
LCP2	3937	genome.wustl.edu	37	5	169685150	169685150	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:169685150G>T	ENST00000046794.5	-	16	1606	c.991C>A	c.(991-993)Cag>Aag	p.Q331K	LCP2_ENST00000521416.1_Missense_Mutation_p.Q126K	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	331					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		AGTGCTGGCTGGGGCAAAGGT	0.502																																																	0													181.0	180.0	180.0					5																	169685150		1950	4146	6096	SO:0001583	missense	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.991C>A	5.37:g.169685150G>T	ENSP00000046794:p.Gln331Lys		A8KA25|Q53XV4	Missense_Mutation	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.Q331K	ENST00000046794.5	37	c.991	CCDS47339.1	5	.	.	.	.	.	.	.	.	.	.	G	15.14	2.743804	0.49151	.	.	ENSG00000043462	ENST00000046794;ENST00000521416;ENST00000520344	T;T	0.44881	0.92;0.91	5.72	5.72	0.89469	.	0.209904	0.41938	D	0.000798	T	0.38639	0.1048	L	0.53249	1.67	0.41128	D	0.985867	B;B	0.32717	0.381;0.267	B;B	0.26517	0.07;0.05	T	0.14504	-1.0470	9	.	.	.	-5.9745	16.9613	0.86273	0.0:0.0:1.0:0.0	.	126;331	E7ESF6;Q13094	.;LCP2_HUMAN	K	331;126;98	ENSP00000046794:Q331K;ENSP00000428871:Q126K	.	Q	-	1	0	LCP2	169617728	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.895000	0.69814	2.865000	0.98341	0.655000	0.94253	CAG	LCP2	-	NULL	ENSG00000043462		0.502	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1		0.00	26	0	G	NM_005565		169685150	-1			no_errors	ENST00000046794	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
LOC100190940	100190940	genome.wustl.edu	37	12	130521234	130521235	+	lincRNA	INS	-	-	AA	rs386378253|rs386378254|rs34472041|rs200802994	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:130521234_130521235insAA	ENST00000567788.1	-	0	1466_1467				RP11-474D1.4_ENST00000561864.1_lincRNA																							gactctgtctcaaaaaaaaaag	0.431																																																	0																																												0																															12.37:g.130521243_130521244dupAA				RNA	INS	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			RP11-474D1.3	-	-	ENSG00000214039		0.431	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1		0.00	10	0	-			130521235	-1	tier1		no_errors	ENST00000291374	ensembl	human	known	74_37	rna	28.57	10	4	INS	0.029:0.046	AA
LOXL4	84171	genome.wustl.edu	37	10	100020863	100020863	+	Silent	SNP	G	G	T	rs201595099		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:100020863G>T	ENST00000260702.3	-	4	628	c.478C>A	c.(478-480)Cgg>Agg	p.R160R		NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	160	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GGCTTGAGCCGCACCTCCTCC	0.652																																																	0													61.0	50.0	54.0					10																	100020863		2203	4300	6503	SO:0001819	synonymous_variant	0			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.478C>A	10.37:g.100020863G>T			Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.R160	ENST00000260702.3	37	c.478	CCDS7473.1	10																																																																																			LOXL4	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000138131		0.652	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	HGNC	protein_coding	OTTHUMT00000049766.1	-	0.00	41	0	G	NM_032211		100020863	-1	tier1	-	no_errors	ENST00000260702	ensembl	human	known	74_37	silent	18.18	36	8	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	142012201	142012201	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:142012201G>T	ENST00000389484.3	-	4	1324	c.353C>A	c.(352-354)tCc>tAc	p.S118Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	118	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTGGCAATTGGATAACAGTTC	0.313										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													106.0	94.0	98.0					2																	142012201		2201	4297	6498	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.353C>A	2.37:g.142012201G>T	ENSP00000374135:p.Ser118Tyr		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S118Y	ENST00000389484.3	37	c.353	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	5.287	0.238298	0.10023	.	.	ENSG00000168702	ENST00000389484	D	0.97598	-4.45	5.52	4.64	0.57946	Growth factor, receptor (1);	0.643151	0.14998	U	0.286264	D	0.92041	0.7478	N	0.08118	0	0.09310	N	0.999998	B	0.18863	0.031	B	0.17098	0.017	D	0.84339	0.0526	10	0.41790	T	0.15	.	14.0678	0.64841	0.0726:0.0:0.9274:0.0	.	118	Q9NZR2	LRP1B_HUMAN	Y	118	ENSP00000374135:S118Y	ENSP00000374135:S118Y	S	-	2	0	LRP1B	141728671	0.997000	0.39634	0.571000	0.28486	0.134000	0.20937	4.605000	0.61119	1.321000	0.45227	0.467000	0.42956	TCC	LRP1B	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000168702		0.313	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2		0.00	18	0	G	NM_018557		142012201	-1			no_errors	ENST00000389484	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.027	T
LRRIQ1	84125	genome.wustl.edu	37	12	85638646	85638646	+	Missense_Mutation	SNP	A	A	G	rs5799725|rs398102301	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:85638646A>G	ENST00000393217.2	+	27	5157	c.5096A>G	c.(5095-5097)gAa>gGa	p.E1699G	LRRIQ1_ENST00000528777.3_3'UTR	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1699										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTGAACAGAGAAAAAAAAAAT	0.388																																																	0													79.0	61.0	67.0					12																	85638646		1828	4079	5907	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.5096A>G	12.37:g.85638646A>G	ENSP00000376910:p.Glu1699Gly		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E1699G	ENST00000393217.2	37	c.5096	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	13.97	2.394556	0.42512	.	.	ENSG00000133640	ENST00000393217	T	0.53206	0.63	5.9	4.77	0.60923	.	.	.	.	.	T	0.31199	0.0789	N	0.14661	0.345	0.26791	N	0.969395	B	0.30664	0.289	B	0.28784	0.094	T	0.22871	-1.0204	9	0.87932	D	0	.	10.1042	0.42524	0.9251:0.0:0.0749:0.0	.	1699	Q96JM4	LRIQ1_HUMAN	G	1699	ENSP00000376910:E1699G	ENSP00000376910:E1699G	E	+	2	0	LRRIQ1	84162777	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.991000	0.49409	2.254000	0.74563	0.460000	0.39030	GAA	LRRIQ1	-	NULL	ENSG00000133640		0.388	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2		0.00	16	0	A	NM_032165		85638646	+1			no_errors	ENST00000393217	ensembl	human	known	74_37	missense	6.12	21	3	SNP	1.000	G
LTBP1	4052	genome.wustl.edu	37	2	33359997	33359997	+	Missense_Mutation	SNP	G	G	A	rs375749254		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:33359997G>A	ENST00000404816.2	+	5	1524	c.1171G>A	c.(1171-1173)Gac>Aac	p.D391N	LTBP1_ENST00000407925.1_Missense_Mutation_p.D65N|LTBP1_ENST00000390003.4_Missense_Mutation_p.D65N|LTBP1_ENST00000402934.1_Missense_Mutation_p.D65N|LTBP1_ENST00000354476.3_Missense_Mutation_p.D391N|LTBP1_ENST00000418533.2_Missense_Mutation_p.D65N|LTBP1_ENST00000404525.1_Missense_Mutation_p.D65N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	391					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCATGCTGCCGACACCCTGAC	0.522																																																	0													88.0	73.0	78.0					2																	33359997		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1171G>A	2.37:g.33359997G>A	ENSP00000386043:p.Asp391Asn		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.D391N	ENST00000404816.2	37	c.1171	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	G	33	5.200913	0.94997	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.86230	-2.09;-2.04;-1.72;-1.69;-1.71;-1.69;-1.69	5.71	5.71	0.89125	.	.	.	.	.	D	0.93180	0.7828	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.997;1.0;1.0;1.0	D;D;P;D;D;D	0.91635	0.998;0.999;0.875;0.999;0.999;0.999	D	0.93288	0.6666	9	0.87932	D	0	.	19.854	0.96750	0.0:0.0:1.0:0.0	.	391;65;65;65;65;391	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	N	391;391;80;65;65;65;65;65	ENSP00000386043:D391N;ENSP00000346467:D391N;ENSP00000374653:D65N;ENSP00000393057:D65N;ENSP00000384373:D65N;ENSP00000385359:D65N;ENSP00000384091:D65N	ENSP00000346467:D391N	D	+	1	0	LTBP1	33213501	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.890000	0.87313	2.699000	0.92147	0.462000	0.41574	GAC	LTBP1	-	NULL	ENSG00000049323		0.522	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	18	0	G	NM_206943		33359997	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	32.56	29	14	SNP	1.000	A
LTBP1	4052	genome.wustl.edu	37	2	33359997	33359997	+	Missense_Mutation	SNP	G	G	A	rs375749254		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:33359997G>A	ENST00000404816.2	+	5	1524	c.1171G>A	c.(1171-1173)Gac>Aac	p.D391N	LTBP1_ENST00000407925.1_Missense_Mutation_p.D65N|LTBP1_ENST00000390003.4_Missense_Mutation_p.D65N|LTBP1_ENST00000402934.1_Missense_Mutation_p.D65N|LTBP1_ENST00000354476.3_Missense_Mutation_p.D391N|LTBP1_ENST00000418533.2_Missense_Mutation_p.D65N|LTBP1_ENST00000404525.1_Missense_Mutation_p.D65N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	391					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCATGCTGCCGACACCCTGAC	0.522																																																	0													88.0	73.0	78.0					2																	33359997		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1171G>A	2.37:g.33359997G>A	ENSP00000386043:p.Asp391Asn		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.D391N	ENST00000404816.2	37	c.1171	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	G	33	5.200913	0.94997	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.86230	-2.09;-2.04;-1.72;-1.69;-1.71;-1.69;-1.69	5.71	5.71	0.89125	.	.	.	.	.	D	0.93180	0.7828	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.997;1.0;1.0;1.0	D;D;P;D;D;D	0.91635	0.998;0.999;0.875;0.999;0.999;0.999	D	0.93288	0.6666	9	0.87932	D	0	.	19.854	0.96750	0.0:0.0:1.0:0.0	.	391;65;65;65;65;391	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	N	391;391;80;65;65;65;65;65	ENSP00000386043:D391N;ENSP00000346467:D391N;ENSP00000374653:D65N;ENSP00000393057:D65N;ENSP00000384373:D65N;ENSP00000385359:D65N;ENSP00000384091:D65N	ENSP00000346467:D391N	D	+	1	0	LTBP1	33213501	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.890000	0.87313	2.699000	0.92147	0.462000	0.41574	GAC	LTBP1	-	NULL	ENSG00000049323		0.522	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	31	0	G	NM_206943		33359997	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	32.56	29	14	SNP	1.000	A
MAGEB6	158809	genome.wustl.edu	37	X	26212570	26212570	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:26212570G>T	ENST00000379034.1	+	2	756	c.607G>T	c.(607-609)Gcg>Tcg	p.A203S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	203	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GTGCACGTTGGCGCAATTCCT	0.473																																																	0													85.0	71.0	76.0					X																	26212570		2202	4300	6502	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.607G>T	X.37:g.26212570G>T	ENSP00000368320:p.Ala203Ser		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A203S	ENST00000379034.1	37	c.607	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	G	8.792	0.930879	0.18131	.	.	ENSG00000176746	ENST00000379034	T	0.01854	4.6	3.1	0.418	0.16429	.	0.273455	0.28736	U	0.014320	T	0.01730	0.0055	L	0.29908	0.895	0.09310	N	1	B	0.16603	0.018	B	0.14578	0.011	T	0.44528	-0.9322	10	0.87932	D	0	.	2.99	0.05980	0.2744:0.2394:0.4862:0.0	.	203	Q8N7X4	MAGB6_HUMAN	S	203	ENSP00000368320:A203S	ENSP00000368320:A203S	A	+	1	0	MAGEB6	26122491	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.313000	0.08103	-0.032000	0.13758	0.594000	0.82650	GCG	MAGEB6	-	pfscan_MAGE	ENSG00000176746		0.473	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	37	0	G	NM_173523		26212570	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	5.33	70	4	SNP	0.000	T
MAGEB6	158809	genome.wustl.edu	37	X	26212570	26212570	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:26212570G>T	ENST00000379034.1	+	2	756	c.607G>T	c.(607-609)Gcg>Tcg	p.A203S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	203	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GTGCACGTTGGCGCAATTCCT	0.473																																																	0													85.0	71.0	76.0					X																	26212570		2202	4300	6502	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.607G>T	X.37:g.26212570G>T	ENSP00000368320:p.Ala203Ser		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A203S	ENST00000379034.1	37	c.607	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	G	8.792	0.930879	0.18131	.	.	ENSG00000176746	ENST00000379034	T	0.01854	4.6	3.1	0.418	0.16429	.	0.273455	0.28736	U	0.014320	T	0.01730	0.0055	L	0.29908	0.895	0.09310	N	1	B	0.16603	0.018	B	0.14578	0.011	T	0.44528	-0.9322	10	0.87932	D	0	.	2.99	0.05980	0.2744:0.2394:0.4862:0.0	.	203	Q8N7X4	MAGB6_HUMAN	S	203	ENSP00000368320:A203S	ENSP00000368320:A203S	A	+	1	0	MAGEB6	26122491	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.313000	0.08103	-0.032000	0.13758	0.594000	0.82650	GCG	MAGEB6	-	pfscan_MAGE	ENSG00000176746		0.473	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	61	0	G	NM_173523		26212570	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	5.33	70	4	SNP	0.000	T
MAGI1	9223	genome.wustl.edu	37	3	65940168	65940168	+	Intron	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:65940168G>A	ENST00000497477.2	-	1	313				MAGI1_ENST00000330909.8_Intron|MAGI1_ENST00000483466.1_Intron|MAGI1_ENST00000402939.2_Intron|MAGI1-IT1_ENST00000460754.1_RNA			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1						cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CGGCGGATCCGGAAACAGGCA	0.478																																																	0																																										SO:0001627	intron_variant	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.313+83502C>T	3.37:g.65940168G>A			A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	RNA	SNP	-	NULL	ENST00000497477.2	37	NULL		3																																																																																			MAGI1-IT1	-	-	ENSG00000272610		0.478	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1-IT1	HGNC	protein_coding	OTTHUMT00000349132.2	-	0.00	61	0	G	NM_004742		65940168	-1	tier1	-	no_errors	ENST00000460754	ensembl	human	known	74_37	rna	21.79	61	17	SNP	0.000	A
MAGI1	9223	genome.wustl.edu	37	3	65940168	65940168	+	Intron	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:65940168G>A	ENST00000497477.2	-	1	313				MAGI1_ENST00000330909.8_Intron|MAGI1_ENST00000483466.1_Intron|MAGI1_ENST00000402939.2_Intron|MAGI1-IT1_ENST00000460754.1_RNA			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1						cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CGGCGGATCCGGAAACAGGCA	0.478																																																	0																																										SO:0001627	intron_variant	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.313+83502C>T	3.37:g.65940168G>A			A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	RNA	SNP	-	NULL	ENST00000497477.2	37	NULL		3																																																																																			MAGI1-IT1	-	-	ENSG00000272610		0.478	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1-IT1	HGNC	protein_coding	OTTHUMT00000349132.2	-	0.00	67	0	G	NM_004742		65940168	-1	tier1	-	no_errors	ENST00000460754	ensembl	human	known	74_37	rna	21.79	61	17	SNP	0.000	A
MAML2	84441	genome.wustl.edu	37	11	95825422	95825422	+	Silent	SNP	C	C	T	rs200834136		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:95825422C>T	ENST00000524717.1	-	2	3057	c.1773G>A	c.(1771-1773)caG>caA	p.Q591Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	591					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgttgctgTT	0.507			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													50.0	54.0	53.0					11																	95825422		2171	4250	6421	SO:0001819	synonymous_variant	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1773G>A	11.37:g.95825422C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q591	ENST00000524717.1	37	c.1773	CCDS44714.1	11																																																																																			MAML2	-	NULL	ENSG00000184384		0.507	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	-	0.00	27	0	C			95825422	-1	tier1	-	no_errors	ENST00000524717	ensembl	human	known	74_37	silent	16.67	30	6	SNP	1.000	T
MAML2	84441	genome.wustl.edu	37	11	95825422	95825422	+	Silent	SNP	C	C	T	rs200834136		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:95825422C>T	ENST00000524717.1	-	2	3057	c.1773G>A	c.(1771-1773)caG>caA	p.Q591Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	591					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgttgctgTT	0.507			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													50.0	54.0	53.0					11																	95825422		2171	4250	6421	SO:0001819	synonymous_variant	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1773G>A	11.37:g.95825422C>T			A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q591	ENST00000524717.1	37	c.1773	CCDS44714.1	11																																																																																			MAML2	-	NULL	ENSG00000184384		0.507	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	-	0.00	36	0	C			95825422	-1	tier1	-	no_errors	ENST00000524717	ensembl	human	known	74_37	silent	16.67	30	6	SNP	1.000	T
MARK1	4139	genome.wustl.edu	37	1	220791832	220791832	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:220791832G>A	ENST00000366917.4	+	8	999	c.733G>A	c.(733-735)Gtc>Atc	p.V245I	MARK1_ENST00000402574.1_Missense_Mutation_p.V110I|MARK1_ENST00000366918.4_Missense_Mutation_p.V223I					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GAGTCTGGGCGTCATTCTCTA	0.433																																																	0													90.0	92.0	91.0					1																	220791832		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.733G>A	1.37:g.220791832G>A	ENSP00000355884:p.Val245Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.V245I	ENST00000366917.4	37	c.733	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784315	0.90282	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.27720	1.65;1.65;1.65	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067183	0.64402	D	0.000012	T	0.46308	0.1386	N	0.25485	0.75	0.80722	D	1	D;D;D;D	0.89917	0.997;0.996;1.0;1.0	P;P;D;D	0.80764	0.891;0.826;0.971;0.994	T	0.45308	-0.9270	10	0.87932	D	0	.	19.9145	0.97053	0.0:0.0:1.0:0.0	.	245;110;245;223	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	I	110;223;245	ENSP00000386017:V110I;ENSP00000355885:V223I;ENSP00000355884:V245I	ENSP00000355884:V245I	V	+	1	0	MARK1	218858455	1.000000	0.71417	0.992000	0.48379	0.496000	0.33645	7.954000	0.87848	2.709000	0.92574	0.655000	0.94253	GTC	MARK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000116141		0.433	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	46	0	G			220791832	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	24.14	66	21	SNP	1.000	A
MARK1	4139	genome.wustl.edu	37	1	220791832	220791832	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:220791832G>A	ENST00000366917.4	+	8	999	c.733G>A	c.(733-735)Gtc>Atc	p.V245I	MARK1_ENST00000402574.1_Missense_Mutation_p.V110I|MARK1_ENST00000366918.4_Missense_Mutation_p.V223I					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GAGTCTGGGCGTCATTCTCTA	0.433																																																	0													90.0	92.0	91.0					1																	220791832		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.733G>A	1.37:g.220791832G>A	ENSP00000355884:p.Val245Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.V245I	ENST00000366917.4	37	c.733	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784315	0.90282	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.27720	1.65;1.65;1.65	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067183	0.64402	D	0.000012	T	0.46308	0.1386	N	0.25485	0.75	0.80722	D	1	D;D;D;D	0.89917	0.997;0.996;1.0;1.0	P;P;D;D	0.80764	0.891;0.826;0.971;0.994	T	0.45308	-0.9270	10	0.87932	D	0	.	19.9145	0.97053	0.0:0.0:1.0:0.0	.	245;110;245;223	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	I	110;223;245	ENSP00000386017:V110I;ENSP00000355885:V223I;ENSP00000355884:V245I	ENSP00000355884:V245I	V	+	1	0	MARK1	218858455	1.000000	0.71417	0.992000	0.48379	0.496000	0.33645	7.954000	0.87848	2.709000	0.92574	0.655000	0.94253	GTC	MARK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000116141		0.433	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	56	0	G			220791832	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	24.14	66	21	SNP	1.000	A
MEF2C	4208	genome.wustl.edu	37	5	88057050	88057050	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:88057050C>T	ENST00000437473.2	-	4	771	c.354G>A	c.(352-354)agG>agA	p.R118R	MEF2C_ENST00000514015.1_Silent_p.R118R|MEF2C_ENST00000508569.1_Silent_p.R118R|MEF2C_ENST00000340208.5_Intron|MEF2C_ENST00000504921.2_Silent_p.R118R|MEF2C_ENST00000510942.1_Silent_p.R118R|MEF2C_ENST00000514028.1_Silent_p.R118R|MEF2C_ENST00000424173.2_Intron|MEF2C_ENST00000539796.1_Intron|MEF2C_ENST00000503554.1_5'UTR|MEF2C_ENST00000506554.1_Silent_p.R118R	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	118					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CGTTAATTTTCCTGTACTTGT	0.438										HNSCC(66;0.2)																																							0													160.0	156.0	157.0					5																	88057050		1902	4128	6030	SO:0001819	synonymous_variant	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.354G>A	5.37:g.88057050C>T			C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.R118	ENST00000437473.2	37	c.354	CCDS47245.1	5																																																																																			MEF2C	-	pfam_HJURP_C	ENSG00000081189		0.438	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	-	0.00	17	0	C	NM_002397		88057050	-1	tier1	-	no_errors	ENST00000437473	ensembl	human	known	74_37	silent	34.38	21	11	SNP	1.000	T
MEF2C	4208	genome.wustl.edu	37	5	88057050	88057050	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:88057050C>T	ENST00000437473.2	-	4	771	c.354G>A	c.(352-354)agG>agA	p.R118R	MEF2C_ENST00000514015.1_Silent_p.R118R|MEF2C_ENST00000508569.1_Silent_p.R118R|MEF2C_ENST00000340208.5_Intron|MEF2C_ENST00000504921.2_Silent_p.R118R|MEF2C_ENST00000510942.1_Silent_p.R118R|MEF2C_ENST00000514028.1_Silent_p.R118R|MEF2C_ENST00000424173.2_Intron|MEF2C_ENST00000539796.1_Intron|MEF2C_ENST00000503554.1_5'UTR|MEF2C_ENST00000506554.1_Silent_p.R118R	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	118					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CGTTAATTTTCCTGTACTTGT	0.438										HNSCC(66;0.2)																																							0													160.0	156.0	157.0					5																	88057050		1902	4128	6030	SO:0001819	synonymous_variant	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.354G>A	5.37:g.88057050C>T			C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.R118	ENST00000437473.2	37	c.354	CCDS47245.1	5																																																																																			MEF2C	-	pfam_HJURP_C	ENSG00000081189		0.438	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	-	0.00	24	0	C	NM_002397		88057050	-1	tier1	-	no_errors	ENST00000437473	ensembl	human	known	74_37	silent	34.38	21	11	SNP	1.000	T
MFSD11	79157	genome.wustl.edu	37	17	74738327	74738327	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:74738327G>T	ENST00000588460.1	+	5	2451	c.409G>T	c.(409-411)Ggg>Tgg	p.G137W	MFSD11_ENST00000590514.1_Missense_Mutation_p.G137W|MFSD11_ENST00000355954.3_Intron|MFSD11_ENST00000336509.4_Missense_Mutation_p.G137W|MFSD11_ENST00000593181.1_Intron|MFSD11_ENST00000586622.1_Missense_Mutation_p.G137W	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	137						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						GAGAAACAGTGGGATTTTCTG	0.388																																																	0													149.0	151.0	151.0					17																	74738327		2203	4300	6503	SO:0001583	missense	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.409G>T	17.37:g.74738327G>T	ENSP00000464932:p.Gly137Trp		O43442|Q9NXI5	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G137W	ENST00000588460.1	37	c.409	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672487	0.88348	.	.	ENSG00000092931	ENST00000336509	D	0.85339	-1.97	5.74	5.74	0.90152	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.94205	0.8140	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.94670	0.7856	10	0.87932	D	0	-13.1589	19.9326	0.97124	0.0:0.0:1.0:0.0	.	137	O43934	MFS11_HUMAN	W	137	ENSP00000337240:G137W	ENSP00000337240:G137W	G	+	1	0	MFSD11	72249922	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	9.471000	0.97696	2.720000	0.93068	0.650000	0.86243	GGG	MFSD11	-	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000092931		0.388	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	-	0.00	36	0	G	NM_024311		74738327	+1	tier1	-	no_errors	ENST00000336509	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
MFSD11	79157	genome.wustl.edu	37	17	74738327	74738327	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:74738327G>T	ENST00000588460.1	+	5	2451	c.409G>T	c.(409-411)Ggg>Tgg	p.G137W	MFSD11_ENST00000590514.1_Missense_Mutation_p.G137W|MFSD11_ENST00000355954.3_Intron|MFSD11_ENST00000336509.4_Missense_Mutation_p.G137W|MFSD11_ENST00000593181.1_Intron|MFSD11_ENST00000586622.1_Missense_Mutation_p.G137W	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	137						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						GAGAAACAGTGGGATTTTCTG	0.388																																																	0													149.0	151.0	151.0					17																	74738327		2203	4300	6503	SO:0001583	missense	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.409G>T	17.37:g.74738327G>T	ENSP00000464932:p.Gly137Trp		O43442|Q9NXI5	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G137W	ENST00000588460.1	37	c.409	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672487	0.88348	.	.	ENSG00000092931	ENST00000336509	D	0.85339	-1.97	5.74	5.74	0.90152	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.94205	0.8140	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.94670	0.7856	10	0.87932	D	0	-13.1589	19.9326	0.97124	0.0:0.0:1.0:0.0	.	137	O43934	MFS11_HUMAN	W	137	ENSP00000337240:G137W	ENSP00000337240:G137W	G	+	1	0	MFSD11	72249922	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	9.471000	0.97696	2.720000	0.93068	0.650000	0.86243	GGG	MFSD11	-	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000092931		0.388	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	-	0.00	42	0	G	NM_024311		74738327	+1	tier1	-	no_errors	ENST00000336509	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
MGAT4C	25834	genome.wustl.edu	37	12	86383258	86383258	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:86383258G>T	ENST00000604798.1	-	6	1271	c.67C>A	c.(67-69)Cgt>Agt	p.R23S	MGAT4C_ENST00000332156.1_Missense_Mutation_p.R23S|MGAT4C_ENST00000552808.2_Missense_Mutation_p.R23S|MGAT4C_ENST00000548651.1_Missense_Mutation_p.R23S|MGAT4C_ENST00000393205.2_Missense_Mutation_p.R52S|MGAT4C_ENST00000549405.2_Missense_Mutation_p.R23S|MGAT4C_ENST00000552435.2_Missense_Mutation_p.R23S			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	23					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.R23C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						ACTGTAGAACGTTTTCTCAGG	0.323																																																	1	Substitution - Missense(1)	kidney(1)											82.0	72.0	76.0					12																	86383258		2202	4299	6501	SO:0001583	missense	0				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.67C>A	12.37:g.86383258G>T	ENSP00000474896:p.Arg23Ser		B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.R52S	ENST00000604798.1	37	c.154	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250299	0.59212	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.51071	1.32;1.25;1.32;1.32;1.32;0.72	5.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.57519	0.2059	L	0.36672	1.1	0.46701	D	0.999168	D;B	0.89917	1.0;0.373	D;B	0.81914	0.995;0.141	T	0.57763	-0.7755	10	0.51188	T	0.08	-5.7685	14.9338	0.70938	0.0:0.0:0.7211:0.2789	.	52;23	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	S	23;52;23;23;23;23;23;23	ENSP00000331664:R23S;ENSP00000376900:R52S;ENSP00000449022:R23S;ENSP00000446647:R23S;ENSP00000447253:R23S;ENSP00000449172:R23S	ENSP00000331664:R23S	R	-	1	0	MGAT4C	84907389	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.096000	0.57734	2.749000	0.94314	0.655000	0.94253	CGT	MGAT4C	-	superfamily_LSM_dom	ENSG00000182050		0.323	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2		0.00	47	0	G	NM_013244		86383258	-1			no_errors	ENST00000393205	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
MLH1	4292	genome.wustl.edu	37	3	37061853	37061853	+	Nonsense_Mutation	SNP	G	G	T	rs63751259		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:37061853G>T	ENST00000231790.2	+	11	1153	c.937G>T	c.(937-939)Gaa>Taa	p.E313*	MLH1_ENST00000539477.1_Nonsense_Mutation_p.E72*|MLH1_ENST00000458205.2_Nonsense_Mutation_p.E72*|MLH1_ENST00000435176.1_Nonsense_Mutation_p.E215*|MLH1_ENST00000455445.2_Nonsense_Mutation_p.E72*|MLH1_ENST00000536378.1_Nonsense_Mutation_p.E72*	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	313					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.E313*(1)|p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CACAAAGCATGAAGTTCACTT	0.502		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	2	Substitution - Nonsense(1)|Whole gene deletion(1)	ovary(1)|lung(1)											106.0	103.0	104.0					3																	37061853		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.937G>T	3.37:g.37061853G>T	ENSP00000231790:p.Glu313*		B4DI13|B4DQ11|E9PCU2	Nonsense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.E313*	ENST00000231790.2	37	c.937	CCDS2663.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.480871|9.480871	0.99183|0.99183	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000441265;ENST00000536378|ENST00000456676	.|.	.|.	.|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80048	.|0.4552	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77797	.|-0.2453	.|3	0.87932|.	D|.	0|.	-20.3185|-20.3185	19.9664|19.9664	0.97271|0.97271	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	313;279;177;72;72;72;215;72;72|304	.|.	ENSP00000231790:E313X|.	E|M	+|+	1|3	0|0	MLH1|MLH1	37036857|37036857	1.000000|1.000000	0.71417|0.71417	0.935000|0.935000	0.37517|0.37517	0.996000|0.996000	0.88848|0.88848	9.387000|9.387000	0.97232|0.97232	2.718000|2.718000	0.92993|0.92993	0.655000|0.655000	0.94253|0.94253	GAA|ATG	MLH1	-	pfam_DNA_mismatch_repair_C,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	ENSG00000076242		0.502	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2		0.00	46	0	G	NM_000249		37061853	+1			no_errors	ENST00000231790	ensembl	human	known	74_37	nonsense	5.36	53	3	SNP	1.000	T
MON2	23041	genome.wustl.edu	37	12	62949801	62949801	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:62949801C>A	ENST00000393632.2	+	25	3629	c.3238C>A	c.(3238-3240)Cga>Aga	p.R1080R	MON2_ENST00000552738.1_Silent_p.R1057R|MON2_ENST00000393630.3_Silent_p.R1081R|MON2_ENST00000546600.1_Silent_p.R1080R|MON2_ENST00000393629.2_Silent_p.R1080R|MON2_ENST00000280379.6_Silent_p.R1081R	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1080					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R1080*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GGACAGAGTTCGAGAGTCCTC	0.388																																																	1	Substitution - Nonsense(1)	large_intestine(1)											59.0	55.0	56.0					12																	62949801		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3238C>A	12.37:g.62949801C>A			A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Silent	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.R1081	ENST00000393632.2	37	c.3241	CCDS31849.1	12																																																																																			MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3		0.00	44	0	C	NM_015026		62949801	+1			no_errors	ENST00000393630	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	A
MT-ND1	4535	genome.wustl.edu	37	M	1309	1309	+	5'Flank	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrM:1309A>G	ENST00000361390.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTAAGCGCAAGTACCCACGTA	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1309A>G	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.463	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	11	0	A	YP_003024026		1309	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	55.56	4	5	SNP	NULL	G
MT-ND5	4540	genome.wustl.edu	37	M	13352	13352	+	Missense_Mutation	SNP	T	T	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrM:13352T>A	ENST00000361567.2	+	1	1016	c.1016T>A	c.(1015-1017)cTa>cAa	p.L339Q	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	339					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAAAGCCATACTATTTATGTG	0.428																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1016T>A	M.37:g.13352T>A	ENSP00000354813:p.Leu339Gln		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L339Q	ENST00000361567.2	37	c.1016		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	10	0	T	YP_003024036		13352	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	75.00	1	3	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13352	13352	+	Missense_Mutation	SNP	T	T	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrM:13352T>A	ENST00000361567.2	+	1	1016	c.1016T>A	c.(1015-1017)cTa>cAa	p.L339Q	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	339					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAAAGCCATACTATTTATGTG	0.428																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1016T>A	M.37:g.13352T>A	ENSP00000354813:p.Leu339Gln		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L339Q	ENST00000361567.2	37	c.1016		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	23	0	T	YP_003024036		13352	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	75.00	1	3	SNP	NULL	A
MUC17	140453	genome.wustl.edu	37	7	100683921	100683921	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100683921G>C	ENST00000306151.4	+	3	9288	c.9224G>C	c.(9223-9225)aGt>aCt	p.S3075T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3075	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GACTCCAACAGTCCTGTGGTC	0.473																																																	0													261.0	261.0	261.0					7																	100683921		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9224G>C	7.37:g.100683921G>C	ENSP00000302716:p.Ser3075Thr		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3075T	ENST00000306151.4	37	c.9224	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	0.769	-0.766643	0.02974	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	0.902	-1.76	0.08006	.	.	.	.	.	T	0.01061	0.0035	N	0.17082	0.46	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.48875	-0.8996	9	0.02654	T	1	.	0.2991	0.00270	0.2509:0.2889:0.2493:0.2109	.	3075	Q685J3	MUC17_HUMAN	T	3075	ENSP00000302716:S3075T	ENSP00000302716:S3075T	S	+	2	0	MUC17	100470641	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.363000	0.07593	-2.076000	0.00875	-2.023000	0.00429	AGT	MUC17	-	NULL	ENSG00000169876		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	142	0	G	NM_001040105		100683921	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	11.88	89	12	SNP	0.000	C
MUC17	140453	genome.wustl.edu	37	7	100683921	100683921	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100683921G>C	ENST00000306151.4	+	3	9288	c.9224G>C	c.(9223-9225)aGt>aCt	p.S3075T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3075	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GACTCCAACAGTCCTGTGGTC	0.473																																																	0													261.0	261.0	261.0					7																	100683921		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9224G>C	7.37:g.100683921G>C	ENSP00000302716:p.Ser3075Thr		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3075T	ENST00000306151.4	37	c.9224	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	c	0.769	-0.766643	0.02974	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	0.902	-1.76	0.08006	.	.	.	.	.	T	0.01061	0.0035	N	0.17082	0.46	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.48875	-0.8996	9	0.02654	T	1	.	0.2991	0.00270	0.2509:0.2889:0.2493:0.2109	.	3075	Q685J3	MUC17_HUMAN	T	3075	ENSP00000302716:S3075T	ENSP00000302716:S3075T	S	+	2	0	MUC17	100470641	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.363000	0.07593	-2.076000	0.00875	-2.023000	0.00429	AGT	MUC17	-	NULL	ENSG00000169876		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	75	0	G	NM_001040105		100683921	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	11.88	89	12	SNP	0.000	C
MUC17	140453	genome.wustl.edu	37	7	100683929	100683930	+	Missense_Mutation	DNP	GT	GT	AC			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G|T	G|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100683929_100683930GT>AC	ENST00000306151.4	+	3	9296_9297	c.9232_9233GT>AC	c.(9232-9234)GTc>ACc	p.V3078T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3078	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGTCCTGTGGTCACTTCTACT	0.48																																																	0																																										SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	Exception_encountered	7.37:g.100683929_100683930delinsAC	ENSP00000302716:p.Val3078Thr		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.V3078I|p.V3078A	ENST00000306151.4	37	c.9232|c.9233	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.480	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	78	0	G|T	NM_001040105		100683929|100683930	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	missense	6.67	84	6	SNP	0.000	A|C
MUC17	140453	genome.wustl.edu	37	7	100684396	100684396	+	Silent	SNP	G	G	A	rs190193919	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100684396G>A	ENST00000306151.4	+	3	9763	c.9699G>A	c.(9697-9699)ccG>ccA	p.P3233P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3233	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCAACACGCCGGTGGCCAGTT	0.493													G|||	3	0.000599042	0.0	0.0	5008	,	,		26911	0.003		0.0	False		,,,				2504	0.0																0													255.0	263.0	260.0					7																	100684396		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9699G>A	7.37:g.100684396G>A			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.P3233	ENST00000306151.4	37	c.9699	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	57	0	G	NM_001040105		100684396	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	silent	6.59	85	6	SNP	0.001	A
MUC17	140453	genome.wustl.edu	37	7	100684404	100684404	+	Missense_Mutation	SNP	G	G	T	rs569041739		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100684404G>T	ENST00000306151.4	+	3	9771	c.9707G>T	c.(9706-9708)aGt>aTt	p.S3236I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3236	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCGGTGGCCAGTTCTGAGGCT	0.493																																																	0													259.0	267.0	264.0					7																	100684404		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9707G>T	7.37:g.100684404G>T	ENSP00000302716:p.Ser3236Ile		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3236I	ENST00000306151.4	37	c.9707	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	g	5.879	0.346270	0.11126	.	.	ENSG00000169876	ENST00000306151	T	0.02032	4.49	1.23	-2.46	0.06461	.	.	.	.	.	T	0.02342	0.0072	N	0.03608	-0.345	0.09310	N	1	D	0.55605	0.972	D	0.66497	0.944	T	0.43605	-0.9381	9	0.37606	T	0.19	.	4.4568	0.11647	0.0:0.4981:0.3211:0.1808	.	3236	Q685J3	MUC17_HUMAN	I	3236	ENSP00000302716:S3236I	ENSP00000302716:S3236I	S	+	2	0	MUC17	100471124	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.717000	0.04986	-0.837000	0.04223	0.121000	0.15741	AGT	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	58	0	G	NM_001040105		100684404	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	missense	6.67	84	6	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100684406	100684406	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100684406T>C	ENST00000306151.4	+	3	9773	c.9709T>C	c.(9709-9711)Tct>Cct	p.S3237P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3237	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGTGGCCAGTTCTGAGGCTAG	0.493																																																	0													258.0	266.0	264.0					7																	100684406		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9709T>C	7.37:g.100684406T>C	ENSP00000302716:p.Ser3237Pro		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S3237P	ENST00000306151.4	37	c.9709	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	N	3.322	-0.138472	0.06669	.	.	ENSG00000169876	ENST00000306151	T	0.02763	4.17	1.24	-2.48	0.06423	.	.	.	.	.	T	0.03608	0.0103	N	0.12182	0.205	0.09310	N	1	P	0.48350	0.909	D	0.63033	0.91	T	0.32666	-0.9898	9	0.33141	T	0.24	.	3.8572	0.08981	0.2166:0.512:0.0:0.2713	.	3237	Q685J3	MUC17_HUMAN	P	3237	ENSP00000302716:S3237P	ENSP00000302716:S3237P	S	+	1	0	MUC17	100471126	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.150000	0.03178	-1.329000	0.02258	-1.568000	0.00874	TCT	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	60	0	T	NM_001040105		100684406	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	missense	8.05	80	7	SNP	0.000	C
MUC17	140453	genome.wustl.edu	37	7	100684419	100684419	+	Missense_Mutation	SNP	T	T	C	rs148148316	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:100684419T>C	ENST00000306151.4	+	3	9786	c.9722T>C	c.(9721-9723)aTc>aCc	p.I3241T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3241	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAGGCTAGCATCCTTTCAACA	0.502													C|||	35	0.00698882	0.025	0.0014	5008	,	,		26381	0.0		0.001	False		,,,				2504	0.0																0								C	THR/ILE	118,4288		0,118,2085	271.0	277.0	275.0		9722	0.7	0.0	7	dbSNP_134	275	1,8599		0,1,4299	no	missense	MUC17	NM_001040105.1	89	0,119,6384	CC,CT,TT		0.0116,2.6782,0.915	possibly-damaging	3241/4494	100684419	119,12887	2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9722T>C	7.37:g.100684419T>C	ENSP00000302716:p.Ile3241Thr		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.I3241T	ENST00000306151.4	37	c.9722	CCDS34711.1	7	25	0.011446886446886446	17	0.034552845528455285	2	0.0055248618784530384	4	0.006993006993006993	2	0.002638522427440633	N	1.367	-0.587102	0.03827	0.026782	1.16E-4	ENSG00000169876	ENST00000306151	T	0.03065	4.06	0.656	0.656	0.17844	.	.	.	.	.	T	0.00440	0.0014	N	0.01576	-0.805	0.09310	N	1	P	0.38110	0.618	B	0.37650	0.255	T	0.31223	-0.9951	9	0.05525	T	0.97	.	3.8624	0.09002	0.0:0.4693:0.0:0.5306	.	3241	Q685J3	MUC17_HUMAN	T	3241	ENSP00000302716:I3241T	ENSP00000302716:I3241T	I	+	2	0	MUC17	100471139	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	0.041000	0.13927	-0.126000	0.11682	-1.386000	0.01163	ATC	MUC17	-	NULL	ENSG00000169876		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	69	0	T	NM_001040105		100684419	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	missense	11.49	77	10	SNP	0.005	C
MUC5B	727897	genome.wustl.edu	37	11	1256532	1256532	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:1256532G>T	ENST00000529681.1	+	23	2827		c.e23-1		MUC5B_ENST00000447027.1_Splice_Site	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TTCTGGCCCAGGACTACTGTG	0.662																																																	0													63.0	72.0	69.0					11																	1256532		2091	4201	6292	SO:0001630	splice_region_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2770-1G>T	11.37:g.1256532G>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Splice_Site	SNP	-	e23-1	ENST00000529681.1	37	c.2779-1	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647348	0.87958	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.143	0.86759	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MUC5B	1213108	1.000000	0.71417	0.993000	0.49108	0.899000	0.52679	9.384000	0.97219	2.265000	0.75225	0.549000	0.68633	.	MUC5B	-	-	ENSG00000117983		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	58	0	G	XM_001126093	Intron	1256532	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	splice_site	5.26	72	4	SNP	1.000	T
MUC5B	727897	genome.wustl.edu	37	11	1265962	1265962	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:1265962G>T	ENST00000529681.1	+	31	7910	c.7852G>T	c.(7852-7854)Gcc>Tcc	p.A2618S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A2621S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2618	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGCTTCACAGCCACCCCCTC	0.647																																																	0													133.0	166.0	155.0					11																	1265962		2104	4227	6331	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7852G>T	11.37:g.1265962G>T	ENSP00000436812:p.Ala2618Ser		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A2621S	ENST00000529681.1	37	c.7861	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	g	4.804	0.149490	0.09185	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000537836	T;T	0.20463	2.07;2.26	2.4	-4.79	0.03200	.	.	.	.	.	T	0.16385	0.0394	M	0.61703	1.905	0.09310	N	1	B;B	0.22346	0.068;0.068	B;B	0.18263	0.014;0.021	T	0.35699	-0.9778	9	0.87932	D	0	.	1.7594	0.02989	0.2633:0.2486:0.3694:0.1187	.	3256;2621	A7Y9J9;E9PBJ0	.;.	S	2618;2621;2590;2633;159	ENSP00000436812:A2618S;ENSP00000415793:A2621S	ENSP00000343037:A2590S	A	+	1	0	MUC5B	1222538	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.952000	0.00677	-1.367000	0.02152	0.205000	0.17691	GCC	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	119	0	G	XM_001126093		1265962	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	34.10	113	59	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1265962	1265962	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:1265962G>T	ENST00000529681.1	+	31	7910	c.7852G>T	c.(7852-7854)Gcc>Tcc	p.A2618S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A2621S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2618	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGCTTCACAGCCACCCCCTC	0.647																																																	0													133.0	166.0	155.0					11																	1265962		2104	4227	6331	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7852G>T	11.37:g.1265962G>T	ENSP00000436812:p.Ala2618Ser		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A2621S	ENST00000529681.1	37	c.7861	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	g	4.804	0.149490	0.09185	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000537836	T;T	0.20463	2.07;2.26	2.4	-4.79	0.03200	.	.	.	.	.	T	0.16385	0.0394	M	0.61703	1.905	0.09310	N	1	B;B	0.22346	0.068;0.068	B;B	0.18263	0.014;0.021	T	0.35699	-0.9778	9	0.87932	D	0	.	1.7594	0.02989	0.2633:0.2486:0.3694:0.1187	.	3256;2621	A7Y9J9;E9PBJ0	.;.	S	2618;2621;2590;2633;159	ENSP00000436812:A2618S;ENSP00000415793:A2621S	ENSP00000343037:A2590S	A	+	1	0	MUC5B	1222538	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.952000	0.00677	-1.367000	0.02152	0.205000	0.17691	GCC	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	178	0	G	XM_001126093		1265962	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	34.10	113	59	SNP	0.000	T
MUTYH	4595	genome.wustl.edu	37	1	45796970	45796970	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:45796970G>T	ENST00000372098.3	-	14	1484	c.1351C>A	c.(1351-1353)Caa>Aaa	p.Q451K	MUTYH_ENST00000488731.2_Missense_Mutation_p.Q121K|MUTYH_ENST00000354383.6_Missense_Mutation_p.Q427K|MUTYH_ENST00000372100.5_Missense_Mutation_p.Q437K|MUTYH_ENST00000528332.2_Missense_Mutation_p.Q135K|MUTYH_ENST00000355498.2_Missense_Mutation_p.Q426K|MUTYH_ENST00000372104.1_Missense_Mutation_p.Q426K|MUTYH_ENST00000448481.1_Missense_Mutation_p.Q437K|MUTYH_ENST00000528013.2_Missense_Mutation_p.Q440K|MUTYH_ENST00000372110.3_Missense_Mutation_p.Q441K|MUTYH_ENST00000372115.3_Missense_Mutation_p.Q440K|MUTYH_ENST00000529984.1_Missense_Mutation_p.Q121K|MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000450313.1_Missense_Mutation_p.Q454K|MUTYH_ENST00000456914.2_Missense_Mutation_p.Q426K			Q9UIF7	MUTYH_HUMAN	mutY homolog	451	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CCATATACTTGATATGTCAGC	0.537			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																														yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	0													91.0	88.0	89.0					1																	45796970		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MAP, MYH-associated polyposis	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.1351C>A	1.37:g.45796970G>T	ENSP00000361170:p.Gln451Lys		D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,superfamily_NUDIX_hydrolase_dom-like,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.Q454K	ENST00000372098.3	37	c.1360	CCDS520.1	1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414686	0.25465	.	.	ENSG00000132781	ENST00000529984;ENST00000528332;ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000488731;ENST00000450313;ENST00000372100	D;D;D;D;D;D;D;D;D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15	5.16	4.23	0.50019	NUDIX hydrolase domain (2);NUDIX hydrolase domain-like (1);	0.263977	0.36066	N	0.002816	D	0.89354	0.6691	L	0.39898	1.24	0.34227	D	0.67613	P;B;B;B;B;B;B;B	0.41102	0.738;0.032;0.001;0.054;0.001;0.066;0.018;0.038	B;B;B;B;B;B;B;B	0.40825	0.341;0.052;0.006;0.111;0.006;0.052;0.032;0.052	D	0.90973	0.4821	10	0.29301	T	0.29	-0.0106	12.2292	0.54478	0.0:0.4391:0.5609:0.0	.	135;454;451;441;451;440;334;427	B4DEX2;E5KP25;E5KP26;Q9UIF7-2;Q9UIF7;E5KP27;D3DPZ6;E5KP28	.;.;.;.;MUTYH_HUMAN;.;.;.	K	121;135;426;437;426;427;426;451;441;440;121;454;437	ENSP00000437093:Q121K;ENSP00000433076:Q135K;ENSP00000361176:Q426K;ENSP00000409718:Q437K;ENSP00000407590:Q426K;ENSP00000346354:Q427K;ENSP00000347685:Q426K;ENSP00000361170:Q451K;ENSP00000361182:Q441K;ENSP00000361187:Q440K;ENSP00000432330:Q121K;ENSP00000408176:Q454K;ENSP00000361172:Q437K	ENSP00000346354:Q427K	Q	-	1	0	MUTYH	45569557	0.999000	0.42202	0.683000	0.30040	0.738000	0.42128	3.392000	0.52537	2.414000	0.81942	0.655000	0.94253	CAA	MUTYH	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000132781		0.537	MUTYH-002	KNOWN	basic|CCDS	protein_coding	MUTYH	HGNC	protein_coding	OTTHUMT00000020529.1	-	0.00	58	0	G	NM_012222		45796970	-1	tier1	-	no_errors	ENST00000450313	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
MUTYH	4595	genome.wustl.edu	37	1	45796970	45796970	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:45796970G>T	ENST00000372098.3	-	14	1484	c.1351C>A	c.(1351-1353)Caa>Aaa	p.Q451K	MUTYH_ENST00000488731.2_Missense_Mutation_p.Q121K|MUTYH_ENST00000354383.6_Missense_Mutation_p.Q427K|MUTYH_ENST00000372100.5_Missense_Mutation_p.Q437K|MUTYH_ENST00000528332.2_Missense_Mutation_p.Q135K|MUTYH_ENST00000355498.2_Missense_Mutation_p.Q426K|MUTYH_ENST00000372104.1_Missense_Mutation_p.Q426K|MUTYH_ENST00000448481.1_Missense_Mutation_p.Q437K|MUTYH_ENST00000528013.2_Missense_Mutation_p.Q440K|MUTYH_ENST00000372110.3_Missense_Mutation_p.Q441K|MUTYH_ENST00000372115.3_Missense_Mutation_p.Q440K|MUTYH_ENST00000529984.1_Missense_Mutation_p.Q121K|MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000450313.1_Missense_Mutation_p.Q454K|MUTYH_ENST00000456914.2_Missense_Mutation_p.Q426K			Q9UIF7	MUTYH_HUMAN	mutY homolog	451	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CCATATACTTGATATGTCAGC	0.537			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																														yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	0													91.0	88.0	89.0					1																	45796970		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MAP, MYH-associated polyposis	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.1351C>A	1.37:g.45796970G>T	ENSP00000361170:p.Gln451Lys		D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,superfamily_NUDIX_hydrolase_dom-like,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.Q454K	ENST00000372098.3	37	c.1360	CCDS520.1	1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414686	0.25465	.	.	ENSG00000132781	ENST00000529984;ENST00000528332;ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000488731;ENST00000450313;ENST00000372100	D;D;D;D;D;D;D;D;D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15;-3.15	5.16	4.23	0.50019	NUDIX hydrolase domain (2);NUDIX hydrolase domain-like (1);	0.263977	0.36066	N	0.002816	D	0.89354	0.6691	L	0.39898	1.24	0.34227	D	0.67613	P;B;B;B;B;B;B;B	0.41102	0.738;0.032;0.001;0.054;0.001;0.066;0.018;0.038	B;B;B;B;B;B;B;B	0.40825	0.341;0.052;0.006;0.111;0.006;0.052;0.032;0.052	D	0.90973	0.4821	10	0.29301	T	0.29	-0.0106	12.2292	0.54478	0.0:0.4391:0.5609:0.0	.	135;454;451;441;451;440;334;427	B4DEX2;E5KP25;E5KP26;Q9UIF7-2;Q9UIF7;E5KP27;D3DPZ6;E5KP28	.;.;.;.;MUTYH_HUMAN;.;.;.	K	121;135;426;437;426;427;426;451;441;440;121;454;437	ENSP00000437093:Q121K;ENSP00000433076:Q135K;ENSP00000361176:Q426K;ENSP00000409718:Q437K;ENSP00000407590:Q426K;ENSP00000346354:Q427K;ENSP00000347685:Q426K;ENSP00000361170:Q451K;ENSP00000361182:Q441K;ENSP00000361187:Q440K;ENSP00000432330:Q121K;ENSP00000408176:Q454K;ENSP00000361172:Q437K	ENSP00000346354:Q427K	Q	-	1	0	MUTYH	45569557	0.999000	0.42202	0.683000	0.30040	0.738000	0.42128	3.392000	0.52537	2.414000	0.81942	0.655000	0.94253	CAA	MUTYH	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000132781		0.537	MUTYH-002	KNOWN	basic|CCDS	protein_coding	MUTYH	HGNC	protein_coding	OTTHUMT00000020529.1	-	0.00	62	0	G	NM_012222		45796970	-1	tier1	-	no_errors	ENST00000450313	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
MX1	4599	genome.wustl.edu	37	21	42807878	42807878	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr21:42807878G>T	ENST00000398600.2	+	8	1245	c.220G>T	c.(220-222)Gcc>Tcc	p.A74S	MX1_ENST00000398598.3_Missense_Mutation_p.A74S|MX1_ENST00000288383.6_Missense_Mutation_p.A74S|MX1_ENST00000455164.2_Missense_Mutation_p.A74S	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	74	Dynamin-type G.|GTPase domain (Globular).				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				GCCAGCCATCGCCGTCATCGG	0.612																																																	0													80.0	79.0	80.0					21																	42807878		2203	4300	6503	SO:0001583	missense	0				CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.220G>T	21.37:g.42807878G>T	ENSP00000381601:p.Ala74Ser		B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.A74S	ENST00000398600.2	37	c.220	CCDS13673.1	21	.	.	.	.	.	.	.	.	.	.	G	31	5.097951	0.94197	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000424365;ENST00000417963;ENST00000441677;ENST00000288383	D;D;D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.19;-4.19;-2.69	4.48	4.48	0.54585	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99445	1.0939	10	0.72032	D	0.01	-22.5154	16.5923	0.84769	0.0:0.0:1.0:0.0	.	74	P20591	MX1_HUMAN	S	74	ENSP00000381601:A74S;ENSP00000381599:A74S;ENSP00000410523:A74S;ENSP00000400923:A74S;ENSP00000402215:A74S;ENSP00000288383:A74S	ENSP00000288383:A74S	A	+	1	0	MX1	41729748	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	6.629000	0.74267	2.445000	0.82738	0.561000	0.74099	GCC	MX1	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	ENSG00000157601		0.612	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX1	HGNC	protein_coding	OTTHUMT00000195161.2		0.00	14	0	G			42807878	+1			no_errors	ENST00000398598	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
MYH15	22989	genome.wustl.edu	37	3	108214704	108214704	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:108214704G>T	ENST00000273353.3	-	8	750	c.694C>A	c.(694-696)Caa>Aaa	p.Q232K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	232	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGCATGATTTGATCTTCTAAC	0.408																																																	0													107.0	93.0	98.0					3																	108214704		1860	4105	5965	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.694C>A	3.37:g.108214704G>T	ENSP00000273353:p.Gln232Lys			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q232K	ENST00000273353.3	37	c.694	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880527	0.51801	.	.	ENSG00000144821	ENST00000273353	D	0.86865	-2.18	4.93	4.05	0.47172	Myosin head, motor domain (2);	.	.	.	.	D	0.92570	0.7640	M	0.80746	2.51	0.48571	D	0.999677	P	0.41929	0.765	P	0.56916	0.809	D	0.93461	0.6810	9	0.87932	D	0	.	15.4461	0.75232	0.0:0.1393:0.8607:0.0	.	232	Q9Y2K3	MYH15_HUMAN	K	232	ENSP00000273353:Q232K	ENSP00000273353:Q232K	Q	-	1	0	MYH15	109697394	1.000000	0.71417	0.046000	0.18839	0.038000	0.13279	3.583000	0.53928	1.188000	0.43014	0.655000	0.94253	CAA	MYH15	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000144821		0.408	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1		0.00	45	0	G	XM_036988		108214704	-1			no_errors	ENST00000273353	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
MYO1C	4641	genome.wustl.edu	37	17	1386153	1386153	+	Splice_Site	SNP	A	A	C	rs115519639	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:1386153A>C	ENST00000575158.1	-	4	618		c.e4+1		MYO1C_ENST00000573198.1_5'Flank|MYO1C_ENST00000545534.2_Splice_Site|MYO1C_ENST00000359786.5_Splice_Site|MYO1C_ENST00000361007.2_Splice_Site|MYO1C_ENST00000438665.2_Splice_Site			Q12965	MYO1E_HUMAN	myosin IC						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTGCCCCTCACCTCCAGCAC	0.682																																																	0													17.0	18.0	18.0					17																	1386153		2198	4282	6480	SO:0001630	splice_region_variant	0			X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.441+1T>G	17.37:g.1386153A>C			Q14778	Splice_Site	SNP	-	e4+2	ENST00000575158.1	37	c.546+2	CCDS11003.1	17	.	.	.	.	.	.	.	.	.	.	A	15.70	2.910766	0.52439	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.558	0.68115	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYO1C	1332903	1.000000	0.71417	1.000000	0.80357	0.365000	0.29674	9.270000	0.95690	2.032000	0.59987	0.334000	0.21626	.	MYO1C	-	-	ENSG00000197879		0.682	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1C	HGNC	protein_coding	OTTHUMT00000438694.2		0.00	17	0	A		Intron	1386153	-1			no_errors	ENST00000359786	ensembl	human	known	74_37	splice_site	17.86	23	5	SNP	1.000	C
MYO3A	53904	genome.wustl.edu	37	10	26443690	26443690	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:26443690G>T	ENST00000265944.5	+	25	2897	c.2731G>T	c.(2731-2733)Gcc>Tcc	p.A911S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	911	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CACTGGAGAAGCCACACGTCA	0.423																																																	0													112.0	110.0	111.0					10																	26443690		2203	4300	6503	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2731G>T	10.37:g.26443690G>T	ENSP00000265944:p.Ala911Ser		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.A911S	ENST00000265944.5	37	c.2731	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	G	0.296	-0.977104	0.02197	.	.	ENSG00000095777	ENST00000265944	T	0.77229	-1.08	5.56	0.452	0.16634	Myosin head, motor domain (2);	0.595363	0.19068	N	0.123569	T	0.40145	0.1105	N	0.01109	-1.01	0.09310	N	1	B	0.12013	0.005	B	0.19666	0.026	T	0.41052	-0.9530	10	0.07813	T	0.8	.	4.6714	0.12691	0.2621:0.0:0.3898:0.348	.	911	Q8NEV4	MYO3A_HUMAN	S	911	ENSP00000265944:A911S	ENSP00000265944:A911S	A	+	1	0	MYO3A	26483696	0.000000	0.05858	0.179000	0.23059	0.053000	0.15095	0.239000	0.18023	0.279000	0.22186	0.650000	0.86243	GCC	MYO3A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000095777		0.423	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1		0.00	46	0	G	NM_017433		26443690	+1			no_errors	ENST00000265944	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.002	T
NAPEPLD	222236	genome.wustl.edu	37	7	102760461	102760461	+	Silent	SNP	G	G	T	rs145880545		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:102760461G>T	ENST00000417955.1	-	3	658	c.504C>A	c.(502-504)tcC>tcA	p.S168S	NAPEPLD_ENST00000341533.4_Silent_p.S168S|NAPEPLD_ENST00000455523.2_Silent_p.S241S|NAPEPLD_ENST00000465647.1_Silent_p.S168S|NAPEPLD_ENST00000427257.1_Silent_p.S168S			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	168					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)	p.S168S(1)		endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TTGTGCACGGGGAACGACGAA	0.463																																																	1	Substitution - coding silent(1)	skin(1)											211.0	185.0	194.0					7																	102760461		2203	4300	6503	SO:0001819	synonymous_variant	0			BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.504C>A	7.37:g.102760461G>T			Q5CZ87|Q769K1	Silent	SNP	NULL	p.S241	ENST00000417955.1	37	c.723	CCDS5729.1	7																																																																																			NAPEPLD	-	NULL	ENSG00000161048		0.463	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NAPEPLD	HGNC	protein_coding	OTTHUMT00000347904.1		0.00	40	0	G	NM_198990		102760461	-1			no_errors	ENST00000455523	ensembl	human	known	74_37	silent	7.14	38	3	SNP	0.101	T
NBPF3	84224	genome.wustl.edu	37	1	21804677	21804677	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:21804677T>C	ENST00000318249.5	+	9	1383	c.1033T>C	c.(1033-1035)Tcc>Ccc	p.S345P	NBPF3_ENST00000454000.2_Missense_Mutation_p.S275P|NBPF3_ENST00000342104.5_Missense_Mutation_p.S370P|NBPF3_ENST00000318220.6_Missense_Mutation_p.S289P	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	345	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCCCCAGGAGTCCTGGGATGA	0.502																																																	0													126.0	129.0	128.0					1																	21804677		2203	4300	6503	SO:0001583	missense	0			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1033T>C	1.37:g.21804677T>C	ENSP00000316782:p.Ser345Pro		A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	pfam_NBPF_dom	p.S345P	ENST00000318249.5	37	c.1033	CCDS216.1	1	.	.	.	.	.	.	.	.	.	.	.	5.050	0.194914	0.09599	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000417552;ENST00000342104;ENST00000434838	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	1.13	-0.213	0.13165	DUF1220 (2);	.	.	.	.	T	0.51991	0.1707	M	0.79475	2.455	0.09310	N	1	B;P;D	0.63880	0.009;0.945;0.993	B;P;D	0.79108	0.025;0.82;0.992	T	0.36890	-0.9729	9	0.49607	T	0.09	.	3.0321	0.06110	0.3944:0.0:0.0:0.6056	.	275;370;345	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	P	275;289;345;289;370;289	ENSP00000415711:S275P;ENSP00000316739:S289P;ENSP00000316782:S345P;ENSP00000340336:S370P;ENSP00000391865:S289P	ENSP00000316739:S289P	S	+	1	0	NBPF3	21677264	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.683000	0.05179	-0.077000	0.12752	0.164000	0.16699	TCC	NBPF3	-	pfam_NBPF_dom	ENSG00000142794		0.502	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBPF3	HGNC	protein_coding		-	0.00	151	0	T	NM_032264		21804677	+1	tier1	-	no_errors	ENST00000318249	ensembl	human	known	74_37	missense	22.22	182	52	SNP	0.001	C
NCOR2	9612	genome.wustl.edu	37	12	124870324	124870324	+	Silent	SNP	G	G	T	rs369119404		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:124870324G>T	ENST00000405201.1	-	17	1986	c.1986C>A	c.(1984-1986)ctC>ctA	p.L662L	NCOR2_ENST00000404621.1_Silent_p.L661L|NCOR2_ENST00000429285.2_Silent_p.L661L|NCOR2_ENST00000356219.3_Silent_p.L662L|NCOR2_ENST00000404121.2_Silent_p.L232L|NCOR2_ENST00000397355.1_Silent_p.L662L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	662					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGATCTCATCGAGGTTCTGCC	0.587																																																	0													122.0	135.0	130.0					12																	124870324		2158	4251	6409	SO:0001819	synonymous_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1986C>A	12.37:g.124870324G>T			O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L662	ENST00000405201.1	37	c.1986	CCDS41858.2	12																																																																																			NCOR2	-	superfamily_Homeodomain-like	ENSG00000196498		0.587	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	31	0	G	NM_006312		124870324	-1			no_errors	ENST00000356219	ensembl	human	known	74_37	silent	8.82	31	3	SNP	0.997	T
NDUFS1	4719	genome.wustl.edu	37	2	207012367	207012367	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:207012367C>T	ENST00000233190.6	-	7	705	c.439G>A	c.(439-441)Gga>Aga	p.G147R	NDUFS1_ENST00000440274.1_Missense_Mutation_p.G111R|NDUFS1_ENST00000455934.2_Missense_Mutation_p.G161R|NDUFS1_ENST00000432169.1_Missense_Mutation_p.G36R|NDUFS1_ENST00000423725.1_Missense_Mutation_p.G90R|NDUFS1_ENST00000449699.1_Missense_Mutation_p.G147R|NDUFS1_ENST00000457011.1_Missense_Mutation_p.G31R	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	147					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTATCATTTCCAAACATCATG	0.383																																																	0													132.0	114.0	120.0					2																	207012367		2203	4300	6503	SO:0001583	missense	0				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.439G>A	2.37:g.207012367C>T	ENSP00000233190:p.Gly147Arg		B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	pfam_Mopterin_OxRdtase,pfam_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,pfam_NuoG_C,pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,smart_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,pfscan_2Fe-2S_ferredoxin-type,tigrfam_NADH_UbQ_OxRdtase_Gsu	p.G161R	ENST00000233190.6	37	c.481	CCDS2366.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956423	0.92726	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	4.76	4.76	0.60689	NADH:ubiquinone oxidoreductase, subunit G, iron-sulphur binding (2);	0.000000	0.85682	D	0.000000	D	0.93504	0.7927	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95275	0.8381	10	0.87932	D	0	-15.687	18.1342	0.89612	0.0:1.0:0.0:0.0	.	36;111;161;147	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	R	147;90;31;111;161;147;36	ENSP00000233190:G147R;ENSP00000397760:G90R;ENSP00000400976:G31R;ENSP00000409766:G111R;ENSP00000392709:G161R;ENSP00000399912:G147R;ENSP00000409689:G36R	ENSP00000233190:G147R	G	-	1	0	NDUFS1	206720612	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.332000	0.79248	0.591000	0.81541	GGA	NDUFS1	-	pfam_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,smart_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,tigrfam_NADH_UbQ_OxRdtase_Gsu	ENSG00000023228		0.383	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS1	HGNC	protein_coding	OTTHUMT00000256391.4	-	0.00	50	0	C	NM_005006		207012367	-1	tier1	-	no_errors	ENST00000455934	ensembl	human	known	74_37	missense	5.26	108	6	SNP	1.000	T
NDUFS1	4719	genome.wustl.edu	37	2	207012367	207012367	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:207012367C>T	ENST00000233190.6	-	7	705	c.439G>A	c.(439-441)Gga>Aga	p.G147R	NDUFS1_ENST00000440274.1_Missense_Mutation_p.G111R|NDUFS1_ENST00000455934.2_Missense_Mutation_p.G161R|NDUFS1_ENST00000432169.1_Missense_Mutation_p.G36R|NDUFS1_ENST00000423725.1_Missense_Mutation_p.G90R|NDUFS1_ENST00000449699.1_Missense_Mutation_p.G147R|NDUFS1_ENST00000457011.1_Missense_Mutation_p.G31R	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	147					apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTATCATTTCCAAACATCATG	0.383																																																	0													132.0	114.0	120.0					2																	207012367		2203	4300	6503	SO:0001583	missense	0				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.439G>A	2.37:g.207012367C>T	ENSP00000233190:p.Gly147Arg		B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Missense_Mutation	SNP	pfam_Mopterin_OxRdtase,pfam_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,pfam_NuoG_C,pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,smart_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,pfscan_2Fe-2S_ferredoxin-type,tigrfam_NADH_UbQ_OxRdtase_Gsu	p.G161R	ENST00000233190.6	37	c.481	CCDS2366.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956423	0.92726	.	.	ENSG00000023228	ENST00000233190;ENST00000423725;ENST00000457011;ENST00000440274;ENST00000455934;ENST00000449699;ENST00000432169	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	4.76	4.76	0.60689	NADH:ubiquinone oxidoreductase, subunit G, iron-sulphur binding (2);	0.000000	0.85682	D	0.000000	D	0.93504	0.7927	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95275	0.8381	10	0.87932	D	0	-15.687	18.1342	0.89612	0.0:1.0:0.0:0.0	.	36;111;161;147	B4DPG1;E7ENF3;B4DJA0;P28331	.;.;.;NDUS1_HUMAN	R	147;90;31;111;161;147;36	ENSP00000233190:G147R;ENSP00000397760:G90R;ENSP00000400976:G31R;ENSP00000409766:G111R;ENSP00000392709:G161R;ENSP00000399912:G147R;ENSP00000409689:G36R	ENSP00000233190:G147R	G	-	1	0	NDUFS1	206720612	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.332000	0.79248	0.591000	0.81541	GGA	NDUFS1	-	pfam_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,smart_NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd,tigrfam_NADH_UbQ_OxRdtase_Gsu	ENSG00000023228		0.383	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS1	HGNC	protein_coding	OTTHUMT00000256391.4	-	0.00	94	0	C	NM_005006		207012367	-1	tier1	-	no_errors	ENST00000455934	ensembl	human	known	74_37	missense	5.26	108	6	SNP	1.000	T
NES	10763	genome.wustl.edu	37	1	156646344	156646344	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:156646344C>T	ENST00000368223.3	-	1	845	c.713G>A	c.(712-714)cGc>cAc	p.R238H		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	238	Coil 2B.|Rod.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGCTGCCCTGCGCTCCAGGAG	0.716																																																	0													10.0	11.0	11.0					1																	156646344		2192	4291	6483	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.713G>A	1.37:g.156646344C>T	ENSP00000357206:p.Arg238His		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_IF	p.R238H	ENST00000368223.3	37	c.713	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024675	0.75390	.	.	ENSG00000132688	ENST00000368223;ENST00000255024	D	0.88818	-2.43	4.56	3.61	0.41365	Filament (1);	0.000000	0.34853	N	0.003621	D	0.90099	0.6907	L	0.53249	1.67	0.37248	D	0.906446	D	0.89917	1.0	D	0.79784	0.993	D	0.91197	0.4988	10	0.72032	D	0.01	.	12.4274	0.55556	0.1694:0.8306:0.0:0.0	.	238	P48681	NEST_HUMAN	H	238	ENSP00000357206:R238H	ENSP00000255024:R238H	R	-	2	0	NES	154912968	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.113000	0.31184	1.080000	0.41073	0.455000	0.32223	CGC	NES	-	pfam_IF	ENSG00000132688		0.716	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	-	0.00	54	0	C	NM_006617		156646344	-1	tier1	-	no_errors	ENST00000368223	ensembl	human	known	74_37	missense	32.76	39	19	SNP	0.788	T
NLRP11	204801	genome.wustl.edu	37	19	56329311	56329311	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56329311C>T	ENST00000589093.1	-	2	323	c.230G>A	c.(229-231)cGt>cAt	p.R77H	NLRP11_ENST00000443188.1_Missense_Mutation_p.R77H|NLRP11_ENST00000589824.2_Missense_Mutation_p.R77H|NLRP11_ENST00000592953.1_Intron|NLRP11_ENST00000360133.3_Missense_Mutation_p.R77H			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	77	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ATCTTCCTTACGCATCATTGA	0.453																																																	0													127.0	115.0	119.0					19																	56329311		2203	4300	6503	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.230G>A	19.37:g.56329311C>T	ENSP00000466285:p.Arg77His		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R77H	ENST00000589093.1	37	c.230	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	C	9.379	1.072422	0.20147	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.57907	0.37;0.37	2.84	-2.88	0.05682	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.31796	0.0808	N	0.25647	0.755	0.09310	N	1	P	0.36010	0.532	B	0.34779	0.189	T	0.16217	-1.0410	9	0.44086	T	0.13	.	4.0413	0.09753	0.0:0.3226:0.4109:0.2664	.	77	P59045	NAL11_HUMAN	H	77	ENSP00000409898:R77H;ENSP00000353251:R77H	ENSP00000353251:R77H	R	-	2	0	NLRP11	61021123	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.680000	0.00395	-0.647000	0.05444	0.650000	0.86243	CGT	NLRP11	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN	ENSG00000179873		0.453	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	-	0.00	25	0	C	NM_145007		56329311	-1	tier1	-	no_errors	ENST00000443188	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.000	T
NLRP11	204801	genome.wustl.edu	37	19	56329311	56329311	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56329311C>T	ENST00000589093.1	-	2	323	c.230G>A	c.(229-231)cGt>cAt	p.R77H	NLRP11_ENST00000443188.1_Missense_Mutation_p.R77H|NLRP11_ENST00000589824.2_Missense_Mutation_p.R77H|NLRP11_ENST00000592953.1_Intron|NLRP11_ENST00000360133.3_Missense_Mutation_p.R77H			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	77	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		ATCTTCCTTACGCATCATTGA	0.453																																																	0													127.0	115.0	119.0					19																	56329311		2203	4300	6503	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.230G>A	19.37:g.56329311C>T	ENSP00000466285:p.Arg77His		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R77H	ENST00000589093.1	37	c.230	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	C	9.379	1.072422	0.20147	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.57907	0.37;0.37	2.84	-2.88	0.05682	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.31796	0.0808	N	0.25647	0.755	0.09310	N	1	P	0.36010	0.532	B	0.34779	0.189	T	0.16217	-1.0410	9	0.44086	T	0.13	.	4.0413	0.09753	0.0:0.3226:0.4109:0.2664	.	77	P59045	NAL11_HUMAN	H	77	ENSP00000409898:R77H;ENSP00000353251:R77H	ENSP00000353251:R77H	R	-	2	0	NLRP11	61021123	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.680000	0.00395	-0.647000	0.05444	0.650000	0.86243	CGT	NLRP11	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN	ENSG00000179873		0.453	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	-	0.00	28	0	C	NM_145007		56329311	-1	tier1	-	no_errors	ENST00000443188	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.000	T
NLRP8	126205	genome.wustl.edu	37	19	56467321	56467321	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56467321G>T	ENST00000291971.3	+	3	1968	c.1897G>T	c.(1897-1899)Gtc>Ttc	p.V633F	NLRP8_ENST00000590542.1_Missense_Mutation_p.V633F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	633					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCATAAAGTTGTCTTGAGAAT	0.463																																																	0													124.0	116.0	119.0					19																	56467321		2203	4300	6503	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1897G>T	19.37:g.56467321G>T	ENSP00000291971:p.Val633Phe		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.V633F	ENST00000291971.3	37	c.1897	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413205	0.25465	.	.	ENSG00000179709	ENST00000291971	D	0.87571	-2.27	2.03	-3.94	0.04130	.	.	.	.	.	T	0.81631	0.4863	L	0.46157	1.445	0.09310	N	1	P;B	0.42785	0.79;0.08	P;B	0.44990	0.466;0.029	T	0.72481	-0.4280	9	0.54805	T	0.06	.	4.7461	0.13038	0.2735:0.2128:0.5137:0.0	.	633;633	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	633	ENSP00000291971:V633F	ENSP00000291971:V633F	V	+	1	0	NLRP8	61159133	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.168000	0.00574	-1.137000	0.02888	-0.507000	0.04495	GTC	NLRP8	-	NULL	ENSG00000179709		0.463	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	-	0.00	36	0	G	NM_176811		56467321	+1	tier1	-	no_errors	ENST00000291971	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
NLRP8	126205	genome.wustl.edu	37	19	56467321	56467321	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56467321G>T	ENST00000291971.3	+	3	1968	c.1897G>T	c.(1897-1899)Gtc>Ttc	p.V633F	NLRP8_ENST00000590542.1_Missense_Mutation_p.V633F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	633					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCATAAAGTTGTCTTGAGAAT	0.463																																																	0													124.0	116.0	119.0					19																	56467321		2203	4300	6503	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1897G>T	19.37:g.56467321G>T	ENSP00000291971:p.Val633Phe		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.V633F	ENST00000291971.3	37	c.1897	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413205	0.25465	.	.	ENSG00000179709	ENST00000291971	D	0.87571	-2.27	2.03	-3.94	0.04130	.	.	.	.	.	T	0.81631	0.4863	L	0.46157	1.445	0.09310	N	1	P;B	0.42785	0.79;0.08	P;B	0.44990	0.466;0.029	T	0.72481	-0.4280	9	0.54805	T	0.06	.	4.7461	0.13038	0.2735:0.2128:0.5137:0.0	.	633;633	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	633	ENSP00000291971:V633F	ENSP00000291971:V633F	V	+	1	0	NLRP8	61159133	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.168000	0.00574	-1.137000	0.02888	-0.507000	0.04495	GTC	NLRP8	-	NULL	ENSG00000179709		0.463	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	-	0.00	48	0	G	NM_176811		56467321	+1	tier1	-	no_errors	ENST00000291971	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
NOP14	8602	genome.wustl.edu	37	4	2956259	2956259	+	Silent	SNP	G	G	T	rs375727243		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:2956259G>T	ENST00000314262.6	-	4	552	c.504C>A	c.(502-504)ggC>ggA	p.G168G	NOP14_ENST00000502735.1_Silent_p.G168G|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000416614.2_Silent_p.G168G|NOP14_ENST00000398071.4_Silent_p.G168G	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	168					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						GGAGCCCACCGCCTCCTCCAA	0.567																																																	0													69.0	67.0	67.0					4																	2956259		2203	4300	6503	SO:0001819	synonymous_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.504C>A	4.37:g.2956259G>T			D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	pfam_Nop14	p.G168	ENST00000314262.6	37	c.504	CCDS33945.1	4																																																																																			NOP14	-	pfam_Nop14	ENSG00000087269		0.567	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2		0.00	32	0	G	NM_003703		2956259	-1			no_errors	ENST00000416614	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.002	T
NRXN1	9378	genome.wustl.edu	37	2	50758518	50758518	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:50758518G>T	ENST00000406316.2	-	11	3670	c.2194C>A	c.(2194-2196)Ccc>Acc	p.P732T	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401669.2_Missense_Mutation_p.P732T|NRXN1_ENST00000404971.1_Missense_Mutation_p.P772T|NRXN1_ENST00000406859.3_Missense_Mutation_p.P732T|NRXN1_ENST00000405472.3_Missense_Mutation_p.P724T|NRXN1_ENST00000402717.3_Missense_Mutation_p.P724T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	732	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGACTACGGGGAGCTGAATT	0.453																																																	0													49.0	51.0	50.0					2																	50758518		1970	4185	6155	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2194C>A	2.37:g.50758518G>T	ENSP00000384311:p.Pro732Thr		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.P724T	ENST00000406316.2	37	c.2170	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561332	0.65538	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.89188	0.6644	M	0.77406	2.37	0.58432	D	0.99999	P;D;P	0.89917	0.747;1.0;0.838	P;D;P	0.91635	0.528;0.999;0.494	D	0.84040	0.0364	10	0.10636	T	0.68	.	20.3316	0.98722	0.0:0.0:1.0:0.0	.	772;732;724	Q9ULB1-3;F8WB18;A7E294	.;.;.	T	772;732;724;732;773;724;732	ENSP00000385142:P772T;ENSP00000384311:P732T;ENSP00000434015:P724T;ENSP00000385017:P732T;ENSP00000385434:P724T;ENSP00000385681:P732T	ENSP00000385017:P732T	P	-	1	0	NRXN1	50612022	1.000000	0.71417	0.985000	0.45067	0.266000	0.26442	7.846000	0.86887	2.871000	0.98454	0.655000	0.94253	CCC	NRXN1	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000179915		0.453	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	31	0	G			50758518	-1	tier1	-	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50758518	50758518	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:50758518G>T	ENST00000406316.2	-	11	3670	c.2194C>A	c.(2194-2196)Ccc>Acc	p.P732T	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401669.2_Missense_Mutation_p.P732T|NRXN1_ENST00000404971.1_Missense_Mutation_p.P772T|NRXN1_ENST00000406859.3_Missense_Mutation_p.P732T|NRXN1_ENST00000405472.3_Missense_Mutation_p.P724T|NRXN1_ENST00000402717.3_Missense_Mutation_p.P724T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	732	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGACTACGGGGAGCTGAATT	0.453																																																	0													49.0	51.0	50.0					2																	50758518		1970	4185	6155	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2194C>A	2.37:g.50758518G>T	ENSP00000384311:p.Pro732Thr		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.P724T	ENST00000406316.2	37	c.2170	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561332	0.65538	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.89188	0.6644	M	0.77406	2.37	0.58432	D	0.99999	P;D;P	0.89917	0.747;1.0;0.838	P;D;P	0.91635	0.528;0.999;0.494	D	0.84040	0.0364	10	0.10636	T	0.68	.	20.3316	0.98722	0.0:0.0:1.0:0.0	.	772;732;724	Q9ULB1-3;F8WB18;A7E294	.;.;.	T	772;732;724;732;773;724;732	ENSP00000385142:P772T;ENSP00000384311:P732T;ENSP00000434015:P724T;ENSP00000385017:P732T;ENSP00000385434:P724T;ENSP00000385681:P732T	ENSP00000385017:P732T	P	-	1	0	NRXN1	50612022	1.000000	0.71417	0.985000	0.45067	0.266000	0.26442	7.846000	0.86887	2.871000	0.98454	0.655000	0.94253	CCC	NRXN1	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000179915		0.453	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	45	0	G			50758518	-1	tier1	-	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176678794	176678794	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:176678794G>T	ENST00000439151.2	+	12	4750	c.4705G>T	c.(4705-4707)Gag>Tag	p.E1569*	NSD1_ENST00000354179.4_Nonsense_Mutation_p.E1300*|NSD1_ENST00000361032.4_Nonsense_Mutation_p.E1466*|NSD1_ENST00000347982.4_Nonsense_Mutation_p.E1300*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1569					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTTCCACCTGGAGTGCCTTGG	0.418			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													125.0	122.0	123.0					5																	176678794		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4705G>T	5.37:g.176678794G>T	ENSP00000395929:p.Glu1569*		Q96PD8|Q96RN7	Nonsense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.E1569*	ENST00000439151.2	37	c.4705	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	43	9.944863	0.99302	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.18	4.24	0.50183	.	0.097480	0.45361	D	0.000361	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	14.9365	0.70960	0.0:0.2685:0.7315:0.0	.	.	.	.	X	1300;1569;1300;1466	.	ENSP00000343209:E1300X	E	+	1	0	NSD1	176611400	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.057000	0.41365	2.586000	0.87340	0.655000	0.94253	GAG	NSD1	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000165671		0.418	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	53	0	G	NM_172349		176678794	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	nonsense	31.43	48	22	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176709523	176709523	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:176709523C>T	ENST00000439151.2	+	19	5995	c.5950C>T	c.(5950-5952)Cga>Tga	p.R1984*	NSD1_ENST00000347982.4_Nonsense_Mutation_p.R1715*|NSD1_ENST00000354179.4_Nonsense_Mutation_p.R1715*|NSD1_ENST00000361032.4_Nonsense_Mutation_p.R1881*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1984	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.		R -> Q (in SOTOS1; loss of enzyme activity). {ECO:0000269|PubMed:12807965}.		gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATGCAGAGCTCGAATTCGCTA	0.373			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0			GRCh37	CM043040|CM051589	NSD1	M							211.0	206.0	208.0					5																	176709523		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5950C>T	5.37:g.176709523C>T	ENSP00000395929:p.Arg1984*		Q96PD8|Q96RN7	Nonsense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R1984*	ENST00000439151.2	37	c.5950	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	C	45	11.810564	0.99605	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.77	5.77	0.91146	.	0.000000	0.48767	D	0.000166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5706	0.76333	0.1385:0.8615:0.0:0.0	.	.	.	.	X	1715;1984;1715;1881	.	ENSP00000343209:R1715X	R	+	1	2	NSD1	176642129	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.468000	0.45102	2.884000	0.98904	0.655000	0.94253	CGA	NSD1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000165671		0.373	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	41	0	C	NM_172349		176709523	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	nonsense	22.22	28	8	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154061967	154061967	+	Nonsense_Mutation	SNP	G	G	T	rs199580130		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:154061967G>T	ENST00000368559.3	-	16	2362	c.2291C>A	c.(2290-2292)tCa>tAa	p.S764*	NUP210L_ENST00000271854.3_Nonsense_Mutation_p.S764*	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	764					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGGAGTTACTGACATACTGGC	0.493																																																	0													150.0	147.0	148.0					1																	154061967		1965	4157	6122	SO:0001587	stop_gained	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2291C>A	1.37:g.154061967G>T	ENSP00000357547:p.Ser764*		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Nonsense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.S764*	ENST00000368559.3	37	c.2291	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908716	0.92107	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	.	.	.	4.56	2.66	0.31614	.	0.150260	0.30940	N	0.008580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	0.0073	8.0931	0.30811	0.192:0.0:0.808:0.0	.	.	.	.	X	764	.	ENSP00000271854:S764X	S	-	2	0	NUP210L	152328591	0.997000	0.39634	0.516000	0.27786	0.242000	0.25591	2.982000	0.49337	0.525000	0.28522	-0.384000	0.06662	TCA	NUP210L	-	NULL	ENSG00000143552		0.493	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	43	0	G	NM_207308		154061967	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	0.819	T
NUP210L	91181	genome.wustl.edu	37	1	154061967	154061967	+	Nonsense_Mutation	SNP	G	G	T	rs199580130		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:154061967G>T	ENST00000368559.3	-	16	2362	c.2291C>A	c.(2290-2292)tCa>tAa	p.S764*	NUP210L_ENST00000271854.3_Nonsense_Mutation_p.S764*	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	764					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGGAGTTACTGACATACTGGC	0.493																																																	0													150.0	147.0	148.0					1																	154061967		1965	4157	6122	SO:0001587	stop_gained	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2291C>A	1.37:g.154061967G>T	ENSP00000357547:p.Ser764*		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Nonsense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.S764*	ENST00000368559.3	37	c.2291	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908716	0.92107	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	.	.	.	4.56	2.66	0.31614	.	0.150260	0.30940	N	0.008580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	0.0073	8.0931	0.30811	0.192:0.0:0.808:0.0	.	.	.	.	X	764	.	ENSP00000271854:S764X	S	-	2	0	NUP210L	152328591	0.997000	0.39634	0.516000	0.27786	0.242000	0.25591	2.982000	0.49337	0.525000	0.28522	-0.384000	0.06662	TCA	NUP210L	-	NULL	ENSG00000143552		0.493	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	67	0	G	NM_207308		154061967	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	0.819	T
NSL1	25936	genome.wustl.edu	37	1	212911901	212911901	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:212911901G>T	ENST00000366977.3	-	6	713	c.695C>A	c.(694-696)cCt>cAt	p.P232H	NSL1_ENST00000366976.1_3'UTR|NSL1_ENST00000422588.2_3'UTR|NSL1_ENST00000366978.1_Intron|NSL1_ENST00000366975.6_Missense_Mutation_p.P191H	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	232					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AAAGTTCTCAGGTTTAGCATC	0.443																																																	0													169.0	172.0	171.0					1																	212911901		2203	4300	6503	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.695C>A	1.37:g.212911901G>T	ENSP00000355944:p.Pro232His		E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.P232H	ENST00000366977.3	37	c.695	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839946	0.32513	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.34667	1.35;1.36	5.25	4.34	0.51931	.	0.669453	0.14180	N	0.336082	T	0.52837	0.1759	M	0.61703	1.905	0.20926	N	0.999822	D;D	0.76494	0.999;0.998	D;P	0.69479	0.964;0.87	T	0.40384	-0.9566	10	0.66056	D	0.02	-4.0E-4	8.033	0.30476	0.1925:0.0:0.8075:0.0	.	191;232	B4E071;Q96IY1	.;NSL1_HUMAN	H	232;191	ENSP00000355944:P232H;ENSP00000355942:P191H	ENSP00000355942:P191H	P	-	2	0	NSL1	210978524	0.371000	0.25056	0.015000	0.15790	0.446000	0.32137	2.050000	0.41297	1.349000	0.45751	-0.266000	0.10368	CCT	NSL1	-	NULL	ENSG00000117697		0.443	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	-	0.00	57	0	G	NM_015471		212911901	-1	tier1	-	no_errors	ENST00000366977	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.051	T
NUTM1	256646	genome.wustl.edu	37	15	34648679	34648679	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:34648679G>A	ENST00000333756.4	+	7	2541	c.2386G>A	c.(2386-2388)Gcc>Acc	p.A796T	NUTM1_ENST00000438749.3_Missense_Mutation_p.A814T|NUTM1_ENST00000537011.1_Missense_Mutation_p.A824T	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	796						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TGCGGCAGCTGCCCTAGAAAA	0.547																																																	0													51.0	54.0	53.0					15																	34648679		2201	4298	6499	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2386G>A	15.37:g.34648679G>A	ENSP00000329448:p.Ala796Thr		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.A796T	ENST00000333756.4	37	c.2386	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693508	0.48202	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.09445	2.98;2.98;2.99	4.94	2.98	0.34508	.	0.522665	0.17690	N	0.165301	T	0.08935	0.0221	L	0.39898	1.24	0.09310	N	1	B;B;B	0.24963	0.07;0.115;0.07	B;B;B	0.23419	0.021;0.046;0.021	T	0.21314	-1.0249	10	0.66056	D	0.02	.	5.8933	0.18925	0.1059:0.2126:0.6815:0.0	.	814;824;796	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	T	824;814;796	ENSP00000444896:A824T;ENSP00000407031:A814T;ENSP00000329448:A796T	ENSP00000329448:A796T	A	+	1	0	C15orf55	32435971	0.000000	0.05858	0.005000	0.12908	0.291000	0.27294	0.125000	0.15749	1.316000	0.45131	0.555000	0.69702	GCC	NUTM1	-	NULL	ENSG00000184507		0.547	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1	-	0.00	11	0	G	NM_175741		34648679	+1	tier1	-	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.008	A
NUTM1	256646	genome.wustl.edu	37	15	34648679	34648679	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:34648679G>A	ENST00000333756.4	+	7	2541	c.2386G>A	c.(2386-2388)Gcc>Acc	p.A796T	NUTM1_ENST00000438749.3_Missense_Mutation_p.A814T|NUTM1_ENST00000537011.1_Missense_Mutation_p.A824T	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	796						cytoplasm (GO:0005737)|nucleus (GO:0005634)											TGCGGCAGCTGCCCTAGAAAA	0.547																																																	0													51.0	54.0	53.0					15																	34648679		2201	4298	6499	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2386G>A	15.37:g.34648679G>A	ENSP00000329448:p.Ala796Thr		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.A796T	ENST00000333756.4	37	c.2386	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693508	0.48202	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.09445	2.98;2.98;2.99	4.94	2.98	0.34508	.	0.522665	0.17690	N	0.165301	T	0.08935	0.0221	L	0.39898	1.24	0.09310	N	1	B;B;B	0.24963	0.07;0.115;0.07	B;B;B	0.23419	0.021;0.046;0.021	T	0.21314	-1.0249	10	0.66056	D	0.02	.	5.8933	0.18925	0.1059:0.2126:0.6815:0.0	.	814;824;796	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	T	824;814;796	ENSP00000444896:A824T;ENSP00000407031:A814T;ENSP00000329448:A796T	ENSP00000329448:A796T	A	+	1	0	C15orf55	32435971	0.000000	0.05858	0.005000	0.12908	0.291000	0.27294	0.125000	0.15749	1.316000	0.45131	0.555000	0.69702	GCC	NUTM1	-	NULL	ENSG00000184507		0.547	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1	-	0.00	26	0	G	NM_175741		34648679	+1	tier1	-	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.008	A
OR10G2	26534	genome.wustl.edu	37	14	22102857	22102857	+	Missense_Mutation	SNP	G	G	A	rs372221393		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:22102857G>A	ENST00000542433.1	-	1	239	c.142C>T	c.(142-144)Ctc>Ttc	p.L48F		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		AGCAGAATGAGCAGGTTCCCC	0.512																																																	0								G	PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	74.0	72.0	73.0		142	2.9	1.0	14		73	0,8600		0,0,4300	no	missense	OR10G2	NM_001005466.1	22	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	48/311	22102857	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.142C>T	14.37:g.22102857G>A	ENSP00000445383:p.Leu48Phe		B2RPD0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L48F	ENST00000542433.1	37	c.142	CCDS32047.1	14	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828776	0.32329	2.27E-4	0.0	ENSG00000255582	ENST00000542433	T	0.02787	4.16	3.79	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39146	N	0.001441	T	0.05227	0.0139	M	0.73753	2.245	0.30530	N	0.767525	B	0.17852	0.024	B	0.22152	0.038	T	0.01504	-1.1338	10	0.66056	D	0.02	-15.6012	9.4611	0.38785	0.1126:0.0:0.8874:0.0	.	48	Q8NGC3	O10G2_HUMAN	F	48	ENSP00000445383:L48F	ENSP00000445383:L48F	L	-	1	0	OR10G2	21172697	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.121000	0.10643	1.941000	0.56285	0.563000	0.77884	CTC	OR10G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000255582		0.512	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G2	HGNC	protein_coding	OTTHUMT00000401525.1	-	0.00	31	0	G			22102857	-1	tier1	-	no_errors	ENST00000542433	ensembl	human	known	74_37	missense	29.07	61	25	SNP	0.999	A
OR2B6	26212	genome.wustl.edu	37	6	27925709	27925709	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:27925709G>T	ENST00000244623.1	+	1	691	c.691G>T	c.(691-693)Gct>Tct	p.A231S		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GATACAGTCTGCTGAAGGTCG	0.428																																																	0													188.0	182.0	184.0					6																	27925709		2203	4300	6503	SO:0001583	missense	0			U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.691G>T	6.37:g.27925709G>T	ENSP00000244623:p.Ala231Ser		O43883|Q6IF89|Q9H5B0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A231S	ENST00000244623.1	37	c.691	CCDS4642.1	6	.	.	.	.	.	.	.	.	.	.	g	6.707	0.499132	0.12762	.	.	ENSG00000124657	ENST00000244623	T	0.00174	8.62	3.55	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.242522	0.20369	U	0.093696	T	0.00109	0.0003	N	0.20530	0.585	0.25312	N	0.989193	B	0.27380	0.177	P	0.48571	0.582	T	0.46978	-0.9152	10	0.28530	T	0.3	.	13.417	0.60974	0.0:0.0:1.0:0.0	.	231	P58173	OR2B6_HUMAN	S	231	ENSP00000244623:A231S	ENSP00000244623:A231S	A	+	1	0	OR2B6	28033688	0.000000	0.05858	0.339000	0.25562	0.169000	0.22640	0.823000	0.27366	1.898000	0.54952	0.467000	0.42956	GCT	OR2B6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000124657		0.428	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B6	HGNC	protein_coding	OTTHUMT00000040165.1	-	0.00	32	0	G			27925709	+1	tier1	-	no_errors	ENST00000244623	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.874	T
OR2B6	26212	genome.wustl.edu	37	6	27925709	27925709	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:27925709G>T	ENST00000244623.1	+	1	691	c.691G>T	c.(691-693)Gct>Tct	p.A231S		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GATACAGTCTGCTGAAGGTCG	0.428																																																	0													188.0	182.0	184.0					6																	27925709		2203	4300	6503	SO:0001583	missense	0			U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.691G>T	6.37:g.27925709G>T	ENSP00000244623:p.Ala231Ser		O43883|Q6IF89|Q9H5B0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A231S	ENST00000244623.1	37	c.691	CCDS4642.1	6	.	.	.	.	.	.	.	.	.	.	g	6.707	0.499132	0.12762	.	.	ENSG00000124657	ENST00000244623	T	0.00174	8.62	3.55	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.242522	0.20369	U	0.093696	T	0.00109	0.0003	N	0.20530	0.585	0.25312	N	0.989193	B	0.27380	0.177	P	0.48571	0.582	T	0.46978	-0.9152	10	0.28530	T	0.3	.	13.417	0.60974	0.0:0.0:1.0:0.0	.	231	P58173	OR2B6_HUMAN	S	231	ENSP00000244623:A231S	ENSP00000244623:A231S	A	+	1	0	OR2B6	28033688	0.000000	0.05858	0.339000	0.25562	0.169000	0.22640	0.823000	0.27366	1.898000	0.54952	0.467000	0.42956	GCT	OR2B6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000124657		0.428	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B6	HGNC	protein_coding	OTTHUMT00000040165.1	-	0.00	49	0	G			27925709	+1	tier1	-	no_errors	ENST00000244623	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.874	T
OR2G3	81469	genome.wustl.edu	37	1	247769044	247769044	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:247769044C>A	ENST00000320002.2	+	1	189	c.157C>A	c.(157-159)Ccc>Acc	p.P53T	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATATCTGGATCCCCCTCTTCA	0.453																																																	0													271.0	265.0	267.0					1																	247769044		2203	4300	6503	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.157C>A	1.37:g.247769044C>A	ENSP00000326301:p.Pro53Thr		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P53T	ENST00000320002.2	37	c.157	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	C	7.878	0.729523	0.15507	.	.	ENSG00000177476	ENST00000320002	T	0.03982	3.74	3.57	-2.27	0.06846	GPCR, rhodopsin-like superfamily (1);	0.214360	0.22806	U	0.055401	T	0.05090	0.0136	M	0.62723	1.935	0.09310	N	1	B	0.23540	0.087	B	0.26969	0.075	T	0.28586	-1.0039	10	0.45353	T	0.12	.	4.5252	0.11978	0.0:0.2939:0.3047:0.4014	.	53	Q8NGZ4	OR2G3_HUMAN	T	53	ENSP00000326301:P53T	ENSP00000326301:P53T	P	+	1	0	OR2G3	245835667	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-1.548000	0.02184	-0.621000	0.05633	0.486000	0.48141	CCC	OR2G3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177476		0.453	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	-	0.00	34	0	C			247769044	+1	tier1	-	no_errors	ENST00000320002	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.000	A
OR2G3	81469	genome.wustl.edu	37	1	247769044	247769044	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:247769044C>A	ENST00000320002.2	+	1	189	c.157C>A	c.(157-159)Ccc>Acc	p.P53T	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATATCTGGATCCCCCTCTTCA	0.453																																																	0													271.0	265.0	267.0					1																	247769044		2203	4300	6503	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.157C>A	1.37:g.247769044C>A	ENSP00000326301:p.Pro53Thr		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P53T	ENST00000320002.2	37	c.157	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	C	7.878	0.729523	0.15507	.	.	ENSG00000177476	ENST00000320002	T	0.03982	3.74	3.57	-2.27	0.06846	GPCR, rhodopsin-like superfamily (1);	0.214360	0.22806	U	0.055401	T	0.05090	0.0136	M	0.62723	1.935	0.09310	N	1	B	0.23540	0.087	B	0.26969	0.075	T	0.28586	-1.0039	10	0.45353	T	0.12	.	4.5252	0.11978	0.0:0.2939:0.3047:0.4014	.	53	Q8NGZ4	OR2G3_HUMAN	T	53	ENSP00000326301:P53T	ENSP00000326301:P53T	P	+	1	0	OR2G3	245835667	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-1.548000	0.02184	-0.621000	0.05633	0.486000	0.48141	CCC	OR2G3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177476		0.453	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	-	0.00	47	0	C			247769044	+1	tier1	-	no_errors	ENST00000320002	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.000	A
OR52E8	390079	genome.wustl.edu	37	11	5878582	5878582	+	Silent	SNP	C	C	T	rs144473097	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:5878582C>T	ENST00000537935.1	-	1	382	c.351G>A	c.(349-351)gaG>gaA	p.E117E	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACACAATGCTCTCCATAGCAG	0.453																																																	0													193.0	210.0	204.0					11																	5878582		2153	4296	6449	SO:0001819	synonymous_variant	0			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.351G>A	11.37:g.5878582C>T			B9EH38	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E117	ENST00000537935.1	37	c.351	CCDS31400.1	11																																																																																			OR52E8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183269		0.453	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	HGNC	protein_coding	OTTHUMT00000401145.1	-	0.00	62	0	C	NM_001005168		5878582	-1	tier1	-	no_errors	ENST00000537935	ensembl	human	known	74_37	silent	23.53	52	16	SNP	0.026	T
OR52E8	390079	genome.wustl.edu	37	11	5878582	5878582	+	Silent	SNP	C	C	T	rs144473097	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:5878582C>T	ENST00000537935.1	-	1	382	c.351G>A	c.(349-351)gaG>gaA	p.E117E	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACACAATGCTCTCCATAGCAG	0.453																																																	0													193.0	210.0	204.0					11																	5878582		2153	4296	6449	SO:0001819	synonymous_variant	0			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.351G>A	11.37:g.5878582C>T			B9EH38	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E117	ENST00000537935.1	37	c.351	CCDS31400.1	11																																																																																			OR52E8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183269		0.453	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	HGNC	protein_coding	OTTHUMT00000401145.1	-	0.00	76	0	C	NM_001005168		5878582	-1	tier1	-	no_errors	ENST00000537935	ensembl	human	known	74_37	silent	23.53	52	16	SNP	0.026	T
OR4C5	79346	genome.wustl.edu	37	11	48387258	48387258	+	Missense_Mutation	SNP	C	C	T	rs78030134		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:48387258C>T	ENST00000319813.3	-	1	759	c.760G>A	c.(760-762)Gcc>Acc	p.A254T				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										ATATGGAAGGCGCAGGTAGAG	0.458																																																	0																																										SO:0001583	missense	0					11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.760G>A	11.37:g.48387258C>T	ENSP00000321338:p.Ala254Thr		Q6IFB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A254T	ENST00000319813.3	37	c.760		11	.	.	.	.	.	.	.	.	.	.	C	9.594	1.126928	0.20959	.	.	ENSG00000176540	ENST00000319813	T	0.36878	1.23	5.45	-1.18	0.09617	.	0.766856	0.11868	N	0.521706	T	0.14270	0.0345	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25117	-1.0141	7	0.12766	T	0.61	.	2.2861	0.04126	0.1182:0.3925:0.116:0.3733	.	.	.	.	T	254	ENSP00000321338:A254T	ENSP00000321338:A254T	A	-	1	0	OR4C5	48343834	0.000000	0.05858	0.549000	0.28204	0.683000	0.39861	-2.926000	0.00691	-0.081000	0.12662	-0.341000	0.08007	GCC	OR4C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176540		0.458	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	HGNC	protein_coding	OTTHUMT00000404174.1	-	0.00	39	0	C	NG_002247		48387258	-1	tier1	rs78030134	no_errors	ENST00000319813	ensembl	human	known	74_37	missense	11.94	59	8	SNP	0.001	T
OR4C5	79346	genome.wustl.edu	37	11	48387262	48387262	+	Silent	SNP	G	G	A	rs75430864	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:48387262G>A	ENST00000319813.3	-	1	755	c.756C>T	c.(754-756)acC>acT	p.T252T				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GGAAGGCGCAGGTAGAGAGAG	0.458																																																	0																																										SO:0001819	synonymous_variant	0					11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.756C>T	11.37:g.48387262G>A			Q6IFB2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T252	ENST00000319813.3	37	c.756		11																																																																																			OR4C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176540		0.458	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	HGNC	protein_coding	OTTHUMT00000404174.1	-	0.00	38	0	G	NG_002247		48387262	-1	tier1	rs75430864	no_errors	ENST00000319813	ensembl	human	known	74_37	silent	12.31	57	8	SNP	1.000	A
OR4C11	219429	genome.wustl.edu	37	11	55371492	55371492	+	Missense_Mutation	SNP	G	G	A	rs139149255	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:55371492G>A	ENST00000302231.4	-	1	382	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R120C(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						GCCACATAGCGATCAACAGCC	0.433													g|||	3	0.000599042	0.0	0.0	5008	,	,		14367	0.002		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)						G	CYS/ARG	7,4351		1,5,2173	92.0	77.0	83.0		358	3.4	1.0	11	dbSNP_134	83	0,8012		0,0,4006	yes	missense	OR4C11	NM_001004700.2	180	1,5,6179	AA,AG,GG		0.0,0.1606,0.0566	possibly-damaging	120/311	55371492	7,12363	2179	4006	6185	SO:0001583	missense	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.358C>T	11.37:g.55371492G>A	ENSP00000306651:p.Arg120Cys		B9EIL4|Q8NGL8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R120C	ENST00000302231.4	37	c.358	CCDS31503.1	11	.	.	.	.	.	.	.	.	.	.	G	8.061	0.768116	0.15983	0.001606	0.0	ENSG00000172188	ENST00000302231	T	0.77358	-1.09	4.34	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	U	0.000140	T	0.76535	0.4001	M	0.85945	2.785	0.35847	D	0.826489	B	0.27971	0.196	B	0.18561	0.022	T	0.80381	-0.1406	10	0.66056	D	0.02	.	9.6689	0.40000	0.0:0.0:0.6221:0.3779	.	120	Q6IEV9	OR4CB_HUMAN	C	120	ENSP00000306651:R120C	ENSP00000306651:R120C	R	-	1	0	OR4C11	55128068	0.454000	0.25728	0.988000	0.46212	0.114000	0.19823	1.490000	0.35573	1.171000	0.42768	0.478000	0.44815	CGC	OR4C11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172188		0.433	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	-	0.00	19	0	G	NM_001004700		55371492	-1	tier1	rs139149255	no_errors	ENST00000302231	ensembl	human	known	74_37	missense	66.67	11	22	SNP	0.999	A
OR4C11	219429	genome.wustl.edu	37	11	55371492	55371492	+	Missense_Mutation	SNP	G	G	A	rs139149255	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:55371492G>A	ENST00000302231.4	-	1	382	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R120C(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						GCCACATAGCGATCAACAGCC	0.433													g|||	3	0.000599042	0.0	0.0	5008	,	,		14367	0.002		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)						G	CYS/ARG	7,4351		1,5,2173	92.0	77.0	83.0		358	3.4	1.0	11	dbSNP_134	83	0,8012		0,0,4006	yes	missense	OR4C11	NM_001004700.2	180	1,5,6179	AA,AG,GG		0.0,0.1606,0.0566	possibly-damaging	120/311	55371492	7,12363	2179	4006	6185	SO:0001583	missense	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.358C>T	11.37:g.55371492G>A	ENSP00000306651:p.Arg120Cys		B9EIL4|Q8NGL8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R120C	ENST00000302231.4	37	c.358	CCDS31503.1	11	.	.	.	.	.	.	.	.	.	.	G	8.061	0.768116	0.15983	0.001606	0.0	ENSG00000172188	ENST00000302231	T	0.77358	-1.09	4.34	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	U	0.000140	T	0.76535	0.4001	M	0.85945	2.785	0.35847	D	0.826489	B	0.27971	0.196	B	0.18561	0.022	T	0.80381	-0.1406	10	0.66056	D	0.02	.	9.6689	0.40000	0.0:0.0:0.6221:0.3779	.	120	Q6IEV9	OR4CB_HUMAN	C	120	ENSP00000306651:R120C	ENSP00000306651:R120C	R	-	1	0	OR4C11	55128068	0.454000	0.25728	0.988000	0.46212	0.114000	0.19823	1.490000	0.35573	1.171000	0.42768	0.478000	0.44815	CGC	OR4C11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172188		0.433	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	-	0.00	35	0	G	NM_001004700		55371492	-1	tier1	rs139149255	no_errors	ENST00000302231	ensembl	human	known	74_37	missense	66.67	11	22	SNP	0.999	A
OSBPL8	114882	genome.wustl.edu	37	12	76881290	76881290	+	Splice_Site	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:76881290C>T	ENST00000261183.3	-	2	521	c.42G>A	c.(40-42)tcG>tcA	p.S14S	OSBPL8_ENST00000393249.2_5'UTR|OSBPL8_ENST00000393250.4_5'UTR|OSBPL8_ENST00000552178.1_5'Flank	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	14					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						AACTACTCACCGAAGTTCGAT	0.353																																																	0													95.0	79.0	85.0					12																	76881290		2203	4300	6503	SO:0001630	splice_region_variant	0			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.42+1G>A	12.37:g.76881290C>T			A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S14	ENST00000261183.3	37	c.42	CCDS31862.1	12																																																																																			OSBPL8	-	NULL	ENSG00000091039		0.353	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	-	0.00	42	0	C	NM_020841	Silent	76881290	-1	tier1	-	no_errors	ENST00000261183	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
OSBPL8	114882	genome.wustl.edu	37	12	76881290	76881290	+	Splice_Site	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:76881290C>T	ENST00000261183.3	-	2	521	c.42G>A	c.(40-42)tcG>tcA	p.S14S	OSBPL8_ENST00000393249.2_5'UTR|OSBPL8_ENST00000393250.4_5'UTR|OSBPL8_ENST00000552178.1_5'Flank	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	14					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						AACTACTCACCGAAGTTCGAT	0.353																																																	0													95.0	79.0	85.0					12																	76881290		2203	4300	6503	SO:0001630	splice_region_variant	0			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.42+1G>A	12.37:g.76881290C>T			A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S14	ENST00000261183.3	37	c.42	CCDS31862.1	12																																																																																			OSBPL8	-	NULL	ENSG00000091039		0.353	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	-	0.00	69	0	C	NM_020841	Silent	76881290	-1	tier1	-	no_errors	ENST00000261183	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
PAMR1	25891	genome.wustl.edu	37	11	35492294	35492294	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:35492294G>A	ENST00000378880.2	-	5	1012	c.567C>T	c.(565-567)aaC>aaT	p.N189N	PAMR1_ENST00000534803.1_5'UTR|PAMR1_ENST00000278360.3_Silent_p.N189N|PAMR1_ENST00000378878.3_Intron|PAMR1_ENST00000532848.1_Silent_p.N149N	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	189	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						GGCCATCGCGGTTGTCTCCAT	0.542																																																	0													147.0	109.0	122.0					11																	35492294		2202	4298	6500	SO:0001819	synonymous_variant	0				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.567C>T	11.37:g.35492294G>A			A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_EG-like_dom,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1	p.N189	ENST00000378880.2	37	c.567	CCDS31460.1	11																																																																																			PAMR1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000149090		0.542	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1	-	0.00	29	0	G	NM_015430		35492294	-1	tier1	-	no_errors	ENST00000278360	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.966	A
PAPPA2	60676	genome.wustl.edu	37	1	176659352	176659352	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:176659352G>T	ENST00000367662.3	+	5	3381	c.2217G>T	c.(2215-2217)ctG>ctT	p.L739L	PAPPA2_ENST00000367661.3_Silent_p.L739L	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	739	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GACATGTTCTGGGACTCTACC	0.502																																																	0													123.0	120.0	121.0					1																	176659352		2080	4248	6328	SO:0001819	synonymous_variant	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2217G>T	1.37:g.176659352G>T			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.L739	ENST00000367662.3	37	c.2217	CCDS41438.1	1																																																																																			PAPPA2	-	pfam_Peptidase_M43	ENSG00000116183		0.502	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	35	0	G			176659352	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	silent	31.43	23	11	SNP	1.000	T
PCSK5	5125	genome.wustl.edu	37	9	78925663	78925663	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:78925663G>A	ENST00000545128.1	+	29	4237	c.3699G>A	c.(3697-3699)gaG>gaA	p.E1233E		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1233	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ACTGTACGGAGGCCTGTGCCA	0.562																																																	0													38.0	35.0	36.0					9																	78925663		876	1991	2867	SO:0001819	synonymous_variant	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3699G>A	9.37:g.78925663G>A			F5H2G7|Q13527|Q96EP4	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.E1233	ENST00000545128.1	37	c.3699	CCDS55320.1	9																																																																																			PCSK5	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000099139		0.562	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	22	0	G			78925663	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	silent	30.56	25	11	SNP	0.981	A
PCSK5	5125	genome.wustl.edu	37	9	78925663	78925663	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:78925663G>A	ENST00000545128.1	+	29	4237	c.3699G>A	c.(3697-3699)gaG>gaA	p.E1233E		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1233	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ACTGTACGGAGGCCTGTGCCA	0.562																																																	0													38.0	35.0	36.0					9																	78925663		876	1991	2867	SO:0001819	synonymous_variant	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.3699G>A	9.37:g.78925663G>A			F5H2G7|Q13527|Q96EP4	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.E1233	ENST00000545128.1	37	c.3699	CCDS55320.1	9																																																																																			PCSK5	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000099139		0.562	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	37	0	G			78925663	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	silent	30.56	25	11	SNP	0.981	A
PFAS	5198	genome.wustl.edu	37	17	8172309	8172309	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:8172309G>T	ENST00000314666.6	+	28	3877	c.3744G>T	c.(3742-3744)caG>caT	p.Q1248H	PFAS_ENST00000545834.1_Missense_Mutation_p.Q824H	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1248	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TCCAAGCTCAGATTGAGGCCA	0.597																																																	0													84.0	86.0	85.0					17																	8172309		2203	4300	6503	SO:0001583	missense	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3744G>T	17.37:g.8172309G>T	ENSP00000313490:p.Gln1248His		A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.Q1248H	ENST00000314666.6	37	c.3744	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382216	0.24944	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.31769	1.48;2.22	5.48	2.41	0.29592	Glutamine amidotransferase type 1 (1);	0.428115	0.23706	N	0.045361	T	0.19685	0.0473	L	0.33753	1.03	0.23972	N	0.996304	B	0.15719	0.014	B	0.17098	0.017	T	0.15636	-1.0430	10	0.72032	D	0.01	-11.8135	4.0713	0.09884	0.2457:0.0:0.5817:0.1726	.	1248	O15067	PUR4_HUMAN	H	824;1248;657	ENSP00000441706:Q824H;ENSP00000313490:Q1248H	ENSP00000313490:Q1248H	Q	+	3	2	PFAS	8113034	0.981000	0.34729	1.000000	0.80357	0.756000	0.42949	0.497000	0.22514	1.307000	0.44944	0.563000	0.77884	CAG	PFAS	-	tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.597	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	-	0.00	38	0	G			8172309	+1	tier1	-	no_errors	ENST00000314666	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.983	T
PFAS	5198	genome.wustl.edu	37	17	8172309	8172309	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:8172309G>T	ENST00000314666.6	+	28	3877	c.3744G>T	c.(3742-3744)caG>caT	p.Q1248H	PFAS_ENST00000545834.1_Missense_Mutation_p.Q824H	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1248	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TCCAAGCTCAGATTGAGGCCA	0.597																																																	0													84.0	86.0	85.0					17																	8172309		2203	4300	6503	SO:0001583	missense	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3744G>T	17.37:g.8172309G>T	ENSP00000313490:p.Gln1248His		A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.Q1248H	ENST00000314666.6	37	c.3744	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382216	0.24944	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.31769	1.48;2.22	5.48	2.41	0.29592	Glutamine amidotransferase type 1 (1);	0.428115	0.23706	N	0.045361	T	0.19685	0.0473	L	0.33753	1.03	0.23972	N	0.996304	B	0.15719	0.014	B	0.17098	0.017	T	0.15636	-1.0430	10	0.72032	D	0.01	-11.8135	4.0713	0.09884	0.2457:0.0:0.5817:0.1726	.	1248	O15067	PUR4_HUMAN	H	824;1248;657	ENSP00000441706:Q824H;ENSP00000313490:Q1248H	ENSP00000313490:Q1248H	Q	+	3	2	PFAS	8113034	0.981000	0.34729	1.000000	0.80357	0.756000	0.42949	0.497000	0.22514	1.307000	0.44944	0.563000	0.77884	CAG	PFAS	-	tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.597	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	-	0.00	81	0	G			8172309	+1	tier1	-	no_errors	ENST00000314666	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.983	T
JADE2	23338	genome.wustl.edu	37	5	133873737	133873737	+	Silent	SNP	G	G	T	rs115719583	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:133873737G>T	ENST00000402835.1	+	3	372	c.117G>T	c.(115-117)tcG>tcT	p.S39S	PHF15_ENST00000282605.4_Silent_p.S39S|PHF15_ENST00000395003.1_Silent_p.S39S|PHF15_ENST00000361895.2_Silent_p.S39S																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCACCAAGTCGGGCTGGCCCC	0.587																																																	0													72.0	68.0	70.0					5																	133873737		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000402835.1:c.117G>T	5.37:g.133873737G>T				Silent	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S39	ENST00000402835.1	37	c.117		5																																																																																			PHF15	-	NULL	ENSG00000043143		0.587	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	PHF15	HGNC	protein_coding	OTTHUMT00000318543.1		0.00	25	0	G			133873737	+1			no_errors	ENST00000395003	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.858	T
PHF19	26147	genome.wustl.edu	37	9	123632125	123632125	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:123632125G>T	ENST00000373896.3	-	5	715	c.463C>A	c.(463-465)Cgg>Agg	p.R155R	PHF19_ENST00000312189.6_Silent_p.R155R|PHF19_ENST00000487555.1_5'Flank|PHF19_ENST00000419155.1_5'Flank	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	155					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGGCTCACCCGCACAGCCAGT	0.627																																																	0													57.0	47.0	50.0					9																	123632125		2202	4300	6502	SO:0001819	synonymous_variant	0			BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.463C>A	9.37:g.123632125G>T			Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD	p.R155	ENST00000373896.3	37	c.463	CCDS35116.1	9																																																																																			PHF19	-	superfamily_Znf_FYVE_PHD	ENSG00000119403		0.627	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF19	HGNC	protein_coding	OTTHUMT00000053838.3	-	0.00	41	0	G	XM_045308		123632125	-1	tier1	-	no_errors	ENST00000373896	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	T
PIAS4	51588	genome.wustl.edu	37	19	4033481	4033481	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:4033481G>A	ENST00000262971.2	+	9	1160	c.1045G>A	c.(1045-1047)Gac>Aac	p.D349N		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	349					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGTGCTTCGACGCCGTCTT	0.657																																																	0													39.0	34.0	35.0					19																	4033481		2189	4293	6482	SO:0001583	missense	0			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.1045G>A	19.37:g.4033481G>A	ENSP00000262971:p.Asp349Asn		O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.D349N	ENST00000262971.2	37	c.1045	CCDS12118.1	19	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704638	0.88924	.	.	ENSG00000105229	ENST00000262971	T	0.17054	2.3	4.21	3.14	0.36123	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (2);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66300	-0.5958	10	0.87932	D	0	-24.5098	12.1986	0.54311	0.0:0.0:0.828:0.172	.	349	Q8N2W9	PIAS4_HUMAN	N	349	ENSP00000262971:D349N	ENSP00000262971:D349N	D	+	1	0	PIAS4	3984481	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.755000	0.98912	0.734000	0.32515	0.561000	0.74099	GAC	PIAS4	-	pfam_Znf_MIZ,pfscan_Znf_MIZ	ENSG00000105229		0.657	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS4	HGNC	protein_coding	OTTHUMT00000457496.1	-	0.00	37	0	G	NM_015897		4033481	+1	tier1	-	no_errors	ENST00000262971	ensembl	human	known	74_37	missense	16.95	47	10	SNP	1.000	A
PIAS4	51588	genome.wustl.edu	37	19	4033481	4033481	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:4033481G>A	ENST00000262971.2	+	9	1160	c.1045G>A	c.(1045-1047)Gac>Aac	p.D349N		NM_015897.2	NP_056981.2	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	349					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(3)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGTGCTTCGACGCCGTCTT	0.657																																																	0													39.0	34.0	35.0					19																	4033481		2189	4293	6482	SO:0001583	missense	0			AF077952	CCDS12118.1	19p13.3	2011-10-11						"""Zinc fingers, MIZ-type"""	17002	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 6"""	605989				9724754	Standard	NM_015897		Approved	Piasg, PIASY, FLJ12419, ZMIZ6	uc002lzg.3	Q8N2W9		ENST00000262971.2:c.1045G>A	19.37:g.4033481G>A	ENSP00000262971:p.Asp349Asn		O75926|Q96G19|Q9UN16	Missense_Mutation	SNP	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.D349N	ENST00000262971.2	37	c.1045	CCDS12118.1	19	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704638	0.88924	.	.	ENSG00000105229	ENST00000262971	T	0.17054	2.3	4.21	3.14	0.36123	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (2);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66300	-0.5958	10	0.87932	D	0	-24.5098	12.1986	0.54311	0.0:0.0:0.828:0.172	.	349	Q8N2W9	PIAS4_HUMAN	N	349	ENSP00000262971:D349N	ENSP00000262971:D349N	D	+	1	0	PIAS4	3984481	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.755000	0.98912	0.734000	0.32515	0.561000	0.74099	GAC	PIAS4	-	pfam_Znf_MIZ,pfscan_Znf_MIZ	ENSG00000105229		0.657	PIAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS4	HGNC	protein_coding	OTTHUMT00000457496.1	-	0.00	50	0	G	NM_015897		4033481	+1	tier1	-	no_errors	ENST00000262971	ensembl	human	known	74_37	missense	16.95	47	10	SNP	1.000	A
PITX3	5309	genome.wustl.edu	37	10	103990330	103990330	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:103990330C>G	ENST00000370002.3	-	4	1003	c.850G>C	c.(850-852)Ggg>Cgg	p.G284R	PITX3_ENST00000539804.1_Missense_Mutation_p.G284R	NM_005029.3	NP_005020.1	O75364	PITX3_HUMAN	paired-like homeodomain 3	284					dopaminergic neuron differentiation (GO:0071542)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|locomotory behavior (GO:0007626)|midbrain development (GO:0030901)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|large_intestine(2)|lung(2)	5		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GGGGGCGGCCCGTGCACAGCG	0.677																																																	0													27.0	29.0	28.0					10																	103990330		2201	4299	6500	SO:0001583	missense	0				CCDS7532.1	10q24.32	2013-11-14	2007-07-12		ENSG00000107859	ENSG00000107859		"""Homeoboxes / PRD class"""	9006	protein-coding gene	gene with protein product		602669	"""paired-like homeodomain transcription factor 3"", ""anterior segment mesenchymal dysgenesis"""	ASMD		9620774	Standard	NM_005029		Approved		uc001kuu.1	O75364	OTTHUMG00000018952	ENST00000370002.3:c.850G>C	10.37:g.103990330C>G	ENSP00000359019:p.Gly284Arg		Q5VZL2	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Pitx/unc30,pfscan_OAR_dom,pfscan_Homeobox_dom	p.G284R	ENST00000370002.3	37	c.850	CCDS7532.1	10	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704043	0.48412	.	.	ENSG00000107859	ENST00000370002;ENST00000539804	D;D	0.88975	-2.45;-2.45	5.15	4.24	0.50183	.	0.253842	0.39274	N	0.001404	D	0.85531	0.5718	N	0.08118	0	0.30817	N	0.738175	D	0.76494	0.999	D	0.68192	0.956	T	0.82159	-0.0595	10	0.45353	T	0.12	.	8.6224	0.33868	0.0:0.8973:0.0:0.1027	.	284	O75364	PITX3_HUMAN	R	284	ENSP00000359019:G284R;ENSP00000439383:G284R	ENSP00000359019:G284R	G	-	1	0	PITX3	103980320	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.225000	0.32551	2.387000	0.81309	0.555000	0.69702	GGG	PITX3	-	pirsf_Homeobox_Pitx/unc30	ENSG00000107859		0.677	PITX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PITX3	HGNC	protein_coding	OTTHUMT00000050031.1	-	0.00	44	0	C			103990330	-1	tier1	-	no_errors	ENST00000370002	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	G
PKDREJ	10343	genome.wustl.edu	37	22	46653089	46653089	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:46653089G>T	ENST00000253255.5	-	1	6130	c.6131C>A	c.(6130-6132)tCt>tAt	p.S2044Y		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	2044					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATCTACCTGAGAAACTGCATG	0.418																																																	0													83.0	86.0	85.0					22																	46653089		2203	4300	6503	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.6131C>A	22.37:g.46653089G>T	ENSP00000253255:p.Ser2044Tyr		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.S2044Y	ENST00000253255.5	37	c.6131	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869725	0.51588	.	.	ENSG00000130943	ENST00000253255	T	0.72051	-0.62	5.81	5.81	0.92471	Polycystin cation channel, PKD1/PKD2 (1);	0.543328	0.18109	N	0.151412	D	0.82921	0.5142	M	0.65975	2.015	0.18873	N	0.999983	D	0.89917	1.0	D	0.70487	0.969	T	0.76049	-0.3101	10	0.72032	D	0.01	-9.1588	16.8074	0.85709	0.0:0.0:1.0:0.0	.	2044	Q9NTG1	PKDRE_HUMAN	Y	2044	ENSP00000253255:S2044Y	ENSP00000253255:S2044Y	S	-	2	0	PKDREJ	45031753	0.999000	0.42202	0.038000	0.18304	0.525000	0.34531	4.539000	0.60657	2.758000	0.94735	0.508000	0.49915	TCT	PKDREJ	-	pfam_PKD1_2_channel,pfam_Ion_trans_dom	ENSG00000130943		0.418	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1		0.00	17	0	G	NM_006071		46653089	-1			no_errors	ENST00000253255	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.103	T
PLEKHM1P	440456	genome.wustl.edu	37	17	62811071	62811071	+	RNA	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:62811071G>T	ENST00000582986.1	-	0	614				RN7SL409P_ENST00000579918.1_RNA	NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										CCACTTCTCTGGCTGTCTCGC	0.622																																																	0																																												0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62811071G>T				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.622	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	-	0.00	20	0	G	NR_024386		62811071	-1	tier1	-	no_errors	ENST00000580919	ensembl	human	known	74_37	rna	15.52	49	9	SNP	0.002	T
PLEKHM1P	440456	genome.wustl.edu	37	17	62811071	62811071	+	RNA	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:62811071G>T	ENST00000582986.1	-	0	614				RN7SL409P_ENST00000579918.1_RNA	NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										CCACTTCTCTGGCTGTCTCGC	0.622																																																	0																																												0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62811071G>T				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.622	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	-	0.00	42	0	G	NR_024386		62811071	-1	tier1	-	no_errors	ENST00000580919	ensembl	human	known	74_37	rna	15.52	49	9	SNP	0.002	T
POLG	5428	genome.wustl.edu	37	15	89869959	89869959	+	Silent	SNP	G	G	T	rs199856571		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:89869959G>T	ENST00000268124.5	-	9	1929	c.1596C>A	c.(1594-1596)ccC>ccA	p.P532P	POLG_ENST00000442287.2_Silent_p.P532P	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	532					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CCTCACTGCAGGGGCCGAGGT	0.602								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)												0													55.0	59.0	58.0					15																	89869959		2200	4299	6499	SO:0001819	synonymous_variant	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.1596C>A	15.37:g.89869959G>T			Q8NFM2|Q92515	Silent	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.P532	ENST00000268124.5	37	c.1596	CCDS10350.1	15																																																																																			POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub	ENSG00000140521		0.602	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	-	0.00	32	0	G	NM_002693		89869959	-1	tier1	-	no_errors	ENST00000268124	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.190	T
POLG	5428	genome.wustl.edu	37	15	89869959	89869959	+	Silent	SNP	G	G	T	rs199856571		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:89869959G>T	ENST00000268124.5	-	9	1929	c.1596C>A	c.(1594-1596)ccC>ccA	p.P532P	POLG_ENST00000442287.2_Silent_p.P532P	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	532					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CCTCACTGCAGGGGCCGAGGT	0.602								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)												0													55.0	59.0	58.0					15																	89869959		2200	4299	6499	SO:0001819	synonymous_variant	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.1596C>A	15.37:g.89869959G>T			Q8NFM2|Q92515	Silent	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.P532	ENST00000268124.5	37	c.1596	CCDS10350.1	15																																																																																			POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub	ENSG00000140521		0.602	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	-	0.00	52	0	G	NM_002693		89869959	-1	tier1	-	no_errors	ENST00000268124	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.190	T
POLQ	10721	genome.wustl.edu	37	3	121208707	121208707	+	Missense_Mutation	SNP	T	T	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:121208707T>G	ENST00000264233.5	-	16	3199	c.3071A>C	c.(3070-3072)aAa>aCa	p.K1024T		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1024					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		AGGTGCCTTTTTTGTTTTCTG	0.408								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													72.0	81.0	78.0					3																	121208707		2202	4300	6502	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3071A>C	3.37:g.121208707T>G	ENSP00000264233:p.Lys1024Thr		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.K1024T	ENST00000264233.5	37	c.3071	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	T	10.59	1.392554	0.25118	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.55760	0.5	5.11	1.46	0.22682	.	0.851711	0.10795	N	0.633293	T	0.48519	0.1504	L	0.29908	0.895	0.18873	N	0.999986	B;D	0.61080	0.085;0.989	B;P	0.55923	0.023;0.787	T	0.30446	-0.9978	10	0.34782	T	0.22	.	4.8078	0.13328	0.0:0.1622:0.3063:0.5315	.	1024;196	O75417;O75417-2	DPOLQ_HUMAN;.	T	647;1024;1160	ENSP00000264233:K1024T	ENSP00000264233:K1024T	K	-	2	0	POLQ	122691397	1.000000	0.71417	0.969000	0.41365	0.005000	0.04900	2.031000	0.41117	0.104000	0.17725	-0.460000	0.05396	AAA	POLQ	-	NULL	ENSG00000051341		0.408	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1		0.00	27	0	T	NM_199420		121208707	-1			no_errors	ENST00000264233	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.615	G
POLR1B	84172	genome.wustl.edu	37	2	113306968	113306968	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:113306968C>A	ENST00000263331.5	+	4	1197	c.617C>A	c.(616-618)aCt>aAt	p.T206N	POLR1B_ENST00000541869.1_Missense_Mutation_p.T244N|POLR1B_ENST00000417433.2_Missense_Mutation_p.T150N|POLR1B_ENST00000409894.3_Missense_Mutation_p.T206N|POLR1B_ENST00000537335.1_Intron	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	206					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CCTGGTTATACTCAGTATGGT	0.318																																					Ovarian(16;256 576 9537 23969 41147)												0													36.0	38.0	37.0					2																	113306968		2203	4300	6503	SO:0001583	missense	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.617C>A	2.37:g.113306968C>A	ENSP00000263331:p.Thr206Asn		B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.T244N	ENST00000263331.5	37	c.731	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430163	0.83776	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000417433	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.48	4.6	0.57074	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90092	0.6905	M	0.92169	3.28	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.995;1.0	D;D;D;D	0.97110	0.993;0.995;0.988;1.0	D	0.91866	0.5503	10	0.66056	D	0.02	-25.2384	13.3107	0.60378	0.0:0.9227:0.0:0.0773	.	244;206;150;206	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	N	206;244;206;150	ENSP00000263331:T206N;ENSP00000444136:T244N;ENSP00000387143:T206N;ENSP00000405358:T150N	ENSP00000263331:T206N	T	+	2	0	POLR1B	113023439	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.763000	0.85283	1.320000	0.45209	0.655000	0.94253	ACT	POLR1B	-	pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2	ENSG00000125630		0.318	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	-	0.00	73	0	C	NM_019014		113306968	+1	tier1	-	no_errors	ENST00000541869	ensembl	human	known	74_37	missense	27.27	88	33	SNP	1.000	A
POLR1B	84172	genome.wustl.edu	37	2	113306968	113306968	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:113306968C>A	ENST00000263331.5	+	4	1197	c.617C>A	c.(616-618)aCt>aAt	p.T206N	POLR1B_ENST00000541869.1_Missense_Mutation_p.T244N|POLR1B_ENST00000417433.2_Missense_Mutation_p.T150N|POLR1B_ENST00000409894.3_Missense_Mutation_p.T206N|POLR1B_ENST00000537335.1_Intron	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	206					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CCTGGTTATACTCAGTATGGT	0.318																																					Ovarian(16;256 576 9537 23969 41147)												0													36.0	38.0	37.0					2																	113306968		2203	4300	6503	SO:0001583	missense	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.617C>A	2.37:g.113306968C>A	ENSP00000263331:p.Thr206Asn		B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.T244N	ENST00000263331.5	37	c.731	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430163	0.83776	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000417433	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.48	4.6	0.57074	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90092	0.6905	M	0.92169	3.28	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.995;1.0	D;D;D;D	0.97110	0.993;0.995;0.988;1.0	D	0.91866	0.5503	10	0.66056	D	0.02	-25.2384	13.3107	0.60378	0.0:0.9227:0.0:0.0773	.	244;206;150;206	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	N	206;244;206;150	ENSP00000263331:T206N;ENSP00000444136:T244N;ENSP00000387143:T206N;ENSP00000405358:T150N	ENSP00000263331:T206N	T	+	2	0	POLR1B	113023439	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.763000	0.85283	1.320000	0.45209	0.655000	0.94253	ACT	POLR1B	-	pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2	ENSG00000125630		0.318	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	-	0.00	92	0	C	NM_019014		113306968	+1	tier1	-	no_errors	ENST00000541869	ensembl	human	known	74_37	missense	27.27	88	33	SNP	1.000	A
POTEF	728378	genome.wustl.edu	37	2	130832231	130832231	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:130832231C>A	ENST00000409914.2	-	17	3213	c.2814G>T	c.(2812-2814)aaG>aaT	p.K938N	POTEF_ENST00000357462.5_Missense_Mutation_p.K938N	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	938	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCTCGTAGCTCTTCTCTAGGG	0.607																																																	0													26.0	29.0	28.0					2																	130832231		2069	4143	6212	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2814G>T	2.37:g.130832231C>A	ENSP00000386786:p.Lys938Asn		A6NC34	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.K938N	ENST00000409914.2	37	c.2814	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	15.66	2.898038	0.52227	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.94687	-3.49;-3.49	.	.	.	.	.	.	.	.	D	0.96926	0.8996	M	0.93678	3.445	0.80722	D	1	D	0.60160	0.987	D	0.65773	0.938	D	0.94767	0.7941	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	938	A5A3E0	POTEF_HUMAN	N	938	ENSP00000350052:K938N;ENSP00000386786:K938N	ENSP00000350052:K938N	K	-	3	2	POTEF	130548701	1.000000	0.71417	0.251000	0.24312	0.254000	0.26022	3.696000	0.54757	0.119000	0.18210	0.121000	0.15741	AAG	POTEF	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000196604		0.607	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	-	0.00	46	0	C	NM_001099771		130832231	-1	tier1	-	no_errors	ENST00000357462	ensembl	human	known	74_37	missense	26.98	46	17	SNP	1.000	A
POTEF	728378	genome.wustl.edu	37	2	130832231	130832231	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:130832231C>A	ENST00000409914.2	-	17	3213	c.2814G>T	c.(2812-2814)aaG>aaT	p.K938N	POTEF_ENST00000357462.5_Missense_Mutation_p.K938N	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	938	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCTCGTAGCTCTTCTCTAGGG	0.607																																																	0													26.0	29.0	28.0					2																	130832231		2069	4143	6212	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2814G>T	2.37:g.130832231C>A	ENSP00000386786:p.Lys938Asn		A6NC34	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.K938N	ENST00000409914.2	37	c.2814	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	15.66	2.898038	0.52227	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.94687	-3.49;-3.49	.	.	.	.	.	.	.	.	D	0.96926	0.8996	M	0.93678	3.445	0.80722	D	1	D	0.60160	0.987	D	0.65773	0.938	D	0.94767	0.7941	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	938	A5A3E0	POTEF_HUMAN	N	938	ENSP00000350052:K938N;ENSP00000386786:K938N	ENSP00000350052:K938N	K	-	3	2	POTEF	130548701	1.000000	0.71417	0.251000	0.24312	0.254000	0.26022	3.696000	0.54757	0.119000	0.18210	0.121000	0.15741	AAG	POTEF	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000196604		0.607	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	-	0.00	80	0	C	NM_001099771		130832231	-1	tier1	-	no_errors	ENST00000357462	ensembl	human	known	74_37	missense	26.98	46	17	SNP	1.000	A
PPM1F	9647	genome.wustl.edu	37	22	22285609	22285609	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:22285609G>A	ENST00000263212.5	-	6	907	c.802C>T	c.(802-804)Cac>Tac	p.H268Y	PPM1F_ENST00000538191.1_Missense_Mutation_p.H164Y|PPM1F_ENST00000407142.1_Missense_Mutation_p.H100Y|PPM1F_ENST00000397495.4_Missense_Mutation_p.H268Y	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	268					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		CAGGCGACGTGCAGGGTCGCT	0.617																																																	0													99.0	77.0	85.0					22																	22285609		2203	4300	6503	SO:0001583	missense	0			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.802C>T	22.37:g.22285609G>A	ENSP00000263212:p.His268Tyr		A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.H268Y	ENST00000263212.5	37	c.802	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	G	1.567	-0.535070	0.04082	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	4.84	3.81	0.43845	Protein phosphatase 2C-like (5);	0.285598	0.38005	N	0.001854	T	0.02571	0.0078	N	0.00122	-2.065	0.36095	D	0.843753	B;B;B	0.15930	0.001;0.015;0.004	B;B;B	0.17098	0.002;0.017;0.017	T	0.38672	-0.9650	10	0.02654	T	1	-20.0027	13.878	0.63665	0.0743:0.0:0.9257:0.0	.	164;268;268	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	Y	268;100;100;164;268	ENSP00000263212:H268Y;ENSP00000384930:H100Y;ENSP00000439915:H164Y;ENSP00000380632:H268Y	ENSP00000263212:H268Y	H	-	1	0	PPM1F	20615609	1.000000	0.71417	0.981000	0.43875	0.321000	0.28281	3.190000	0.50973	1.406000	0.46857	0.561000	0.74099	CAC	PPM1F	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000100034		0.617	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	HGNC	protein_coding	OTTHUMT00000320267.2	-	0.00	28	0	G	NM_014634		22285609	-1	tier1	-	no_errors	ENST00000263212	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.897	A
PPM1F	9647	genome.wustl.edu	37	22	22285609	22285609	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr22:22285609G>A	ENST00000263212.5	-	6	907	c.802C>T	c.(802-804)Cac>Tac	p.H268Y	PPM1F_ENST00000538191.1_Missense_Mutation_p.H164Y|PPM1F_ENST00000407142.1_Missense_Mutation_p.H100Y|PPM1F_ENST00000397495.4_Missense_Mutation_p.H268Y	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	268					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		CAGGCGACGTGCAGGGTCGCT	0.617																																																	0													99.0	77.0	85.0					22																	22285609		2203	4300	6503	SO:0001583	missense	0			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.802C>T	22.37:g.22285609G>A	ENSP00000263212:p.His268Tyr		A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.H268Y	ENST00000263212.5	37	c.802	CCDS13796.1	22	.	.	.	.	.	.	.	.	.	.	G	1.567	-0.535070	0.04082	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	4.84	3.81	0.43845	Protein phosphatase 2C-like (5);	0.285598	0.38005	N	0.001854	T	0.02571	0.0078	N	0.00122	-2.065	0.36095	D	0.843753	B;B;B	0.15930	0.001;0.015;0.004	B;B;B	0.17098	0.002;0.017;0.017	T	0.38672	-0.9650	10	0.02654	T	1	-20.0027	13.878	0.63665	0.0743:0.0:0.9257:0.0	.	164;268;268	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	Y	268;100;100;164;268	ENSP00000263212:H268Y;ENSP00000384930:H100Y;ENSP00000439915:H164Y;ENSP00000380632:H268Y	ENSP00000263212:H268Y	H	-	1	0	PPM1F	20615609	1.000000	0.71417	0.981000	0.43875	0.321000	0.28281	3.190000	0.50973	1.406000	0.46857	0.561000	0.74099	CAC	PPM1F	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000100034		0.617	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1F	HGNC	protein_coding	OTTHUMT00000320267.2	-	0.00	42	0	G	NM_014634		22285609	-1	tier1	-	no_errors	ENST00000263212	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.897	A
PRAMEF5	343068	genome.wustl.edu	37	1	13366043	13366043	+	Missense_Mutation	SNP	T	T	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:13366043T>C	ENST00000376168.1	+	3	587	c.487T>C	c.(487-489)Tac>Cac	p.Y163H		NM_001013407.1	NP_001013425.1	Q5TYX0	PRAM5_HUMAN	PRAME family member 5	163					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					central_nervous_system(1)|kidney(3)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGATGAATACCTCACCTG	0.473																																																	0													1.0	1.0	1.0					1																	13366043		14	23	37	SO:0001583	missense	0				CCDS72708.1	1p36.21	2014-07-15			ENSG00000204502			"""-"""	27995	protein-coding gene	gene with protein product			"""PRAME family member 23"""	PRAMEF23			Standard	NM_001013407		Approved	PRAMEF5L	uc001auu.1	Q5TYX0	OTTHUMG00000009505	ENST00000376168.1:c.487T>C	1.37:g.13366043T>C	ENSP00000365338:p.Tyr163His		A2BDD6|A4FU31	Missense_Mutation	SNP	NULL	p.Y163H	ENST00000376168.1	37	c.487	CCDS30596.1	1	.	.	.	.	.	.	.	.	.	.	.	6.256	0.415292	0.11870	.	.	ENSG00000204502	ENST00000376168	T	0.04917	3.53	1.13	1.13	0.20643	.	0.307559	0.30940	N	0.008569	T	0.03095	0.0091	N	0.12471	0.22	0.80722	P	0.0	.	.	.	.	.	.	T	0.34976	-0.9807	7	0.19147	T	0.46	.	4.4783	0.11755	0.0:0.0:0.0:1.0	.	.	.	.	H	163	ENSP00000365338:Y163H	ENSP00000365338:Y163H	Y	+	1	0	PRAMEF5	13238630	0.002000	0.14202	0.002000	0.10522	0.164000	0.22412	1.152000	0.31663	0.768000	0.33290	0.136000	0.15936	TAC	PRAMEF5	-	NULL	ENSG00000204502		0.473	PRAMEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF5	HGNC	protein_coding	OTTHUMT00000026271.1	-	0.00	9	0	T	NM_001013407		13366043	+1	tier1	-	no_errors	ENST00000376168	ensembl	human	known	74_37	missense	50.00	3	3	SNP	0.002	C
PRPF40B	25766	genome.wustl.edu	37	12	50036107	50036108	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:50036107_50036108GC>TT	ENST00000380281.1	+	19	1972_1973	c.1908_1909GC>TT	c.(1906-1911)atGCtg>atTTtg	p.M636I	PRPF40B_ENST00000261897.1_Missense_Mutation_p.M623I|PRPF40B_ENST00000548825.2_Missense_Mutation_p.M658I|FMNL3_ENST00000335154.5_3'UTR			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	636	FF 6.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						TTCGAAGCATGCTGAGGCAGGC	0.649																																																	0																																										SO:0001583	missense	0			AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		Exception_encountered	12.37:g.50036107_50036108delinsTT	ENSP00000369634:p.Met636Ile		O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation|Silent	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.M658I|p.L659	ENST00000380281.1	37	c.1974|c.1975		12																																																																																			PRPF40B	-	superfamily_FF_domain,smart_FF_domain	ENSG00000110844		0.649	PRPF40B-001	KNOWN	basic	protein_coding	PRPF40B	HGNC	protein_coding	OTTHUMT00000404838.1	-	0.00	14|13	0	G|C	NM_012272		50036107|50036108	+1	tier1	-	no_errors	ENST00000548825	ensembl	human	known	74_37	missense|silent	18.52	22	5	SNP	1.000	T
PRRT1	80863	genome.wustl.edu	37	6	32116781	32116781	+	3'UTR	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:32116781G>A	ENST00000211413.5	-	0	1263				PRRT1_ENST00000375152.2_3'UTR|PRRT1_ENST00000375150.2_3'UTR|PRRT1_ENST00000467780.1_5'UTR	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1						response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						CCCGGAAAGCGGCGTCCCTGG	0.637																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.*218C>T	6.37:g.32116781G>A			A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	RNA	SNP	-	NULL	ENST00000211413.5	37	NULL	CCDS4739.1	6																																																																																			PRRT1	-	-	ENSG00000204314		0.637	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2	-	0.00	48	0	G	NM_030651		32116781	-1	tier1	-	no_errors	ENST00000467780	ensembl	human	known	74_37	rna	22.97	57	17	SNP	0.001	A
PRRT1	80863	genome.wustl.edu	37	6	32116781	32116781	+	3'UTR	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:32116781G>A	ENST00000211413.5	-	0	1263				PRRT1_ENST00000375152.2_3'UTR|PRRT1_ENST00000375150.2_3'UTR|PRRT1_ENST00000467780.1_5'UTR	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1						response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						CCCGGAAAGCGGCGTCCCTGG	0.637																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.*218C>T	6.37:g.32116781G>A			A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	RNA	SNP	-	NULL	ENST00000211413.5	37	NULL	CCDS4739.1	6																																																																																			PRRT1	-	-	ENSG00000204314		0.637	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2	-	0.00	99	0	G	NM_030651		32116781	-1	tier1	-	no_errors	ENST00000467780	ensembl	human	known	74_37	rna	22.97	57	17	SNP	0.001	A
PRRT1	80863	genome.wustl.edu	37	6	32117443	32117443	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:32117443C>T	ENST00000211413.5	-	3	739	c.615G>A	c.(613-615)ccG>ccA	p.P205P	PRRT1_ENST00000375152.2_Silent_p.P124P|PRRT1_ENST00000375150.2_Silent_p.P124P|PRRT1_ENST00000467780.1_5'UTR	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1	205	Poly-Pro.				response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						GGCCCTGGGGCGGCGGGGGGA	0.672																																																	0													23.0	26.0	25.0					6																	32117443		1500	2698	4198	SO:0001819	synonymous_variant	0			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.615G>A	6.37:g.32117443C>T			A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	Silent	SNP	pfam_CD225/Dispanin_fam	p.P205	ENST00000211413.5	37	c.615	CCDS4739.1	6																																																																																			PRRT1	-	NULL	ENSG00000204314		0.672	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2	-	0.00	19	0	C	NM_030651		32117443	-1	tier1	-	no_errors	ENST00000211413	ensembl	human	known	74_37	silent	26.92	19	7	SNP	0.943	T
PRRT1	80863	genome.wustl.edu	37	6	32117443	32117443	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:32117443C>T	ENST00000211413.5	-	3	739	c.615G>A	c.(613-615)ccG>ccA	p.P205P	PRRT1_ENST00000375152.2_Silent_p.P124P|PRRT1_ENST00000375150.2_Silent_p.P124P|PRRT1_ENST00000467780.1_5'UTR	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1	205	Poly-Pro.				response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						GGCCCTGGGGCGGCGGGGGGA	0.672																																																	0													23.0	26.0	25.0					6																	32117443		1500	2698	4198	SO:0001819	synonymous_variant	0			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.615G>A	6.37:g.32117443C>T			A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	Silent	SNP	pfam_CD225/Dispanin_fam	p.P205	ENST00000211413.5	37	c.615	CCDS4739.1	6																																																																																			PRRT1	-	NULL	ENSG00000204314		0.672	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2	-	0.00	42	0	C	NM_030651		32117443	-1	tier1	-	no_errors	ENST00000211413	ensembl	human	known	74_37	silent	26.92	19	7	SNP	0.943	T
PRSS35	167681	genome.wustl.edu	37	6	84233206	84233206	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:84233206A>G	ENST00000369700.3	+	2	223	c.46A>G	c.(46-48)Acc>Gcc	p.T16A	PRSS35_ENST00000536636.1_Missense_Mutation_p.T16A	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	16						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CCCTGGGTGGACCCTCATTGA	0.403																																																	0													102.0	103.0	102.0					6																	84233206		2203	4300	6503	SO:0001583	missense	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.46A>G	6.37:g.84233206A>G	ENSP00000358714:p.Thr16Ala		A8K7B3|Q9BQP6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.T16A	ENST00000369700.3	37	c.46	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.989807	0.00439	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.42900	0.96;0.96	5.37	-3.27	0.05048	.	1.084670	0.07022	N	0.826906	T	0.08891	0.0220	L	0.45137	1.4	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23976	-1.0173	10	0.06236	T	0.91	-0.1223	5.9556	0.19271	0.2884:0.1117:0.4911:0.1088	.	16	Q8N3Z0	PRS35_HUMAN	A	16	ENSP00000440870:T16A;ENSP00000358714:T16A	ENSP00000358714:T16A	T	+	1	0	PRSS35	84289925	0.001000	0.12720	0.024000	0.17045	0.046000	0.14306	-0.160000	0.10041	-0.887000	0.03961	-1.243000	0.01532	ACC	PRSS35	-	NULL	ENSG00000146250		0.403	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	-	0.00	46	0	A	NM_153362		84233206	+1	tier1	-	no_errors	ENST00000369700	ensembl	human	known	74_37	missense	24.56	43	14	SNP	0.001	G
PRSS35	167681	genome.wustl.edu	37	6	84233206	84233206	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:84233206A>G	ENST00000369700.3	+	2	223	c.46A>G	c.(46-48)Acc>Gcc	p.T16A	PRSS35_ENST00000536636.1_Missense_Mutation_p.T16A	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	16						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CCCTGGGTGGACCCTCATTGA	0.403																																																	0													102.0	103.0	102.0					6																	84233206		2203	4300	6503	SO:0001583	missense	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.46A>G	6.37:g.84233206A>G	ENSP00000358714:p.Thr16Ala		A8K7B3|Q9BQP6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.T16A	ENST00000369700.3	37	c.46	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.989807	0.00439	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.42900	0.96;0.96	5.37	-3.27	0.05048	.	1.084670	0.07022	N	0.826906	T	0.08891	0.0220	L	0.45137	1.4	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23976	-1.0173	10	0.06236	T	0.91	-0.1223	5.9556	0.19271	0.2884:0.1117:0.4911:0.1088	.	16	Q8N3Z0	PRS35_HUMAN	A	16	ENSP00000440870:T16A;ENSP00000358714:T16A	ENSP00000358714:T16A	T	+	1	0	PRSS35	84289925	0.001000	0.12720	0.024000	0.17045	0.046000	0.14306	-0.160000	0.10041	-0.887000	0.03961	-1.243000	0.01532	ACC	PRSS35	-	NULL	ENSG00000146250		0.403	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	-	0.00	66	0	A	NM_153362		84233206	+1	tier1	-	no_errors	ENST00000369700	ensembl	human	known	74_37	missense	24.56	43	14	SNP	0.001	G
PTPN21	11099	genome.wustl.edu	37	14	88945961	88945961	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:88945961G>A	ENST00000556564.1	-	13	2098	c.1814C>T	c.(1813-1815)aCg>aTg	p.T605M	PTPN21_ENST00000328736.3_Missense_Mutation_p.T605M	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	605					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CTCCTGGAACGTTTGCACCGA	0.682																																																	0													18.0	17.0	17.0					14																	88945961		2198	4290	6488	SO:0001583	missense	0			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1814C>T	14.37:g.88945961G>A	ENSP00000452414:p.Thr605Met			Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.T605M	ENST00000556564.1	37	c.1814	CCDS9884.1	14	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522667	0.64747	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.74002	-0.8;-0.8	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	L	0.51914	1.62	0.46499	D	0.99907	P	0.48350	0.909	B	0.30646	0.118	T	0.66878	-0.5812	10	0.41790	T	0.15	.	12.254	0.54613	0.078:0.0:0.922:0.0	.	605	Q16825	PTN21_HUMAN	M	605	ENSP00000330276:T605M;ENSP00000452414:T605M	ENSP00000330276:T605M	T	-	2	0	PTPN21	88015714	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	6.742000	0.74843	2.439000	0.82584	0.655000	0.94253	ACG	PTPN21	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000070778		0.682	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	HGNC	protein_coding	OTTHUMT00000410303.1	-	0.00	34	0	G			88945961	-1	tier1	-	no_errors	ENST00000328736	ensembl	human	known	74_37	missense	37.88	41	25	SNP	0.999	A
PTPN23	25930	genome.wustl.edu	37	3	47454574	47454574	+	Missense_Mutation	SNP	A	A	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:47454574A>C	ENST00000265562.4	+	25	4887	c.4810A>C	c.(4810-4812)Aac>Cac	p.N1604H	PTPN23_ENST00000431726.1_Missense_Mutation_p.N1478H	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1604					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGCAAGCATAACTTTCTGCA	0.642																																																	0													35.0	38.0	37.0					3																	47454574		2203	4297	6500	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.4810A>C	3.37:g.47454574A>C	ENSP00000265562:p.Asn1604His		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.N1604H	ENST00000265562.4	37	c.4810	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795471	0.31777	.	.	ENSG00000076201	ENST00000265562	T	0.02787	4.16	4.35	3.18	0.36537	.	0.222024	0.36409	N	0.002618	T	0.02649	0.0080	N	0.24115	0.695	0.38541	D	0.949215	B	0.32693	0.38	B	0.34873	0.191	T	0.54906	-0.8223	10	0.72032	D	0.01	-16.8132	8.8937	0.35451	0.9084:0.0:0.0916:0.0	.	1604	Q9H3S7	PTN23_HUMAN	H	1604	ENSP00000265562:N1604H	ENSP00000265562:N1604H	N	+	1	0	PTPN23	47429578	1.000000	0.71417	0.987000	0.45799	0.367000	0.29736	6.554000	0.73923	0.694000	0.31654	0.460000	0.39030	AAC	PTPN23	-	NULL	ENSG00000076201		0.642	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	-	0.00	45	0	A	NM_015466		47454574	+1	tier1	-	no_errors	ENST00000265562	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	C
PTPN23	25930	genome.wustl.edu	37	3	47454574	47454574	+	Missense_Mutation	SNP	A	A	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:47454574A>C	ENST00000265562.4	+	25	4887	c.4810A>C	c.(4810-4812)Aac>Cac	p.N1604H	PTPN23_ENST00000431726.1_Missense_Mutation_p.N1478H	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1604					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGCAAGCATAACTTTCTGCA	0.642																																																	0													35.0	38.0	37.0					3																	47454574		2203	4297	6500	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.4810A>C	3.37:g.47454574A>C	ENSP00000265562:p.Asn1604His		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.N1604H	ENST00000265562.4	37	c.4810	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795471	0.31777	.	.	ENSG00000076201	ENST00000265562	T	0.02787	4.16	4.35	3.18	0.36537	.	0.222024	0.36409	N	0.002618	T	0.02649	0.0080	N	0.24115	0.695	0.38541	D	0.949215	B	0.32693	0.38	B	0.34873	0.191	T	0.54906	-0.8223	10	0.72032	D	0.01	-16.8132	8.8937	0.35451	0.9084:0.0:0.0916:0.0	.	1604	Q9H3S7	PTN23_HUMAN	H	1604	ENSP00000265562:N1604H	ENSP00000265562:N1604H	N	+	1	0	PTPN23	47429578	1.000000	0.71417	0.987000	0.45799	0.367000	0.29736	6.554000	0.73923	0.694000	0.31654	0.460000	0.39030	AAC	PTPN23	-	NULL	ENSG00000076201		0.642	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	-	0.00	50	0	A	NM_015466		47454574	+1	tier1	-	no_errors	ENST00000265562	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	C
RABGAP1	23637	genome.wustl.edu	37	9	125827753	125827753	+	Intron	DEL	A	A	-	rs3214358		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:125827753delA	ENST00000373647.4	+	14	2042				RABGAP1_ENST00000373643.5_Intron|RABGAP1_ENST00000493854.1_Intron	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ATTTCATGTCAAAAAAAAAAA	0.343																																																	0													36.0	38.0	37.0					9																	125827753		2203	4300	6503	SO:0001627	intron_variant	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1908+13A>-	9.37:g.125827753delA			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Frame_Shift_Del	DEL	pfam_Kinesin-like,pfam_Rab-GTPase-TBC_dom,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.K576fs	ENST00000373647.4	37	c.1717	CCDS6848.2	9																																																																																			RABGAP1	-	pfscan_Rab-GTPase-TBC_dom	ENSG00000011454		0.343	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3		0.00	42	0	A	NM_012197		125827753	+1	tier1		no_errors	ENST00000456584	ensembl	human	known	74_37	frame_shift_del	10.34	52	6	DEL	0.000	-
RABGGTB	5876	genome.wustl.edu	37	1	76255542	76255542	+	Intron	DEL	A	A	-			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:76255542delA	ENST00000319942.3	+	4	380				SNORD45A_ENST00000384512.1_RNA|RABGGTB_ENST00000535300.1_Intron|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000370826.3_Intron|RABGGTB_ENST00000496055.1_3'UTR|SNORD45B_ENST00000364617.1_RNA	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						ACACAGAGACAAAAGGATGTG	0.289																																																	0																																										SO:0001627	intron_variant	0			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.310-95A>-	1.37:g.76255542delA			Q92697	RNA	DEL	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			RABGGTB	-	-	ENSG00000137955		0.289	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1		0.00	29	0	A	NM_004582		76255542	+1	tier1		no_errors	ENST00000461653	ensembl	human	known	74_37	rna	5.71	33	2	DEL	0.000	-
RASGEF1C	255426	genome.wustl.edu	37	5	179528352	179528353	+	3'UTR	DEL	GG	GG	-	rs561317274|rs34705746|rs67139455|rs372059555		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	GG	GG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:179528352_179528353delGG	ENST00000393371.2	-	0	1845_1846				RASGEF1C_ENST00000522500.1_3'UTR|RASGEF1C_ENST00000361132.4_3'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGCCACTGTGGGGGGGGGGGG	0.668																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.*149CC>-	5.37:g.179528362_179528363delGG			D3DWQ7|Q7Z4T0|Q8NA49	RNA	DEL	-	NULL	ENST00000393371.2	37	NULL	CCDS4452.1	5																																																																																			RASGEF1C	-	-	ENSG00000146090		0.668	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2		0.00	18	0	GG	NM_175062		179528353	-1	tier1		no_errors	ENST00000519456	ensembl	human	known	74_37	rna	24.00	19	6	DEL	0.147:0.007	-
RBFOX1	54715	genome.wustl.edu	37	16	7743345	7743345	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:7743345G>T	ENST00000550418.1	+	15	1983				RBFOX1_ENST00000311745.5_Intron|RBFOX1_ENST00000547338.1_Intron|RBFOX1_ENST00000355637.4_Nonsense_Mutation_p.E363*|RBFOX1_ENST00000553186.1_Intron|RBFOX1_ENST00000436368.2_Intron|RBFOX1_ENST00000547372.1_Nonsense_Mutation_p.E385*|RBFOX1_ENST00000552089.1_Nonsense_Mutation_p.E359*|RBFOX1_ENST00000340209.4_Intron|RBFOX1_ENST00000422070.4_Intron|RBFOX1_ENST00000535565.2_Nonsense_Mutation_p.E299*	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1						mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						TGCAGCAGATGAAATTTCTTG	0.398																																					Ovarian(157;934 2567 15163 39509)												0													150.0	136.0	141.0					16																	7743345		2197	4300	6497	SO:0001627	intron_variant	0			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.996-15713G>T	16.37:g.7743345G>T			Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Nonsense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.E385*	ENST00000550418.1	37	c.1153	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	G	41	8.668283	0.98908	.	.	ENSG00000078328	ENST00000547372;ENST00000535565;ENST00000552089;ENST00000355637	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.521	0.99222	0.0:0.0:1.0:0.0	.	.	.	.	X	385;299;359;363	.	ENSP00000347855:E363X	E	+	1	0	RBFOX1	7683346	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.562000	0.82300	2.861000	0.98227	0.650000	0.86243	GAA	RBFOX1	-	pirsf_RNA-bd_Fox-1	ENSG00000078328		0.398	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	HGNC	protein_coding	OTTHUMT00000409492.2		0.00	34	0	G	NM_145891		7743345	+1			no_errors	ENST00000547372	ensembl	human	known	74_37	nonsense	5.88	48	3	SNP	1.000	T
RBM26	64062	genome.wustl.edu	37	13	79940176	79940176	+	Intron	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:79940176G>A	ENST00000438737.2	-	8	1717				RBM26_ENST00000267229.7_Intron|RBM26_ENST00000461008.1_5'UTR|RBM26_ENST00000438724.1_Intron			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26						mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		ATATAAAAAGGGCCAAAACTG	0.393																																																	0													90.0	97.0	94.0					13																	79940176		2203	4300	6503	SO:0001627	intron_variant	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1276+13C>T	13.37:g.79940176G>A			B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	RNA	SNP	-	NULL	ENST00000438737.2	37	NULL		13																																																																																			RBM26	-	-	ENSG00000139746		0.393	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4	-	0.00	22	0	G	NM_022118		79940176	-1	tier1	-	no_errors	ENST00000461008	ensembl	human	known	74_37	rna	17.14	29	6	SNP	0.459	A
RBM26	64062	genome.wustl.edu	37	13	79940176	79940176	+	Intron	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:79940176G>A	ENST00000438737.2	-	8	1717				RBM26_ENST00000267229.7_Intron|RBM26_ENST00000461008.1_5'UTR|RBM26_ENST00000438724.1_Intron			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26						mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		ATATAAAAAGGGCCAAAACTG	0.393																																																	0													90.0	97.0	94.0					13																	79940176		2203	4300	6503	SO:0001627	intron_variant	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1276+13C>T	13.37:g.79940176G>A			B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	RNA	SNP	-	NULL	ENST00000438737.2	37	NULL		13																																																																																			RBM26	-	-	ENSG00000139746		0.393	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4	-	0.00	25	0	G	NM_022118		79940176	-1	tier1	-	no_errors	ENST00000461008	ensembl	human	known	74_37	rna	17.14	29	6	SNP	0.459	A
RBMS1	5937	genome.wustl.edu	37	2	161130757	161130757	+	3'UTR	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:161130757C>T	ENST00000348849.3	-	0	2177				RBMS1_ENST00000474820.1_5'UTR|ITGB6_ENST00000485635.1_5'Flank	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1						DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								GAGACACTGACGGCAACACTG	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.*526G>A	2.37:g.161130757C>T			Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	RNA	SNP	-	NULL	ENST00000348849.3	37	NULL	CCDS2213.1	2																																																																																			RBMS1	-	-	ENSG00000153250		0.408	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4	-	0.00	40	0	C	NM_016836		161130757	-1	tier1	-	no_errors	ENST00000474820	ensembl	human	known	74_37	rna	22.92	74	22	SNP	0.998	T
RBMS1	5937	genome.wustl.edu	37	2	161130757	161130757	+	3'UTR	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:161130757C>T	ENST00000348849.3	-	0	2177				RBMS1_ENST00000474820.1_5'UTR|ITGB6_ENST00000485635.1_5'Flank	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1						DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								GAGACACTGACGGCAACACTG	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.*526G>A	2.37:g.161130757C>T			Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	RNA	SNP	-	NULL	ENST00000348849.3	37	NULL	CCDS2213.1	2																																																																																			RBMS1	-	-	ENSG00000153250		0.408	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	HGNC	protein_coding	OTTHUMT00000255043.4	-	0.00	47	0	C	NM_016836		161130757	-1	tier1	-	no_errors	ENST00000474820	ensembl	human	known	74_37	rna	22.92	74	22	SNP	0.998	T
RELN	5649	genome.wustl.edu	37	7	103234836	103234836	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:103234836C>A	ENST00000428762.1	-	26	3802	c.3643G>T	c.(3643-3645)Gat>Tat	p.D1215Y	RELN_ENST00000343529.5_Missense_Mutation_p.D1215Y|RELN_ENST00000424685.2_Missense_Mutation_p.D1215Y	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1215					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATGATGTCATCGACTGCCCAC	0.517																																					NSCLC(146;835 1944 15585 22231 52158)												0													261.0	250.0	254.0					7																	103234836		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3643G>T	7.37:g.103234836C>A	ENSP00000392423:p.Asp1215Tyr		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.D1215Y	ENST00000428762.1	37	c.3643	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449401	0.84101	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.39592	1.07;1.07;1.07	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.68439	0.3001	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.70806	-0.4772	10	0.87932	D	0	.	19.9347	0.97133	0.0:1.0:0.0:0.0	.	1215;1215	P78509-2;P78509	.;RELN_HUMAN	Y	1215	ENSP00000392423:D1215Y;ENSP00000345694:D1215Y;ENSP00000388446:D1215Y	ENSP00000345694:D1215Y	D	-	1	0	RELN	103022072	1.000000	0.71417	0.960000	0.40013	0.990000	0.78478	7.267000	0.78462	2.707000	0.92482	0.591000	0.81541	GAT	RELN	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000189056		0.517	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1		0.00	22	0	C	NM_005045		103234836	-1			no_errors	ENST00000424685	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
RFT1	91869	genome.wustl.edu	37	3	53145865	53145865	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:53145865C>A	ENST00000296292.3	-	7	817	c.756G>T	c.(754-756)ttG>ttT	p.L252F	RFT1_ENST00000394738.3_Missense_Mutation_p.L213F	NM_052859.3	NP_443091.1	Q96AA3	RFT1_HUMAN	RFT1 homolog (S. cerevisiae)	252					carbohydrate transport (GO:0008643)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)	lipid transporter activity (GO:0005319)			NS(1)|breast(1)|kidney(1)|lung(5)|skin(2)|urinary_tract(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		AAATCTGTTTCAAGAAAGACT	0.408																																																	0													95.0	96.0	96.0					3																	53145865		2203	4300	6503	SO:0001583	missense	0			AJ318099	CCDS2869.1	3p21.1	2014-02-06	2005-01-26		ENSG00000163933	ENSG00000163933			30220	protein-coding gene	gene with protein product	"""congenital disorder of glycosylation 1N"""	611908	"""RFT1, requiring fifty three 1 homolog (S. cerevisiae)"""			12477932	Standard	NM_052859		Approved	CDG1N	uc003dgj.3	Q96AA3	OTTHUMG00000074035	ENST00000296292.3:c.756G>T	3.37:g.53145865C>A	ENSP00000296292:p.Leu252Phe		Q96J03	Missense_Mutation	SNP	pfam_RFT1	p.L252F	ENST00000296292.3	37	c.756	CCDS2869.1	3	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205218	0.58234	.	.	ENSG00000163933	ENST00000296292;ENST00000394738;ENST00000467048	D;D;D	0.90444	-2.67;-2.67;-2.67	5.66	2.92	0.33932	.	0.000000	0.64402	D	0.000001	D	0.89417	0.6709	M	0.67953	2.075	0.80722	D	1	P;P	0.48162	0.906;0.906	P;P	0.48982	0.575;0.597	D	0.84084	0.0386	10	0.17832	T	0.49	.	8.3546	0.32323	0.0:0.6919:0.0:0.3081	.	213;252	B5MDE0;Q96AA3	.;RFT1_HUMAN	F	252;213;206	ENSP00000296292:L252F;ENSP00000378223:L213F;ENSP00000420325:L206F	ENSP00000296292:L252F	L	-	3	2	RFT1	53120905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.464000	0.35288	0.345000	0.23873	0.563000	0.77884	TTG	RFT1	-	pfam_RFT1	ENSG00000163933		0.408	RFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFT1	HGNC	protein_coding	OTTHUMT00000157136.2		0.00	40	0	C	NM_052859		53145865	-1			no_errors	ENST00000296292	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	A
RHBG	57127	genome.wustl.edu	37	1	156354355	156354355	+	Silent	SNP	C	C	A	rs375620360		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:156354355C>A	ENST00000368249.1	+	9	1310	c.1272C>A	c.(1270-1272)ccC>ccA	p.P424P	RHBG_ENST00000255013.3_Silent_p.P355P|RHBG_ENST00000368246.2_Missense_Mutation_p.P423Q|RHBG_ENST00000400992.2_Silent_p.P392P|RHBG_ENST00000494874.1_Intron	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	424	Interaction with ANK3.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					ACTCCCCCCCCAGACTCCCAG	0.632											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													67.0	78.0	75.0					1																	156354355		1989	4159	6148	SO:0001819	synonymous_variant	0			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1272C>A	1.37:g.156354355C>A		1777	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.P423Q	ENST00000368249.1	37	c.1268		1	.	.	.	.	.	.	.	.	.	.	C	5.063	0.197249	0.09599	.	.	ENSG00000132677	ENST00000368246	T	0.19105	2.17	.	.	.	Ammonium transporter AmtB-like (1);	1.228880	0.06099	N	0.665143	T	0.12347	0.0300	.	.	.	0.36535	D	0.870987	P	0.48162	0.906	P	0.47402	0.546	T	0.40421	-0.9564	7	0.46703	T	0.11	-13.372	.	.	.	.	424	Q9H310	RHBG_HUMAN	Q	423	ENSP00000357229:P423Q	ENSP00000357229:P423Q	P	+	2	0	RHBG	154620979	0.054000	0.20591	0.482000	0.27366	0.854000	0.48673	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CCA	RHBG	-	NULL	ENSG00000132677		0.632	RHBG-001	NOVEL	basic	protein_coding	RHBG	HGNC	protein_coding	OTTHUMT00000060589.2		0.00	48	0	C	NM_001256395		156354355	+1			no_errors	ENST00000368246	ensembl	human	known	74_37	missense	6.58	71	5	SNP	0.476	A
RICTOR	253260	genome.wustl.edu	37	5	38945021	38945021	+	Silent	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:38945021A>G	ENST00000357387.3	-	35	4813	c.4783T>C	c.(4783-4785)Tta>Cta	p.L1595L	RICTOR_ENST00000296782.5_Silent_p.L1619L	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TCACCTAGTAACAATTCTGTG	0.373																																																	0													103.0	102.0	103.0					5																	38945021		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4783T>C	5.37:g.38945021A>G				Silent	SNP	superfamily_ARM-type_fold	p.L1619	ENST00000357387.3	37	c.4855	CCDS34148.1	5																																																																																			RICTOR	-	NULL	ENSG00000164327		0.373	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	-	0.00	48	0	A	NM_152756		38945021	-1	tier1	-	no_errors	ENST00000296782	ensembl	human	known	74_37	silent	18.75	65	15	SNP	0.748	G
RIMS1	22999	genome.wustl.edu	37	6	72955519	72955519	+	Splice_Site	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:72955519G>T	ENST00000521978.1	+	11	2083	c.2083G>T	c.(2083-2085)Gac>Tac	p.D695Y	RIMS1_ENST00000425662.2_Splice_Site_p.D88Y|RIMS1_ENST00000517960.1_Splice_Site_p.D695Y|RIMS1_ENST00000401910.3_Splice_Site_p.D169Y|RIMS1_ENST00000518273.1_Splice_Site_p.D695Y|RIMS1_ENST00000523963.1_Splice_Site_p.D169Y|RIMS1_ENST00000348717.5_Splice_Site_p.D695Y|RIMS1_ENST00000517827.1_Splice_Site_p.D154Y|RIMS1_ENST00000520567.1_Splice_Site_p.D695Y|RIMS1_ENST00000264839.7_Splice_Site_p.D695Y|RIMS1_ENST00000491071.2_Splice_Site_p.D695Y|RIMS1_ENST00000522291.1_Splice_Site_p.D695Y	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	695					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TTCTTTTAGTGACATTCCCCG	0.408																																																	0													93.0	87.0	89.0					6																	72955519		1819	4081	5900	SO:0001630	splice_region_variant	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2082-1G>T	6.37:g.72955519G>T			A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.D695Y	ENST00000521978.1	37	c.2083	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.468911|4.468911	0.84533|0.84533	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.38887|.	1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11;1.11|.	5.96|5.96	5.96|5.96	0.96718|0.96718	PDZ/DHR/GLGF (1);|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|.	0.56046|.	0.1959|.	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D;D|.	0.89917|.	0.602;0.999;1.0;1.0;1.0;1.0;1.0|.	B;D;D;D;D;D;D|.	0.91635|.	0.416;0.994;0.998;0.987;0.999;0.999;0.987|.	T|.	0.49872|.	-0.8893|.	10|.	0.87932|.	D|.	0|.	-20.519|-20.519	20.394|20.394	0.98981|0.98981	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	154;169;695;154;169;695;695|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5|.	.;.;.;.;.;.;RIMS1_HUMAN|.	Y|L	695;695;695;695;695;695;695;695;695;695;695;695;169;169;88;88;154|268	ENSP00000430101:D695Y;ENSP00000275037:D695Y;ENSP00000264839:D695Y;ENSP00000429959:D695Y;ENSP00000430408:D695Y;ENSP00000430502:D695Y;ENSP00000430932:D695Y;ENSP00000428417:D695Y;ENSP00000385649:D169Y;ENSP00000428328:D169Y;ENSP00000411235:D88Y;ENSP00000389503:D88Y;ENSP00000428367:D154Y|.	ENSP00000264839:D695Y|.	D|X	+|+	1|2	0|2	RIMS1|RIMS1	73012240|73012240	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.476000|9.476000	0.97823|0.97823	2.830000|2.830000	0.97506|0.97506	0.585000|0.585000	0.79938|0.79938	GAC|TGA	RIMS1	-	superfamily_PDZ	ENSG00000079841		0.408	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1		0.00	62	0	G		Missense_Mutation	72955519	+1			no_errors	ENST00000521978	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
RNASE4	6038	genome.wustl.edu	37	14	21167735	21167735	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:21167735C>T	ENST00000555835.1	+	2	881	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	AL163636.6_ENST00000553909.1_3'UTR|RNASE4_ENST00000304704.4_Missense_Mutation_p.R69C|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000555597.1_Missense_Mutation_p.R69C|RNASE4_ENST00000397995.2_Missense_Mutation_p.R69C	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	69	Substrate binding.				cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		TCACTGCAAGCGCTTCAACAC	0.488																																					Esophageal Squamous(59;1059 1362 26290 51151)												0													157.0	127.0	137.0					14																	21167735		2203	4300	6503	SO:0001583	missense	0			U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.205C>T	14.37:g.21167735C>T	ENSP00000452245:p.Arg69Cys			Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.R69C	ENST00000555835.1	37	c.205	CCDS9555.1	14	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218406	0.58560	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.81	1.71	0.24356	Ribonuclease A, domain (4);	1.526630	0.03396	N	0.202551	T	0.59376	0.2189	M	0.78801	2.425	0.34329	D	0.687464	D	0.67145	0.996	P	0.60068	0.868	T	0.51639	-0.8680	10	0.87932	D	0	0.223	2.5396	0.04722	0.1521:0.5385:0.1473:0.162	.	69	P34096	RNAS4_HUMAN	C	69	ENSP00000452245:R69C;ENSP00000381081:R69C;ENSP00000451624:R69C;ENSP00000381087:R69C;ENSP00000307096:R69C;ENSP00000381085:R69C	ENSP00000307096:R69C	R	+	1	0	AL163636.2;RNASE4	20237575	0.065000	0.20965	0.438000	0.26821	0.682000	0.39822	0.113000	0.15499	0.454000	0.26884	0.655000	0.94253	CGC	RNASE4	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	ENSG00000258818		0.488	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE4	HGNC	protein_coding	OTTHUMT00000073729.3	-	0.00	29	0	C			21167735	+1	tier1	-	no_errors	ENST00000304704	ensembl	human	known	74_37	missense	17.95	32	7	SNP	0.300	T
RNASE4	6038	genome.wustl.edu	37	14	21167735	21167735	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:21167735C>T	ENST00000555835.1	+	2	881	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	AL163636.6_ENST00000553909.1_3'UTR|RNASE4_ENST00000304704.4_Missense_Mutation_p.R69C|RP11-903H12.3_ENST00000554286.1_RNA|RNASE4_ENST00000555597.1_Missense_Mutation_p.R69C|RNASE4_ENST00000397995.2_Missense_Mutation_p.R69C	NM_002937.3	NP_002928.1	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4	69	Substrate binding.				cellular response to starvation (GO:0009267)|mRNA cleavage (GO:0006379)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		TCACTGCAAGCGCTTCAACAC	0.488																																					Esophageal Squamous(59;1059 1362 26290 51151)												0													157.0	127.0	137.0					14																	21167735		2203	4300	6503	SO:0001583	missense	0			U36775	CCDS9555.1	14q11	2014-07-16			ENSG00000258818	ENSG00000258818		"""Ribonucleases, RNase A"""	10047	protein-coding gene	gene with protein product		601030				7501448	Standard	NM_002937		Approved		uc001vxy.4	P34096	OTTHUMG00000029575	ENST00000555835.1:c.205C>T	14.37:g.21167735C>T	ENSP00000452245:p.Arg69Cys			Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.R69C	ENST00000555835.1	37	c.205	CCDS9555.1	14	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218406	0.58560	.	.	ENSG00000258818;ENSG00000258818;ENSG00000258818;ENSG00000181784;ENSG00000181784;ENSG00000181784	ENST00000555835;ENST00000397995;ENST00000555597;ENST00000398001;ENST00000304704;ENST00000397999	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.81	1.71	0.24356	Ribonuclease A, domain (4);	1.526630	0.03396	N	0.202551	T	0.59376	0.2189	M	0.78801	2.425	0.34329	D	0.687464	D	0.67145	0.996	P	0.60068	0.868	T	0.51639	-0.8680	10	0.87932	D	0	0.223	2.5396	0.04722	0.1521:0.5385:0.1473:0.162	.	69	P34096	RNAS4_HUMAN	C	69	ENSP00000452245:R69C;ENSP00000381081:R69C;ENSP00000451624:R69C;ENSP00000381087:R69C;ENSP00000307096:R69C;ENSP00000381085:R69C	ENSP00000307096:R69C	R	+	1	0	AL163636.2;RNASE4	20237575	0.065000	0.20965	0.438000	0.26821	0.682000	0.39822	0.113000	0.15499	0.454000	0.26884	0.655000	0.94253	CGC	RNASE4	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	ENSG00000258818		0.488	RNASE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE4	HGNC	protein_coding	OTTHUMT00000073729.3	-	0.00	41	0	C			21167735	+1	tier1	-	no_errors	ENST00000304704	ensembl	human	known	74_37	missense	17.95	32	7	SNP	0.300	T
RNF213	57674	genome.wustl.edu	37	17	78350691	78350691	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:78350691C>A	ENST00000582970.1	+	53	13581	c.13438C>A	c.(13438-13440)Ctt>Att	p.L4480I	RNF213_ENST00000508628.2_Missense_Mutation_p.L4529I|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.L2553I|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4480					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCATGCTTTTCTTCCAACCAT	0.527																																																	0													104.0	96.0	99.0					17																	78350691		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13438C>A	17.37:g.78350691C>A	ENSP00000464087:p.Leu4480Ile		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L4480I	ENST00000582970.1	37	c.13438	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995323	0.54147	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.32753	1.44	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000002	T	0.56731	0.2005	M	0.73598	2.24	0.29200	N	0.875256	D;D	0.71674	0.998;0.991	D;P	0.69824	0.966;0.813	T	0.56384	-0.7988	10	0.49607	T	0.09	.	18.5058	0.90897	0.0:1.0:0.0:0.0	.	4529;2553	C9JCP4;Q63HN8	.;RN213_HUMAN	I	4480;4529;2553	ENSP00000338218:L2553I	ENSP00000338218:L2553I	L	+	1	0	RNF213	75965286	0.998000	0.40836	0.927000	0.36925	0.337000	0.28794	1.966000	0.40481	2.357000	0.79964	0.561000	0.74099	CTT	RNF213	-	NULL	ENSG00000173821		0.527	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	23	0	C	NM_020914		78350691	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78350691	78350691	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:78350691C>A	ENST00000582970.1	+	53	13581	c.13438C>A	c.(13438-13440)Ctt>Att	p.L4480I	RNF213_ENST00000508628.2_Missense_Mutation_p.L4529I|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.L2553I|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4480					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCATGCTTTTCTTCCAACCAT	0.527																																																	0													104.0	96.0	99.0					17																	78350691		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13438C>A	17.37:g.78350691C>A	ENSP00000464087:p.Leu4480Ile		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L4480I	ENST00000582970.1	37	c.13438	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995323	0.54147	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.32753	1.44	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000002	T	0.56731	0.2005	M	0.73598	2.24	0.29200	N	0.875256	D;D	0.71674	0.998;0.991	D;P	0.69824	0.966;0.813	T	0.56384	-0.7988	10	0.49607	T	0.09	.	18.5058	0.90897	0.0:1.0:0.0:0.0	.	4529;2553	C9JCP4;Q63HN8	.;RN213_HUMAN	I	4480;4529;2553	ENSP00000338218:L2553I	ENSP00000338218:L2553I	L	+	1	0	RNF213	75965286	0.998000	0.40836	0.927000	0.36925	0.337000	0.28794	1.966000	0.40481	2.357000	0.79964	0.561000	0.74099	CTT	RNF213	-	NULL	ENSG00000173821		0.527	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	37	0	C	NM_020914		78350691	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	A
ROBO3	64221	genome.wustl.edu	37	11	124740981	124740981	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:124740981G>T	ENST00000397801.1	+	7	1297	c.1105G>T	c.(1105-1107)Gag>Tag	p.E369*	ROBO3_ENST00000538940.1_Nonsense_Mutation_p.E347*	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	369	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TTTCCAGTGCGAGACCAAAGG	0.612																																																	0													38.0	42.0	41.0					11																	124740981		1965	4145	6110	SO:0001587	stop_gained	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1105G>T	11.37:g.124740981G>T	ENSP00000380903:p.Glu369*			Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E369*	ENST00000397801.1	37	c.1105	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.756814	0.98471	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	.	.	.	4.3	3.38	0.38709	.	0.000000	0.37095	N	0.002259	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	11.8924	0.52637	0.0866:0.0:0.9134:0.0	.	.	.	.	X	369;347	.	ENSP00000380903:E369X	E	+	1	0	ROBO3	124246191	1.000000	0.71417	0.992000	0.48379	0.869000	0.49853	6.349000	0.73013	1.150000	0.42419	0.455000	0.32223	GAG	ROBO3	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154134		0.612	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1		0.00	25	0	G	XM_370663		124740981	+1			no_errors	ENST00000397801	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	1.000	T
ROR2	4920	genome.wustl.edu	37	9	94489026	94489026	+	Splice_Site	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:94489026C>T	ENST00000375708.3	-	8	1382		c.e8-1		ROR2_ENST00000375715.1_Splice_Site|ROR2_ENST00000550066.1_Splice_Site	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCTCGGGGACCTGTGAACAAT	0.473																																																	0													79.0	71.0	74.0					9																	94489026		2203	4300	6503	SO:0001630	splice_region_variant	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1184-1G>A	9.37:g.94489026C>T			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Splice_Site	SNP	-	e8-1	ENST00000375708.3	37	c.1184-1	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717860	0.48622	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1763	0.89762	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROR2	93528847	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	5.486000	0.66856	2.529000	0.85273	0.561000	0.74099	.	ROR2	-	-	ENSG00000169071		0.473	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	-	0.00	17	0	C		Intron	94489026	-1	tier1	-	no_errors	ENST00000375708	ensembl	human	known	74_37	splice_site	32.43	25	12	SNP	1.000	T
ROR2	4920	genome.wustl.edu	37	9	94489026	94489026	+	Splice_Site	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:94489026C>T	ENST00000375708.3	-	8	1382		c.e8-1		ROR2_ENST00000375715.1_Splice_Site|ROR2_ENST00000550066.1_Splice_Site	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TCTCGGGGACCTGTGAACAAT	0.473																																																	0													79.0	71.0	74.0					9																	94489026		2203	4300	6503	SO:0001630	splice_region_variant	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1184-1G>A	9.37:g.94489026C>T			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Splice_Site	SNP	-	e8-1	ENST00000375708.3	37	c.1184-1	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717860	0.48622	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1763	0.89762	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROR2	93528847	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	5.486000	0.66856	2.529000	0.85273	0.561000	0.74099	.	ROR2	-	-	ENSG00000169071		0.473	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	-	0.00	22	0	C		Intron	94489026	-1	tier1	-	no_errors	ENST00000375708	ensembl	human	known	74_37	splice_site	32.43	25	12	SNP	1.000	T
RPL12P38	645688	genome.wustl.edu	37	17	58512418	58512419	+	RNA	INS	-	-	A	rs111246796|rs576351054		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:58512418_58512419insA	ENST00000588627.1	-	0	938_939									ribosomal protein L12 pseudogene 38																		CAACGTAGCTTAAAAAAAAAAA	0.317																																																	0																																												0					17q23.2	2013-01-23			ENSG00000213228	ENSG00000213228			36838	pseudogene	pseudogene						19123937	Standard	NG_010298		Approved				OTTHUMG00000157897		17.37:g.58512429_58512429dupA				RNA	INS	-	NULL	ENST00000588627.1	37	NULL		17																																																																																			RPL12P38	-	-	ENSG00000213228		0.317	RPL12P38-002	KNOWN	basic	processed_transcript	RPL12P38	HGNC	pseudogene	OTTHUMT00000449464.1		0.00	37	0	-	NG_010298		58512419	-1	tier1		no_errors	ENST00000588627	ensembl	human	known	74_37	rna	8.33	55	5	INS	0.998:0.998	A
RPLP0P2	113157	genome.wustl.edu	37	11	61405193	61405193	+	RNA	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:61405193A>G	ENST00000496593.1	+	0	1797					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		aaaaaaaaagaaaagaaaaaa	0.303																																																	0																																												0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405193A>G				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.303	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1		0.00	63	0	A	NR_002775		61405193	+1			no_errors	ENST00000496593	ensembl	human	known	74_37	rna	5.88	112	7	SNP	0.179	G
RSPO4	343637	genome.wustl.edu	37	20	982768	982768	+	Missense_Mutation	SNP	C	C	T	rs200584918		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:982768C>T	ENST00000217260.4	-	1	136	c.40G>A	c.(40-42)Gcc>Acc	p.A14T	RSPO4_ENST00000400634.2_Missense_Mutation_p.A14T	NM_001029871.3	NP_001025042.2	Q2I0M5	RSPO4_HUMAN	R-spondin 4	14					Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	heparin binding (GO:0008201)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						ATGTCCACGGCGTGGGCGACG	0.746																																																	0													10.0	12.0	11.0					20																	982768		1902	4064	5966	SO:0001583	missense	0			AK122609	CCDS42845.1, CCDS42846.1	20p13	2014-01-30	2011-06-29	2005-08-08	ENSG00000101282	ENSG00000101282		"""Endogenous ligands"""	16175	protein-coding gene	gene with protein product		610573	"""chromosome 20 open reading frame 182"", ""R-spondin family, member 4"""	C20orf182		15469841	Standard	NM_001029871		Approved	dJ824F16.3	uc002wej.3	Q2I0M5	OTTHUMG00000031651	ENST00000217260.4:c.40G>A	20.37:g.982768C>T	ENSP00000217260:p.Ala14Thr		A2A2I6|Q9UGB2	Missense_Mutation	SNP	superfamily_Growth_fac_rcpt_N_dom,superfamily_Thrombospondin_1_rpt,smart_Furin_repeat,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.A14T	ENST00000217260.4	37	c.40	CCDS42846.1	20	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149266	0.37923	.	.	ENSG00000101282	ENST00000217260;ENST00000400634	D;D	0.87334	-1.66;-2.24	4.14	1.14	0.20703	.	0.560172	0.14769	N	0.299535	T	0.75547	0.3864	L	0.36672	1.1	0.21652	N	0.999608	B;B	0.29270	0.098;0.24	B;B	0.17098	0.01;0.017	T	0.58741	-0.7583	10	0.23302	T	0.38	-3.6673	5.9141	0.19045	0.0:0.6593:0.0:0.3407	.	14;14	Q2I0M5-2;Q2I0M5	.;RSPO4_HUMAN	T	14	ENSP00000217260:A14T;ENSP00000383475:A14T	ENSP00000217260:A14T	A	-	1	0	RSPO4	930768	0.895000	0.30542	0.736000	0.30914	0.946000	0.59487	0.132000	0.15891	0.082000	0.17018	-0.258000	0.10820	GCC	RSPO4	-	NULL	ENSG00000101282		0.746	RSPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPO4	HGNC	protein_coding	OTTHUMT00000077492.3		0.00	8	0	C	XM_297816		982768	-1			no_errors	ENST00000217260	ensembl	human	known	74_37	missense	16.67	10	2	SNP	0.910	T
RYR1	6261	genome.wustl.edu	37	19	39025783	39025783	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:39025783G>T	ENST00000359596.3	+	80	11362	c.11362G>T	c.(11362-11364)Gag>Tag	p.E3788*	RYR1_ENST00000360985.3_Nonsense_Mutation_p.E3788*|RYR1_ENST00000355481.4_Nonsense_Mutation_p.E3783*|AC067969.2_ENST00000595853.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3788					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.E3788Q(2)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCTCCAGGAGAGACAGGTGC	0.557																																																	2	Substitution - Missense(2)	lung(2)											70.0	51.0	57.0					19																	39025783		2203	4300	6503	SO:0001587	stop_gained	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11362G>T	19.37:g.39025783G>T	ENSP00000352608:p.Glu3788*		Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E3788*	ENST00000359596.3	37	c.11362	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	53	20.752117	0.99933	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	3.83	3.83	0.44106	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	15.0434	0.71807	0.0:0.0:1.0:0.0	.	.	.	.	X	3788;3783;3788	.	ENSP00000347667:E3783X	E	+	1	0	RYR1	43717623	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.350000	0.73017	2.146000	0.66826	0.561000	0.74099	GAG	RYR1	-	NULL	ENSG00000196218		0.557	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1		0.00	26	0	G			39025783	+1			no_errors	ENST00000359596	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
SAMD14	201191	genome.wustl.edu	37	17	48191301	48191301	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:48191301C>T	ENST00000330175.4	-	9	1402	c.1085G>A	c.(1084-1086)gGa>gAa	p.G362E	SAMD14_ENST00000503131.1_Missense_Mutation_p.G390E|SAMD14_ENST00000503734.1_5'Flank	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	362	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.G390E(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						TAGTTTGCTTCCGTCCAGCTG	0.572																																																	1	Substitution - Missense(1)	breast(1)											50.0	49.0	50.0					17																	48191301		2203	4300	6503	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.1085G>A	17.37:g.48191301C>T	ENSP00000329144:p.Gly362Glu		A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.G390E	ENST00000330175.4	37	c.1169	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374582	0.61735	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	D;D;D	0.82803	-1.65;-1.65;-1.65	5.02	5.02	0.67125	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.081868	0.48767	D	0.000169	D	0.87422	0.6173	L	0.39085	1.19	0.50171	D	0.999859	D;D	0.89917	1.0;1.0	D;D	0.85130	0.989;0.997	D	0.88873	0.3334	10	0.72032	D	0.01	-7.3806	17.1353	0.86737	0.0:1.0:0.0:0.0	.	362;390	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	E	362;374;390	ENSP00000329144:G362E;ENSP00000285206:G374E;ENSP00000424474:G390E	ENSP00000285206:G374E	G	-	2	0	SAMD14	45546300	1.000000	0.71417	0.996000	0.52242	0.247000	0.25773	7.360000	0.79487	2.340000	0.79590	0.462000	0.41574	GGA	SAMD14	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000167100		0.572	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	-	0.00	47	0	C	NM_174920		48191301	-1	tier1	-	no_errors	ENST00000503131	ensembl	human	known	74_37	missense	35.38	42	23	SNP	1.000	T
SAMD14	201191	genome.wustl.edu	37	17	48191301	48191301	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr17:48191301C>T	ENST00000330175.4	-	9	1402	c.1085G>A	c.(1084-1086)gGa>gAa	p.G362E	SAMD14_ENST00000503131.1_Missense_Mutation_p.G390E|SAMD14_ENST00000503734.1_5'Flank	NM_001257359.1	NP_001244288.1	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	362	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.							p.G390E(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	15						TAGTTTGCTTCCGTCCAGCTG	0.572																																																	1	Substitution - Missense(1)	breast(1)											50.0	49.0	50.0					17																	48191301		2203	4300	6503	SO:0001583	missense	0				CCDS11560.1, CCDS58562.1	17q21.33	2013-01-10				ENSG00000167100		"""Sterile alpha motif (SAM) domain containing"""	27312	protein-coding gene	gene with protein product						8619474	Standard	NM_174920		Approved	FLJ36890	uc002iqg.4	Q8IZD0		ENST00000330175.4:c.1085G>A	17.37:g.48191301C>T	ENSP00000329144:p.Gly362Glu		A5D8V1|Q8N2X0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.G390E	ENST00000330175.4	37	c.1169	CCDS58562.1	17	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374582	0.61735	.	.	ENSG00000167100	ENST00000330175;ENST00000285206;ENST00000503131	D;D;D	0.82803	-1.65;-1.65;-1.65	5.02	5.02	0.67125	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.081868	0.48767	D	0.000169	D	0.87422	0.6173	L	0.39085	1.19	0.50171	D	0.999859	D;D	0.89917	1.0;1.0	D;D	0.85130	0.989;0.997	D	0.88873	0.3334	10	0.72032	D	0.01	-7.3806	17.1353	0.86737	0.0:1.0:0.0:0.0	.	362;390	Q8IZD0;Q8IZD0-2	SAM14_HUMAN;.	E	362;374;390	ENSP00000329144:G362E;ENSP00000285206:G374E;ENSP00000424474:G390E	ENSP00000285206:G374E	G	-	2	0	SAMD14	45546300	1.000000	0.71417	0.996000	0.52242	0.247000	0.25773	7.360000	0.79487	2.340000	0.79590	0.462000	0.41574	GGA	SAMD14	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000167100		0.572	SAMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD14	HGNC	protein_coding	OTTHUMT00000366661.1	-	0.00	84	0	C	NM_174920		48191301	-1	tier1	-	no_errors	ENST00000503131	ensembl	human	known	74_37	missense	35.38	42	23	SNP	1.000	T
SDK1	221935	genome.wustl.edu	37	7	3678687	3678687	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:3678687G>T	ENST00000404826.2	+	3	649	c.510G>T	c.(508-510)gtG>gtT	p.V170V	SDK1_ENST00000389531.3_Silent_p.V170V	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	170	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCGCTGCGTGGTGCGAAACA	0.408																																																	0													79.0	69.0	72.0					7																	3678687		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.510G>T	7.37:g.3678687G>T			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V170	ENST00000404826.2	37	c.510	CCDS34590.1	7																																																																																			SDK1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000146555		0.408	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1		0.00	26	0	G	NM_152744		3678687	+1			no_errors	ENST00000404826	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.996	T
SAMD9L	219285	genome.wustl.edu	37	7	92762703	92762703	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:92762703A>G	ENST00000318238.4	-	5	3798	c.2582T>C	c.(2581-2583)cTt>cCt	p.L861P	SAMD9L_ENST00000437805.1_Missense_Mutation_p.L861P|SAMD9L_ENST00000411955.1_Missense_Mutation_p.L861P	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	861					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTGGAAGAAAGTTGGTAATT	0.363																																																	0													92.0	100.0	97.0					7																	92762703		2203	4299	6502	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2582T>C	7.37:g.92762703A>G	ENSP00000326247:p.Leu861Pro		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.L861P	ENST00000318238.4	37	c.2582	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	A	16.91	3.253912	0.59212	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.39787	1.06;1.06;1.06	4.71	3.52	0.40303	.	0.000000	0.64402	D	0.000006	T	0.60143	0.2246	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.61850	-0.6978	10	0.87932	D	0	-11.9435	10.2741	0.43499	0.8517:0.0:0.0:0.1483	.	861	Q8IVG5	SAM9L_HUMAN	P	861	ENSP00000326247:L861P;ENSP00000405760:L861P;ENSP00000408796:L861P	ENSP00000326247:L861P	L	-	2	0	SAMD9L	92600639	1.000000	0.71417	0.924000	0.36721	0.914000	0.54420	8.956000	0.93066	0.791000	0.33826	0.383000	0.25322	CTT	SAMD9L	-	superfamily_P-loop_NTPase	ENSG00000177409		0.363	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	-	0.00	17	0	A	NM_152703		92762703	-1	tier1	-	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	G
SEC22C	9117	genome.wustl.edu	37	3	42610376	42610376	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:42610376C>A	ENST00000264454.3	-	2	306	c.163G>T	c.(163-165)Ggt>Tgt	p.G55C	SEC22C_ENST00000417572.1_Missense_Mutation_p.G55C|SEC22C_ENST00000423701.2_Missense_Mutation_p.G55C|SEC22C_ENST00000536332.1_De_novo_Start_InFrame|SEC22C_ENST00000273156.7_Missense_Mutation_p.G55C|SEC22C_ENST00000493107.1_5'UTR			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	55	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		AAGTCACAACCTTCTGCAGAA	0.383																																																	0													57.0	63.0	61.0					3																	42610376		2203	4300	6503	SO:0001583	missense	0			AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.163G>T	3.37:g.42610376C>A	ENSP00000264454:p.Gly55Cys		O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	superfamily_Longin-like_dom,pfscan_Longin_dom	p.G55C	ENST00000264454.3	37	c.163	CCDS2700.1	3	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863686	0.71949	.	.	ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000264454;ENST00000456515;ENST00000450981;ENST00000416880;ENST00000420163	T;T;T;T;T;T;T;T	0.21734	2.01;2.01;2.01;2.01;2.01;2.01;2.01;1.99	5.42	4.47	0.54385	Longin (2);Longin-like (1);	0.113273	0.64402	D	0.000010	T	0.32585	0.0834	L	0.44542	1.39	0.80722	D	1	D;D;D	0.76494	0.998;0.98;0.999	D;P;D	0.65443	0.912;0.88;0.935	T	0.02519	-1.1147	10	0.42905	T	0.14	-1.9616	8.8714	0.35318	0.0:0.8734:0.0:0.1266	.	55;55;55	Q9BRL7-3;Q9BRL7;Q9BRL7-2	.;SC22C_HUMAN;.	C	55	ENSP00000414576:G55C;ENSP00000273156:G55C;ENSP00000407564:G55C;ENSP00000264454:G55C;ENSP00000391170:G55C;ENSP00000397170:G55C;ENSP00000391957:G55C;ENSP00000408242:G55C	ENSP00000264454:G55C	G	-	1	0	SEC22C	42585380	1.000000	0.71417	0.510000	0.27712	0.910000	0.53928	5.359000	0.66074	1.077000	0.40990	0.655000	0.94253	GGT	SEC22C	-	superfamily_Longin-like_dom,pfscan_Longin_dom	ENSG00000093183		0.383	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC22C	HGNC	protein_coding	OTTHUMT00000254734.1	-	0.00	42	0	C	NM_004206		42610376	-1	tier1	-	no_errors	ENST00000264454	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
SEC22C	9117	genome.wustl.edu	37	3	42610376	42610376	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:42610376C>A	ENST00000264454.3	-	2	306	c.163G>T	c.(163-165)Ggt>Tgt	p.G55C	SEC22C_ENST00000417572.1_Missense_Mutation_p.G55C|SEC22C_ENST00000423701.2_Missense_Mutation_p.G55C|SEC22C_ENST00000536332.1_De_novo_Start_InFrame|SEC22C_ENST00000273156.7_Missense_Mutation_p.G55C|SEC22C_ENST00000493107.1_5'UTR			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	55	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		AAGTCACAACCTTCTGCAGAA	0.383																																																	0													57.0	63.0	61.0					3																	42610376		2203	4300	6503	SO:0001583	missense	0			AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.163G>T	3.37:g.42610376C>A	ENSP00000264454:p.Gly55Cys		O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	superfamily_Longin-like_dom,pfscan_Longin_dom	p.G55C	ENST00000264454.3	37	c.163	CCDS2700.1	3	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863686	0.71949	.	.	ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000264454;ENST00000456515;ENST00000450981;ENST00000416880;ENST00000420163	T;T;T;T;T;T;T;T	0.21734	2.01;2.01;2.01;2.01;2.01;2.01;2.01;1.99	5.42	4.47	0.54385	Longin (2);Longin-like (1);	0.113273	0.64402	D	0.000010	T	0.32585	0.0834	L	0.44542	1.39	0.80722	D	1	D;D;D	0.76494	0.998;0.98;0.999	D;P;D	0.65443	0.912;0.88;0.935	T	0.02519	-1.1147	10	0.42905	T	0.14	-1.9616	8.8714	0.35318	0.0:0.8734:0.0:0.1266	.	55;55;55	Q9BRL7-3;Q9BRL7;Q9BRL7-2	.;SC22C_HUMAN;.	C	55	ENSP00000414576:G55C;ENSP00000273156:G55C;ENSP00000407564:G55C;ENSP00000264454:G55C;ENSP00000391170:G55C;ENSP00000397170:G55C;ENSP00000391957:G55C;ENSP00000408242:G55C	ENSP00000264454:G55C	G	-	1	0	SEC22C	42585380	1.000000	0.71417	0.510000	0.27712	0.910000	0.53928	5.359000	0.66074	1.077000	0.40990	0.655000	0.94253	GGT	SEC22C	-	superfamily_Longin-like_dom,pfscan_Longin_dom	ENSG00000093183		0.383	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC22C	HGNC	protein_coding	OTTHUMT00000254734.1	-	0.00	52	0	C	NM_004206		42610376	-1	tier1	-	no_errors	ENST00000264454	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
SELP	6403	genome.wustl.edu	37	1	169586496	169586496	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:169586496G>A	ENST00000263686.6	-	3	288	c.251C>T	c.(250-252)cCc>cTc	p.P84L	SELP_ENST00000458599.2_Missense_Mutation_p.P84L|SELP_ENST00000367793.2_Missense_Mutation_p.P84L|SELP_ENST00000367786.2_Missense_Mutation_p.P84L|SELP_ENST00000367792.2_Missense_Mutation_p.P84L|SELP_ENST00000367788.2_Missense_Mutation_p.P84L|SELP_ENST00000367791.2_Missense_Mutation_p.P84L|SELP_ENST00000367794.2_Missense_Mutation_p.P84L	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	84	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GCTGTAGTAGGGTAGGACCTT	0.438																																																	0													222.0	200.0	208.0					1																	169586496		2203	4300	6503	SO:0001583	missense	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.251C>T	1.37:g.169586496G>A	ENSP00000263686:p.Pro84Leu		Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.P84L	ENST00000263686.6	37	c.251	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219220	0.79464	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.9	5.9	0.94986	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.53938	D	0.000046	T	0.41811	0.1175	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.38866	-0.9641	10	0.72032	D	0.01	-20.7022	17.7661	0.88478	0.0:0.0:1.0:0.0	.	84;84	Q6NUL9;P16109	.;LYAM3_HUMAN	L	84;84;83;84;84;84;84;84;84;84;84;84;69	ENSP00000263686:P84L;ENSP00000356767:P84L;ENSP00000356768:P84L;ENSP00000356766:P84L;ENSP00000356765:P84L;ENSP00000356762:P84L;ENSP00000356760:P84L	ENSP00000263686:P84L	P	-	2	0	SELP	167853120	1.000000	0.71417	0.811000	0.32455	0.483000	0.33249	9.476000	0.97823	2.793000	0.96121	0.563000	0.77884	CCC	SELP	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000174175		0.438	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	-	0.00	77	0	G	NM_003005		169586496	-1	tier1	-	no_errors	ENST00000263686	ensembl	human	known	74_37	missense	26.09	68	24	SNP	0.998	A
SELP	6403	genome.wustl.edu	37	1	169586496	169586496	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:169586496G>A	ENST00000263686.6	-	3	288	c.251C>T	c.(250-252)cCc>cTc	p.P84L	SELP_ENST00000458599.2_Missense_Mutation_p.P84L|SELP_ENST00000367793.2_Missense_Mutation_p.P84L|SELP_ENST00000367786.2_Missense_Mutation_p.P84L|SELP_ENST00000367792.2_Missense_Mutation_p.P84L|SELP_ENST00000367788.2_Missense_Mutation_p.P84L|SELP_ENST00000367791.2_Missense_Mutation_p.P84L|SELP_ENST00000367794.2_Missense_Mutation_p.P84L	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	84	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	GCTGTAGTAGGGTAGGACCTT	0.438																																																	0													222.0	200.0	208.0					1																	169586496		2203	4300	6503	SO:0001583	missense	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.251C>T	1.37:g.169586496G>A	ENSP00000263686:p.Pro84Leu		Q5R344|Q8IVD1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.P84L	ENST00000263686.6	37	c.251	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219220	0.79464	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.9	5.9	0.94986	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.53938	D	0.000046	T	0.41811	0.1175	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.38866	-0.9641	10	0.72032	D	0.01	-20.7022	17.7661	0.88478	0.0:0.0:1.0:0.0	.	84;84	Q6NUL9;P16109	.;LYAM3_HUMAN	L	84;84;83;84;84;84;84;84;84;84;84;84;69	ENSP00000263686:P84L;ENSP00000356767:P84L;ENSP00000356768:P84L;ENSP00000356766:P84L;ENSP00000356765:P84L;ENSP00000356762:P84L;ENSP00000356760:P84L	ENSP00000263686:P84L	P	-	2	0	SELP	167853120	1.000000	0.71417	0.811000	0.32455	0.483000	0.33249	9.476000	0.97823	2.793000	0.96121	0.563000	0.77884	CCC	SELP	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000174175		0.438	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4	-	0.00	87	0	G	NM_003005		169586496	-1	tier1	-	no_errors	ENST00000263686	ensembl	human	known	74_37	missense	26.09	68	24	SNP	0.998	A
SEMA4D	10507	genome.wustl.edu	37	9	92006182	92006182	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:92006182G>T	ENST00000450295.1	-	9	1547	c.771C>A	c.(769-771)tgC>tgA	p.C257*	SEMA4D_ENST00000420987.1_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000356444.2_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000455551.2_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000422704.2_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000343780.4_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000339861.4_Nonsense_Mutation_p.C257*|SEMA4D_ENST00000438547.2_Nonsense_Mutation_p.C257*			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	257	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						CACTCACCTTGCACACTCTTG	0.552																																																	0													167.0	119.0	136.0					9																	92006182		2203	4300	6503	SO:0001587	stop_gained	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.771C>A	9.37:g.92006182G>T	ENSP00000416523:p.Cys257*		B2RPM6|Q7Z5S4|Q8N8B0	Nonsense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.C257*	ENST00000450295.1	37	c.771	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	G	43	10.075238	0.99331	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	.	.	.	5.16	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2967	0.43629	0.0731:0.1372:0.7897:0.0	.	.	.	.	X	257	.	ENSP00000344923:C257X	C	-	3	2	SEMA4D	91196002	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	2.374000	0.44274	1.406000	0.46857	0.555000	0.69702	TGC	SEMA4D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000187764		0.552	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1		0.00	20	0	G	NM_006378		92006182	-1			no_errors	ENST00000356444	ensembl	human	known	74_37	nonsense	9.68	28	3	SNP	1.000	T
SETD2	29072	genome.wustl.edu	37	3	47155365	47155365	+	Splice_Site	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:47155365C>G	ENST00000409792.3	-	5	4758		c.e5+1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAAGAACTTACGAAGGAAGGT	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													106.0	107.0	106.0					3																	47155365		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4715+1G>C	3.37:g.47155365C>G			O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	-	e5+1	ENST00000409792.3	37	c.4715+1	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254094	0.80135	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8075	0.88606	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47130369	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.256000	0.78350	2.518000	0.84900	0.585000	0.79938	.	SETD2	-	-	ENSG00000181555		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2		0.00	13	0	C	NM_014159	Intron	47155365	-1			no_errors	ENST00000409792	ensembl	human	known	74_37	splice_site	36.36	14	8	SNP	1.000	G
SFRP4	6424	genome.wustl.edu	37	7	37947216	37947216	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:37947216C>A	ENST00000436072.2	-	6	1283	c.906G>T	c.(904-906)aaG>aaT	p.K302N	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	302	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						CGGCTGTTTTCTTCTTGTCCT	0.483																																																	0													107.0	107.0	107.0					7																	37947216		2203	4300	6503	SO:0001583	missense	0			AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.906G>T	7.37:g.37947216C>A	ENSP00000410715:p.Lys302Asn		B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.K302N	ENST00000436072.2	37	c.906	CCDS5453.1	7	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622358	0.28889	.	.	ENSG00000106483	ENST00000436072;ENST00000446575	T	0.64085	-0.08	5.83	4.04	0.47022	Netrin domain (1);	0.363813	0.30556	N	0.009369	T	0.37073	0.0990	N	0.12182	0.205	0.28954	N	0.890223	B	0.09022	0.002	B	0.06405	0.002	T	0.16630	-1.0396	10	0.23302	T	0.38	.	4.8421	0.13496	0.1498:0.6187:0.0:0.2315	.	302	Q6FHJ7	SFRP4_HUMAN	N	302;299	ENSP00000410715:K302N	ENSP00000410715:K302N	K	-	3	2	SFRP4	37913741	0.997000	0.39634	0.952000	0.39060	0.771000	0.43674	1.369000	0.34227	0.811000	0.34303	0.650000	0.86243	AAG	SFRP4	-	pfscan_Netrin_domain	ENSG00000106483		0.483	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP4	HGNC	protein_coding	OTTHUMT00000220017.2	-	0.00	49	0	C	NM_003014		37947216	-1	tier1	-	no_errors	ENST00000436072	ensembl	human	known	74_37	missense	27.12	43	16	SNP	0.931	A
SFRP4	6424	genome.wustl.edu	37	7	37947216	37947216	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:37947216C>A	ENST00000436072.2	-	6	1283	c.906G>T	c.(904-906)aaG>aaT	p.K302N	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	302	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						CGGCTGTTTTCTTCTTGTCCT	0.483																																																	0													107.0	107.0	107.0					7																	37947216		2203	4300	6503	SO:0001583	missense	0			AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.906G>T	7.37:g.37947216C>A	ENSP00000410715:p.Lys302Asn		B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.K302N	ENST00000436072.2	37	c.906	CCDS5453.1	7	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622358	0.28889	.	.	ENSG00000106483	ENST00000436072;ENST00000446575	T	0.64085	-0.08	5.83	4.04	0.47022	Netrin domain (1);	0.363813	0.30556	N	0.009369	T	0.37073	0.0990	N	0.12182	0.205	0.28954	N	0.890223	B	0.09022	0.002	B	0.06405	0.002	T	0.16630	-1.0396	10	0.23302	T	0.38	.	4.8421	0.13496	0.1498:0.6187:0.0:0.2315	.	302	Q6FHJ7	SFRP4_HUMAN	N	302;299	ENSP00000410715:K302N	ENSP00000410715:K302N	K	-	3	2	SFRP4	37913741	0.997000	0.39634	0.952000	0.39060	0.771000	0.43674	1.369000	0.34227	0.811000	0.34303	0.650000	0.86243	AAG	SFRP4	-	pfscan_Netrin_domain	ENSG00000106483		0.483	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP4	HGNC	protein_coding	OTTHUMT00000220017.2	-	0.00	62	0	C	NM_003014		37947216	-1	tier1	-	no_errors	ENST00000436072	ensembl	human	known	74_37	missense	27.12	43	16	SNP	0.931	A
SH3BP5	9467	genome.wustl.edu	37	3	15297082	15297083	+	3'UTR	INS	-	-	T	rs544125875		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:15297082_15297083insT	ENST00000383791.3	-	0	2098_2099				SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)						intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GTGTTCTTGGATTTTTTTTTTT	0.361																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.*511->A	3.37:g.15297093_15297093dupT			B3KQW6|Q5JWV9	RNA	INS	-	NULL	ENST00000383791.3	37	NULL	CCDS2625.2	3																																																																																			SH3BP5-AS1	-	-	ENSG00000224660		0.361	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5-AS1	HGNC	protein_coding	OTTHUMT00000340740.2		0.00	20	0	-	NM_004844		15297083	+1	tier1		no_errors	ENST00000420195	ensembl	human	known	74_37	rna	22.22	14	4	INS	0.057:0.010	T
SLC18A3	6572	genome.wustl.edu	37	10	50818987	50818987	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:50818987C>T	ENST00000374115.3	+	1	641	c.201C>T	c.(199-201)ggC>ggT	p.G67G	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	67					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TGCGCGGGGGCGGCGAGGGCC	0.667																																																	0													34.0	28.0	30.0					10																	50818987		2202	4299	6501	SO:0001819	synonymous_variant	0			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.201C>T	10.37:g.50818987C>T			B2R7S1	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G67	ENST00000374115.3	37	c.201	CCDS7231.1	10																																																																																			SLC18A3	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000187714		0.667	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	-	0.00	18	0	C	NM_003055		50818987	+1	tier1	-	no_errors	ENST00000374115	ensembl	human	known	74_37	silent	39.29	17	11	SNP	0.907	T
SLC26A2	1836	genome.wustl.edu	37	5	149357798	149357798	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:149357798G>T	ENST00000286298.4	+	2	851	c.583G>T	c.(583-585)Gga>Tga	p.G195*		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	195					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCCTTCCTTAGGAATGGTTTC	0.413																																																	0													142.0	130.0	134.0					5																	149357798		2203	4300	6503	SO:0001587	stop_gained	0			U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.583G>T	5.37:g.149357798G>T	ENSP00000286298:p.Gly195*		A8K2U3|B2R6J1|Q6N051	Nonsense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G195*	ENST00000286298.4	37	c.583	CCDS4300.1	5	.	.	.	.	.	.	.	.	.	.	G	7.731	0.699165	0.15106	.	.	ENSG00000155850	ENST00000286298;ENST00000503336	.	.	.	5.21	3.05	0.35203	.	155.122000	0.01777	U	0.031556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	6.2729	0.20965	0.2289:0.0:0.6288:0.1423	.	.	.	.	X	195;86	.	ENSP00000286298:G195X	G	+	1	0	SLC26A2	149337991	0.002000	0.14202	0.013000	0.15412	0.069000	0.16628	0.707000	0.25704	1.161000	0.42604	0.655000	0.94253	GGA	SLC26A2	-	tigrfam_SulP_transpt	ENSG00000155850		0.413	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A2	HGNC	protein_coding	OTTHUMT00000252333.2	-	0.00	17	0	G	NM_000112		149357798	+1	tier1	-	no_errors	ENST00000286298	ensembl	human	known	74_37	nonsense	26.47	25	9	SNP	0.000	T
SLC26A2	1836	genome.wustl.edu	37	5	149357798	149357798	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:149357798G>T	ENST00000286298.4	+	2	851	c.583G>T	c.(583-585)Gga>Tga	p.G195*		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	195					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCCTTCCTTAGGAATGGTTTC	0.413																																																	0													142.0	130.0	134.0					5																	149357798		2203	4300	6503	SO:0001587	stop_gained	0			U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.583G>T	5.37:g.149357798G>T	ENSP00000286298:p.Gly195*		A8K2U3|B2R6J1|Q6N051	Nonsense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G195*	ENST00000286298.4	37	c.583	CCDS4300.1	5	.	.	.	.	.	.	.	.	.	.	G	7.731	0.699165	0.15106	.	.	ENSG00000155850	ENST00000286298;ENST00000503336	.	.	.	5.21	3.05	0.35203	.	155.122000	0.01777	U	0.031556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	6.2729	0.20965	0.2289:0.0:0.6288:0.1423	.	.	.	.	X	195;86	.	ENSP00000286298:G195X	G	+	1	0	SLC26A2	149337991	0.002000	0.14202	0.013000	0.15412	0.069000	0.16628	0.707000	0.25704	1.161000	0.42604	0.655000	0.94253	GGA	SLC26A2	-	tigrfam_SulP_transpt	ENSG00000155850		0.413	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A2	HGNC	protein_coding	OTTHUMT00000252333.2	-	0.00	27	0	G	NM_000112		149357798	+1	tier1	-	no_errors	ENST00000286298	ensembl	human	known	74_37	nonsense	26.47	25	9	SNP	0.000	T
SLC26A9	115019	genome.wustl.edu	37	1	205897959	205897959	+	Missense_Mutation	SNP	G	G	T	rs375592150		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:205897959G>T	ENST00000367135.3	-	8	1062	c.949C>A	c.(949-951)Cgc>Agc	p.R317S	SLC26A9_ENST00000340781.4_Missense_Mutation_p.R317S|SLC26A9_ENST00000367134.2_Missense_Mutation_p.R317S	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	317					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			ACTCACCCGCGTTGGATTTCT	0.567																																																	0													69.0	62.0	64.0					1																	205897959		2203	4300	6503	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.949C>A	1.37:g.205897959G>T	ENSP00000356103:p.Arg317Ser		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.R317S	ENST00000367135.3	37	c.949	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	G	5.439	0.266163	0.10294	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.91894	-2.93;-2.93;-2.93	4.88	4.88	0.63580	Sulphate transporter (1);	1.057300	0.07403	N	0.891096	T	0.80763	0.4685	N	0.02775	-0.495	0.09310	N	0.999996	B;B	0.22003	0.004;0.063	B;B	0.23716	0.018;0.048	T	0.61347	-0.7081	10	0.02654	T	1	.	12.6184	0.56590	0.0:0.0:0.8338:0.1662	.	317;317	Q7LBE3;B1AVM8	S26A9_HUMAN;.	S	317	ENSP00000341682:R317S;ENSP00000356103:R317S;ENSP00000356102:R317S	ENSP00000341682:R317S	R	-	1	0	SLC26A9	204164582	0.114000	0.22134	0.857000	0.33713	0.890000	0.51754	1.319000	0.33655	2.258000	0.74832	0.655000	0.94253	CGC	SLC26A9	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000174502		0.567	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1		0.00	23	0	G	NM_052934		205897959	-1			no_errors	ENST00000340781	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.431	T
SLC4A10	57282	genome.wustl.edu	37	2	162751223	162751223	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:162751223G>A	ENST00000446997.1	+	11	1322	c.1229G>A	c.(1228-1230)cGt>cAt	p.R410H	SLC4A10_ENST00000415876.2_Missense_Mutation_p.R380H|SLC4A10_ENST00000535165.1_Missense_Mutation_p.V381I|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000375514.5_Missense_Mutation_p.R391H|SLC4A10_ENST00000421911.1_Missense_Mutation_p.R410H|SLC4A10_ENST00000272716.5_Missense_Mutation_p.R380H	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	410					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GCTAAAGATCGTAATGACTTG	0.328																																																	0													114.0	104.0	107.0					2																	162751223		1824	4078	5902	SO:0001583	missense	0				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1229G>A	2.37:g.162751223G>A	ENSP00000393066:p.Arg410His		B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.R410H	ENST00000446997.1	37	c.1229	CCDS54411.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.343665|5.343665	0.95783|0.95783	.|.	.|.	ENSG00000144290|ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711|ENST00000535165	T;T;T;T;T|T	0.70399|0.53640	-0.48;-0.48;-0.48;-0.48;-0.48|0.61	5.43|5.43	5.43|5.43	0.79202|0.79202	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79423|0.79423	0.4443|0.4443	H|H	0.95574|0.95574	3.69|3.69	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.996;1.0;0.998|.	D|D	0.84666|0.84666	0.0709|0.0709	10|7	0.87932|0.59425	D|D	0|0.04	.|.	19.6166|19.6166	0.95636|0.95636	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	391;410;380;410|.	F8W675;E7EW28;Q6U841-2;Q6U841|.	.;.;.;S4A10_HUMAN|.	H|I	391;380;380;379;410;410;409|381	ENSP00000364664:R391H;ENSP00000395797:R380H;ENSP00000272716:R380H;ENSP00000393066:R410H;ENSP00000404486:R410H|ENSP00000437527:V381I	ENSP00000272716:R380H|ENSP00000437527:V381I	R|V	+|+	2|1	0|0	SLC4A10|SLC4A10	162459469|162459469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.813000|9.813000	0.99286|0.99286	2.721000|2.721000	0.93114|0.93114	0.655000|0.655000	0.94253|0.94253	CGT|GTA	SLC4A10	-	pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000144290		0.328	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	-	0.00	92	0	G	NM_022058		162751223	+1	tier1	-	no_errors	ENST00000446997	ensembl	human	known	74_37	missense	42.50	69	51	SNP	1.000	A
SLC40A1	30061	genome.wustl.edu	37	2	190426823	190426823	+	Missense_Mutation	SNP	C	C	A	rs200982250		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:190426823C>A	ENST00000261024.2	-	8	1923	c.1497G>T	c.(1495-1497)atG>atT	p.M499I		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	499					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GAAGATAGTTCATGGAGTTCT	0.388																																																	0													84.0	80.0	81.0					2																	190426823		2203	4300	6503	SO:0001583	missense	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1497G>T	2.37:g.190426823C>A	ENSP00000261024:p.Met499Ile		Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.M499I	ENST00000261024.2	37	c.1497	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551371	0.86127	.	.	ENSG00000138449	ENST00000261024	D	0.93906	-3.31	5.92	5.03	0.67393	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.94102	0.8109	L	0.54323	1.7	0.80722	D	1	D	0.59767	0.986	P	0.55577	0.779	D	0.93148	0.6547	10	0.41790	T	0.15	-19.8013	15.5026	0.75713	0.0:0.9327:0.0:0.0673	.	499	Q9NP59	S40A1_HUMAN	I	499	ENSP00000261024:M499I	ENSP00000261024:M499I	M	-	3	0	SLC40A1	190135068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.999000	0.70665	2.814000	0.96858	0.585000	0.79938	ATG	SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.388	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2	-	0.00	35	0	C			190426823	-1	tier1	-	no_errors	ENST00000261024	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
SLC40A1	30061	genome.wustl.edu	37	2	190426823	190426823	+	Missense_Mutation	SNP	C	C	A	rs200982250		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:190426823C>A	ENST00000261024.2	-	8	1923	c.1497G>T	c.(1495-1497)atG>atT	p.M499I		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	499					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GAAGATAGTTCATGGAGTTCT	0.388																																																	0													84.0	80.0	81.0					2																	190426823		2203	4300	6503	SO:0001583	missense	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1497G>T	2.37:g.190426823C>A	ENSP00000261024:p.Met499Ile		Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.M499I	ENST00000261024.2	37	c.1497	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551371	0.86127	.	.	ENSG00000138449	ENST00000261024	D	0.93906	-3.31	5.92	5.03	0.67393	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.94102	0.8109	L	0.54323	1.7	0.80722	D	1	D	0.59767	0.986	P	0.55577	0.779	D	0.93148	0.6547	10	0.41790	T	0.15	-19.8013	15.5026	0.75713	0.0:0.9327:0.0:0.0673	.	499	Q9NP59	S40A1_HUMAN	I	499	ENSP00000261024:M499I	ENSP00000261024:M499I	M	-	3	0	SLC40A1	190135068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.999000	0.70665	2.814000	0.96858	0.585000	0.79938	ATG	SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.388	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2	-	0.00	48	0	C			190426823	-1	tier1	-	no_errors	ENST00000261024	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
SLC4A2	6522	genome.wustl.edu	37	7	150762016	150762016	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:150762016G>A	ENST00000485713.1	+	5	1581	c.541G>A	c.(541-543)Gag>Aag	p.E181K	SLC4A2_ENST00000461735.1_Missense_Mutation_p.E167K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E181K|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E99K|SLC4A2_ENST00000392826.2_Missense_Mutation_p.E172K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	181	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCCCACCAGGAGGCGACTCC	0.582																																																	0													60.0	65.0	64.0					7																	150762016		2203	4300	6503	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.541G>A	7.37:g.150762016G>A	ENSP00000419412:p.Glu181Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E181K	ENST00000485713.1	37	c.541	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130205	0.37630	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.87	5.33	4.4	0.53042	.	0.817918	0.10943	N	0.617067	T	0.76357	0.3976	L	0.50333	1.59	0.25867	N	0.983759	D;D;D	0.56287	0.975;0.975;0.958	P;P;P	0.58130	0.833;0.833;0.685	T	0.63047	-0.6724	10	0.08179	T	0.78	.	10.4854	0.44719	0.0:0.0:0.8067:0.1933	.	172;167;181	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	181;181;99;172;167	ENSP00000419412:E181K;ENSP00000405600:E181K;ENSP00000311402:E99K;ENSP00000376571:E172K;ENSP00000419164:E167K	ENSP00000311402:E99K	E	+	1	0	SLC4A2	150392949	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.149000	0.58091	2.479000	0.83701	0.655000	0.94253	GAG	SLC4A2	-	NULL	ENSG00000164889		0.582	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	-	0.00	51	0	G	NM_003040		150762016	+1	tier1	-	no_errors	ENST00000413384	ensembl	human	known	74_37	missense	7.79	71	6	SNP	0.977	A
SLC4A2	6522	genome.wustl.edu	37	7	150762016	150762016	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:150762016G>A	ENST00000485713.1	+	5	1581	c.541G>A	c.(541-543)Gag>Aag	p.E181K	SLC4A2_ENST00000461735.1_Missense_Mutation_p.E167K|SLC4A2_ENST00000413384.2_Missense_Mutation_p.E181K|SLC4A2_ENST00000310317.5_Missense_Mutation_p.E99K|SLC4A2_ENST00000392826.2_Missense_Mutation_p.E172K	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	181	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCCCACCAGGAGGCGACTCC	0.582																																																	0													60.0	65.0	64.0					7																	150762016		2203	4300	6503	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.541G>A	7.37:g.150762016G>A	ENSP00000419412:p.Glu181Lys		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.E181K	ENST00000485713.1	37	c.541	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130205	0.37630	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.87	5.33	4.4	0.53042	.	0.817918	0.10943	N	0.617067	T	0.76357	0.3976	L	0.50333	1.59	0.25867	N	0.983759	D;D;D	0.56287	0.975;0.975;0.958	P;P;P	0.58130	0.833;0.833;0.685	T	0.63047	-0.6724	10	0.08179	T	0.78	.	10.4854	0.44719	0.0:0.0:0.8067:0.1933	.	172;167;181	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	K	181;181;99;172;167	ENSP00000419412:E181K;ENSP00000405600:E181K;ENSP00000311402:E99K;ENSP00000376571:E172K;ENSP00000419164:E167K	ENSP00000311402:E99K	E	+	1	0	SLC4A2	150392949	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.149000	0.58091	2.479000	0.83701	0.655000	0.94253	GAG	SLC4A2	-	NULL	ENSG00000164889		0.582	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	-	0.00	97	0	G	NM_003040		150762016	+1	tier1	-	no_errors	ENST00000413384	ensembl	human	known	74_37	missense	7.79	71	6	SNP	0.977	A
SLC6A20	54716	genome.wustl.edu	37	3	45814027	45814027	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:45814027G>T	ENST00000358525.4	-	5	778	c.663C>A	c.(661-663)acC>acA	p.T221T	SLC6A20_ENST00000456124.2_Silent_p.T221T|SLC6A20_ENST00000353278.4_Intron	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	221					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		TGAGGCCATTGGTGGCTCCGT	0.602																																																	0													81.0	89.0	86.0					3																	45814027		2062	4201	6263	SO:0001819	synonymous_variant	0			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.663C>A	3.37:g.45814027G>T			A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.T221	ENST00000358525.4	37	c.663	CCDS43077.1	3																																																																																			SLC6A20	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000163817		0.602	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A20	HGNC	protein_coding	OTTHUMT00000257318.3	-	0.00	31	0	G	NM_020208		45814027	-1	tier1	-	no_errors	ENST00000358525	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.991	T
SLC6A20	54716	genome.wustl.edu	37	3	45814027	45814027	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:45814027G>T	ENST00000358525.4	-	5	778	c.663C>A	c.(661-663)acC>acA	p.T221T	SLC6A20_ENST00000456124.2_Silent_p.T221T|SLC6A20_ENST00000353278.4_Intron	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	221					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		TGAGGCCATTGGTGGCTCCGT	0.602																																																	0													81.0	89.0	86.0					3																	45814027		2062	4201	6263	SO:0001819	synonymous_variant	0			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.663C>A	3.37:g.45814027G>T			A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.T221	ENST00000358525.4	37	c.663	CCDS43077.1	3																																																																																			SLC6A20	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000163817		0.602	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A20	HGNC	protein_coding	OTTHUMT00000257318.3	-	0.00	41	0	G	NM_020208		45814027	-1	tier1	-	no_errors	ENST00000358525	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.991	T
SLC7A6	9057	genome.wustl.edu	37	16	68308966	68308966	+	Missense_Mutation	SNP	G	G	T	rs144583655		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:68308966G>T	ENST00000566454.1	+	4	606	c.337G>T	c.(337-339)Gct>Tct	p.A113S	SLC7A6_ENST00000219343.6_Missense_Mutation_p.A113S	NM_001076785.2	NP_001070253.1			solute carrier family 7 (amino acid transporter light chain, y+L system), member 6									p.A113T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)		AGCCAGCTACGCTTATATTCT	0.562																																																	1	Substitution - Missense(1)	endometrium(1)											105.0	102.0	103.0					16																	68308966		2198	4300	6498	SO:0001583	missense	0			D87432	CCDS32470.1	16q22.1	2013-07-15	2011-07-12		ENSG00000103064	ENSG00000103064		"""Solute carriers"""	11064	protein-coding gene	gene with protein product		605641				9878049	Standard	NM_001076785		Approved	y+LAT-2, KIAA0245, LAT3, LAT-2	uc002evu.2	Q92536	OTTHUMG00000176544	ENST00000566454.1:c.337G>T	16.37:g.68308966G>T	ENSP00000455064:p.Ala113Ser			Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.A113S	ENST00000566454.1	37	c.337	CCDS32470.1	16	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912994	0.92178	.	.	ENSG00000103064	ENST00000219343;ENST00000379152	D;D	0.89196	-2.48;-2.48	5.76	5.76	0.90799	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.93615	0.7961	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92346	0.5885	10	0.37606	T	0.19	.	17.5215	0.87789	0.0:0.0:1.0:0.0	.	113	Q92536	YLAT2_HUMAN	S	113	ENSP00000219343:A113S;ENSP00000368448:A113S	ENSP00000219343:A113S	A	+	1	0	SLC7A6	66866467	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.653000	0.98506	2.718000	0.92993	0.650000	0.86243	GCT	SLC7A6	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	ENSG00000103064		0.562	SLC7A6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC7A6	HGNC	protein_coding	OTTHUMT00000432466.1		0.00	31	0	G	NM_003983		68308966	+1			no_errors	ENST00000219343	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
SLC9A3	6550	genome.wustl.edu	37	5	488464	488464	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:488464G>A	ENST00000264938.3	-	3	651	c.642C>T	c.(640-642)ttC>ttT	p.F214F	SLC9A3_ENST00000514375.1_Silent_p.F214F	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	214					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GCGACTCCCCGAAGACGATGA	0.667																																																	0													72.0	66.0	68.0					5																	488464		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.642C>T	5.37:g.488464G>A			B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_dom,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F214	ENST00000264938.3	37	c.642	CCDS3855.1	5																																																																																			SLC9A3	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000066230		0.667	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	-	0.00	50	0	G	NM_004174		488464	-1	tier1	-	no_errors	ENST00000264938	ensembl	human	known	74_37	silent	32.47	52	25	SNP	0.961	A
SLC9A3	6550	genome.wustl.edu	37	5	488464	488464	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:488464G>A	ENST00000264938.3	-	3	651	c.642C>T	c.(640-642)ttC>ttT	p.F214F	SLC9A3_ENST00000514375.1_Silent_p.F214F	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	214					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GCGACTCCCCGAAGACGATGA	0.667																																																	0													72.0	66.0	68.0					5																	488464		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.642C>T	5.37:g.488464G>A			B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_dom,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F214	ENST00000264938.3	37	c.642	CCDS3855.1	5																																																																																			SLC9A3	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000066230		0.667	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	-	0.00	65	0	G	NM_004174		488464	-1	tier1	-	no_errors	ENST00000264938	ensembl	human	known	74_37	silent	32.47	52	25	SNP	0.961	A
SLCO1B7	338821	genome.wustl.edu	37	12	21196409	21196409	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:21196409G>A	ENST00000421593.2	+	6	728	c.728G>A	c.(727-729)aGg>aAg	p.R243K	LST3_ENST00000381541.3_Missense_Mutation_p.R290K|SLCO1B3_ENST00000553473.1_Intron|SLCO1B7_ENST00000554957.1_Missense_Mutation_p.R290K|LST3_ENST00000540229.1_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CAGAAAGAAAGGAAAGTTTCA	0.323																																																	0													84.0	85.0	85.0					12																	21196409		2199	4299	6498	SO:0001583	missense	0			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.728G>A	12.37:g.21196409G>A	ENSP00000394168:p.Arg243Lys		Q71QF0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.R290K	ENST00000421593.2	37	c.869	CCDS44843.1	12	.	.	.	.	.	.	.	.	.	.	.	4.651	0.121065	0.08881	.	.	ENSG00000257046;ENSG00000205754;ENSG00000205754	ENST00000381541;ENST00000554957;ENST00000421593	T;T;T	0.80653	-1.4;-1.4;1.07	3.17	1.28	0.21552	.	2.800900	0.00988	N	0.003496	T	0.67439	0.2893	N	0.25890	0.77	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.15052	0.006;0.012	T	0.52328	-0.8590	10	0.07030	T	0.85	.	5.5299	0.16978	0.3856:0.0:0.6144:0.0	.	243;290	G3V0H7;F5H094	.;.	K	290;290;243	ENSP00000370952:R290K;ENSP00000452013:R290K;ENSP00000394168:R243K	ENSP00000370952:R290K	R	+	2	0	SLCO1B7;RP11-545J16.1	21087676	0.744000	0.28250	0.037000	0.18230	0.172000	0.22775	0.913000	0.28611	0.182000	0.20032	0.305000	0.20034	AGG	SLCO1B7	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000205754		0.323	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	SLCO1B7	HGNC	protein_coding	OTTHUMT00000402066.1	-	0.00	67	0	G	NM_001009562		21196409	+1	tier1	-	no_errors	ENST00000554957	ensembl	human	known	74_37	missense	30.34	62	27	SNP	0.013	A
SLTM	79811	genome.wustl.edu	37	15	59225696	59225696	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:59225696G>T	ENST00000380516.2	-	1	156	c.69C>A	c.(67-69)acC>acA	p.T23T	SLTM_ENST00000536328.1_5'UTR|SLTM_ENST00000557950.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	23	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCCGCAGATCGGTGATCTTTT	0.622																																																	0													40.0	35.0	37.0					15																	59225696		2192	4292	6484	SO:0001819	synonymous_variant	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.69C>A	15.37:g.59225696G>T			A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.T23	ENST00000380516.2	37	c.69	CCDS10168.2	15																																																																																			SLTM	-	smart_SAP_dom,pfscan_SAP_dom	ENSG00000137776		0.622	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1		0.00	21	0	G	NM_024755		59225696	-1			no_errors	ENST00000380516	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.809	T
SMARCA4	6597	genome.wustl.edu	37	19	11144146	11144146	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:11144146C>T	ENST00000429416.3	+	27	4008	c.3727C>T	c.(3727-3729)Cgg>Tgg	p.R1243W	SMARCA4_ENST00000538456.3_3'UTR|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1243W|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1243W|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1243W|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1243W|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1243W	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1243	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R1243W(3)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CAGCCATGAGCGGCGCGCCTT	0.637			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	4	Substitution - Missense(3)|Unknown(1)	kidney(2)|lung(1)|central_nervous_system(1)											86.0	86.0	86.0					19																	11144146		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3727C>T	19.37:g.11144146C>T	ENSP00000395654:p.Arg1243Trp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R1243W	ENST00000429416.3	37	c.3727	CCDS12253.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.79|18.79	3.698723|3.698723	0.68501|0.68501	.|.	.|.	ENSG00000127616|ENSG00000127616	ENST00000538456|ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T|D;D;D;D;D;D;D	0.76060|0.95103	-0.99|-2.35;-2.34;-2.35;-3.61;-3.61;-3.61;-3.61	4.74|4.74	-4.88|-4.88	0.03113|0.03113	.|Helicase, C-terminal (1);	.|0.066410	.|0.64402	.|D	.|0.000011	D|D	0.96876|0.96876	0.8980|0.8980	M|M	0.89287|0.89287	3.02|3.02	0.47994|0.47994	D|D	0.999562|0.999562	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;0.979;0.995;0.991;0.988	D|D	0.95985|0.95985	0.8981|0.8981	6|10	.|0.87932	.|D	.|0	-32.479|-32.479	16.3987|16.3987	0.83632|0.83632	0.6595:0.3405:0.0:0.0|0.6595:0.3405:0.0:0.0	.|.	.|1243;1243;1243;1243;1243;463;1243	.|B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.|.;.;.;.;.;.;SMCA4_HUMAN	V|W	12|1243;1243;1307;1243;1243;1243;1243;1243	ENSP00000443848:A12V|ENSP00000395654:R1243W;ENSP00000350720:R1243W;ENSP00000343896:R1243W;ENSP00000445036:R1243W;ENSP00000392837:R1243W;ENSP00000397783:R1243W;ENSP00000414727:R1243W	.|ENSP00000343896:R1243W	A|R	+|+	2|1	0|2	SMARCA4|SMARCA4	11005146|11005146	0.951000|0.951000	0.32395|0.32395	0.989000|0.989000	0.46669|0.46669	0.990000|0.990000	0.78478|0.78478	0.134000|0.134000	0.15932|0.15932	-0.414000|-0.414000	0.07495|0.07495	0.558000|0.558000	0.71614|0.71614	GCG|CGG	SMARCA4	-	pfscan_Helicase_C	ENSG00000127616		0.637	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	35	0	C	NM_003072		11144146	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	31.91	32	15	SNP	0.997	T
SMARCA4	6597	genome.wustl.edu	37	19	11144146	11144146	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:11144146C>T	ENST00000429416.3	+	27	4008	c.3727C>T	c.(3727-3729)Cgg>Tgg	p.R1243W	SMARCA4_ENST00000538456.3_3'UTR|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1243W|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1243W|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1243W|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1243W|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1243W|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1243W	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1243	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R1243W(3)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CAGCCATGAGCGGCGCGCCTT	0.637			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	4	Substitution - Missense(3)|Unknown(1)	kidney(2)|lung(1)|central_nervous_system(1)											86.0	86.0	86.0					19																	11144146		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3727C>T	19.37:g.11144146C>T	ENSP00000395654:p.Arg1243Trp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R1243W	ENST00000429416.3	37	c.3727	CCDS12253.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.79|18.79	3.698723|3.698723	0.68501|0.68501	.|.	.|.	ENSG00000127616|ENSG00000127616	ENST00000538456|ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T|D;D;D;D;D;D;D	0.76060|0.95103	-0.99|-2.35;-2.34;-2.35;-3.61;-3.61;-3.61;-3.61	4.74|4.74	-4.88|-4.88	0.03113|0.03113	.|Helicase, C-terminal (1);	.|0.066410	.|0.64402	.|D	.|0.000011	D|D	0.96876|0.96876	0.8980|0.8980	M|M	0.89287|0.89287	3.02|3.02	0.47994|0.47994	D|D	0.999562|0.999562	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0;1.0;1.0	.|D;D;D;D;D;D;D	.|0.97110	.|0.999;1.0;1.0;0.979;0.995;0.991;0.988	D|D	0.95985|0.95985	0.8981|0.8981	6|10	.|0.87932	.|D	.|0	-32.479|-32.479	16.3987|16.3987	0.83632|0.83632	0.6595:0.3405:0.0:0.0|0.6595:0.3405:0.0:0.0	.|.	.|1243;1243;1243;1243;1243;463;1243	.|B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.|.;.;.;.;.;.;SMCA4_HUMAN	V|W	12|1243;1243;1307;1243;1243;1243;1243;1243	ENSP00000443848:A12V|ENSP00000395654:R1243W;ENSP00000350720:R1243W;ENSP00000343896:R1243W;ENSP00000445036:R1243W;ENSP00000392837:R1243W;ENSP00000397783:R1243W;ENSP00000414727:R1243W	.|ENSP00000343896:R1243W	A|R	+|+	2|1	0|2	SMARCA4|SMARCA4	11005146|11005146	0.951000|0.951000	0.32395|0.32395	0.989000|0.989000	0.46669|0.46669	0.990000|0.990000	0.78478|0.78478	0.134000|0.134000	0.15932|0.15932	-0.414000|-0.414000	0.07495|0.07495	0.558000|0.558000	0.71614|0.71614	GCG|CGG	SMARCA4	-	pfscan_Helicase_C	ENSG00000127616		0.637	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	55	0	C	NM_003072		11144146	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	31.91	32	15	SNP	0.997	T
SMCO2	341346	genome.wustl.edu	37	12	27627742	27627742	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:27627742G>T	ENST00000535986.1	+	3	258	c.258G>T	c.(256-258)gaG>gaT	p.E86D	SMCO2_ENST00000416383.1_Missense_Mutation_p.E86D|SMCO2_ENST00000298876.4_Missense_Mutation_p.E86D			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	86						integral component of membrane (GO:0016021)											TAGAGGCTGAGCATGACCAGG	0.458																																																	0													116.0	103.0	107.0					12																	27627742		692	1591	2283	SO:0001583	missense	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.258G>T	12.37:g.27627742G>T	ENSP00000441688:p.Glu86Asp			Missense_Mutation	SNP	NULL	p.E86D	ENST00000535986.1	37	c.258	CCDS44852.1	12	.	.	.	.	.	.	.	.	.	.	G	7.888	0.731635	0.15507	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	3.57	1.75	0.24633	.	0.508313	0.16634	N	0.205935	T	0.29945	0.0749	L	0.29908	0.895	0.09310	N	1	B	0.32245	0.361	B	0.37304	0.246	T	0.17745	-1.0359	9	0.44086	T	0.13	-3.8343	5.7772	0.18285	0.2411:0.0:0.7589:0.0	.	86	A6NFE2	CL070_HUMAN	D	86	.	ENSP00000298876:E86D	E	+	3	2	C12orf70	27519009	0.064000	0.20934	0.034000	0.17996	0.001000	0.01503	1.125000	0.31332	0.522000	0.28464	-0.136000	0.14681	GAG	SMCO2	-	NULL	ENSG00000165935		0.458	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO2	HGNC	protein_coding	OTTHUMT00000402867.1	-	0.00	53	0	G	NM_001145010		27627742	+1	tier1	-	no_errors	ENST00000416383	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.037	T
SMCO2	341346	genome.wustl.edu	37	12	27627742	27627742	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:27627742G>T	ENST00000535986.1	+	3	258	c.258G>T	c.(256-258)gaG>gaT	p.E86D	SMCO2_ENST00000416383.1_Missense_Mutation_p.E86D|SMCO2_ENST00000298876.4_Missense_Mutation_p.E86D			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	86						integral component of membrane (GO:0016021)											TAGAGGCTGAGCATGACCAGG	0.458																																																	0													116.0	103.0	107.0					12																	27627742		692	1591	2283	SO:0001583	missense	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.258G>T	12.37:g.27627742G>T	ENSP00000441688:p.Glu86Asp			Missense_Mutation	SNP	NULL	p.E86D	ENST00000535986.1	37	c.258	CCDS44852.1	12	.	.	.	.	.	.	.	.	.	.	G	7.888	0.731635	0.15507	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	3.57	1.75	0.24633	.	0.508313	0.16634	N	0.205935	T	0.29945	0.0749	L	0.29908	0.895	0.09310	N	1	B	0.32245	0.361	B	0.37304	0.246	T	0.17745	-1.0359	9	0.44086	T	0.13	-3.8343	5.7772	0.18285	0.2411:0.0:0.7589:0.0	.	86	A6NFE2	CL070_HUMAN	D	86	.	ENSP00000298876:E86D	E	+	3	2	C12orf70	27519009	0.064000	0.20934	0.034000	0.17996	0.001000	0.01503	1.125000	0.31332	0.522000	0.28464	-0.136000	0.14681	GAG	SMCO2	-	NULL	ENSG00000165935		0.458	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO2	HGNC	protein_coding	OTTHUMT00000402867.1	-	0.00	62	0	G	NM_001145010		27627742	+1	tier1	-	no_errors	ENST00000416383	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.037	T
SMLR1	100507203	genome.wustl.edu	37	6	131148611	131148611	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:131148611G>T	ENST00000541421.2	+	1	66	c.58G>T	c.(58-60)Gcc>Tcc	p.A20S		NM_001195597.1	NP_001182526.1	H3BR10	SMLR1_HUMAN	small leucine-rich protein 1	20						integral component of membrane (GO:0016021)											GAGGAAAGCTGCCCTGGTCCT	0.517																																																	0																																										SO:0001583	missense	0			AK091900	CCDS59036.1	6q23.1	2012-12-12			ENSG00000256162	ENSG00000256162			44670	protein-coding gene	gene with protein product							Standard	NM_001195597		Approved		uc011ebx.2	H3BR10	OTTHUMG00000176259	ENST00000541421.2:c.58G>T	6.37:g.131148611G>T	ENSP00000456026:p.Ala20Ser			Missense_Mutation	SNP	NULL	p.A20S	ENST00000541421.2	37	c.58	CCDS59036.1	6																																																																																			SMLR1	-	NULL	ENSG00000256162		0.517	SMLR1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	SMLR1	HGNC	protein_coding	OTTHUMT00000431691.1	-	0.00	110	0	G	NM_001195597		131148611	+1	tier1	-	no_errors	ENST00000541421	ensembl	human	putative	74_37	missense	5.10	93	5	SNP	0.001	T
SMLR1	100507203	genome.wustl.edu	37	6	131148611	131148611	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:131148611G>T	ENST00000541421.2	+	1	66	c.58G>T	c.(58-60)Gcc>Tcc	p.A20S		NM_001195597.1	NP_001182526.1	H3BR10	SMLR1_HUMAN	small leucine-rich protein 1	20						integral component of membrane (GO:0016021)											GAGGAAAGCTGCCCTGGTCCT	0.517																																																	0																																										SO:0001583	missense	0			AK091900	CCDS59036.1	6q23.1	2012-12-12			ENSG00000256162	ENSG00000256162			44670	protein-coding gene	gene with protein product							Standard	NM_001195597		Approved		uc011ebx.2	H3BR10	OTTHUMG00000176259	ENST00000541421.2:c.58G>T	6.37:g.131148611G>T	ENSP00000456026:p.Ala20Ser			Missense_Mutation	SNP	NULL	p.A20S	ENST00000541421.2	37	c.58	CCDS59036.1	6																																																																																			SMLR1	-	NULL	ENSG00000256162		0.517	SMLR1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	SMLR1	HGNC	protein_coding	OTTHUMT00000431691.1	-	0.00	64	0	G	NM_001195597		131148611	+1	tier1	-	no_errors	ENST00000541421	ensembl	human	putative	74_37	missense	5.10	93	5	SNP	0.001	T
SMO	6608	genome.wustl.edu	37	7	128850838	128850838	+	Missense_Mutation	SNP	G	G	T	rs121918348		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr7:128850838G>T	ENST00000249373.3	+	10	1965	c.1685G>T	c.(1684-1686)cGg>cTg	p.R562L	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	562	Interaction with BBS5 and BBS7.		R -> Q (in basal cell carcinoma samples; somatic mutation). {ECO:0000269|PubMed:9422511}.		adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R562Q(1)		biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	GAGCCAAAGCGGATCAAGAAG	0.557			Mis		skin basal cell						OREG0018305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	1	Substitution - Missense(1)	skin(1)											133.0	105.0	115.0					7																	128850838		2203	4300	6503	SO:0001583	missense	0			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1685G>T	7.37:g.128850838G>T	ENSP00000249373:p.Arg562Leu	1568	A4D1K5	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,pfam_GPCR_2_secretin-like,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R562L	ENST00000249373.3	37	c.1685	CCDS5811.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.930021	0.97116	.	.	ENSG00000128602	ENST00000249373	T	0.80033	-1.33	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88851	0.6549	M	0.63843	1.955	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.76071	0.987;0.987	D	0.88969	0.3399	10	0.72032	D	0.01	.	19.0419	0.93004	0.0:0.0:1.0:0.0	.	562;562	A4D1K5;Q99835	.;SMO_HUMAN	L	562	ENSP00000249373:R562L	ENSP00000249373:R562L	R	+	2	0	SMO	128638074	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.605000	0.82844	2.758000	0.94735	0.561000	0.74099	CGG	SMO	-	NULL	ENSG00000128602		0.557	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	HGNC	protein_coding	OTTHUMT00000350986.1		0.00	12	0	G	NM_005631		128850838	+1			no_errors	ENST00000249373	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
SNAPC3	6619	genome.wustl.edu	37	9	15451373	15451373	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:15451373G>T	ENST00000380821.3	+	6	964	c.788G>T	c.(787-789)aGa>aTa	p.R263I	SNAPC3_ENST00000380799.1_Missense_Mutation_p.R60I	NM_001039697.1	NP_001034786.1	Q92966	SNPC3_HUMAN	small nuclear RNA activating complex, polypeptide 3, 50kDa	263					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(6)|lung(2)	12				GBM - Glioblastoma multiforme(50;2.15e-06)		AATGATAAAAGATACCCAGAA	0.308																																																	0													54.0	56.0	55.0					9																	15451373		2202	4296	6498	SO:0001583	missense	0			U71300	CCDS6478.1	9p22.3	2008-07-21	2002-08-29		ENSG00000164975	ENSG00000164975			11136	protein-coding gene	gene with protein product		602348	"""small nuclear RNA activating complex, polypeptide 3, 50kD"""			9003788	Standard	XR_428427		Approved	SNAP50, PTFbeta, MGC33124, MGC132011	uc003zlt.3	Q92966	OTTHUMG00000019583	ENST00000380821.3:c.788G>T	9.37:g.15451373G>T	ENSP00000370200:p.Arg263Ile		D3DRI8|Q2VPI6|Q5T285	Missense_Mutation	SNP	pfam_snRNA-activating_su3	p.R263I	ENST00000380821.3	37	c.788	CCDS6478.1	9	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629716	0.87660	.	.	ENSG00000164975	ENST00000380821;ENST00000380807;ENST00000421710;ENST00000380799	T;T;T	0.57907	0.37;0.37;0.37	5.27	4.34	0.51931	.	0.049180	0.85682	D	0.000000	T	0.76572	0.4006	M	0.90198	3.095	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.82250	-0.0550	10	0.87932	D	0	-16.4162	14.946	0.71032	0.0:0.0:0.8566:0.1434	.	263	Q92966	SNPC3_HUMAN	I	263;213;213;60	ENSP00000370200:R263I;ENSP00000391832:R213I;ENSP00000370177:R60I	ENSP00000370177:R60I	R	+	2	0	SNAPC3	15441373	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.323000	0.79105	2.476000	0.83614	0.462000	0.41574	AGA	SNAPC3	-	pfam_snRNA-activating_su3	ENSG00000164975		0.308	SNAPC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC3	HGNC	protein_coding	OTTHUMT00000051763.2		0.00	21	0	G	NM_001039697		15451373	+1			no_errors	ENST00000380821	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
RPL30	6156	genome.wustl.edu	37	8	99054503	99054504	+	Intron	INS	-	-	T	rs534352583|rs367741409	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr8:99054503_99054504insT	ENST00000521291.1	-	3	445				RPL30_ENST00000287038.3_Intron|RPL30_ENST00000396070.2_Intron|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron|RPL30_ENST00000518164.1_Intron|SNORA72_ENST00000384339.1_RNA			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			TTTTTTGGCACTTTTTTTTTTC	0.312																																																	0																																										SO:0001627	intron_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+368->A	8.37:g.99054513_99054513dupT			B2R591|P04645|Q502Z6	RNA	INS	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.312	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1		0.00	18	0	-			99054504	+1	tier1		no_errors	ENST00000501016	ensembl	human	known	74_37	rna	9.09	30	3	INS	0.000:0.001	T
SORCS1	114815	genome.wustl.edu	37	10	108923969	108923969	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:108923969C>T	ENST00000263054.6	-	1	323	c.316G>A	c.(316-318)Ggc>Agc	p.G106S	SORCS1_ENST00000344440.6_Missense_Mutation_p.G106S	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	106					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTCCTCCGGCCGGAGCGTGCA	0.701																																																	0													18.0	19.0	19.0					10																	108923969		2199	4298	6497	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.316G>A	10.37:g.108923969C>T	ENSP00000263054:p.Gly106Ser		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.G106S	ENST00000263054.6	37	c.316	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418159	0.25552	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.14144	2.53;2.55	4.45	-1.01	0.10169	.	0.678333	0.12335	N	0.477986	T	0.06005	0.0156	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.0;0.001	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.001	T	0.41161	-0.9524	9	.	.	.	-6.513	4.3046	0.10940	0.167:0.3215:0.0:0.5115	.	106;106;106;106;106	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	S	106	ENSP00000263054:G106S;ENSP00000345964:G106S	.	G	-	1	0	SORCS1	108913959	0.010000	0.17322	0.539000	0.28077	0.405000	0.30901	0.379000	0.20585	-0.073000	0.12842	-0.948000	0.02665	GGC	SORCS1	-	NULL	ENSG00000108018		0.701	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	-	0.00	9	0	C	NM_052918		108923969	-1	tier1	-	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.002	T
NPR2	4882	genome.wustl.edu	37	9	35809795	35809795	+	IGR	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:35809795C>G	ENST00000342694.2	+	0	3686				SPAG8_ENST00000340291.2_Intron|SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000484764.1_3'UTR|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CACAGAATCACTAAATTAGCA	0.403																																																	0																																										SO:0001628	intergenic_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35809795C>G			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	RNA	SNP	-	NULL	ENST00000342694.2	37	NULL	CCDS6590.1	9																																																																																			SPAG8	-	-	ENSG00000137098		0.403	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	23	0	C			35809795	-1	tier1	-	no_errors	ENST00000489063	ensembl	human	known	74_37	rna	30.00	21	9	SNP	0.120	G
NPR2	4882	genome.wustl.edu	37	9	35809795	35809795	+	IGR	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:35809795C>G	ENST00000342694.2	+	0	3686				SPAG8_ENST00000340291.2_Intron|SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000484764.1_3'UTR|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CACAGAATCACTAAATTAGCA	0.403																																																	0																																										SO:0001628	intergenic_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35809795C>G			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	RNA	SNP	-	NULL	ENST00000342694.2	37	NULL	CCDS6590.1	9																																																																																			SPAG8	-	-	ENSG00000137098		0.403	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	8	0	C			35809795	-1	tier1	-	no_errors	ENST00000489063	ensembl	human	known	74_37	rna	30.00	21	9	SNP	0.120	G
SPANXN1	494118	genome.wustl.edu	37	X	144337320	144337320	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:144337320A>T	ENST00000370493.3	+	2	964	c.205A>T	c.(205-207)Aat>Tat	p.N69Y		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	69										endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					TCAACTGGAGAATGACCAGTC	0.433																																																	0													187.0	162.0	170.0					X																	144337320		2203	4298	6501	SO:0001583	missense	0				CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.205A>T	X.37:g.144337320A>T	ENSP00000359524:p.Asn69Tyr			Missense_Mutation	SNP	pfam_SPANX_prot	p.N69Y	ENST00000370493.3	37	c.205	CCDS35421.1	X	.	.	.	.	.	.	.	.	.	.	-	10.69	1.421288	0.25639	.	.	ENSG00000203923	ENST00000370493	T	0.10668	2.85	1.19	1.19	0.21007	.	.	.	.	.	T	0.22898	0.0553	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.69479	0.964	T	0.07328	-1.0778	8	0.87932	D	0	.	4.2466	0.10674	1.0:0.0:0.0:0.0	.	69	Q5VSR9	SPXN1_HUMAN	Y	69	ENSP00000359524:N69Y	ENSP00000359524:N69Y	N	+	1	0	SPANXN1	144145012	0.002000	0.14202	0.001000	0.08648	0.015000	0.08874	-0.214000	0.09292	0.733000	0.32492	0.127000	0.15803	AAT	SPANXN1	-	pfam_SPANX_prot	ENSG00000203923		0.433	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN1	HGNC	protein_coding	OTTHUMT00000058631.2	-	0.00	112	0	A	NM_001009614		144337320	+1	tier1	-	no_errors	ENST00000370493	ensembl	human	known	74_37	missense	27.71	60	23	SNP	0.001	T
SPANXN1	494118	genome.wustl.edu	37	X	144337320	144337320	+	Missense_Mutation	SNP	A	A	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:144337320A>T	ENST00000370493.3	+	2	964	c.205A>T	c.(205-207)Aat>Tat	p.N69Y		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	69										endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					TCAACTGGAGAATGACCAGTC	0.433																																																	0													187.0	162.0	170.0					X																	144337320		2203	4298	6501	SO:0001583	missense	0				CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.205A>T	X.37:g.144337320A>T	ENSP00000359524:p.Asn69Tyr			Missense_Mutation	SNP	pfam_SPANX_prot	p.N69Y	ENST00000370493.3	37	c.205	CCDS35421.1	X	.	.	.	.	.	.	.	.	.	.	-	10.69	1.421288	0.25639	.	.	ENSG00000203923	ENST00000370493	T	0.10668	2.85	1.19	1.19	0.21007	.	.	.	.	.	T	0.22898	0.0553	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.69479	0.964	T	0.07328	-1.0778	8	0.87932	D	0	.	4.2466	0.10674	1.0:0.0:0.0:0.0	.	69	Q5VSR9	SPXN1_HUMAN	Y	69	ENSP00000359524:N69Y	ENSP00000359524:N69Y	N	+	1	0	SPANXN1	144145012	0.002000	0.14202	0.001000	0.08648	0.015000	0.08874	-0.214000	0.09292	0.733000	0.32492	0.127000	0.15803	AAT	SPANXN1	-	pfam_SPANX_prot	ENSG00000203923		0.433	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN1	HGNC	protein_coding	OTTHUMT00000058631.2	-	0.00	72	0	A	NM_001009614		144337320	+1	tier1	-	no_errors	ENST00000370493	ensembl	human	known	74_37	missense	27.71	60	23	SNP	0.001	T
SPATA21	374955	genome.wustl.edu	37	1	16752165	16752165	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:16752165G>T	ENST00000335496.1	-	4	517				SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000375577.1_Missense_Mutation_p.Q115K|SPATA21_ENST00000540400.1_5'UTR	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		AGCTCACTCTGATCCTGGCCT	0.592																																																	0																																										SO:0001627	intron_variant	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.35-3699C>A	1.37:g.16752165G>T			B9EK40|F5GXP5	Missense_Mutation	SNP	NULL	p.Q115K	ENST00000335496.1	37	c.343	CCDS172.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997078	0.74818	.	.	ENSG00000187144	ENST00000375577	.	.	.	3.77	2.82	0.32997	.	.	.	.	.	T	0.42359	0.1199	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	T	0.30297	-0.9983	5	0.49607	T	0.09	.	9.1788	0.37129	0.0:0.2223:0.7777:0.0	.	.	.	.	K	115	.	ENSP00000364727:Q115K	Q	-	1	0	SPATA21	16624752	0.000000	0.05858	0.003000	0.11579	0.895000	0.52256	0.538000	0.23160	1.132000	0.42129	0.462000	0.41574	CAG	SPATA21	-	NULL	ENSG00000187144		0.592	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	-	0.00	46	0	G	NM_198546		16752165	-1	tier1	-	no_errors	ENST00000375577	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.003	T
SPATA21	374955	genome.wustl.edu	37	1	16752165	16752165	+	Intron	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:16752165G>T	ENST00000335496.1	-	4	517				SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000375577.1_Missense_Mutation_p.Q115K|SPATA21_ENST00000540400.1_5'UTR	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		AGCTCACTCTGATCCTGGCCT	0.592																																																	0																																										SO:0001627	intron_variant	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.35-3699C>A	1.37:g.16752165G>T			B9EK40|F5GXP5	Missense_Mutation	SNP	NULL	p.Q115K	ENST00000335496.1	37	c.343	CCDS172.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997078	0.74818	.	.	ENSG00000187144	ENST00000375577	.	.	.	3.77	2.82	0.32997	.	.	.	.	.	T	0.42359	0.1199	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	T	0.30297	-0.9983	5	0.49607	T	0.09	.	9.1788	0.37129	0.0:0.2223:0.7777:0.0	.	.	.	.	K	115	.	ENSP00000364727:Q115K	Q	-	1	0	SPATA21	16624752	0.000000	0.05858	0.003000	0.11579	0.895000	0.52256	0.538000	0.23160	1.132000	0.42129	0.462000	0.41574	CAG	SPATA21	-	NULL	ENSG00000187144		0.592	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	-	0.00	82	0	G	NM_198546		16752165	-1	tier1	-	no_errors	ENST00000375577	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.003	T
SPINK5	11005	genome.wustl.edu	37	5	147481362	147481362	+	Missense_Mutation	SNP	C	C	T	rs550961797		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:147481362C>T	ENST00000256084.7	+	15	1363	c.1321C>T	c.(1321-1323)Cgc>Tgc	p.R441C	SPINK5_ENST00000398454.1_Missense_Mutation_p.R441C|SPINK5_ENST00000359874.3_Missense_Mutation_p.R441C	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	441	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.		R -> H (in dbSNP:rs34393923).		anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGTGAATACCGCAAATCCAG	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		18421	0.0		0.0	False		,,,				2504	0.001																0													97.0	92.0	94.0					5																	147481362		1880	4110	5990	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1321C>T	5.37:g.147481362C>T	ENSP00000256084:p.Arg441Cys		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal_dom,smart_Kazal_dom	p.R441C	ENST00000256084.7	37	c.1321	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441842	0.43326	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	3.99	3.12	0.35913	Proteinase inhibitor I1, Kazal (1);	0.509013	0.18397	N	0.142461	T	0.26593	0.0650	M	0.82323	2.585	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.995;0.997;0.972;0.997	T	0.02743	-1.1116	10	0.48119	T	0.1	-3.3977	7.3873	0.26891	0.0:0.884:0.0:0.116	.	422;441;441;441	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	C	441;441;422;441	ENSP00000381472:R441C;ENSP00000352936:R441C;ENSP00000421519:R422C;ENSP00000256084:R441C	ENSP00000256084:R441C	R	+	1	0	SPINK5	147461555	0.294000	0.24380	0.013000	0.15412	0.002000	0.02628	0.871000	0.28023	1.248000	0.43934	0.650000	0.86243	CGC	SPINK5	-	smart_Kazal_dom	ENSG00000133710		0.438	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	-	0.00	28	0	C	NM_001127698		147481362	+1	tier1	-	no_errors	ENST00000359874	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.023	T
STX5	6811	genome.wustl.edu	37	11	62595064	62595064	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:62595064G>T	ENST00000294179.3	-	3	418	c.265C>A	c.(265-267)Cga>Aga	p.R89R	STX5_ENST00000541317.1_5'UTR|STX5_ENST00000394690.1_Silent_p.R35R|STX5_ENST00000377897.4_Silent_p.R89R	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	89					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)	p.R89*(1)		breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						CTGCGTTGTCGGACAGCACGC	0.483																																																	1	Substitution - Nonsense(1)	ovary(1)											133.0	120.0	124.0					11																	62595064		2201	4299	6500	SO:0001819	synonymous_variant	0			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.265C>A	11.37:g.62595064G>T			B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.R89	ENST00000294179.3	37	c.265	CCDS8038.2	11																																																																																			STX5	-	superfamily_t-SNARE	ENSG00000162236		0.483	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX5	HGNC	protein_coding	OTTHUMT00000290113.1		0.00	25	0	G	NM_003164		62595064	-1			no_errors	ENST00000294179	ensembl	human	known	74_37	silent	7.41	25	2	SNP	1.000	T
ST3GAL4	6484	genome.wustl.edu	37	11	126283472	126283472	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:126283472G>T	ENST00000526727.1	+	9	1218	c.844G>T	c.(844-846)Ggc>Tgc	p.G282C	ST3GAL4_ENST00000356132.4_Missense_Mutation_p.G288C|ST3GAL4_ENST00000449406.2_Missense_Mutation_p.G271C|ST3GAL4_ENST00000534457.1_Missense_Mutation_p.G277C|ST3GAL4_ENST00000444328.2_Missense_Mutation_p.G282C|ST3GAL4_ENST00000392669.2_Missense_Mutation_p.G282C|ST3GAL4_ENST00000227495.6_Missense_Mutation_p.G278C|ST3GAL4_ENST00000532243.1_Missense_Mutation_p.G281C|ST3GAL4_ENST00000534083.1_Missense_Mutation_p.G282C|ST3GAL4_ENST00000530591.1_Missense_Mutation_p.G278C			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	282					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		TGCCGGCTTTGGCTACCCAGA	0.582																																																	0													111.0	96.0	101.0					11																	126283472		2201	4297	6498	SO:0001583	missense	0			X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.844G>T	11.37:g.126283472G>T	ENSP00000436047:p.Gly282Cys		A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.G288C	ENST00000526727.1	37	c.862	CCDS58193.1	11	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571528	0.86542	.	.	ENSG00000110080	ENST00000227495;ENST00000444328;ENST00000356132;ENST00000530591;ENST00000534083;ENST00000392669;ENST00000526727;ENST00000449406;ENST00000532243;ENST00000534457;ENST00000524860	T;T;T;T;T;T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34;1.34	5.36	5.36	0.76844	.	.	.	.	.	T	0.69895	0.3162	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77598	-0.2528	9	0.87932	D	0	.	19.0893	0.93219	0.0:0.0:1.0:0.0	.	278;282	Q6IBE6;Q11206	.;SIA4C_HUMAN	C	278;282;288;278;282;282;282;271;281;277;118	ENSP00000227495:G278C;ENSP00000394354:G282C;ENSP00000348451:G288C;ENSP00000433989:G278C;ENSP00000433318:G282C;ENSP00000376437:G282C;ENSP00000436047:G282C;ENSP00000399444:G271C;ENSP00000434349:G281C;ENSP00000434668:G277C;ENSP00000431170:G118C	ENSP00000227495:G278C	G	+	1	0	ST3GAL4	125788682	1.000000	0.71417	0.982000	0.44146	0.785000	0.44390	9.109000	0.94291	2.523000	0.85059	0.455000	0.32223	GGC	ST3GAL4	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000110080		0.582	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ST3GAL4	HGNC	protein_coding	OTTHUMT00000386470.1	-	0.00	51	0	G	NM_006278		126283472	+1	tier1	-	no_errors	ENST00000356132	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
SULT2B1	6820	genome.wustl.edu	37	19	49102487	49102487	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:49102487C>T	ENST00000201586.2	+	7	1100	c.922C>T	c.(922-924)Ccc>Tcc	p.P308S	SULT2B1_ENST00000323090.4_Missense_Mutation_p.P293S|SULT2B1_ENST00000594274.1_3'UTR	NM_177973.1	NP_814444.1	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	308	Pro/Ser-rich.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	alcohol sulfotransferase activity (GO:0004027)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	11		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		GCCGACCTTCCCCTGGGATGA	0.662																																																	0													43.0	34.0	37.0					19																	49102487		2199	4300	6499	SO:0001583	missense	0			U92314	CCDS12723.1, CCDS12724.1	19q13.3	2008-02-05				ENSG00000088002		"""Sulfotransferases, cytosolic"""	11459	protein-coding gene	gene with protein product		604125				9799594	Standard	NM_177973		Approved	HSST2	uc002pjl.3	O00204		ENST00000201586.2:c.922C>T	19.37:g.49102487C>T	ENSP00000201586:p.Pro308Ser		O00205|O75814	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.P308S	ENST00000201586.2	37	c.922	CCDS12723.1	19	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997182	0.35226	.	.	ENSG00000088002	ENST00000201586;ENST00000323090	T;T	0.01335	5.0;5.0	5.29	3.13	0.36017	.	0.179935	0.26268	N	0.025348	T	0.01320	0.0043	L	0.29908	0.895	0.23282	N	0.997989	B;B	0.25609	0.13;0.08	B;B	0.15052	0.012;0.005	T	0.47522	-0.9111	10	0.54805	T	0.06	.	7.6268	0.28216	0.0:0.7451:0.1653:0.0896	.	293;308	O00204-2;O00204	.;ST2B1_HUMAN	S	308;293	ENSP00000201586:P308S;ENSP00000312880:P293S	ENSP00000201586:P308S	P	+	1	0	SULT2B1	53794299	1.000000	0.71417	0.488000	0.27440	0.018000	0.09664	1.173000	0.31920	0.719000	0.32188	0.644000	0.83932	CCC	SULT2B1	-	NULL	ENSG00000088002		0.662	SULT2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULT2B1	HGNC	protein_coding	OTTHUMT00000466140.1		0.00	101	0	C	NM_004605		49102487	+1			no_errors	ENST00000201586	ensembl	human	known	74_37	missense	5.61	101	6	SNP	0.546	T
SURF6	6838	genome.wustl.edu	37	9	136198862	136198862	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:136198862C>A	ENST00000372022.4	-	5	1194	c.929G>T	c.(928-930)cGc>cTc	p.R310L	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	310					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		GCCGGCCGTGCGCTTCTCCCA	0.721																																																	0													21.0	21.0	21.0					9																	136198862		2202	4298	6500	SO:0001583	missense	0			AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.929G>T	9.37:g.136198862C>A	ENSP00000361092:p.Arg310Leu		Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	pfam_Surf6	p.R310L	ENST00000372022.4	37	c.929	CCDS6962.1	9	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631765	0.67015	.	.	ENSG00000148296	ENST00000372022	T	0.39406	1.08	5.15	4.24	0.50183	.	0.056727	0.64402	D	0.000003	T	0.66436	0.2789	M	0.86178	2.8	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.71692	-0.4516	10	0.62326	D	0.03	-3.3045	13.1496	0.59482	0.0:0.9206:0.0:0.0794	.	310	O75683	SURF6_HUMAN	L	310	ENSP00000361092:R310L	ENSP00000361092:R310L	R	-	2	0	SURF6	135188683	1.000000	0.71417	0.999000	0.59377	0.669000	0.39330	4.232000	0.58645	2.387000	0.81309	0.467000	0.42956	CGC	SURF6	-	pfam_Surf6	ENSG00000148296		0.721	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	HGNC	protein_coding	OTTHUMT00000054905.1		0.00	10	0	C	NM_006753		136198862	-1			no_errors	ENST00000372022	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.985	A
SURF2	6835	genome.wustl.edu	37	9	136226967	136226967	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:136226967G>T	ENST00000371964.4	+	4	520	c.479G>T	c.(478-480)gGa>gTa	p.G160V	SURF2_ENST00000495524.1_3'UTR	NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	160				G -> A (in Ref. 1; CAA84477). {ECO:0000305}.		nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		GATGAGGGGGGAGCTGCAAGT	0.632																																																	0													65.0	65.0	65.0					9																	136226967		2203	4300	6503	SO:0001583	missense	0				CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.479G>T	9.37:g.136226967G>T	ENSP00000361032:p.Gly160Val		Q6IBP9|Q96CD1	Missense_Mutation	SNP	pfam_Surf2	p.G160V	ENST00000371964.4	37	c.479	CCDS6967.1	9	.	.	.	.	.	.	.	.	.	.	G	11.86	1.766094	0.31228	.	.	ENSG00000148291	ENST00000371964	T	0.32515	1.45	4.56	1.51	0.23008	.	0.878022	0.09715	N	0.765255	T	0.32941	0.0846	L	0.54323	1.7	0.22096	N	0.999364	P	0.46327	0.876	P	0.44597	0.454	T	0.18713	-1.0328	10	0.72032	D	0.01	-7.0005	9.2281	0.37418	0.0914:0.378:0.5305:0.0	.	160	Q15527	SURF2_HUMAN	V	160	ENSP00000361032:G160V	ENSP00000361032:G160V	G	+	2	0	SURF2	135216788	0.002000	0.14202	0.001000	0.08648	0.269000	0.26545	0.316000	0.19469	0.189000	0.20188	0.462000	0.41574	GGA	SURF2	-	pfam_Surf2	ENSG00000148291		0.632	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF2	HGNC	protein_coding	OTTHUMT00000054883.1		0.00	34	0	G	NM_017503		136226967	+1			no_errors	ENST00000371964	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.007	T
SWT1	54823	genome.wustl.edu	37	1	185130022	185130022	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:185130022G>T	ENST00000367500.4	+	2	214	c.49G>T	c.(49-51)Gac>Tac	p.D17Y	SWT1_ENST00000367501.3_Missense_Mutation_p.D17Y	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	17										breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						TCAGAGGAAAGACACCACCAC	0.318																																																	0													81.0	85.0	83.0					1																	185130022		2203	4300	6503	SO:0001583	missense	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.49G>T	1.37:g.185130022G>T	ENSP00000356470:p.Asp17Tyr		Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	smart_PIN_dom	p.D17Y	ENST00000367500.4	37	c.49	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	G	4.614	0.114083	0.08831	.	.	ENSG00000116668	ENST00000367501;ENST00000367500;ENST00000450350	T;T;T	0.42900	0.96;0.96;0.96	5.37	-1.3	0.09259	.	1.043410	0.07578	N	0.919754	T	0.20047	0.0482	N	0.22421	0.69	0.09310	N	1	P	0.42785	0.79	B	0.31751	0.135	T	0.15009	-1.0452	10	0.66056	D	0.02	.	1.0649	0.01608	0.3737:0.1543:0.3239:0.148	.	17	Q5T5J6	SWT1_HUMAN	Y	17	ENSP00000356471:D17Y;ENSP00000356470:D17Y;ENSP00000401413:D17Y	ENSP00000356470:D17Y	D	+	1	0	SWT1	183396645	0.036000	0.19791	0.000000	0.03702	0.007000	0.05969	0.075000	0.14686	-0.410000	0.07542	0.650000	0.86243	GAC	SWT1	-	NULL	ENSG00000116668		0.318	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1		0.00	28	0	G	NM_017673		185130022	+1			no_errors	ENST00000367500	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
TAB2	23118	genome.wustl.edu	37	6	149699391	149699391	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:149699391G>T	ENST00000367456.1	+	4	917	c.340G>T	c.(340-342)Ggt>Tgt	p.G114C	TAB2_ENST00000392282.1_Missense_Mutation_p.G114C|TAB2_ENST00000286332.5_Missense_Mutation_p.G114C|TAB2_ENST00000536230.1_Missense_Mutation_p.G82C|TAB2_ENST00000538427.1_Missense_Mutation_p.G114C			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	114					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						ACAACTTCAAGGTGGCCAGTC	0.458																																																	0													96.0	83.0	87.0					6																	149699391		2203	4300	6503	SO:0001583	missense	0			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.340G>T	6.37:g.149699391G>T	ENSP00000356426:p.Gly114Cys		B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.G114C	ENST00000367456.1	37	c.340	CCDS5214.1	6	.	.	.	.	.	.	.	.	.	.	G	4.051	0.007175	0.07866	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.96	4.18	0.49190	.	0.669501	0.16577	N	0.208352	T	0.45034	0.1322	L	0.36672	1.1	0.36509	D	0.869466	P;P	0.40619	0.724;0.724	B;B	0.37091	0.241;0.241	T	0.52510	-0.8566	10	0.54805	T	0.06	-4.6568	9.9553	0.41663	0.2445:0.0:0.7555:0.0	.	82;114	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	C	82;114;114;114;114	ENSP00000443206:G82C;ENSP00000376106:G114C;ENSP00000445752:G114C;ENSP00000356426:G114C;ENSP00000286332:G114C	ENSP00000286332:G114C	G	+	1	0	TAB2	149741084	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	2.686000	0.46968	1.536000	0.49237	0.650000	0.86243	GGT	TAB2	-	NULL	ENSG00000055208		0.458	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3	-	0.00	37	0	G			149699391	+1	tier1	-	no_errors	ENST00000286332	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.998	T
TAB2	23118	genome.wustl.edu	37	6	149699391	149699391	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr6:149699391G>T	ENST00000367456.1	+	4	917	c.340G>T	c.(340-342)Ggt>Tgt	p.G114C	TAB2_ENST00000392282.1_Missense_Mutation_p.G114C|TAB2_ENST00000286332.5_Missense_Mutation_p.G114C|TAB2_ENST00000536230.1_Missense_Mutation_p.G82C|TAB2_ENST00000538427.1_Missense_Mutation_p.G114C			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	114					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						ACAACTTCAAGGTGGCCAGTC	0.458																																																	0													96.0	83.0	87.0					6																	149699391		2203	4300	6503	SO:0001583	missense	0			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.340G>T	6.37:g.149699391G>T	ENSP00000356426:p.Gly114Cys		B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.G114C	ENST00000367456.1	37	c.340	CCDS5214.1	6	.	.	.	.	.	.	.	.	.	.	G	4.051	0.007175	0.07866	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.96	4.18	0.49190	.	0.669501	0.16577	N	0.208352	T	0.45034	0.1322	L	0.36672	1.1	0.36509	D	0.869466	P;P	0.40619	0.724;0.724	B;B	0.37091	0.241;0.241	T	0.52510	-0.8566	10	0.54805	T	0.06	-4.6568	9.9553	0.41663	0.2445:0.0:0.7555:0.0	.	82;114	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	C	82;114;114;114;114	ENSP00000443206:G82C;ENSP00000376106:G114C;ENSP00000445752:G114C;ENSP00000356426:G114C;ENSP00000286332:G114C	ENSP00000286332:G114C	G	+	1	0	TAB2	149741084	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	2.686000	0.46968	1.536000	0.49237	0.650000	0.86243	GGT	TAB2	-	NULL	ENSG00000055208		0.458	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3	-	0.00	38	0	G			149699391	+1	tier1	-	no_errors	ENST00000286332	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.998	T
TAF1	6872	genome.wustl.edu	37	X	70617240	70617240	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:70617240C>T	ENST00000373790.4	+	23	3592	c.3541C>T	c.(3541-3543)Cgc>Tgc	p.R1181C	TAF1_ENST00000449580.1_Missense_Mutation_p.R1181C|TAF1_ENST00000276072.3_Missense_Mutation_p.R1202C|TAF1_ENST00000423759.1_Missense_Mutation_p.R1202C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1181					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AGAGTATGTTCGCTGTGAGAC	0.458																																																	0													188.0	136.0	154.0					X																	70617240		2203	4300	6503	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3541C>T	X.37:g.70617240C>T	ENSP00000362895:p.Arg1181Cys		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1181C	ENST00000373790.4	37	c.3541	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	20.8	4.050546	0.75960	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.91	4.0	0.46444	.	0.215659	0.46442	D	0.000286	T	0.78394	0.4276	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.85130	0.927;0.997;0.997	T	0.81575	-0.0870	10	0.87932	D	0	.	12.7154	0.57111	0.2745:0.7255:0.0:0.0	.	1181;1181;1202	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	C	1181;1181;1202;1202	ENSP00000362895:R1181C;ENSP00000389000:R1181C;ENSP00000406549:R1202C;ENSP00000276072:R1202C	ENSP00000276072:R1202C	R	+	1	0	TAF1	70533965	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.320000	0.43797	2.322000	0.78497	0.449000	0.29647	CGC	TAF1	-	pirsf_TAF1_animal	ENSG00000147133		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	-	0.00	50	0	C	NM_004606		70617240	+1	tier1	-	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	27.27	40	15	SNP	1.000	T
TAF1	6872	genome.wustl.edu	37	X	70617240	70617240	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:70617240C>T	ENST00000373790.4	+	23	3592	c.3541C>T	c.(3541-3543)Cgc>Tgc	p.R1181C	TAF1_ENST00000449580.1_Missense_Mutation_p.R1181C|TAF1_ENST00000276072.3_Missense_Mutation_p.R1202C|TAF1_ENST00000423759.1_Missense_Mutation_p.R1202C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1181					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AGAGTATGTTCGCTGTGAGAC	0.458																																																	0													188.0	136.0	154.0					X																	70617240		2203	4300	6503	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3541C>T	X.37:g.70617240C>T	ENSP00000362895:p.Arg1181Cys		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1181C	ENST00000373790.4	37	c.3541	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	20.8	4.050546	0.75960	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.91	4.0	0.46444	.	0.215659	0.46442	D	0.000286	T	0.78394	0.4276	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.85130	0.927;0.997;0.997	T	0.81575	-0.0870	10	0.87932	D	0	.	12.7154	0.57111	0.2745:0.7255:0.0:0.0	.	1181;1181;1202	P21675-4;P21675;P21675-2	.;TAF1_HUMAN;.	C	1181;1181;1202;1202	ENSP00000362895:R1181C;ENSP00000389000:R1181C;ENSP00000406549:R1202C;ENSP00000276072:R1202C	ENSP00000276072:R1202C	R	+	1	0	TAF1	70533965	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.320000	0.43797	2.322000	0.78497	0.449000	0.29647	CGC	TAF1	-	pirsf_TAF1_animal	ENSG00000147133		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	-	0.00	76	0	C	NM_004606		70617240	+1	tier1	-	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	27.27	40	15	SNP	1.000	T
TAF1B	9014	genome.wustl.edu	37	2	9989570	9989571	+	Frame_Shift_Ins	INS	-	-	A	rs528368939		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:9989570_9989571insA	ENST00000263663.5	+	3	374_375	c.186_187insA	c.(187-189)aaafs	p.K63fs	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	63	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)	p.K63fs*1(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACCGGGGGCTTAAAAAAAAAAA	0.337																																																	1	Insertion - Frameshift(1)	upper_aerodigestive_tract(1)																																								SO:0001589	frameshift_variant	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.197dupA	2.37:g.9989581_9989581dupA	ENSP00000263663:p.Lys63fs		B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Ins	INS	pfam_TF_Rrn7	p.N65fs	ENST00000263663.5	37	c.186_187	CCDS33143.1	2																																																																																			TAF1B	-	NULL	ENSG00000115750		0.337	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2		0.00	23	0	-	NM_005680		9989571	+1	tier1		no_errors	ENST00000263663	ensembl	human	known	74_37	frame_shift_ins	16.13	26	5	INS	0.992:0.991	A
TBC1D21	161514	genome.wustl.edu	37	15	74181427	74181427	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:74181427G>A	ENST00000300504.2	+	11	1079	c.996G>A	c.(994-996)aaG>aaA	p.K332K	TBC1D21_ENST00000535547.2_Silent_p.K296K|AC108137.1_ENST00000410132.1_RNA|TBC1D21_ENST00000562056.1_Silent_p.K295K	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	332						acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						AGACATTAAAGGATTTCTTCC	0.527																																																	0													80.0	65.0	70.0					15																	74181427		2198	4297	6495	SO:0001819	synonymous_variant	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.996G>A	15.37:g.74181427G>A			B9A6M2	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.K332	ENST00000300504.2	37	c.996	CCDS10252.1	15																																																																																			TBC1D21	-	NULL	ENSG00000167139		0.527	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	HGNC	protein_coding	OTTHUMT00000268994.1	-	0.00	33	0	G	NM_153356		74181427	+1	tier1	-	no_errors	ENST00000300504	ensembl	human	known	74_37	silent	32.26	21	10	SNP	0.860	A
TBC1D21	161514	genome.wustl.edu	37	15	74181427	74181427	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr15:74181427G>A	ENST00000300504.2	+	11	1079	c.996G>A	c.(994-996)aaG>aaA	p.K332K	TBC1D21_ENST00000535547.2_Silent_p.K296K|AC108137.1_ENST00000410132.1_RNA|TBC1D21_ENST00000562056.1_Silent_p.K295K	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	332						acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						AGACATTAAAGGATTTCTTCC	0.527																																																	0													80.0	65.0	70.0					15																	74181427		2198	4297	6495	SO:0001819	synonymous_variant	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.996G>A	15.37:g.74181427G>A			B9A6M2	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.K332	ENST00000300504.2	37	c.996	CCDS10252.1	15																																																																																			TBC1D21	-	NULL	ENSG00000167139		0.527	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	HGNC	protein_coding	OTTHUMT00000268994.1	-	0.00	47	0	G	NM_153356		74181427	+1	tier1	-	no_errors	ENST00000300504	ensembl	human	known	74_37	silent	32.26	21	10	SNP	0.860	A
TFAP2C	7022	genome.wustl.edu	37	20	55206907	55206907	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr20:55206907G>A	ENST00000201031.2	+	3	824	c.581G>A	c.(580-582)cGc>cAc	p.R194H	TFAP2C_ENST00000544508.1_Missense_Mutation_p.R25H	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	194					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			ACAGTCATTCGCAAAGGTAAA	0.542																																																	0													117.0	101.0	107.0					20																	55206907		2203	4300	6503	SO:0001583	missense	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.581G>A	20.37:g.55206907G>A	ENSP00000201031:p.Arg194His		B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.R194H	ENST00000201031.2	37	c.581	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016942	0.93404	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	T;D	0.97378	-1.07;-4.36	5.84	5.84	0.93424	.	0.094577	0.64402	D	0.000001	D	0.96833	0.8966	L	0.43152	1.355	0.43719	D	0.99619	D	0.71674	0.998	P	0.58520	0.84	D	0.96658	0.9487	10	0.72032	D	0.01	-13.5055	13.344	0.60561	0.0719:0.0:0.9281:0.0	.	194	Q92754	AP2C_HUMAN	H	194;25	ENSP00000201031:R194H;ENSP00000442274:R25H	ENSP00000201031:R194H	R	+	2	0	TFAP2C	54640314	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	5.157000	0.64911	2.768000	0.95171	0.561000	0.74099	CGC	TFAP2C	-	NULL	ENSG00000087510		0.542	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2		0.00	43	0	G	NM_003222		55206907	+1			no_errors	ENST00000201031	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
TFRC	7037	genome.wustl.edu	37	3	195791279	195791279	+	Missense_Mutation	SNP	C	C	A	rs184956956	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:195791279C>A	ENST00000360110.4	-	11	1388	c.1219G>T	c.(1219-1221)Gcc>Tcc	p.A407S	TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000392396.3_Missense_Mutation_p.A407S|TFRC_ENST00000535031.1_Missense_Mutation_p.A125S|TFRC_ENST00000420415.1_Missense_Mutation_p.A326S	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	407					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TCTCTCTGGGCCCCAACTACA	0.403			T	BCL6	NHL																																			Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0													57.0	57.0	57.0					3																	195791279		2203	4300	6503	SO:0001583	missense	0			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1219G>T	3.37:g.195791279C>A	ENSP00000353224:p.Ala407Ser		D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.A407S	ENST00000360110.4	37	c.1219	CCDS3312.1	3	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062409	0.76187	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.74106	0.6;0.6;0.6;-0.81	5.37	5.37	0.77165	Peptidase M28 (1);	0.046170	0.85682	D	0.000000	D	0.84279	0.5437	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82430	-0.0461	10	0.33940	T	0.23	-15.087	17.6652	0.88201	0.0:1.0:0.0:0.0	.	407	P02786	TFR1_HUMAN	S	407;326;407;125	ENSP00000353224:A407S;ENSP00000390133:A326S;ENSP00000376197:A407S;ENSP00000437753:A125S	ENSP00000353224:A407S	A	-	1	0	TFRC	197275676	1.000000	0.71417	1.000000	0.80357	0.323000	0.28346	6.760000	0.74939	2.506000	0.84524	0.561000	0.74099	GCC	TFRC	-	pfam_Peptidase_M28	ENSG00000072274		0.403	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	HGNC	protein_coding	OTTHUMT00000341346.1	-	0.00	43	0	C			195791279	-1	tier1	-	no_errors	ENST00000360110	ensembl	human	known	74_37	missense	11.11	56	7	SNP	1.000	A
TFRC	7037	genome.wustl.edu	37	3	195791279	195791279	+	Missense_Mutation	SNP	C	C	A	rs184956956	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr3:195791279C>A	ENST00000360110.4	-	11	1388	c.1219G>T	c.(1219-1221)Gcc>Tcc	p.A407S	TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000392396.3_Missense_Mutation_p.A407S|TFRC_ENST00000535031.1_Missense_Mutation_p.A125S|TFRC_ENST00000420415.1_Missense_Mutation_p.A326S	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	407					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TCTCTCTGGGCCCCAACTACA	0.403			T	BCL6	NHL																																			Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0													57.0	57.0	57.0					3																	195791279		2203	4300	6503	SO:0001583	missense	0			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1219G>T	3.37:g.195791279C>A	ENSP00000353224:p.Ala407Ser		D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.A407S	ENST00000360110.4	37	c.1219	CCDS3312.1	3	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062409	0.76187	.	.	ENSG00000072274	ENST00000360110;ENST00000420415;ENST00000392396;ENST00000535031	T;T;T;T	0.74106	0.6;0.6;0.6;-0.81	5.37	5.37	0.77165	Peptidase M28 (1);	0.046170	0.85682	D	0.000000	D	0.84279	0.5437	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82430	-0.0461	10	0.33940	T	0.23	-15.087	17.6652	0.88201	0.0:1.0:0.0:0.0	.	407	P02786	TFR1_HUMAN	S	407;326;407;125	ENSP00000353224:A407S;ENSP00000390133:A326S;ENSP00000376197:A407S;ENSP00000437753:A125S	ENSP00000353224:A407S	A	-	1	0	TFRC	197275676	1.000000	0.71417	1.000000	0.80357	0.323000	0.28346	6.760000	0.74939	2.506000	0.84524	0.561000	0.74099	GCC	TFRC	-	pfam_Peptidase_M28	ENSG00000072274		0.403	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	HGNC	protein_coding	OTTHUMT00000341346.1	-	0.00	51	0	C			195791279	-1	tier1	-	no_errors	ENST00000360110	ensembl	human	known	74_37	missense	11.11	56	7	SNP	1.000	A
TH	7054	genome.wustl.edu	37	11	2191949	2191949	+	Missense_Mutation	SNP	G	G	T	rs369200051		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:2191949G>T	ENST00000381178.1	-	2	172	c.154C>A	c.(154-156)Cca>Aca	p.P52T	TH_ENST00000381175.1_Missense_Mutation_p.P48T|TH_ENST00000352909.3_Intron|TH_ENST00000333684.5_Intron|MIR4686_ENST00000584128.1_RNA	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	52					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GATGCAGCTGGGGCTGCAGTT	0.672																																																	0													17.0	21.0	20.0					11																	2191949		2200	4295	6495	SO:0001583	missense	0			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.154C>A	11.37:g.2191949G>T	ENSP00000370571:p.Pro52Thr		B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_Tyrosine_hydroxylase_CS,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Tyr_3_mOase	p.P52T	ENST00000381178.1	37	c.154	CCDS7731.1	11	.	.	.	.	.	.	.	.	.	.	G	6.890	0.533607	0.13188	.	.	ENSG00000180176	ENST00000381178;ENST00000381175	D;D	0.99429	-5.89;-5.89	2.41	-1.06	0.10002	Tyrosine hydroxylase, conserved site (1);	605.235000	0.00966	U	0.003178	D	0.97766	0.9267	L	0.36672	1.1	0.09310	N	1	B;B	0.14805	0.011;0.009	B;B	0.15052	0.012;0.007	D	0.95515	0.8589	10	0.40728	T	0.16	.	5.8033	0.18426	0.4434:0.0:0.5566:0.0	.	52;48	P07101;P07101-2	TY3H_HUMAN;.	T	52;48	ENSP00000370571:P52T;ENSP00000370567:P48T	ENSP00000370567:P48T	P	-	1	0	TH	2148525	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.129000	0.15830	-0.412000	0.07519	-0.350000	0.07774	CCA	TH	-	pfam_Tyrosine_hydroxylase_CS,pirsf_Tyrosine_3-monooxygenase-like	ENSG00000180176		0.672	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TH	HGNC	protein_coding	OTTHUMT00000026597.1	-	0.00	20	0	G	NM_000360		2191949	-1	tier1	-	no_errors	ENST00000381178	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.000	T
THYN1	29087	genome.wustl.edu	37	11	134121080	134121080	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:134121080G>T	ENST00000341541.3	-	2	627	c.166C>A	c.(166-168)Cac>Aac	p.H56N	THYN1_ENST00000525677.1_5'Flank|ACAD8_ENST00000537423.1_5'Flank|ACAD8_ENST00000543332.1_5'Flank|THYN1_ENST00000392595.2_Missense_Mutation_p.H56N|THYN1_ENST00000392594.3_Missense_Mutation_p.H56N|THYN1_ENST00000352327.5_Missense_Mutation_p.H56N|ACAD8_ENST00000281182.4_5'Flank|ACAD8_ENST00000374752.4_5'Flank	NM_014174.2	NP_054893.1	Q9P016	THYN1_HUMAN	thymocyte nuclear protein 1	56						nucleus (GO:0005634)				endometrium(2)|kidney(1)|lung(3)|pancreas(1)	7	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;1.68e-10)|all cancers(11;1.95e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00148)|Lung(977;0.207)		ATCAGCCAGTGGCTGCTTAGA	0.478																																																	0													186.0	191.0	189.0					11																	134121080		2201	4297	6498	SO:0001583	missense	0			BC006978	CCDS8496.1, CCDS8497.1	11q25	2006-02-09			ENSG00000151500	ENSG00000151500			29560	protein-coding gene	gene with protein product		613739				14601557, 12384300	Standard	NM_014174		Approved	THY28	uc001qhg.3	Q9P016	OTTHUMG00000167176	ENST00000341541.3:c.166C>A	11.37:g.134121080G>T	ENSP00000341657:p.His56Asn		Q567Q2|Q9H3L4|Q9HC20	Missense_Mutation	SNP	pfam_EVE_domain,superfamily_PUA-like_domain	p.H56N	ENST00000341541.3	37	c.166	CCDS8496.1	11	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128415	0.56721	.	.	ENSG00000151500	ENST00000392595;ENST00000341541;ENST00000392594;ENST00000352327;ENST00000534274	.	.	.	5.16	-1.8	0.07907	EVE domain (1);PUA-like domain (1);	0.706089	0.15354	N	0.266781	T	0.59770	0.2218	M	0.84948	2.725	0.27720	N	0.94517	D;P;P	0.54964	0.969;0.666;0.61	P;P;B	0.53006	0.715;0.557;0.371	T	0.61486	-0.7053	9	0.72032	D	0.01	-7.0823	12.1257	0.53915	0.3088:0.0:0.6912:0.0	.	56;56;56	E9PPQ6;Q9P016-2;Q9P016	.;.;THYN1_HUMAN	N	56	.	ENSP00000341657:H56N	H	-	1	0	THYN1	133626290	1.000000	0.71417	0.051000	0.19133	0.633000	0.38033	3.576000	0.53878	-0.253000	0.09514	-0.302000	0.09304	CAC	THYN1	-	pfam_EVE_domain,superfamily_PUA-like_domain	ENSG00000151500		0.478	THYN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THYN1	HGNC	protein_coding	OTTHUMT00000393599.1	-	0.00	39	0	G	NM_014174		134121080	-1	tier1	-	no_errors	ENST00000341541	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.991	T
THYN1	29087	genome.wustl.edu	37	11	134121080	134121080	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr11:134121080G>T	ENST00000341541.3	-	2	627	c.166C>A	c.(166-168)Cac>Aac	p.H56N	THYN1_ENST00000525677.1_5'Flank|ACAD8_ENST00000537423.1_5'Flank|ACAD8_ENST00000543332.1_5'Flank|THYN1_ENST00000392595.2_Missense_Mutation_p.H56N|THYN1_ENST00000392594.3_Missense_Mutation_p.H56N|THYN1_ENST00000352327.5_Missense_Mutation_p.H56N|ACAD8_ENST00000281182.4_5'Flank|ACAD8_ENST00000374752.4_5'Flank	NM_014174.2	NP_054893.1	Q9P016	THYN1_HUMAN	thymocyte nuclear protein 1	56						nucleus (GO:0005634)				endometrium(2)|kidney(1)|lung(3)|pancreas(1)	7	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;1.68e-10)|all cancers(11;1.95e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00148)|Lung(977;0.207)		ATCAGCCAGTGGCTGCTTAGA	0.478																																																	0													186.0	191.0	189.0					11																	134121080		2201	4297	6498	SO:0001583	missense	0			BC006978	CCDS8496.1, CCDS8497.1	11q25	2006-02-09			ENSG00000151500	ENSG00000151500			29560	protein-coding gene	gene with protein product		613739				14601557, 12384300	Standard	NM_014174		Approved	THY28	uc001qhg.3	Q9P016	OTTHUMG00000167176	ENST00000341541.3:c.166C>A	11.37:g.134121080G>T	ENSP00000341657:p.His56Asn		Q567Q2|Q9H3L4|Q9HC20	Missense_Mutation	SNP	pfam_EVE_domain,superfamily_PUA-like_domain	p.H56N	ENST00000341541.3	37	c.166	CCDS8496.1	11	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128415	0.56721	.	.	ENSG00000151500	ENST00000392595;ENST00000341541;ENST00000392594;ENST00000352327;ENST00000534274	.	.	.	5.16	-1.8	0.07907	EVE domain (1);PUA-like domain (1);	0.706089	0.15354	N	0.266781	T	0.59770	0.2218	M	0.84948	2.725	0.27720	N	0.94517	D;P;P	0.54964	0.969;0.666;0.61	P;P;B	0.53006	0.715;0.557;0.371	T	0.61486	-0.7053	9	0.72032	D	0.01	-7.0823	12.1257	0.53915	0.3088:0.0:0.6912:0.0	.	56;56;56	E9PPQ6;Q9P016-2;Q9P016	.;.;THYN1_HUMAN	N	56	.	ENSP00000341657:H56N	H	-	1	0	THYN1	133626290	1.000000	0.71417	0.051000	0.19133	0.633000	0.38033	3.576000	0.53878	-0.253000	0.09514	-0.302000	0.09304	CAC	THYN1	-	pfam_EVE_domain,superfamily_PUA-like_domain	ENSG00000151500		0.478	THYN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THYN1	HGNC	protein_coding	OTTHUMT00000393599.1	-	0.00	47	0	G	NM_014174		134121080	-1	tier1	-	no_errors	ENST00000341541	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.991	T
TLX1	3195	genome.wustl.edu	37	10	102896595	102896595	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:102896595G>A	ENST00000370196.6	+	3	2960	c.918G>A	c.(916-918)ctG>ctA	p.L306L	RP11-31L23.3_ENST00000411459.1_RNA|TLX1_ENST00000467928.2_3'UTR			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	306					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TCTTCGCCCTGCAGAATCTGC	0.637			T	"""TRB@, TRD@"""	T-ALL																																			Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	0													87.0	73.0	78.0					10																	102896595		2203	4300	6503	SO:0001819	synonymous_variant	0			M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.918G>A	10.37:g.102896595G>A			A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.L306	ENST00000370196.6	37	c.918	CCDS7510.1	10																																																																																			TLX1	-	NULL	ENSG00000107807		0.637	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLX1	HGNC	protein_coding	OTTHUMT00000051193.3	-	0.00	33	0	G	NM_005521		102896595	+1	tier1	-	no_errors	ENST00000370196	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	A
TMEM132C	92293	genome.wustl.edu	37	12	129189834	129189834	+	Missense_Mutation	SNP	C	C	T	rs371001314		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:129189834C>T	ENST00000435159.2	+	9	2321	c.2321C>T	c.(2320-2322)aCg>aTg	p.T774M	TMEM132C_ENST00000537538.1_Missense_Mutation_p.T159M|TMEM132C_ENST00000315208.8_Missense_Mutation_p.T390M	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	774						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GTGGACATGACGATCGCCGAG	0.637																																																	0								C	MET/THR	0,1384		0,0,692	24.0	30.0	28.0		2321	1.4	0.2	12		28	1,3181		0,1,1590	no	missense	TMEM132C	NM_001136103.2	81	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	benign	774/1109	129189834	1,4565	692	1591	2283	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2321C>T	12.37:g.129189834C>T	ENSP00000410852:p.Thr774Met		Q69YX8	Missense_Mutation	SNP	NULL	p.T774M	ENST00000435159.2	37	c.2321		12	.	.	.	.	.	.	.	.	.	.	C	2.141	-0.396847	0.04899	0.0	3.14E-4	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.18016	2.24;2.24;2.24	4.84	1.36	0.22044	.	0.389091	0.22434	N	0.060107	T	0.03783	0.0107	N	0.01109	-1.01	0.21915	N	0.999472	B	0.24651	0.108	B	0.11329	0.006	T	0.37526	-0.9702	10	0.20046	T	0.44	.	3.6644	0.08250	0.0:0.2459:0.5081:0.246	.	774	Q8N3T6	T132C_HUMAN	M	774;390;159	ENSP00000410852:T774M;ENSP00000324458:T390M;ENSP00000438477:T159M	ENSP00000324458:T390M	T	+	2	0	TMEM132C	127755787	1.000000	0.71417	0.197000	0.23402	0.524000	0.34500	1.832000	0.39151	0.418000	0.25898	-0.165000	0.13383	ACG	TMEM132C	-	NULL	ENSG00000181234		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	24	0	C	XM_044062		129189834	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.996	T
TMEM132C	92293	genome.wustl.edu	37	12	129189834	129189834	+	Missense_Mutation	SNP	C	C	T	rs371001314		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:129189834C>T	ENST00000435159.2	+	9	2321	c.2321C>T	c.(2320-2322)aCg>aTg	p.T774M	TMEM132C_ENST00000537538.1_Missense_Mutation_p.T159M|TMEM132C_ENST00000315208.8_Missense_Mutation_p.T390M	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	774						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GTGGACATGACGATCGCCGAG	0.637																																																	0								C	MET/THR	0,1384		0,0,692	24.0	30.0	28.0		2321	1.4	0.2	12		28	1,3181		0,1,1590	no	missense	TMEM132C	NM_001136103.2	81	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	benign	774/1109	129189834	1,4565	692	1591	2283	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2321C>T	12.37:g.129189834C>T	ENSP00000410852:p.Thr774Met		Q69YX8	Missense_Mutation	SNP	NULL	p.T774M	ENST00000435159.2	37	c.2321		12	.	.	.	.	.	.	.	.	.	.	C	2.141	-0.396847	0.04899	0.0	3.14E-4	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.18016	2.24;2.24;2.24	4.84	1.36	0.22044	.	0.389091	0.22434	N	0.060107	T	0.03783	0.0107	N	0.01109	-1.01	0.21915	N	0.999472	B	0.24651	0.108	B	0.11329	0.006	T	0.37526	-0.9702	10	0.20046	T	0.44	.	3.6644	0.08250	0.0:0.2459:0.5081:0.246	.	774	Q8N3T6	T132C_HUMAN	M	774;390;159	ENSP00000410852:T774M;ENSP00000324458:T390M;ENSP00000438477:T159M	ENSP00000324458:T390M	T	+	2	0	TMEM132C	127755787	1.000000	0.71417	0.197000	0.23402	0.524000	0.34500	1.832000	0.39151	0.418000	0.25898	-0.165000	0.13383	ACG	TMEM132C	-	NULL	ENSG00000181234		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	44	0	C	XM_044062		129189834	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.996	T
TNIP1	10318	genome.wustl.edu	37	5	150411870	150411870	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:150411870G>A	ENST00000389378.2	-	17	2442	c.1854C>T	c.(1852-1854)ccC>ccT	p.P618P	TNIP1_ENST00000521423.1_5'UTR|TNIP1_ENST00000523200.1_Silent_p.P554P|TNIP1_ENST00000522226.1_Silent_p.P618P|TNIP1_ENST00000315050.7_Silent_p.P618P|TNIP1_ENST00000521591.1_Silent_p.P618P|TNIP1_ENST00000523338.1_Silent_p.P618P|TNIP1_ENST00000518977.1_Silent_p.P618P|TNIP1_ENST00000520931.1_Silent_p.P565P|TNIP1_ENST00000524280.1_Intron	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	618	Pro-rich.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCTGGCTGTGGGAGGGTCCA	0.532																																																	0													92.0	86.0	88.0					5																	150411870		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1854C>T	5.37:g.150411870G>A			A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	superfamily_ARM-type_fold	p.P618	ENST00000389378.2	37	c.1854	CCDS34280.1	5																																																																																			TNIP1	-	NULL	ENSG00000145901		0.532	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	-	0.00	52	0	G	NM_006058		150411870	-1	tier1	-	no_errors	ENST00000315050	ensembl	human	known	74_37	silent	27.27	48	18	SNP	0.000	A
TNIP1	10318	genome.wustl.edu	37	5	150411870	150411870	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:150411870G>A	ENST00000389378.2	-	17	2442	c.1854C>T	c.(1852-1854)ccC>ccT	p.P618P	TNIP1_ENST00000521423.1_5'UTR|TNIP1_ENST00000523200.1_Silent_p.P554P|TNIP1_ENST00000522226.1_Silent_p.P618P|TNIP1_ENST00000315050.7_Silent_p.P618P|TNIP1_ENST00000521591.1_Silent_p.P618P|TNIP1_ENST00000523338.1_Silent_p.P618P|TNIP1_ENST00000518977.1_Silent_p.P618P|TNIP1_ENST00000520931.1_Silent_p.P565P|TNIP1_ENST00000524280.1_Intron	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	618	Pro-rich.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCTGGCTGTGGGAGGGTCCA	0.532																																																	0													92.0	86.0	88.0					5																	150411870		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1854C>T	5.37:g.150411870G>A			A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	superfamily_ARM-type_fold	p.P618	ENST00000389378.2	37	c.1854	CCDS34280.1	5																																																																																			TNIP1	-	NULL	ENSG00000145901		0.532	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	-	0.00	77	0	G	NM_006058		150411870	-1	tier1	-	no_errors	ENST00000315050	ensembl	human	known	74_37	silent	27.27	48	18	SNP	0.000	A
TPSAB1	7177	genome.wustl.edu	37	16	1291206	1291206	+	Silent	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:1291206C>G	ENST00000338844.3	+	3	147	c.114C>G	c.(112-114)ccC>ccG	p.P38P	TPSAB1_ENST00000461509.2_Silent_p.P45P	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	38	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				AGGAGGCCCCCAGGAGCAAGT	0.706																																																	0													47.0	46.0	46.0					16																	1291206		2199	4300	6499	SO:0001819	synonymous_variant	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.114C>G	16.37:g.1291206C>G			D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P38	ENST00000338844.3	37	c.114	CCDS10431.1	16																																																																																			TPSAB1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000172236		0.706	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	-	0.00	108	0	C	NM_003294		1291206	+1	tier1	-	no_errors	ENST00000338844	ensembl	human	known	74_37	silent	17.95	96	21	SNP	0.000	G
TPSAB1	7177	genome.wustl.edu	37	16	1291206	1291206	+	Silent	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:1291206C>G	ENST00000338844.3	+	3	147	c.114C>G	c.(112-114)ccC>ccG	p.P38P	TPSAB1_ENST00000461509.2_Silent_p.P45P	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	38	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				AGGAGGCCCCCAGGAGCAAGT	0.706																																																	0													47.0	46.0	46.0					16																	1291206		2199	4300	6499	SO:0001819	synonymous_variant	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.114C>G	16.37:g.1291206C>G			D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P38	ENST00000338844.3	37	c.114	CCDS10431.1	16																																																																																			TPSAB1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000172236		0.706	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	-	0.00	86	0	C	NM_003294		1291206	+1	tier1	-	no_errors	ENST00000338844	ensembl	human	known	74_37	silent	17.95	96	21	SNP	0.000	G
TRIM58	25893	genome.wustl.edu	37	1	248039251	248039251	+	Silent	SNP	C	C	T	rs201527424	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:248039251C>T	ENST00000366481.3	+	6	969	c.921C>T	c.(919-921)acC>acT	p.T307T	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	307	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGCTCTTGACCGCCGACCTGC	0.572																																																	0													76.0	71.0	73.0					1																	248039251		2203	4300	6503	SO:0001819	synonymous_variant	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.921C>T	1.37:g.248039251C>T			Q6B0H9	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T307	ENST00000366481.3	37	c.921	CCDS1636.1	1																																																																																			TRIM58	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000162722		0.572	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	-	0.00	35	0	C	NM_015431		248039251	+1	tier1	-	no_errors	ENST00000366481	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.000	T
TRIM58	25893	genome.wustl.edu	37	1	248039251	248039251	+	Silent	SNP	C	C	T	rs201527424	byFrequency	TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:248039251C>T	ENST00000366481.3	+	6	969	c.921C>T	c.(919-921)acC>acT	p.T307T	OR2W3_ENST00000537741.1_5'UTR	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	307	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGCTCTTGACCGCCGACCTGC	0.572																																																	0													76.0	71.0	73.0					1																	248039251		2203	4300	6503	SO:0001819	synonymous_variant	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.921C>T	1.37:g.248039251C>T			Q6B0H9	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T307	ENST00000366481.3	37	c.921	CCDS1636.1	1																																																																																			TRIM58	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000162722		0.572	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	-	0.00	39	0	C	NM_015431		248039251	+1	tier1	-	no_errors	ENST00000366481	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179412140	179412140	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:179412140G>C	ENST00000591111.1	-	289	89514	c.89290C>G	c.(89290-89292)Cca>Gca	p.P29764A	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P22532A|TTN_ENST00000359218.5_Missense_Mutation_p.P22465A|TTN_ENST00000460472.2_Missense_Mutation_p.P22340A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P28837A|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P31405A|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29764	Fibronectin type-III 116. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACCAAATGGATGTTCAGCA	0.303																																																	0													33.0	30.0	31.0					2																	179412140		1810	4079	5889	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89290C>G	2.37:g.179412140G>C	ENSP00000465570:p.Pro29764Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P28837A	ENST00000591111.1	37	c.86509		2	.	.	.	.	.	.	.	.	.	.	G	15.05	2.716755	0.48622	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	6.03	5.13	0.70059	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.51856	0.1699	L	0.59967	1.855	0.80722	D	1	P;P;P;P	0.48294	0.908;0.908;0.908;0.908	B;B;B;B	0.41860	0.368;0.368;0.368;0.368	T	0.58989	-0.7538	9	0.87932	D	0	.	14.4639	0.67470	0.0727:0.0:0.9273:0.0	.	22340;22465;22532;29764	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	28837;22340;22532;22465;22337	ENSP00000343764:P28837A;ENSP00000434586:P22340A;ENSP00000340554:P22532A;ENSP00000352154:P22465A	ENSP00000340554:P22532A	P	-	1	0	TTN	179120386	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.029000	0.88807	1.486000	0.48398	0.655000	0.94253	CCA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.303	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	26	0	G	NM_133378		179412140	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179412140	179412140	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:179412140G>C	ENST00000591111.1	-	289	89514	c.89290C>G	c.(89290-89292)Cca>Gca	p.P29764A	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P22532A|TTN_ENST00000359218.5_Missense_Mutation_p.P22465A|TTN_ENST00000460472.2_Missense_Mutation_p.P22340A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P28837A|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P31405A|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29764	Fibronectin type-III 116. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACCAAATGGATGTTCAGCA	0.303																																																	0													33.0	30.0	31.0					2																	179412140		1810	4079	5889	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89290C>G	2.37:g.179412140G>C	ENSP00000465570:p.Pro29764Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P28837A	ENST00000591111.1	37	c.86509		2	.	.	.	.	.	.	.	.	.	.	G	15.05	2.716755	0.48622	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	6.03	5.13	0.70059	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.51856	0.1699	L	0.59967	1.855	0.80722	D	1	P;P;P;P	0.48294	0.908;0.908;0.908;0.908	B;B;B;B	0.41860	0.368;0.368;0.368;0.368	T	0.58989	-0.7538	9	0.87932	D	0	.	14.4639	0.67470	0.0727:0.0:0.9273:0.0	.	22340;22465;22532;29764	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	28837;22340;22532;22465;22337	ENSP00000343764:P28837A;ENSP00000434586:P22340A;ENSP00000340554:P22532A;ENSP00000352154:P22465A	ENSP00000340554:P22532A	P	-	1	0	TTN	179120386	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.029000	0.88807	1.486000	0.48398	0.655000	0.94253	CCA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.303	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	40	0	G	NM_133378		179412140	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179643819	179643819	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:179643819G>T	ENST00000591111.1	-	24	4214	c.3990C>A	c.(3988-3990)cgC>cgA	p.R1330R	TTN_ENST00000360870.5_Silent_p.R1330R|TTN_ENST00000342175.6_Silent_p.R1284R|TTN_ENST00000359218.5_Silent_p.R1284R|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000460472.2_Silent_p.R1284R|TTN_ENST00000342992.6_Silent_p.R1330R|TTN_ENST00000589042.1_Silent_p.R1330R			Q8WZ42	TITIN_HUMAN	titin	33527	Ig-like 5.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATGTTTGATGCGCTTGCCAT	0.358																																																	0													118.0	104.0	109.0					2																	179643819		2203	4300	6503	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3990C>A	2.37:g.179643819G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R1330	ENST00000591111.1	37	c.3990		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	15	0	G	NM_133378		179643819	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.998	T
TTN	7273	genome.wustl.edu	37	2	179647087	179647087	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:179647087C>T	ENST00000591111.1	-	20	3456	c.3232G>A	c.(3232-3234)Gaa>Aaa	p.E1078K	TTN_ENST00000360870.5_Missense_Mutation_p.E1078K|TTN_ENST00000342175.6_Missense_Mutation_p.E1032K|TTN_ENST00000359218.5_Missense_Mutation_p.E1032K|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E1032K|TTN_ENST00000342992.6_Missense_Mutation_p.E1078K|TTN_ENST00000589042.1_Missense_Mutation_p.E1078K			Q8WZ42	TITIN_HUMAN	titin	32618					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCGGCAGGTTCTCCAGGCCCT	0.507																																																	0													53.0	56.0	55.0					2																	179647087		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3232G>A	2.37:g.179647087C>T	ENSP00000465570:p.Glu1078Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E1078K	ENST00000591111.1	37	c.3232		2	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265526	0.59431	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.64803	-0.12;0.1;0.07;0.06;0.22	5.6	5.6	0.85130	Ribonuclease H-like (1);	.	.	.	.	T	0.70876	0.3274	L	0.34521	1.04	0.40019	D	0.975383	P;P;P;P;D	0.69078	0.953;0.953;0.953;0.953;0.997	P;P;P;P;D	0.63033	0.551;0.551;0.551;0.551;0.91	T	0.73607	-0.3929	9	0.87932	D	0	.	19.9801	0.97322	0.0:1.0:0.0:0.0	.	1032;1032;1032;1078;1078	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	1078;1032;1032;1032;1032;1078	ENSP00000343764:E1078K;ENSP00000434586:E1032K;ENSP00000340554:E1032K;ENSP00000352154:E1032K;ENSP00000354117:E1078K	ENSP00000340554:E1032K	E	-	1	0	TTN	179355332	1.000000	0.71417	0.999000	0.59377	0.560000	0.35617	5.754000	0.68743	2.808000	0.96608	0.650000	0.86243	GAA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.507	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	28	0	C	NM_133378		179647087	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	52.78	17	19	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179647087	179647087	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:179647087C>T	ENST00000591111.1	-	20	3456	c.3232G>A	c.(3232-3234)Gaa>Aaa	p.E1078K	TTN_ENST00000360870.5_Missense_Mutation_p.E1078K|TTN_ENST00000342175.6_Missense_Mutation_p.E1032K|TTN_ENST00000359218.5_Missense_Mutation_p.E1032K|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E1032K|TTN_ENST00000342992.6_Missense_Mutation_p.E1078K|TTN_ENST00000589042.1_Missense_Mutation_p.E1078K			Q8WZ42	TITIN_HUMAN	titin	32618					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCGGCAGGTTCTCCAGGCCCT	0.507																																																	0													53.0	56.0	55.0					2																	179647087		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3232G>A	2.37:g.179647087C>T	ENSP00000465570:p.Glu1078Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E1078K	ENST00000591111.1	37	c.3232		2	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265526	0.59431	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.64803	-0.12;0.1;0.07;0.06;0.22	5.6	5.6	0.85130	Ribonuclease H-like (1);	.	.	.	.	T	0.70876	0.3274	L	0.34521	1.04	0.40019	D	0.975383	P;P;P;P;D	0.69078	0.953;0.953;0.953;0.953;0.997	P;P;P;P;D	0.63033	0.551;0.551;0.551;0.551;0.91	T	0.73607	-0.3929	9	0.87932	D	0	.	19.9801	0.97322	0.0:1.0:0.0:0.0	.	1032;1032;1032;1078;1078	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	1078;1032;1032;1032;1032;1078	ENSP00000343764:E1078K;ENSP00000434586:E1032K;ENSP00000340554:E1032K;ENSP00000352154:E1032K;ENSP00000354117:E1078K	ENSP00000340554:E1032K	E	-	1	0	TTN	179355332	1.000000	0.71417	0.999000	0.59377	0.560000	0.35617	5.754000	0.68743	2.808000	0.96608	0.650000	0.86243	GAA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.507	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	56	0	C	NM_133378		179647087	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	52.78	17	19	SNP	1.000	T
UNC5D	137970	genome.wustl.edu	37	8	35624506	35624506	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr8:35624506C>A	ENST00000404895.2	+	15	2728	c.2400C>A	c.(2398-2400)acC>acA	p.T800T	UNC5D_ENST00000287272.2_Silent_p.T731T|UNC5D_ENST00000420357.1_Silent_p.T733T|UNC5D_ENST00000449677.1_Silent_p.T376T|UNC5D_ENST00000416672.1_Silent_p.T805T|UNC5D_ENST00000453357.2_Silent_p.T795T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	800					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T795T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCACTACCACCCAGCTGTCCT	0.572																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											119.0	100.0	106.0					8																	35624506		2203	4300	6503	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2400C>A	8.37:g.35624506C>A			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.T800	ENST00000404895.2	37	c.2400	CCDS6093.2	8																																																																																			UNC5D	-	NULL	ENSG00000156687		0.572	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	25	0	C			35624506	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	33.96	35	18	SNP	1.000	A
UNC5D	137970	genome.wustl.edu	37	8	35624506	35624506	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr8:35624506C>A	ENST00000404895.2	+	15	2728	c.2400C>A	c.(2398-2400)acC>acA	p.T800T	UNC5D_ENST00000287272.2_Silent_p.T731T|UNC5D_ENST00000420357.1_Silent_p.T733T|UNC5D_ENST00000449677.1_Silent_p.T376T|UNC5D_ENST00000416672.1_Silent_p.T805T|UNC5D_ENST00000453357.2_Silent_p.T795T	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	800					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T795T(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCACTACCACCCAGCTGTCCT	0.572																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											119.0	100.0	106.0					8																	35624506		2203	4300	6503	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2400C>A	8.37:g.35624506C>A			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.T800	ENST00000404895.2	37	c.2400	CCDS6093.2	8																																																																																			UNC5D	-	NULL	ENSG00000156687		0.572	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	39	0	C			35624506	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	33.96	35	18	SNP	1.000	A
UNC79	57578	genome.wustl.edu	37	14	94038291	94038291	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr14:94038291G>T	ENST00000393151.2	+	15	1807	c.1807G>T	c.(1807-1809)Ggt>Tgt	p.G603C	UNC79_ENST00000553484.1_Missense_Mutation_p.G603C|UNC79_ENST00000256339.4_Missense_Mutation_p.G426C|UNC79_ENST00000555664.1_Missense_Mutation_p.G603C			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	603					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GCTGAAGGAAGGTCTCAACCG	0.478																																																	0													115.0	107.0	110.0					14																	94038291		2203	4300	6503	SO:0001583	missense	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1807G>T	14.37:g.94038291G>T	ENSP00000376858:p.Gly603Cys		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.G603C	ENST00000393151.2	37	c.1807		14	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847335	0.91277	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.37915	1.18;1.19;1.17;1.19	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.60932	0.2307	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61387	-0.7073	10	0.87932	D	0	-16.1255	19.9157	0.97061	0.0:0.0:1.0:0.0	.	603	C9JQL1	.	C	426;603;603;603;603	ENSP00000256339:G426C;ENSP00000450868:G603C;ENSP00000451360:G603C;ENSP00000376858:G603C	ENSP00000256339:G426C	G	+	1	0	KIAA1409	93108044	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.505000	0.97989	2.719000	0.93026	0.650000	0.86243	GGT	UNC79	-	NULL	ENSG00000133958		0.478	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1		0.00	31	0	G	XM_028395		94038291	+1			no_errors	ENST00000553484	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
USP38	84640	genome.wustl.edu	37	4	144107006	144107006	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr4:144107006G>A	ENST00000307017.4	+	1	909	c.403G>A	c.(403-405)Gtg>Atg	p.V135M	RP11-284M14.1_ENST00000507826.1_RNA|USP38_ENST00000510377.1_Missense_Mutation_p.V135M|RP11-284M14.1_ENST00000507486.1_RNA	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	135					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					GTTACGGATGGTGTGTGAGAG	0.557																																																	0													111.0	100.0	104.0					4																	144107006		2203	4300	6503	SO:0001583	missense	0			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.403G>A	4.37:g.144107006G>A	ENSP00000303434:p.Val135Met		B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.V135M	ENST00000307017.4	37	c.403	CCDS3758.1	4	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925717	0.73213	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.68331	-0.25;-0.32	4.91	4.07	0.47477	.	0.071575	0.56097	D	0.000038	T	0.67069	0.2854	L	0.34521	1.04	0.54753	D	0.999981	P;D	0.55172	0.822;0.97	P;P	0.52710	0.599;0.707	T	0.72104	-0.4391	10	0.87932	D	0	-10.0239	15.4223	0.75022	0.0:0.1393:0.8607:0.0	.	135;135	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	M	135	ENSP00000427647:V135M;ENSP00000303434:V135M	ENSP00000303434:V135M	V	+	1	0	USP38	144326456	1.000000	0.71417	0.992000	0.48379	0.870000	0.49936	5.532000	0.67154	1.292000	0.44672	0.561000	0.74099	GTG	USP38	-	NULL	ENSG00000170185		0.557	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	HGNC	protein_coding	OTTHUMT00000364869.1		0.00	18	0	G	NM_032557		144107006	+1			no_errors	ENST00000307017	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
USP51	158880	genome.wustl.edu	37	X	55515327	55515327	+	Missense_Mutation	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:55515327G>C	ENST00000500968.3	-	2	128	c.46C>G	c.(46-48)Cgc>Ggc	p.R16G	USP51_ENST00000586165.1_5'Flank	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	16					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						GAGATCCAGCGGACCCCAGAG	0.637																																																	0													11.0	10.0	10.0					X																	55515327		2146	4201	6347	SO:0001583	missense	0			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.46C>G	X.37:g.55515327G>C	ENSP00000423333:p.Arg16Gly		Q8IWJ8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R16G	ENST00000500968.3	37	c.46	CCDS14370.1	X	.	.	.	.	.	.	.	.	.	.	.	0.961	-0.703212	0.03255	.	.	ENSG00000247746	ENST00000500968	T	0.10192	2.9	2.66	-3.41	0.04839	.	.	.	.	.	T	0.04907	0.0132	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44922	-0.9296	9	0.14252	T	0.57	.	4.055	0.09813	0.3866:0.3472:0.2662:0.0	.	16	Q70EK9	UBP51_HUMAN	G	16	ENSP00000423333:R16G	ENSP00000423333:R16G	R	-	1	0	USP51	55532052	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-0.613000	0.05610	-1.107000	0.03004	0.431000	0.28591	CGC	USP51	-	NULL	ENSG00000247746		0.637	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2		0.00	48	0	G	NM_201286		55515327	-1			no_errors	ENST00000500968	ensembl	human	known	74_37	missense	28.00	36	14	SNP	0.000	C
VPS13A	23230	genome.wustl.edu	37	9	79972696	79972696	+	Missense_Mutation	SNP	T	T	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:79972696T>G	ENST00000360280.3	+	56	8155	c.7895T>G	c.(7894-7896)gTg>gGg	p.V2632G	VPS13A_ENST00000357409.5_Missense_Mutation_p.V2632G|VPS13A_ENST00000376634.4_Missense_Mutation_p.V2632G|VPS13A_ENST00000376636.3_Missense_Mutation_p.V2593G	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2632					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GCATTAAAAGTGGAATATAAC	0.343																																																	0													64.0	69.0	67.0					9																	79972696		2203	4300	6503	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.7895T>G	9.37:g.79972696T>G	ENSP00000353422:p.Val2632Gly		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.V2632G	ENST00000360280.3	37	c.7895	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016926	0.75161	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.99	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.88070	0.6338	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.76494	0.981;0.999;0.991;0.991	D;D;P;P	0.67103	0.937;0.949;0.903;0.903	D	0.88483	0.3070	9	.	.	.	.	12.6709	0.56866	0.1232:0.0:0.0:0.8768	.	2593;2632;2632;2632	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	G	2632;2593;2632;2632	ENSP00000365821:V2632G;ENSP00000365823:V2593G;ENSP00000353422:V2632G;ENSP00000349985:V2632G	.	V	+	2	0	VPS13A	79162516	1.000000	0.71417	0.986000	0.45419	0.850000	0.48378	5.413000	0.66399	2.291000	0.77112	0.533000	0.62120	GTG	VPS13A	-	NULL	ENSG00000197969		0.343	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	59	0	T	NM_015186		79972696	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	22.22	63	18	SNP	0.998	G
VPS13A	23230	genome.wustl.edu	37	9	79972696	79972696	+	Missense_Mutation	SNP	T	T	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr9:79972696T>G	ENST00000360280.3	+	56	8155	c.7895T>G	c.(7894-7896)gTg>gGg	p.V2632G	VPS13A_ENST00000357409.5_Missense_Mutation_p.V2632G|VPS13A_ENST00000376634.4_Missense_Mutation_p.V2632G|VPS13A_ENST00000376636.3_Missense_Mutation_p.V2593G	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2632					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GCATTAAAAGTGGAATATAAC	0.343																																																	0													64.0	69.0	67.0					9																	79972696		2203	4300	6503	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.7895T>G	9.37:g.79972696T>G	ENSP00000353422:p.Val2632Gly		Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.V2632G	ENST00000360280.3	37	c.7895	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	T	20.6	4.016926	0.75161	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.99	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.88070	0.6338	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.76494	0.981;0.999;0.991;0.991	D;D;P;P	0.67103	0.937;0.949;0.903;0.903	D	0.88483	0.3070	9	.	.	.	.	12.6709	0.56866	0.1232:0.0:0.0:0.8768	.	2593;2632;2632;2632	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	G	2632;2593;2632;2632	ENSP00000365821:V2632G;ENSP00000365823:V2593G;ENSP00000353422:V2632G;ENSP00000349985:V2632G	.	V	+	2	0	VPS13A	79162516	1.000000	0.71417	0.986000	0.45419	0.850000	0.48378	5.413000	0.66399	2.291000	0.77112	0.533000	0.62120	GTG	VPS13A	-	NULL	ENSG00000197969		0.343	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	-	0.00	69	0	T	NM_015186		79972696	+1	tier1	-	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	22.22	63	18	SNP	0.998	G
VPS13D	55187	genome.wustl.edu	37	1	12313875	12313875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:12313875G>T	ENST00000358136.3	+	7	791	c.661G>T	c.(661-663)Gag>Tag	p.E221*	VPS13D_ENST00000356315.4_Nonsense_Mutation_p.E221*	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCCTCAGATGGAGTTACAGGT	0.488																																																	0													192.0	176.0	181.0					1																	12313875		2203	4300	6503	SO:0001587	stop_gained	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.661G>T	1.37:g.12313875G>T	ENSP00000350854:p.Glu221*			Nonsense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E221*	ENST00000358136.3	37	c.661	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.970547	0.97971	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	.	.	.	5.48	5.48	0.80851	.	0.247510	0.38492	N	0.001664	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	15.5582	0.76216	0.0:0.1378:0.8622:0.0	.	.	.	.	X	221	.	ENSP00000348666:E221X	E	+	1	0	VPS13D	12236462	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	3.220000	0.51207	2.560000	0.86352	0.650000	0.86243	GAG	VPS13D	-	NULL	ENSG00000048707		0.488	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	46	0	G	NM_015378		12313875	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	T
VPS13D	55187	genome.wustl.edu	37	1	12313875	12313875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:12313875G>T	ENST00000358136.3	+	7	791	c.661G>T	c.(661-663)Gag>Tag	p.E221*	VPS13D_ENST00000356315.4_Nonsense_Mutation_p.E221*	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCCTCAGATGGAGTTACAGGT	0.488																																																	0													192.0	176.0	181.0					1																	12313875		2203	4300	6503	SO:0001587	stop_gained	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.661G>T	1.37:g.12313875G>T	ENSP00000350854:p.Glu221*			Nonsense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E221*	ENST00000358136.3	37	c.661	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.970547	0.97971	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	.	.	.	5.48	5.48	0.80851	.	0.247510	0.38492	N	0.001664	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	15.5582	0.76216	0.0:0.1378:0.8622:0.0	.	.	.	.	X	221	.	ENSP00000348666:E221X	E	+	1	0	VPS13D	12236462	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	3.220000	0.51207	2.560000	0.86352	0.650000	0.86243	GAG	VPS13D	-	NULL	ENSG00000048707		0.488	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	54	0	G	NM_015378		12313875	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	T
WASF3	10810	genome.wustl.edu	37	13	27216440	27216440	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:27216440G>A	ENST00000335327.5	+	3	211	c.33G>A	c.(31-33)cgG>cgA	p.R11R	WASF3_ENST00000361042.4_Silent_p.R11R|WASF3-AS1_ENST00000586418.1_RNA|WASF3-AS1_ENST00000413063.1_RNA|WASF3_ENST00000496788.1_3'UTR|WASF3-AS1_ENST00000585599.1_RNA	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	11					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		TTGAGCCCCGGCACTTGTGCC	0.438																																																	0													84.0	85.0	85.0					13																	27216440		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.33G>A	13.37:g.27216440G>A			O94974|Q86VQ2	Silent	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R11	ENST00000335327.5	37	c.33	CCDS9318.1	13																																																																																			WASF3	-	NULL	ENSG00000132970		0.438	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF3	HGNC	protein_coding	OTTHUMT00000044258.1	-	0.00	51	0	G			27216440	+1	tier1	-	no_errors	ENST00000335327	ensembl	human	known	74_37	silent	30.59	59	26	SNP	1.000	A
WASF3	10810	genome.wustl.edu	37	13	27216440	27216440	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr13:27216440G>A	ENST00000335327.5	+	3	211	c.33G>A	c.(31-33)cgG>cgA	p.R11R	WASF3_ENST00000361042.4_Silent_p.R11R|WASF3-AS1_ENST00000586418.1_RNA|WASF3-AS1_ENST00000413063.1_RNA|WASF3_ENST00000496788.1_3'UTR|WASF3-AS1_ENST00000585599.1_RNA	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	11					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		TTGAGCCCCGGCACTTGTGCC	0.438																																																	0													84.0	85.0	85.0					13																	27216440		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.33G>A	13.37:g.27216440G>A			O94974|Q86VQ2	Silent	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R11	ENST00000335327.5	37	c.33	CCDS9318.1	13																																																																																			WASF3	-	NULL	ENSG00000132970		0.438	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF3	HGNC	protein_coding	OTTHUMT00000044258.1	-	0.00	64	0	G			27216440	+1	tier1	-	no_errors	ENST00000335327	ensembl	human	known	74_37	silent	30.59	59	26	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110428207	110428207	+	Missense_Mutation	SNP	G	G	T	rs376575241		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr5:110428207G>T	ENST00000513710.2	+	1	225	c.221G>T	c.(220-222)cGg>cTg	p.R74L	CTC-551A13.2_ENST00000507269.3_RNA|WDR36_ENST00000505303.1_Missense_Mutation_p.R18L|WDR36_ENST00000506538.2_Missense_Mutation_p.R74L			Q8NI36	WDR36_HUMAN	WD repeat domain 36	74					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		GCGGGGTTCCGGGCCTTGGGA	0.602																																																	0								G	LEU/ARG	1,4403	2.1+/-5.4	0,1,2201	35.0	40.0	38.0		221	6.0	1.0	5		38	0,8600		0,0,4300	no	missense	WDR36	NM_139281.2	102	0,1,6501	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging	74/952	110428207	1,13003	2202	4300	6502	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.221G>T	5.37:g.110428207G>T	ENSP00000424628:p.Arg74Leu		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R74L	ENST00000513710.2	37	c.221	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.679152	0.96764	2.27E-4	0.0	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	D;D;T	0.82984	-1.67;-1.67;-0.96	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.92440	0.7600	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.92903	0.6341	10	0.87932	D	0	-13.8234	19.2296	0.93833	0.0:0.0:1.0:0.0	.	74	Q8NI36	WDR36_HUMAN	L	74;74;18	ENSP00000423067:R74L;ENSP00000424628:R74L;ENSP00000422158:R18L	ENSP00000422158:R18L	R	+	2	0	WDR36	110456106	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.255000	0.78338	2.835000	0.97688	0.650000	0.86243	CGG	WDR36	-	NULL	ENSG00000134987		0.602	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	-	0.00	29	0	G	NM_139281		110428207	+1	tier1	-	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
WDR87	83889	genome.wustl.edu	37	19	38383490	38383490	+	Silent	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:38383490G>A	ENST00000303868.5	-	4	2960	c.2736C>T	c.(2734-2736)taC>taT	p.Y912Y	WDR87_ENST00000447313.2_Silent_p.Y951Y	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	912										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGGACACCTGGTAAGAGGCAA	0.498																																																	0													70.0	58.0	62.0					19																	38383490		692	1591	2283	SO:0001819	synonymous_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2736C>T	19.37:g.38383490G>A			Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y951	ENST00000303868.5	37	c.2853	CCDS46063.1	19																																																																																			WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.498	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	39	0	G	XM_940478		38383490	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	silent	30.00	28	12	SNP	0.999	A
ZCCHC8	55596	genome.wustl.edu	37	12	122962497	122962497	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:122962497C>A	ENST00000336229.4	-	13	1366	c.1236G>T	c.(1234-1236)gtG>gtT	p.V412V	ZCCHC8_ENST00000536306.1_Silent_p.V174V|ZCCHC8_ENST00000538116.1_Silent_p.V23V|ZCCHC8_ENST00000543897.1_Silent_p.V174V	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	412					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TGCCAGACTTCACACCTGGCT	0.453																																																	0													86.0	83.0	84.0					12																	122962497		1884	4106	5990	SO:0001819	synonymous_variant	0			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1236G>T	12.37:g.122962497C>A			Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Silent	SNP	pfam_PSP,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_PSP,pfscan_Znf_CCHC	p.V412	ENST00000336229.4	37	c.1236		12																																																																																			ZCCHC8	-	NULL	ENSG00000033030		0.453	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	HGNC	protein_coding			0.00	22	0	C	NM_017612		122962497	-1			no_errors	ENST00000336229	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.000	A
ZDHHC16	84287	genome.wustl.edu	37	10	99211481	99211481	+	Missense_Mutation	SNP	C	C	T	rs376949987		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:99211481C>T	ENST00000370854.3	+	2	238	c.49C>T	c.(49-51)Cgc>Tgc	p.R17C	ZDHHC16_ENST00000353979.3_Missense_Mutation_p.R17C|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.R17C|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.R17C|ZDHHC16_ENST00000370846.4_Missense_Mutation_p.R17C|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.R17C|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.R17C	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	17					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CCTCTGCCTCCGCCTCCTTCT	0.667																																																	0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	29.0	33.0	32.0		49,49,49,49,49	5.6	1.0	10		32	1,8599		0,1,4299	no	missense,missense,missense,missense,missense	ZDHHC16	NM_032327.2,NM_198043.1,NM_198044.1,NM_198045.1,NM_198046.1	180,180,180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	17/378,17/362,17/339,17/297,17/378	99211481	1,13005	2203	4300	6503	SO:0001583	missense	0			AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.49C>T	10.37:g.99211481C>T	ENSP00000359891:p.Arg17Cys		D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R17C	ENST00000370854.3	37	c.49	CCDS7460.1	10	.	.	.	.	.	.	.	.	.	.	C	19.57	3.851753	0.71719	0.0	1.16E-4	ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000414567;ENST00000370846;ENST00000352634;ENST00000353979;ENST00000370842;ENST00000345745;ENST00000433086	T;T;T;T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05	5.59	5.59	0.84812	.	0.052524	0.64402	D	0.000001	T	0.38054	0.1026	L	0.42245	1.32	0.50632	D	0.999889	P;D;D;D;D;D;P	0.89917	0.946;0.992;1.0;0.968;0.995;0.968;0.946	B;P;D;B;P;B;B	0.71184	0.18;0.513;0.972;0.335;0.707;0.335;0.249	T	0.06716	-1.0811	10	0.87932	D	0	.	14.3222	0.66493	0.1846:0.8154:0.0:0.0	.	17;17;17;17;17;17;17	B4DNL2;E9PCL9;B1AMU0;Q969W1-3;Q969W1-4;Q969W1-2;Q969W1	.;.;.;.;.;.;ZDH16_HUMAN	C	17	ENSP00000359891:R17C;ENSP00000377357:R17C;ENSP00000400719:R17C;ENSP00000359883:R17C;ENSP00000345383:R17C;ENSP00000323360:R17C;ENSP00000359879:R17C;ENSP00000304487:R17C;ENSP00000398532:R17C	ENSP00000304487:R17C	R	+	1	0	ZDHHC16	99201471	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.147000	0.42226	2.641000	0.89580	0.561000	0.74099	CGC	ZDHHC16	-	NULL	ENSG00000171307		0.667	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC16	HGNC	protein_coding	OTTHUMT00000049658.2	-	0.00	16	0	C	NM_032327		99211481	+1	tier1	-	no_errors	ENST00000370854	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	T
ZEB2	9839	genome.wustl.edu	37	2	145157786	145157786	+	Missense_Mutation	SNP	C	C	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:145157786C>G	ENST00000558170.2	-	8	2152	c.968G>C	c.(967-969)gGt>gCt	p.G323A	ZEB2_ENST00000303660.4_Missense_Mutation_p.G323A|ZEB2_ENST00000409487.3_Missense_Mutation_p.G323A|ZEB2_ENST00000539609.3_Missense_Mutation_p.G299A	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	323					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		ACTGTAGGAACCAGAATGGGA	0.373																																					Melanoma(33;1235 1264 5755 16332)												0													49.0	52.0	51.0					2																	145157786		2202	4300	6502	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.968G>C	2.37:g.145157786C>G	ENSP00000454157:p.Gly323Ala		A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.G323A	ENST00000558170.2	37	c.968	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488221	0.64074	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.20170	0.0485	N	0.12637	0.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.97110	1.0;0.999;0.995;0.995	T	0.16988	-1.0384	10	0.72032	D	0.01	-8.38	19.7156	0.96119	0.0:1.0:0.0:0.0	.	299;188;322;323	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	A	318;299;323;323;323;323	ENSP00000443792:G299A;ENSP00000302501:G323A;ENSP00000386854:G323A;ENSP00000395496:G323A;ENSP00000376601:G323A	ENSP00000302501:G323A	G	-	2	0	ZEB2	144874256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.658000	0.90341	0.655000	0.94253	GGT	ZEB2	-	smart_Znf_C2H2-like	ENSG00000169554		0.373	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5		0.00	36	0	C	NM_014795		145157786	-1			no_errors	ENST00000303660	ensembl	human	known	74_37	missense	8.11	68	6	SNP	1.000	G
ZFPM2	23414	genome.wustl.edu	37	8	106815683	106815683	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr8:106815683G>T	ENST00000407775.2	+	8	3623	c.3373G>T	c.(3373-3375)Gat>Tat	p.D1125Y	RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.D993Y|ZFPM2_ENST00000520492.1_Missense_Mutation_p.D993Y|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.D856Y|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	1125					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.D1125H(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CCGGCTATGTGATATCCAGTT	0.413																																																	1	Substitution - Missense(1)	endometrium(1)											40.0	39.0	40.0					8																	106815683		1881	4106	5987	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.3373G>T	8.37:g.106815683G>T	ENSP00000384179:p.Asp1125Tyr		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D1125Y	ENST00000407775.2	37	c.3373	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268908	0.59540	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.81	5.81	0.92471	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.59595	0.2205	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60454	-0.7260	10	0.72032	D	0.01	.	20.0805	0.97772	0.0:0.0:1.0:0.0	.	1125	Q8WW38	FOG2_HUMAN	Y	1125;993;993;856	ENSP00000384179:D1125Y;ENSP00000430757:D993Y;ENSP00000428720:D993Y;ENSP00000367733:D856Y	ENSP00000367733:D856Y	D	+	1	0	ZFPM2	106884859	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.755000	0.94549	0.650000	0.86243	GAT	ZFPM2	-	smart_Znf_C2H2-like	ENSG00000169946		0.413	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1		0.00	20	0	G			106815683	+1			no_errors	ENST00000407775	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
ZMIZ1	57178	genome.wustl.edu	37	10	81050766	81050766	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:81050766C>T	ENST00000334512.5	+	10	1163	c.591C>T	c.(589-591)ggC>ggT	p.G197G	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	197					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			ATCCAGGCGGCAACCCCATGG	0.622																																																	0													120.0	101.0	107.0					10																	81050766		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.591C>T	10.37:g.81050766C>T			Q5JSH9|Q7Z7E6	Silent	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.G197	ENST00000334512.5	37	c.591	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433177	0.25813	.	.	ENSG00000108175	ENST00000372347	.	.	.	5.67	2.57	0.30868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-11.2641	6.8291	0.23900	0.2088:0.6225:0.0:0.1687	.	.	.	.	X	129	.	ENSP00000361422:Q129X	Q	+	1	0	ZMIZ1	80720772	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.702000	0.25631	0.764000	0.33197	-0.136000	0.14681	CAA	ZMIZ1	-	NULL	ENSG00000108175		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	-	0.00	34	0	C	NM_020338		81050766	+1	tier1	-	no_errors	ENST00000334512	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.998	T
ZMIZ1	57178	genome.wustl.edu	37	10	81050766	81050766	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr10:81050766C>T	ENST00000334512.5	+	10	1163	c.591C>T	c.(589-591)ggC>ggT	p.G197G	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	197					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			ATCCAGGCGGCAACCCCATGG	0.622																																																	0													120.0	101.0	107.0					10																	81050766		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.591C>T	10.37:g.81050766C>T			Q5JSH9|Q7Z7E6	Silent	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.G197	ENST00000334512.5	37	c.591	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433177	0.25813	.	.	ENSG00000108175	ENST00000372347	.	.	.	5.67	2.57	0.30868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-11.2641	6.8291	0.23900	0.2088:0.6225:0.0:0.1687	.	.	.	.	X	129	.	ENSP00000361422:Q129X	Q	+	1	0	ZMIZ1	80720772	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.702000	0.25631	0.764000	0.33197	-0.136000	0.14681	CAA	ZMIZ1	-	NULL	ENSG00000108175		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	-	0.00	37	0	C	NM_020338		81050766	+1	tier1	-	no_errors	ENST00000334512	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.998	T
ZMYM1	79830	genome.wustl.edu	37	1	35579635	35579635	+	Missense_Mutation	SNP	A	A	G			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:35579635A>G	ENST00000373330.1	+	11	2378	c.2204A>G	c.(2203-2205)aAa>aGa	p.K735R	ZMYM1_ENST00000359858.4_Missense_Mutation_p.K735R|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	735						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAATTCAAGAAAGAAGAACCA	0.318																																																	0													51.0	52.0	51.0					1																	35579635		1795	4067	5862	SO:0001583	missense	0			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2204A>G	1.37:g.35579635A>G	ENSP00000362427:p.Lys735Arg		D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.K735R	ENST00000373330.1	37	c.2204	CCDS41302.1	1	.	.	.	.	.	.	.	.	.	.	A	6.582	0.475633	0.12521	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.18960	2.44;2.18;2.44	4.24	4.24	0.50183	Ribonuclease H-like (1);	0.603507	0.14963	N	0.288228	T	0.36880	0.0983	L	0.51422	1.61	0.29585	N	0.848843	D;D	0.63880	0.993;0.978	D;P	0.70935	0.971;0.651	T	0.09509	-1.0671	9	.	.	.	-11.5594	10.0121	0.41992	1.0:0.0:0.0:0.0	.	716;735	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	R	735;660;735	ENSP00000352920:K735R;ENSP00000362426:K660R;ENSP00000362427:K735R	.	K	+	2	0	ZMYM1	35352222	1.000000	0.71417	1.000000	0.80357	0.162000	0.22319	5.071000	0.64382	2.138000	0.66242	0.455000	0.32223	AAA	ZMYM1	-	superfamily_RNaseH-like_dom	ENSG00000197056		0.318	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	-	0.00	39	0	A	NM_024772		35579635	+1	tier1	-	no_errors	ENST00000359858	ensembl	human	novel	74_37	missense	25.00	29	10	SNP	1.000	G
ZMYM3	9203	genome.wustl.edu	37	X	70462090	70462090	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:70462090G>T	ENST00000353904.2	-	23	3919	c.3732C>A	c.(3730-3732)acC>acA	p.T1244T	ZMYM3_ENST00000373998.1_Silent_p.T1232T|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Silent_p.T1246T|ZMYM3_ENST00000373984.3_Intron|ZMYM3_ENST00000314425.5_Silent_p.T1244T	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1244					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CCCGAGGGGTGGTACACTTGC	0.582																																																	0													81.0	49.0	60.0					X																	70462090		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3732C>A	X.37:g.70462090G>T			D3DVV3|O15089|Q96E26	Silent	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.T1246	ENST00000353904.2	37	c.3738	CCDS14409.1	X																																																																																			ZMYM3	-	pfam_DUF3504	ENSG00000147130		0.582	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	106	0	G	NM_201599		70462090	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	silent	33.86	84	43	SNP	0.998	T
ZMYM3	9203	genome.wustl.edu	37	X	70462090	70462090	+	Silent	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chrX:70462090G>T	ENST00000353904.2	-	23	3919	c.3732C>A	c.(3730-3732)acC>acA	p.T1244T	ZMYM3_ENST00000373998.1_Silent_p.T1232T|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Silent_p.T1246T|ZMYM3_ENST00000373984.3_Intron|ZMYM3_ENST00000314425.5_Silent_p.T1244T	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1244					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CCCGAGGGGTGGTACACTTGC	0.582																																																	0													81.0	49.0	60.0					X																	70462090		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3732C>A	X.37:g.70462090G>T			D3DVV3|O15089|Q96E26	Silent	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.T1246	ENST00000353904.2	37	c.3738	CCDS14409.1	X																																																																																			ZMYM3	-	pfam_DUF3504	ENSG00000147130		0.582	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	131	0	G	NM_201599		70462090	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	silent	33.86	84	43	SNP	0.998	T
ZNF423	23090	genome.wustl.edu	37	16	49670652	49670652	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:49670652C>T	ENST00000561648.1	-	4	2464	c.2411G>A	c.(2410-2412)aGc>aAc	p.S804N	ZNF423_ENST00000567169.1_Missense_Mutation_p.S687N|ZNF423_ENST00000535559.1_Missense_Mutation_p.S687N|ZNF423_ENST00000562520.1_Missense_Mutation_p.S744N|ZNF423_ENST00000562871.1_Missense_Mutation_p.S744N|ZNF423_ENST00000262383.2_Missense_Mutation_p.S804N|ZNF423_ENST00000563137.2_Missense_Mutation_p.S744N	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	804					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ATACTTCTTGCTGTGTGTGGT	0.572																																																	0													194.0	187.0	189.0					16																	49670652		2198	4300	6498	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2411G>A	16.37:g.49670652C>T	ENSP00000455426:p.Ser804Asn		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S804N	ENST00000561648.1	37	c.2411	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062308	0.76187	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.28255	1.62;1.62	4.81	4.81	0.61882	Zinc finger, C2H2 (1);	0.080279	0.85682	D	0.000000	T	0.41949	0.1181	N	0.25286	0.73	0.58432	D	0.99999	D	0.76494	0.999	D	0.78314	0.991	T	0.27157	-1.0082	9	.	.	.	-32.3298	17.8857	0.88854	0.0:1.0:0.0:0.0	.	804	Q2M1K9	ZN423_HUMAN	N	804;687	ENSP00000262383:S804N;ENSP00000442321:S687N	.	S	-	2	0	ZNF423	48228153	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.234000	0.73211	0.561000	0.74099	AGC	ZNF423	-	pfscan_Znf_C2H2	ENSG00000102935		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	13	0	C	NM_015069		49670652	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	T
ZNF423	23090	genome.wustl.edu	37	16	49670652	49670652	+	Missense_Mutation	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:49670652C>T	ENST00000561648.1	-	4	2464	c.2411G>A	c.(2410-2412)aGc>aAc	p.S804N	ZNF423_ENST00000567169.1_Missense_Mutation_p.S687N|ZNF423_ENST00000535559.1_Missense_Mutation_p.S687N|ZNF423_ENST00000562520.1_Missense_Mutation_p.S744N|ZNF423_ENST00000562871.1_Missense_Mutation_p.S744N|ZNF423_ENST00000262383.2_Missense_Mutation_p.S804N|ZNF423_ENST00000563137.2_Missense_Mutation_p.S744N	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	804					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				ATACTTCTTGCTGTGTGTGGT	0.572																																																	0													194.0	187.0	189.0					16																	49670652		2198	4300	6498	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2411G>A	16.37:g.49670652C>T	ENSP00000455426:p.Ser804Asn		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S804N	ENST00000561648.1	37	c.2411	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062308	0.76187	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.28255	1.62;1.62	4.81	4.81	0.61882	Zinc finger, C2H2 (1);	0.080279	0.85682	D	0.000000	T	0.41949	0.1181	N	0.25286	0.73	0.58432	D	0.99999	D	0.76494	0.999	D	0.78314	0.991	T	0.27157	-1.0082	9	.	.	.	-32.3298	17.8857	0.88854	0.0:1.0:0.0:0.0	.	804	Q2M1K9	ZN423_HUMAN	N	804;687	ENSP00000262383:S804N;ENSP00000442321:S687N	.	S	-	2	0	ZNF423	48228153	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.234000	0.73211	0.561000	0.74099	AGC	ZNF423	-	pfscan_Znf_C2H2	ENSG00000102935		0.572	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	27	0	C	NM_015069		49670652	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	T
ZNF441	126068	genome.wustl.edu	37	19	11889180	11889180	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:11889180C>A	ENST00000357901.4	+	3	268	c.166C>A	c.(166-168)Cag>Aag	p.Q56K	ZNF441_ENST00000454339.2_5'UTR	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGAAGAAGATCAGTACAAAGA	0.279																																																	0													59.0	52.0	54.0					19																	11889180		692	1591	2283	SO:0001583	missense	0			AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.166C>A	19.37:g.11889180C>A	ENSP00000350576:p.Gln56Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q56K	ENST00000357901.4	37	c.166	CCDS12266.2	19	.	.	.	.	.	.	.	.	.	.	g	3.376	-0.127393	0.06753	.	.	ENSG00000197044	ENST00000409902;ENST00000357901	T	0.05580	3.42	1.65	-3.12	0.05282	Krueppel-associated box (3);	.	.	.	.	T	0.02848	0.0085	N	0.12182	0.205	0.20196	N	0.999923	B	0.02656	0.0	B	0.01281	0.0	T	0.47005	-0.9150	9	0.19590	T	0.45	.	4.861	0.13583	0.227:0.3251:0.4479:0.0	.	56	Q8N8Z8	ZN441_HUMAN	K	12;56	ENSP00000350576:Q56K	ENSP00000350576:Q56K	Q	+	1	0	ZNF441	11750180	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.512000	0.06313	-0.619000	0.05648	-2.085000	0.00377	CAG	ZNF441	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197044		0.279	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF441	HGNC	protein_coding	OTTHUMT00000335273.3	-	0.00	65	0	C	NM_152355		11889180	+1	tier1	-	no_errors	ENST00000357901	ensembl	human	known	74_37	missense	29.89	61	26	SNP	0.002	A
ZNF644	84146	genome.wustl.edu	37	1	91487584	91487584	+	5'UTR	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:91487584G>C	ENST00000337393.5	-	0	186				ZNF644_ENST00000361321.5_5'UTR|ZNF644_ENST00000467231.1_5'Flank|ZNF644_ENST00000347275.5_5'Flank|ZNF644_ENST00000370440.1_5'Flank	NM_201269.2	NP_958357.1	Q9H582	ZN644_HUMAN	zinc finger protein 644						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGCGACGTTGGGAGCACGCGG	0.672																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000337393.5:c.-55C>G	1.37:g.91487584G>C			A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	RNA	SNP	-	NULL	ENST00000337393.5	37	NULL	CCDS731.1	1																																																																																			ZNF644	-	-	ENSG00000122482		0.672	ZNF644-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	-	0.00	105	0	G	NM_032186		91487584	-1	tier1	-	no_errors	ENST00000495966	ensembl	human	known	74_37	rna	27.12	86	32	SNP	1.000	C
ZNF644	84146	genome.wustl.edu	37	1	91487584	91487584	+	5'UTR	SNP	G	G	C			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:91487584G>C	ENST00000337393.5	-	0	186				ZNF644_ENST00000361321.5_5'UTR|ZNF644_ENST00000467231.1_5'Flank|ZNF644_ENST00000347275.5_5'Flank|ZNF644_ENST00000370440.1_5'Flank	NM_201269.2	NP_958357.1	Q9H582	ZN644_HUMAN	zinc finger protein 644						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGCGACGTTGGGAGCACGCGG	0.672																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000337393.5:c.-55C>G	1.37:g.91487584G>C			A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	RNA	SNP	-	NULL	ENST00000337393.5	37	NULL	CCDS731.1	1																																																																																			ZNF644	-	-	ENSG00000122482		0.672	ZNF644-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	-	0.00	67	0	G	NM_032186		91487584	-1	tier1	-	no_errors	ENST00000495966	ensembl	human	known	74_37	rna	27.12	86	32	SNP	1.000	C
ZNF496	84838	genome.wustl.edu	37	1	247464284	247464284	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:247464284G>A	ENST00000294753.4	-	9	1765	c.1301C>T	c.(1300-1302)cCg>cTg	p.P434L	ZNF496_ENST00000366498.2_Missense_Mutation_p.P470L|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	434					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GCACTCGTGCGGCTTCTCCTG	0.622																																																	0													62.0	63.0	63.0					1																	247464284		2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1301C>T	1.37:g.247464284G>A	ENSP00000294753:p.Pro434Leu		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P470L	ENST00000294753.4	37	c.1409	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093583	0.36952	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.17054	2.3;2.3	4.36	1.36	0.22044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.558719	0.16436	N	0.214494	T	0.18383	0.0441	M	0.85777	2.775	0.32751	N	0.506421	B;B	0.34255	0.178;0.445	B;B	0.19391	0.025;0.02	T	0.20672	-1.0268	10	0.87932	D	0	-17.2117	5.875	0.18824	0.1917:0.1641:0.6442:0.0	.	470;434	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	L	434;470	ENSP00000294753:P434L;ENSP00000355454:P470L	ENSP00000294753:P434L	P	-	2	0	ZNF496	245530907	1.000000	0.71417	0.327000	0.25402	0.956000	0.61745	3.866000	0.56040	0.541000	0.28827	0.655000	0.94253	CCG	ZNF496	-	pfscan_Znf_C2H2	ENSG00000162714		0.622	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	35	0	G	NM_032752		247464284	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	28.21	28	11	SNP	0.348	A
ZNF496	84838	genome.wustl.edu	37	1	247464284	247464284	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr1:247464284G>A	ENST00000294753.4	-	9	1765	c.1301C>T	c.(1300-1302)cCg>cTg	p.P434L	ZNF496_ENST00000366498.2_Missense_Mutation_p.P470L|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	434					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GCACTCGTGCGGCTTCTCCTG	0.622																																																	0													62.0	63.0	63.0					1																	247464284		2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1301C>T	1.37:g.247464284G>A	ENSP00000294753:p.Pro434Leu		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P470L	ENST00000294753.4	37	c.1409	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093583	0.36952	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.17054	2.3;2.3	4.36	1.36	0.22044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.558719	0.16436	N	0.214494	T	0.18383	0.0441	M	0.85777	2.775	0.32751	N	0.506421	B;B	0.34255	0.178;0.445	B;B	0.19391	0.025;0.02	T	0.20672	-1.0268	10	0.87932	D	0	-17.2117	5.875	0.18824	0.1917:0.1641:0.6442:0.0	.	470;434	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	L	434;470	ENSP00000294753:P434L;ENSP00000355454:P470L	ENSP00000294753:P434L	P	-	2	0	ZNF496	245530907	1.000000	0.71417	0.327000	0.25402	0.956000	0.61745	3.866000	0.56040	0.541000	0.28827	0.655000	0.94253	CCG	ZNF496	-	pfscan_Znf_C2H2	ENSG00000162714		0.622	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	43	0	G	NM_032752		247464284	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	28.21	28	11	SNP	0.348	A
ZNF664	144348	genome.wustl.edu	37	12	124497201	124497201	+	Silent	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr12:124497201C>A	ENST00000539644.1	+	6	2340	c.510C>A	c.(508-510)ccC>ccA	p.P170P	ZNF664_ENST00000538932.2_Silent_p.P170P|ZNF664_ENST00000337815.4_Silent_p.P170P|ZNF664_ENST00000392404.3_Silent_p.P170P|FAM101A_ENST00000545615.1_Intron			Q8N3J9	ZN664_HUMAN	zinc finger protein 664	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|skin(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		GAGAGAAACCCTATAAATGTT	0.502																																																	0													89.0	94.0	92.0					12																	124497201		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9257.1	12q24.31	2013-05-10			ENSG00000179195	ENSG00000179195		"""Zinc fingers, C2H2-type"""	25406	protein-coding gene	gene with protein product			"""zinc finger protein 176"""	ZNF176		12477932	Standard	NM_001204298		Approved	ZFOC1, DKFZp761B128	uc001uga.3	Q8N3J9	OTTHUMG00000168596	ENST00000539644.1:c.510C>A	12.37:g.124497201C>A			B3KP97|Q15914|Q3ZCQ7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P170	ENST00000539644.1	37	c.510	CCDS9257.1	12																																																																																			ZNF664	-	pfscan_Znf_C2H2	ENSG00000179195		0.502	ZNF664-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF664	HGNC	protein_coding	OTTHUMT00000400365.1		0.00	24	0	C	NM_152437		124497201	+1			no_errors	ENST00000337815	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.994	A
ZNF676	163223	genome.wustl.edu	37	19	22363008	22363008	+	Missense_Mutation	SNP	C	C	A	rs202153135		TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:22363008C>A	ENST00000397121.2	-	3	1828	c.1511G>T	c.(1510-1512)cGc>cTc	p.R504L		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ACATTTGTAGCGTTTCTCTCC	0.388																																																	0													64.0	69.0	67.0					19																	22363008		2162	4278	6440	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1511G>T	19.37:g.22363008C>A	ENSP00000380310:p.Arg504Leu		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R504L	ENST00000397121.2	37	c.1511	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	0.018	-1.482818	0.01027	.	.	ENSG00000196109	ENST00000397121	T	0.17213	2.29	0.81	-1.62	0.08372	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08670	0.0215	N	0.12961	0.28	0.21064	N	0.999797	B	0.09022	0.002	B	0.10450	0.005	T	0.28681	-1.0036	9	0.51188	T	0.08	.	4.9138	0.13835	0.0:0.2226:0.5595:0.2178	.	504	Q8N7Q3	ZN676_HUMAN	L	504	ENSP00000380310:R504L	ENSP00000380310:R504L	R	-	2	0	ZNF676	22154848	0.003000	0.15002	0.050000	0.19076	0.051000	0.14879	0.735000	0.26115	-1.275000	0.02417	-1.271000	0.01417	CGC	ZNF676	-	pfscan_Znf_C2H2	ENSG00000196109		0.388	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1		0.00	33	0	C	NM_001001411		22363008	-1			no_errors	ENST00000397121	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.515	A
ZNF729	100287226	genome.wustl.edu	37	19	22498307	22498307	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:22498307C>T	ENST00000601693.1	+	4	2206	c.2088C>T	c.(2086-2088)ttC>ttT	p.F696F	ZNF729_ENST00000357491.6_Silent_p.F696F			A6NN14	ZN729_HUMAN	zinc finger protein 729	696					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TTAGCCATTTCTCAGCCCTTA	0.363																																																	0																																										SO:0001819	synonymous_variant	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2088C>T	19.37:g.22498307C>T			M0QY45	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F696	ENST00000601693.1	37	c.2088	CCDS59368.1	19																																																																																			ZNF729	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.363	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	48	0	C	XM_496301		22498307	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	silent	18.75	39	9	SNP	0.000	T
ZNF729	100287226	genome.wustl.edu	37	19	22498307	22498307	+	Silent	SNP	C	C	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:22498307C>T	ENST00000601693.1	+	4	2206	c.2088C>T	c.(2086-2088)ttC>ttT	p.F696F	ZNF729_ENST00000357491.6_Silent_p.F696F			A6NN14	ZN729_HUMAN	zinc finger protein 729	696					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TTAGCCATTTCTCAGCCCTTA	0.363																																																	0																																										SO:0001819	synonymous_variant	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2088C>T	19.37:g.22498307C>T			M0QY45	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F696	ENST00000601693.1	37	c.2088	CCDS59368.1	19																																																																																			ZNF729	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.363	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	49	0	C	XM_496301		22498307	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	silent	18.75	39	9	SNP	0.000	T
ZNF784	147808	genome.wustl.edu	37	19	56133379	56133379	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56133379G>A	ENST00000325351.4	-	2	749	c.710C>T	c.(709-711)tCg>tTg	p.S237L	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	237					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GCTAAGCACCGAGGACTGGGT	0.662																																																	0													36.0	27.0	30.0					19																	56133379		2199	4296	6495	SO:0001583	missense	0			AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.710C>T	19.37:g.56133379G>A	ENSP00000320096:p.Ser237Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S237L	ENST00000325351.4	37	c.710	CCDS12930.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780434	0.70222	.	.	ENSG00000179922	ENST00000325351	T	0.07908	3.15	3.48	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36815	N	0.002382	T	0.16599	0.0399	M	0.69823	2.125	0.80722	D	1	D	0.57571	0.98	P	0.48089	0.566	T	0.05178	-1.0901	10	0.66056	D	0.02	-19.2156	14.9372	0.70967	0.0:0.0:1.0:0.0	.	237	Q8NCA9	ZN784_HUMAN	L	237	ENSP00000320096:S237L	ENSP00000320096:S237L	S	-	2	0	ZNF784	60825191	0.156000	0.22821	0.992000	0.48379	0.848000	0.48234	2.791000	0.47829	2.248000	0.74166	0.313000	0.20887	TCG	ZNF784	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179922		0.662	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF784	HGNC	protein_coding	OTTHUMT00000453355.2	-	0.00	21	0	G	NM_203374		56133379	-1	tier1	-	no_errors	ENST00000325351	ensembl	human	known	74_37	missense	28.12	22	9	SNP	0.797	A
ZNF784	147808	genome.wustl.edu	37	19	56133379	56133379	+	Missense_Mutation	SNP	G	G	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr19:56133379G>A	ENST00000325351.4	-	2	749	c.710C>T	c.(709-711)tCg>tTg	p.S237L	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	237					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GCTAAGCACCGAGGACTGGGT	0.662																																																	0													36.0	27.0	30.0					19																	56133379		2199	4296	6495	SO:0001583	missense	0			AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.710C>T	19.37:g.56133379G>A	ENSP00000320096:p.Ser237Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S237L	ENST00000325351.4	37	c.710	CCDS12930.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780434	0.70222	.	.	ENSG00000179922	ENST00000325351	T	0.07908	3.15	3.48	3.48	0.39840	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36815	N	0.002382	T	0.16599	0.0399	M	0.69823	2.125	0.80722	D	1	D	0.57571	0.98	P	0.48089	0.566	T	0.05178	-1.0901	10	0.66056	D	0.02	-19.2156	14.9372	0.70967	0.0:0.0:1.0:0.0	.	237	Q8NCA9	ZN784_HUMAN	L	237	ENSP00000320096:S237L	ENSP00000320096:S237L	S	-	2	0	ZNF784	60825191	0.156000	0.22821	0.992000	0.48379	0.848000	0.48234	2.791000	0.47829	2.248000	0.74166	0.313000	0.20887	TCG	ZNF784	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179922		0.662	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF784	HGNC	protein_coding	OTTHUMT00000453355.2	-	0.00	24	0	G	NM_203374		56133379	-1	tier1	-	no_errors	ENST00000325351	ensembl	human	known	74_37	missense	28.12	22	9	SNP	0.797	A
ZP2	7783	genome.wustl.edu	37	16	21212735	21212735	+	Missense_Mutation	SNP	G	G	T			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr16:21212735G>T	ENST00000574002.1	-	15	2131	c.1649C>A	c.(1648-1650)aCc>aAc	p.T550N	ZP2_ENST00000574091.1_Missense_Mutation_p.T541N|ZP2_ENST00000219593.4_Missense_Mutation_p.T550N|AF001550.7_ENST00000572747.1_RNA			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	550	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TGGATCCATGGTGGACGTCGC	0.507																																																	0													177.0	156.0	163.0					16																	21212735		2200	4300	6500	SO:0001583	missense	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1649C>A	16.37:g.21212735G>T	ENSP00000460971:p.Thr550Asn		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.T550N	ENST00000574002.1	37	c.1649	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	G	11.57	1.679258	0.29783	.	.	ENSG00000103310	ENST00000219593	D	0.83250	-1.7	5.31	3.3	0.37823	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.660209	0.14438	N	0.319576	T	0.80732	0.4679	L	0.54323	1.7	0.09310	N	1	P;B	0.37688	0.605;0.34	B;B	0.43018	0.405;0.215	T	0.69405	-0.5154	10	0.42905	T	0.14	-2.5764	7.8487	0.29442	0.1454:0.0:0.7226:0.132	.	541;550	Q4VAP1;Q05996	.;ZP2_HUMAN	N	550	ENSP00000219593:T550N	ENSP00000219593:T550N	T	-	2	0	ZP2	21120236	0.964000	0.33143	0.000000	0.03702	0.256000	0.26092	4.107000	0.57811	0.694000	0.31654	0.591000	0.81541	ACC	ZP2	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	ENSG00000103310		0.507	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	-	0.00	63	0	G			21212735	-1	tier1	-	no_errors	ENST00000219593	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.003	T
ZRANB3	84083	genome.wustl.edu	37	2	135960485	135960485	+	Missense_Mutation	SNP	C	C	A			TCGA-IC-A6RF-01A-13D-A33E-09	TCGA-IC-A6RF-10A-21D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b0c1770c-8e08-4a0b-a96f-374b66ca6ddf	1c18afec-20fc-4456-9a04-f65fce56e159	g.chr2:135960485C>A	ENST00000264159.6	-	20	3174	c.3058G>T	c.(3058-3060)Gat>Tat	p.D1020Y	ZRANB3_ENST00000536680.1_Missense_Mutation_p.D1018Y|ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Missense_Mutation_p.D1018Y	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	1020	Endonuclease activity.|HNH.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		TTGATGTGATCCACCTGCCAG	0.453																																																	0													76.0	75.0	75.0					2																	135960485		1953	4149	6102	SO:0001583	missense	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.3058G>T	2.37:g.135960485C>A	ENSP00000264159:p.Asp1020Tyr		B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1020Y	ENST00000264159.6	37	c.3058	CCDS46419.1	2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910701	0.92107	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.98633	-5.02;-5.04;-5.0	5.47	5.47	0.80525	HNH nuclease (1);HNH endonuclease (1);	0.000000	0.85682	D	0.000000	D	0.99560	0.9842	H	0.98276	4.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97782	1.0233	10	0.87932	D	0	-13.6926	19.3172	0.94220	0.0:1.0:0.0:0.0	.	1020;1018	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	Y	483;483;1018;1020;1018	ENSP00000383979:D1018Y;ENSP00000264159:D1020Y;ENSP00000441320:D1018Y	ENSP00000264159:D1020Y	D	-	1	0	ZRANB3	135676955	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.727000	0.84838	2.553000	0.86117	0.563000	0.77884	GAT	ZRANB3	-	pfam_HNH,smart_HNH_nuc	ENSG00000121988		0.453	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1		0.00	23	0	C	NM_032143		135960485	-1			no_errors	ENST00000264159	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
