#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACSS1	84532	genome.wustl.edu	37	20	24993469	24993469	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:24993469G>A	ENST00000323482.4	-	11	1765	c.1686C>T	c.(1684-1686)acC>acT	p.T562T	ACSS1_ENST00000432802.2_Intron|ACSS1_ENST00000484396.1_5'Flank|ACSS1_ENST00000537502.1_Silent_p.T479T|ACSS1_ENST00000542618.1_Silent_p.T441T	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	562					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAATCTCTGCGGTCCCCAGCC	0.597																																																	0													124.0	108.0	113.0					20																	24993469		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.1686C>T	20.37:g.24993469G>A			B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Silent	SNP	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	p.T562	ENST00000323482.4	37	c.1686	CCDS13167.1	20																																																																																			ACSS1	-	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	ENSG00000154930		0.597	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	-	0.00	48	0	G	NM_032501		24993469	-1	tier1	-	no_errors	ENST00000323482	ensembl	human	known	74_37	silent	10.00	117	13	SNP	0.035	A
ACSS1	84532	genome.wustl.edu	37	20	24993469	24993469	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:24993469G>A	ENST00000323482.4	-	11	1765	c.1686C>T	c.(1684-1686)acC>acT	p.T562T	ACSS1_ENST00000432802.2_Intron|ACSS1_ENST00000484396.1_5'Flank|ACSS1_ENST00000537502.1_Silent_p.T479T|ACSS1_ENST00000542618.1_Silent_p.T441T	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	562					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAATCTCTGCGGTCCCCAGCC	0.597																																																	0													124.0	108.0	113.0					20																	24993469		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.1686C>T	20.37:g.24993469G>A			B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Silent	SNP	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	p.T562	ENST00000323482.4	37	c.1686	CCDS13167.1	20																																																																																			ACSS1	-	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	ENSG00000154930		0.597	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	-	0.00	56	0	G	NM_032501		24993469	-1	tier1	-	no_errors	ENST00000323482	ensembl	human	known	74_37	silent	10.00	117	13	SNP	0.035	A
ACSS3	79611	genome.wustl.edu	37	12	81593158	81593158	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:81593158T>C	ENST00000548058.1	+	9	2199	c.1289T>C	c.(1288-1290)gTa>gCa	p.V430A	ACSS3_ENST00000548324.1_Missense_Mutation_p.V112A|ACSS3_ENST00000261206.3_Missense_Mutation_p.V429A			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	430						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CGATGTGATGTAGAGACCCTG	0.348																																																	0													85.0	80.0	82.0					12																	81593158		2203	4300	6503	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1289T>C	12.37:g.81593158T>C	ENSP00000449535:p.Val430Ala		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V430A	ENST00000548058.1	37	c.1289	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839499	0.71488	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.38240	1.15;1.15;1.15	6.05	6.05	0.98169	AMP-dependent synthetase/ligase (1);	0.116033	0.64402	D	0.000013	T	0.27967	0.0689	N	0.16307	0.4	0.48975	D	0.999738	B;P	0.42456	0.123;0.78	B;B	0.40602	0.047;0.334	T	0.09952	-1.0651	10	0.66056	D	0.02	-12.3785	15.5757	0.76380	0.0:0.0:0.0:1.0	.	112;430	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	A	430;429;112	ENSP00000449535:V430A;ENSP00000261206:V429A;ENSP00000448965:V112A	ENSP00000261206:V429A	V	+	2	0	ACSS3	80117289	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.256000	0.65468	2.320000	0.78422	0.528000	0.53228	GTA	ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.348	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	25	0	T	NM_024560		81593158	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	C
ACSS3	79611	genome.wustl.edu	37	12	81593158	81593158	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:81593158T>C	ENST00000548058.1	+	9	2199	c.1289T>C	c.(1288-1290)gTa>gCa	p.V430A	ACSS3_ENST00000548324.1_Missense_Mutation_p.V112A|ACSS3_ENST00000261206.3_Missense_Mutation_p.V429A			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	430						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CGATGTGATGTAGAGACCCTG	0.348																																																	0													85.0	80.0	82.0					12																	81593158		2203	4300	6503	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1289T>C	12.37:g.81593158T>C	ENSP00000449535:p.Val430Ala		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V430A	ENST00000548058.1	37	c.1289	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839499	0.71488	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.38240	1.15;1.15;1.15	6.05	6.05	0.98169	AMP-dependent synthetase/ligase (1);	0.116033	0.64402	D	0.000013	T	0.27967	0.0689	N	0.16307	0.4	0.48975	D	0.999738	B;P	0.42456	0.123;0.78	B;B	0.40602	0.047;0.334	T	0.09952	-1.0651	10	0.66056	D	0.02	-12.3785	15.5757	0.76380	0.0:0.0:0.0:1.0	.	112;430	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	A	430;429;112	ENSP00000449535:V430A;ENSP00000261206:V429A;ENSP00000448965:V112A	ENSP00000261206:V429A	V	+	2	0	ACSS3	80117289	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.256000	0.65468	2.320000	0.78422	0.528000	0.53228	GTA	ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.348	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	31	0	T	NM_024560		81593158	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	C
ADAMTSL1	92949	genome.wustl.edu	37	9	18775842	18775842	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:18775842G>A	ENST00000380548.4	+	18	2838	c.2499G>A	c.(2497-2499)ccG>ccA	p.P833P		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	833	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCCTGTGCCCGCCCCTGCCTT	0.567																																																	0													38.0	44.0	42.0					9																	18775842		1956	4138	6094	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2499G>A	9.37:g.18775842G>A			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P833	ENST00000380548.4	37	c.2499	CCDS47954.1	9																																																																																			ADAMTSL1	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.567	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	51	0	G			18775842	+1	tier1	-	no_errors	ENST00000380548	ensembl	human	novel	74_37	silent	27.27	39	15	SNP	0.013	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18775842	18775842	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:18775842G>A	ENST00000380548.4	+	18	2838	c.2499G>A	c.(2497-2499)ccG>ccA	p.P833P		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	833	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCCTGTGCCCGCCCCTGCCTT	0.567																																																	0													38.0	44.0	42.0					9																	18775842		1956	4138	6094	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2499G>A	9.37:g.18775842G>A			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P833	ENST00000380548.4	37	c.2499	CCDS47954.1	9																																																																																			ADAMTSL1	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.567	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	65	0	G			18775842	+1	tier1	-	no_errors	ENST00000380548	ensembl	human	novel	74_37	silent	27.27	39	15	SNP	0.013	A
ADCY10	55811	genome.wustl.edu	37	1	167805612	167805612	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:167805612C>T	ENST00000367851.4	-	23	3428	c.3244G>A	c.(3244-3246)Gac>Aac	p.D1082N	ADCY10_ENST00000367848.1_Missense_Mutation_p.D990N|ADCY10_ENST00000545172.1_Missense_Mutation_p.D929N	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1082					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAGGCTTTGTCATTTTCTCCC	0.423																																																	0													77.0	78.0	78.0					1																	167805612		2203	4300	6503	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3244G>A	1.37:g.167805612C>T	ENSP00000356825:p.Asp1082Asn		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.D1082N	ENST00000367851.4	37	c.3244	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	T	1.162	-0.643616	0.03531	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.78364	-1.17;-1.17;-1.17	5.26	0.0665	0.14362	.	1.080830	0.06992	N	0.821786	T	0.11665	0.0284	N	0.00162	-1.95	0.09310	N	1.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09907	-1.0653	9	0.05525	T	0.97	-4.1751	4.6297	0.12495	0.0:0.252:0.2994:0.4487	.	990;1082	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	N	929;1082;990	ENSP00000441992:D929N;ENSP00000356825:D1082N;ENSP00000356822:D990N	ENSP00000356822:D990N	D	-	1	0	ADCY10	166072236	0.759000	0.28416	0.610000	0.28997	0.752000	0.42762	0.052000	0.14163	-0.123000	0.11745	-0.269000	0.10298	GAC	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.423	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	14	0	C	NM_018417		167805612	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	57.89	8	11	SNP	0.003	T
ADCY10	55811	genome.wustl.edu	37	1	167805612	167805612	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:167805612C>T	ENST00000367851.4	-	23	3428	c.3244G>A	c.(3244-3246)Gac>Aac	p.D1082N	ADCY10_ENST00000367848.1_Missense_Mutation_p.D990N|ADCY10_ENST00000545172.1_Missense_Mutation_p.D929N	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1082					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAGGCTTTGTCATTTTCTCCC	0.423																																																	0													77.0	78.0	78.0					1																	167805612		2203	4300	6503	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3244G>A	1.37:g.167805612C>T	ENSP00000356825:p.Asp1082Asn		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.D1082N	ENST00000367851.4	37	c.3244	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	T	1.162	-0.643616	0.03531	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.78364	-1.17;-1.17;-1.17	5.26	0.0665	0.14362	.	1.080830	0.06992	N	0.821786	T	0.11665	0.0284	N	0.00162	-1.95	0.09310	N	1.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09907	-1.0653	9	0.05525	T	0.97	-4.1751	4.6297	0.12495	0.0:0.252:0.2994:0.4487	.	990;1082	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	N	929;1082;990	ENSP00000441992:D929N;ENSP00000356825:D1082N;ENSP00000356822:D990N	ENSP00000356822:D990N	D	-	1	0	ADCY10	166072236	0.759000	0.28416	0.610000	0.28997	0.752000	0.42762	0.052000	0.14163	-0.123000	0.11745	-0.269000	0.10298	GAC	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.423	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	27	0	C	NM_018417		167805612	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	57.89	8	11	SNP	0.003	T
AHNAK2	113146	genome.wustl.edu	37	14	105418612	105418612	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:105418612G>T	ENST00000333244.5	-	7	3295	c.3176C>A	c.(3175-3177)gCt>gAt	p.A1059D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1059						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACCTGGTCAGCCTGGACCTT	0.617																																																	0													99.0	110.0	106.0					14																	105418612		1958	4139	6097	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3176C>A	14.37:g.105418612G>T	ENSP00000353114:p.Ala1059Asp		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1059D	ENST00000333244.5	37	c.3176	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	11.04	1.522720	0.27211	.	.	ENSG00000185567	ENST00000333244	T	0.00691	5.84	3.35	0.638	0.17742	.	.	.	.	.	T	0.01489	0.0048	M	0.82193	2.58	0.09310	N	1	P	0.43701	0.815	B	0.42522	0.39	T	0.41893	-0.9483	9	0.34782	T	0.22	.	4.9141	0.13837	0.2228:0.3163:0.4609:0.0	.	1059	Q8IVF2	AHNK2_HUMAN	D	1059	ENSP00000353114:A1059D	ENSP00000353114:A1059D	A	-	2	0	AHNAK2	104489657	0.005000	0.15991	0.001000	0.08648	0.011000	0.07611	-0.737000	0.04877	0.493000	0.27837	0.491000	0.48974	GCT	AHNAK2	-	NULL	ENSG00000185567		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	91	0	G	NM_138420		105418612	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	9.52	114	12	SNP	0.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105418612	105418612	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:105418612G>T	ENST00000333244.5	-	7	3295	c.3176C>A	c.(3175-3177)gCt>gAt	p.A1059D	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1059						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CACCTGGTCAGCCTGGACCTT	0.617																																																	0													99.0	110.0	106.0					14																	105418612		1958	4139	6097	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3176C>A	14.37:g.105418612G>T	ENSP00000353114:p.Ala1059Asp		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1059D	ENST00000333244.5	37	c.3176	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	11.04	1.522720	0.27211	.	.	ENSG00000185567	ENST00000333244	T	0.00691	5.84	3.35	0.638	0.17742	.	.	.	.	.	T	0.01489	0.0048	M	0.82193	2.58	0.09310	N	1	P	0.43701	0.815	B	0.42522	0.39	T	0.41893	-0.9483	9	0.34782	T	0.22	.	4.9141	0.13837	0.2228:0.3163:0.4609:0.0	.	1059	Q8IVF2	AHNK2_HUMAN	D	1059	ENSP00000353114:A1059D	ENSP00000353114:A1059D	A	-	2	0	AHNAK2	104489657	0.005000	0.15991	0.001000	0.08648	0.011000	0.07611	-0.737000	0.04877	0.493000	0.27837	0.491000	0.48974	GCT	AHNAK2	-	NULL	ENSG00000185567		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	94	0	G	NM_138420		105418612	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	9.52	114	12	SNP	0.000	T
AK9	221264	genome.wustl.edu	37	6	109854548	109854548	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:109854548C>T	ENST00000424296.2	-	28	3552	c.3476G>A	c.(3475-3477)cGc>cAc	p.R1159H	AK9_ENST00000341338.6_Missense_Mutation_p.R238H|AK9_ENST00000355283.1_Missense_Mutation_p.R238H	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1159	Adenylate kinase 2.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										AGGAAGGAGGCGATCAAAAAT	0.383																																																	0													154.0	139.0	144.0					6																	109854548		2203	4300	6503	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3476G>A	6.37:g.109854548C>T	ENSP00000410186:p.Arg1159His		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1159H	ENST00000424296.2	37	c.3476	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.9|26.9	4.777801|4.777801	0.90195|0.90195	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000491875|ENST00000424296;ENST00000355283;ENST00000341338	.|D;D;D	.|0.87029	.|-2.2;-2.2;-2.2	5.16|5.16	5.16|5.16	0.70880|0.70880	.|ATPase, AAA+ type, core (1);	.|0.106561	.|0.64402	.|N	.|0.000003	D|D	0.93579|0.93579	0.7950|0.7950	M|M	0.85542|0.85542	2.76|2.76	0.40156|0.40156	D|D	0.977004|0.977004	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.999;1.0	D|D	0.93478|0.93478	0.6825|0.6825	5|9	.|.	.|.	.|.	.|.	19.0135|19.0135	0.92884|0.92884	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|238;1159	.|Q5TCS8-5;Q5TCS8	.|.;AKD1_HUMAN	T|H	94|1159;238;238	.|ENSP00000410186:R1159H;ENSP00000347431:R238H;ENSP00000344637:R238H	.|.	A|R	-|-	1|2	0|0	AKD1|AKD1	109961241|109961241	0.997000|0.997000	0.39634|0.39634	0.948000|0.948000	0.38648|0.38648	0.797000|0.797000	0.45037|0.45037	3.813000|3.813000	0.55636|0.55636	2.579000|2.579000	0.87056|0.87056	0.549000|0.549000	0.68633|0.68633	GCC|CGC	AK9	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000155085		0.383	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding		-	0.00	50	0	C	NM_001145128		109854548	-1	tier1	-	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	26.09	33	12	SNP	0.997	T
AK9	221264	genome.wustl.edu	37	6	109854548	109854548	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:109854548C>T	ENST00000424296.2	-	28	3552	c.3476G>A	c.(3475-3477)cGc>cAc	p.R1159H	AK9_ENST00000341338.6_Missense_Mutation_p.R238H|AK9_ENST00000355283.1_Missense_Mutation_p.R238H	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1159	Adenylate kinase 2.				ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										AGGAAGGAGGCGATCAAAAAT	0.383																																																	0													154.0	139.0	144.0					6																	109854548		2203	4300	6503	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3476G>A	6.37:g.109854548C>T	ENSP00000410186:p.Arg1159His		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1159H	ENST00000424296.2	37	c.3476	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.9|26.9	4.777801|4.777801	0.90195|0.90195	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000491875|ENST00000424296;ENST00000355283;ENST00000341338	.|D;D;D	.|0.87029	.|-2.2;-2.2;-2.2	5.16|5.16	5.16|5.16	0.70880|0.70880	.|ATPase, AAA+ type, core (1);	.|0.106561	.|0.64402	.|N	.|0.000003	D|D	0.93579|0.93579	0.7950|0.7950	M|M	0.85542|0.85542	2.76|2.76	0.40156|0.40156	D|D	0.977004|0.977004	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.999;1.0	D|D	0.93478|0.93478	0.6825|0.6825	5|9	.|.	.|.	.|.	.|.	19.0135|19.0135	0.92884|0.92884	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|238;1159	.|Q5TCS8-5;Q5TCS8	.|.;AKD1_HUMAN	T|H	94|1159;238;238	.|ENSP00000410186:R1159H;ENSP00000347431:R238H;ENSP00000344637:R238H	.|.	A|R	-|-	1|2	0|0	AKD1|AKD1	109961241|109961241	0.997000|0.997000	0.39634|0.39634	0.948000|0.948000	0.38648|0.38648	0.797000|0.797000	0.45037|0.45037	3.813000|3.813000	0.55636|0.55636	2.579000|2.579000	0.87056|0.87056	0.549000|0.549000	0.68633|0.68633	GCC|CGC	AK9	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000155085		0.383	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding		-	0.00	56	0	C	NM_001145128		109854548	-1	tier1	-	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	26.09	33	12	SNP	0.997	T
ANAPC2	29882	genome.wustl.edu	37	9	140070321	140070321	+	Intron	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:140070321C>T	ENST00000323927.2	-	11	1895				ANAPC2_ENST00000487917.1_5'UTR	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		ACGGGCAGCTCGGCTGCAGGG	0.697																																																	0																																										SO:0001627	intron_variant	0			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1891-32G>A	9.37:g.140070321C>T			Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	RNA	SNP	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																			ANAPC2	-	-	ENSG00000176248		0.697	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	HGNC	protein_coding	OTTHUMT00000055315.1	-	0.00	36	0	C	NM_013366		140070321	-1	tier1	-	no_errors	ENST00000487917	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.000	T
ANAPC2	29882	genome.wustl.edu	37	9	140070321	140070321	+	Intron	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:140070321C>T	ENST00000323927.2	-	11	1895				ANAPC2_ENST00000487917.1_5'UTR	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		ACGGGCAGCTCGGCTGCAGGG	0.697																																																	0																																										SO:0001627	intron_variant	0			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1891-32G>A	9.37:g.140070321C>T			Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	RNA	SNP	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																			ANAPC2	-	-	ENSG00000176248		0.697	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	HGNC	protein_coding	OTTHUMT00000055315.1	-	0.00	56	0	C	NM_013366		140070321	-1	tier1	-	no_errors	ENST00000487917	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.000	T
ANK3	288	genome.wustl.edu	37	10	61829891	61829891	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:61829891G>A	ENST00000280772.2	-	37	10939	c.10748C>T	c.(10747-10749)aCg>aTg	p.T3583M	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3583					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T3583M(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTGGCTGGCGTTGTATCAGG	0.488																																																	1	Substitution - Missense(1)	pancreas(1)											135.0	126.0	129.0					10																	61829891		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10748C>T	10.37:g.61829891G>A	ENSP00000280772:p.Thr3583Met		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.T3583M	ENST00000280772.2	37	c.10748	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666397	0.67814	.	.	ENSG00000151150	ENST00000280772	T	0.17528	2.27	5.77	5.77	0.91146	.	0.000000	0.43416	D	0.000572	T	0.39937	0.1097	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.06320	-1.0833	10	0.87932	D	0	.	19.9837	0.97340	0.0:0.0:1.0:0.0	.	3583	Q12955	ANK3_HUMAN	M	3583	ENSP00000280772:T3583M	ENSP00000280772:T3583M	T	-	2	0	ANK3	61499897	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.723000	0.93209	0.655000	0.94253	ACG	ANK3	-	NULL	ENSG00000151150		0.488	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	34	0	G	NM_020987		61829891	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	45.90	33	28	SNP	1.000	A
ANK3	288	genome.wustl.edu	37	10	61829891	61829891	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:61829891G>A	ENST00000280772.2	-	37	10939	c.10748C>T	c.(10747-10749)aCg>aTg	p.T3583M	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3583					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T3583M(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTGGCTGGCGTTGTATCAGG	0.488																																																	1	Substitution - Missense(1)	pancreas(1)											135.0	126.0	129.0					10																	61829891		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10748C>T	10.37:g.61829891G>A	ENSP00000280772:p.Thr3583Met		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.T3583M	ENST00000280772.2	37	c.10748	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666397	0.67814	.	.	ENSG00000151150	ENST00000280772	T	0.17528	2.27	5.77	5.77	0.91146	.	0.000000	0.43416	D	0.000572	T	0.39937	0.1097	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.06320	-1.0833	10	0.87932	D	0	.	19.9837	0.97340	0.0:0.0:1.0:0.0	.	3583	Q12955	ANK3_HUMAN	M	3583	ENSP00000280772:T3583M	ENSP00000280772:T3583M	T	-	2	0	ANK3	61499897	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.723000	0.93209	0.655000	0.94253	ACG	ANK3	-	NULL	ENSG00000151150		0.488	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	40	0	G	NM_020987		61829891	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	45.90	33	28	SNP	1.000	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015445	133015445	+	5'UTR	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:133015445C>G	ENST00000470729.1	-	0	97				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCACCAGCCTCCTTTCTCCCA	0.677																																																	0													42.0	43.0	43.0					2																	133015445		692	1591	2283	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1328G>C	2.37:g.133015445C>G			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	-	0.00	80	0	C	NR_027019		133015445	-1	tier1	-	no_errors	ENST00000470729	ensembl	human	known	74_37	rna	12.69	117	17	SNP	0.001	G
AOX1	316	genome.wustl.edu	37	2	201470309	201470309	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:201470309G>T	ENST00000374700.2	+	10	1106	c.865G>T	c.(865-867)Gat>Tat	p.D289Y		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	289	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AATTTCTCCTGATAGAATTGA	0.313																																																	0													84.0	91.0	89.0					2																	201470309		2203	4300	6503	SO:0001583	missense	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.865G>T	2.37:g.201470309G>T	ENSP00000363832:p.Asp289Tyr		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.D289Y	ENST00000374700.2	37	c.865	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	G	1.199	-0.633026	0.03584	.	.	ENSG00000138356	ENST00000374700	T	0.23147	1.92	5.92	4.11	0.48088	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);Molybdopterin dehydrogenase, FAD-binding (1);	0.338944	0.29830	N	0.011085	T	0.29288	0.0729	M	0.72894	2.215	0.09310	N	1	B	0.21309	0.054	B	0.32583	0.148	T	0.29150	-1.0021	10	0.41790	T	0.15	-20.1086	6.1633	0.20376	0.0665:0.2525:0.5501:0.1309	.	289	Q06278	ADO_HUMAN	Y	289	ENSP00000363832:D289Y	ENSP00000363832:D289Y	D	+	1	0	AOX1	201178554	0.001000	0.12720	0.308000	0.25141	0.013000	0.08279	1.092000	0.30927	0.830000	0.34757	-0.182000	0.12963	GAT	AOX1	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.313	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	46	0	G	NM_001159		201470309	+1	tier1	-	no_errors	ENST00000374700	ensembl	human	known	74_37	missense	21.54	51	14	SNP	0.059	T
AOX1	316	genome.wustl.edu	37	2	201470309	201470309	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:201470309G>T	ENST00000374700.2	+	10	1106	c.865G>T	c.(865-867)Gat>Tat	p.D289Y		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	289	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AATTTCTCCTGATAGAATTGA	0.313																																																	0													84.0	91.0	89.0					2																	201470309		2203	4300	6503	SO:0001583	missense	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.865G>T	2.37:g.201470309G>T	ENSP00000363832:p.Asp289Tyr		O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.D289Y	ENST00000374700.2	37	c.865	CCDS33360.1	2	.	.	.	.	.	.	.	.	.	.	G	1.199	-0.633026	0.03584	.	.	ENSG00000138356	ENST00000374700	T	0.23147	1.92	5.92	4.11	0.48088	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);Molybdopterin dehydrogenase, FAD-binding (1);	0.338944	0.29830	N	0.011085	T	0.29288	0.0729	M	0.72894	2.215	0.09310	N	1	B	0.21309	0.054	B	0.32583	0.148	T	0.29150	-1.0021	10	0.41790	T	0.15	-20.1086	6.1633	0.20376	0.0665:0.2525:0.5501:0.1309	.	289	Q06278	ADO_HUMAN	Y	289	ENSP00000363832:D289Y	ENSP00000363832:D289Y	D	+	1	0	AOX1	201178554	0.001000	0.12720	0.308000	0.25141	0.013000	0.08279	1.092000	0.30927	0.830000	0.34757	-0.182000	0.12963	GAT	AOX1	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.313	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	50	0	G	NM_001159		201470309	+1	tier1	-	no_errors	ENST00000374700	ensembl	human	known	74_37	missense	21.54	51	14	SNP	0.059	T
ARHGAP5	394	genome.wustl.edu	37	14	32561340	32561340	+	Missense_Mutation	SNP	G	G	A	rs78337553		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:32561340G>A	ENST00000345122.3	+	2	1780	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.E489K|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000433497.1_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	489	FF 4.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.E489K(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCCAAAGAAGAGTTTCAAGA	0.343																																					NSCLC(9;77 350 3443 29227 41353)												1	Substitution - Missense(1)	stomach(1)											60.0	61.0	61.0					14																	32561340		2203	4298	6501	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1465G>A	14.37:g.32561340G>A	ENSP00000371897:p.Glu489Lys		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.E489K	ENST00000345122.3	37	c.1465	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741262	0.69304	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	6.02	6.02	0.97574	FF domain (2);	0.044905	0.85682	D	0.000000	T	0.39009	0.1062	N	0.22421	0.69	0.80722	D	1	P;P	0.42296	0.734;0.775	P;P	0.52066	0.562;0.689	T	0.11060	-1.0603	10	0.62326	D	0.03	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	489;489	Q13017-2;Q13017	.;RHG05_HUMAN	K	489	ENSP00000452222:E489K;ENSP00000441692:E489K;ENSP00000371897:E489K;ENSP00000393307:E489K	ENSP00000371897:E489K	E	+	1	0	ARHGAP5	31631091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAG	ARHGAP5	-	pfam_FF_domain,superfamily_FF_domain,smart_FF_domain	ENSG00000100852		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	37	0	G	NM_001030055		32561340	+1	tier1	rs78337553	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	8.57	64	6	SNP	1.000	A
ARHGEF10	9639	genome.wustl.edu	37	8	1853763	1853763	+	Silent	SNP	C	C	T	rs146717173	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:1853763C>T	ENST00000398564.1	+	17	1923	c.1923C>T	c.(1921-1923)ctC>ctT	p.L641L	ARHGEF10_ENST00000520359.1_Silent_p.L578L|ARHGEF10_ENST00000518288.1_Silent_p.L640L|ARHGEF10_ENST00000349830.3_Silent_p.L616L|ARHGEF10_ENST00000262112.6_Silent_p.L641L			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	641					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GCCGATACCTCATTCGATCAG	0.423																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	196.0	190.0	192.0		1848	3.4	0.8	8	dbSNP_134	192	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ARHGEF10	NM_014629.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		616/1345	1853763	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1923C>T	8.37:g.1853763C>T			O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.L641	ENST00000398564.1	37	c.1923		8																																																																																			ARHGEF10	-	NULL	ENSG00000104728		0.423	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding		-	0.00	59	0	C			1853763	+1	tier1	rs146717173	no_errors	ENST00000398564	ensembl	human	known	74_37	silent	14.73	110	19	SNP	0.976	T
ARHGEF10	9639	genome.wustl.edu	37	8	1853763	1853763	+	Silent	SNP	C	C	T	rs146717173	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:1853763C>T	ENST00000398564.1	+	17	1923	c.1923C>T	c.(1921-1923)ctC>ctT	p.L641L	ARHGEF10_ENST00000520359.1_Silent_p.L578L|ARHGEF10_ENST00000518288.1_Silent_p.L640L|ARHGEF10_ENST00000349830.3_Silent_p.L616L|ARHGEF10_ENST00000262112.6_Silent_p.L641L			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	641					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GCCGATACCTCATTCGATCAG	0.423																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	196.0	190.0	192.0		1848	3.4	0.8	8	dbSNP_134	192	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ARHGEF10	NM_014629.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		616/1345	1853763	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1923C>T	8.37:g.1853763C>T			O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.L641	ENST00000398564.1	37	c.1923		8																																																																																			ARHGEF10	-	NULL	ENSG00000104728		0.423	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding		-	0.00	64	0	C			1853763	+1	tier1	rs146717173	no_errors	ENST00000398564	ensembl	human	known	74_37	silent	14.73	110	19	SNP	0.976	T
ARVCF	421	genome.wustl.edu	37	22	19958768	19958768	+	Missense_Mutation	SNP	C	C	T	rs72554700	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr22:19958768C>T	ENST00000263207.3	-	19	3163	c.2872G>A	c.(2872-2874)Gtt>Att	p.V958I	ARVCF_ENST00000344269.3_Missense_Mutation_p.V895I|ARVCF_ENST00000406522.1_Missense_Mutation_p.V889I|ARVCF_ENST00000401994.1_Missense_Mutation_p.V895I|ARVCF_ENST00000406259.1_Missense_Mutation_p.V952I	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	958					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CAGGAATCAACGGGCTGAGGC	0.652											OREG0026306	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0									ILE/VAL	1,4331		0,1,2165	188.0	117.0	141.0		2872	4.1	1.0	22	dbSNP_130	141	5,8499		0,5,4247	yes	missense	ARVCF	NM_001670.2	29	0,6,6412	TT,TC,CC		0.0588,0.0231,0.0467	possibly-damaging	958/963	19958768	6,12830	2166	4252	6418	SO:0001583	missense	0				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2872G>A	22.37:g.19958768C>T	ENSP00000263207:p.Val958Ile	737	B7WNV2	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V958I	ENST00000263207.3	37	c.2872	CCDS13771.1	22	.	.	.	.	.	.	.	.	.	.	c	24.4	4.523151	0.85600	2.31E-4	5.88E-4	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.70986	-0.53;-0.49;-0.49;-0.48;-0.53	4.07	4.07	0.47477	.	1.580110	0.04919	U	0.454665	T	0.67795	0.2931	L	0.48642	1.525	0.47407	D	0.999415	D	0.58268	0.982	B	0.41374	0.355	T	0.64351	-0.6428	9	.	.	.	-16.5562	13.6559	0.62338	0.0:1.0:0.0:0.0	.	958	O00192	ARVC_HUMAN	I	958;895;895;889;952	ENSP00000263207:V958I;ENSP00000342042:V895I;ENSP00000384341:V895I;ENSP00000384732:V889I;ENSP00000385444:V952I	.	V	-	1	0	ARVCF	18338768	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	3.273000	0.51623	2.288000	0.76882	0.450000	0.29827	GTT	ARVCF	-	NULL	ENSG00000099889		0.652	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARVCF	HGNC	protein_coding	OTTHUMT00000075314.5	-	0.00	31	0	C	NM_001670		19958768	-1	tier1	rs72554700	no_errors	ENST00000263207	ensembl	human	known	74_37	missense	18.37	40	9	SNP	0.998	T
ARVCF	421	genome.wustl.edu	37	22	19958768	19958768	+	Missense_Mutation	SNP	C	C	T	rs72554700	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr22:19958768C>T	ENST00000263207.3	-	19	3163	c.2872G>A	c.(2872-2874)Gtt>Att	p.V958I	ARVCF_ENST00000344269.3_Missense_Mutation_p.V895I|ARVCF_ENST00000406522.1_Missense_Mutation_p.V889I|ARVCF_ENST00000401994.1_Missense_Mutation_p.V895I|ARVCF_ENST00000406259.1_Missense_Mutation_p.V952I	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	958					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CAGGAATCAACGGGCTGAGGC	0.652											OREG0026306	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0									ILE/VAL	1,4331		0,1,2165	188.0	117.0	141.0		2872	4.1	1.0	22	dbSNP_130	141	5,8499		0,5,4247	yes	missense	ARVCF	NM_001670.2	29	0,6,6412	TT,TC,CC		0.0588,0.0231,0.0467	possibly-damaging	958/963	19958768	6,12830	2166	4252	6418	SO:0001583	missense	0				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2872G>A	22.37:g.19958768C>T	ENSP00000263207:p.Val958Ile	737	B7WNV2	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V958I	ENST00000263207.3	37	c.2872	CCDS13771.1	22	.	.	.	.	.	.	.	.	.	.	c	24.4	4.523151	0.85600	2.31E-4	5.88E-4	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.70986	-0.53;-0.49;-0.49;-0.48;-0.53	4.07	4.07	0.47477	.	1.580110	0.04919	U	0.454665	T	0.67795	0.2931	L	0.48642	1.525	0.47407	D	0.999415	D	0.58268	0.982	B	0.41374	0.355	T	0.64351	-0.6428	9	.	.	.	-16.5562	13.6559	0.62338	0.0:1.0:0.0:0.0	.	958	O00192	ARVC_HUMAN	I	958;895;895;889;952	ENSP00000263207:V958I;ENSP00000342042:V895I;ENSP00000384341:V895I;ENSP00000384732:V889I;ENSP00000385444:V952I	.	V	-	1	0	ARVCF	18338768	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	3.273000	0.51623	2.288000	0.76882	0.450000	0.29827	GTT	ARVCF	-	NULL	ENSG00000099889		0.652	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARVCF	HGNC	protein_coding	OTTHUMT00000075314.5	-	0.00	50	0	C	NM_001670		19958768	-1	tier1	rs72554700	no_errors	ENST00000263207	ensembl	human	known	74_37	missense	18.37	40	9	SNP	0.998	T
ATL3	25923	genome.wustl.edu	37	11	63426708	63426708	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:63426708G>T	ENST00000398868.3	-	2	339	c.63C>A	c.(61-63)agC>agA	p.S21R	RP11-697H9.2_ENST00000540307.1_RNA|ATL3_ENST00000535789.1_5'UTR|ATL3_ENST00000332645.4_Missense_Mutation_p.S73R|ATL3_ENST00000538786.1_Missense_Mutation_p.S3R	NM_015459.3	NP_056274.3	Q6DD88	ATLA3_HUMAN	atlastin GTPase 3	21					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.S21S(1)		endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	11						CAGGCTTGCTGCTCTCCATGG	0.388																																																	1	Substitution - coding silent(1)	ovary(1)											72.0	70.0	70.0					11																	63426708		1931	4136	6067	SO:0001583	missense	0				CCDS41663.1, CCDS73309.1	11q13.1	2008-09-17			ENSG00000184743	ENSG00000184743			24526	protein-coding gene	gene with protein product		609369				18270207	Standard	XM_005273891		Approved	DKFZP564J0863	uc001nxk.1	Q6DD88	OTTHUMG00000167854	ENST00000398868.3:c.63C>A	11.37:g.63426708G>T	ENSP00000381844:p.Ser21Arg		Q8N7W5|Q9H8Q5|Q9UFL1	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.S73R	ENST00000398868.3	37	c.219	CCDS41663.1	11	.	.	.	.	.	.	.	.	.	.	G	7.204	0.593985	0.13875	.	.	ENSG00000184743	ENST00000398868;ENST00000332645;ENST00000538786;ENST00000540699	T;T;T;T	0.80304	-1.24;-1.36;-1.25;0.96	5.82	-2.46	0.06461	.	0.200137	0.42420	D	0.000707	T	0.59770	0.2218	N	0.08118	0	0.09310	N	1	B;B	0.16802	0.019;0.0	B;B	0.12156	0.007;0.0	T	0.52815	-0.8525	10	0.87932	D	0	9.4695	12.0237	0.53358	0.5624:0.0:0.4376:0.0	.	73;21	F5GWF8;Q6DD88	.;ATLA3_HUMAN	R	21;73;3;73	ENSP00000381844:S21R;ENSP00000329034:S73R;ENSP00000437593:S3R;ENSP00000441842:S73R	ENSP00000329034:S73R	S	-	3	2	ATL3	63183284	0.000000	0.05858	0.001000	0.08648	0.992000	0.81027	-1.744000	0.01832	-0.481000	0.06792	0.655000	0.94253	AGC	ATL3	-	superfamily_P-loop_NTPase	ENSG00000184743		0.388	ATL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATL3	HGNC	protein_coding	OTTHUMT00000396637.1		0.00	35	0	G	NM_015459		63426708	-1			no_errors	ENST00000332645	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
ATP8A2	51761	genome.wustl.edu	37	13	26106431	26106431	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr13:26106431G>T	ENST00000381655.2	+	5	584	c.442G>T	c.(442-444)Gca>Tca	p.A148S	ATP8A2_ENST00000255283.8_Missense_Mutation_p.A108S	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	108					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GGCAGACAATGCAGTTAACAA	0.323																																																	0													95.0	83.0	86.0					13																	26106431		1820	4072	5892	SO:0001583	missense	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.442G>T	13.37:g.26106431G>T	ENSP00000371070:p.Ala148Ser		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.A148S	ENST00000381655.2	37	c.442	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052196	0.36181	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000381648	D;D	0.89123	-2.47;-2.47	5.73	4.77	0.60923	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.155915	0.56097	D	0.000033	T	0.81711	0.4880	L	0.35593	1.075	0.30859	N	0.733758	B;B;B	0.31383	0.242;0.321;0.033	B;B;B	0.36766	0.232;0.149;0.068	T	0.74876	-0.3515	10	0.19590	T	0.45	.	7.0021	0.24815	0.2552:0.0:0.7448:0.0	.	108;108;108	B7Z880;Q9NTI2-3;Q9NTI2	.;.;AT8A2_HUMAN	S	148;108;108	ENSP00000371070:A148S;ENSP00000255283:A108S	ENSP00000255283:A108S	A	+	1	0	ATP8A2	25004431	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.249000	0.51437	2.702000	0.92279	0.643000	0.83706	GCA	ATP8A2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000132932		0.323	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2		0.00	18	0	G	NM_016529		26106431	+1			no_errors	ENST00000381655	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
BBS10	79738	genome.wustl.edu	37	12	76741020	76741020	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:76741020G>T	ENST00000393262.3	-	2	828	c.745C>A	c.(745-747)Cgc>Agc	p.R249S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	249					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						TCTGCTGGGCGGTACACAGAA	0.423									Bardet-Biedl syndrome																																								0													75.0	65.0	69.0					12																	76741020		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.745C>A	12.37:g.76741020G>T	ENSP00000376946:p.Arg249Ser		Q96CW2|Q9H5D2	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.R249S	ENST00000393262.3	37	c.745	CCDS9014.2	12	.	.	.	.	.	.	.	.	.	.	g	12.05	1.822834	0.32237	.	.	ENSG00000179941	ENST00000393262	T	0.77489	-1.1	5.13	1.48	0.22813	.	0.186307	0.48286	D	0.000192	T	0.59487	0.2197	N	0.22421	0.69	0.22127	N	0.999348	B	0.02656	0.0	B	0.10450	0.005	T	0.39961	-0.9588	10	0.18710	T	0.47	-0.7116	8.7625	0.34683	0.7802:0.0:0.2198:0.0	.	249	Q8TAM1	BBS10_HUMAN	S	249	ENSP00000376946:R249S	ENSP00000376946:R249S	R	-	1	0	BBS10	75265151	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	2.436000	0.44819	0.156000	0.19299	-0.295000	0.09555	CGC	BBS10	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000179941		0.423	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS10	HGNC	protein_coding	OTTHUMT00000303983.2		0.00	19	0	G	NM_024685		76741020	-1			no_errors	ENST00000393262	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
BRD2	6046	genome.wustl.edu	37	6	32947844	32947844	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:32947844C>T	ENST00000374825.4	+	11	3782	c.2081C>T	c.(2080-2082)tCc>tTc	p.S694F	BRD2_ENST00000449085.2_Missense_Mutation_p.S647F|BRD2_ENST00000443797.2_Missense_Mutation_p.S574F|BRD2_ENST00000395289.2_Missense_Mutation_p.S729F|BRD2_ENST00000374831.4_Missense_Mutation_p.S694F|BRD2_ENST00000395287.1_Missense_Mutation_p.S729F	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	694	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CTCAAGCCATCCACACTTAGA	0.468																																																	0													76.0	77.0	77.0					6																	32947844		1509	2707	4216	SO:0001583	missense	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2081C>T	6.37:g.32947844C>T	ENSP00000363958:p.Ser694Phe		A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S729F	ENST00000374825.4	37	c.2186	CCDS4762.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.9|28.9	4.963192|4.963192	0.92791|0.92791	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.49139	.|0.79;0.79;0.79;0.79;0.79;0.79	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.49916	.|D	.|0.000131	T|T	0.69061|0.69061	0.3069|0.3069	M|M	0.87617|0.87617	2.895|2.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.998;0.995	.|D;D	.|0.78314	.|0.991;0.979	T|T	0.73467|0.73467	-0.3973|-0.3973	5|10	.|0.87932	.|D	.|0	-15.4865|-15.4865	16.9633|16.9633	0.86278|0.86278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|729;694	.|A2AAU0;P25440	.|.;BRD2_HUMAN	S|F	700|694;694;729;574;729;647	.|ENSP00000363958:S694F;ENSP00000363964:S694F;ENSP00000378704:S729F;ENSP00000413495:S574F;ENSP00000378702:S729F;ENSP00000409145:S647F	.|ENSP00000363958:S694F	P|S	+|+	1|2	0|0	BRD2|BRD2	33055822|33055822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.637000|7.637000	0.83313|0.83313	2.873000|2.873000	0.98535|0.98535	0.643000|0.643000	0.83706|0.83706	CCA|TCC	BRD2	-	NULL	ENSG00000204256		0.468	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	HGNC	protein_coding	OTTHUMT00000076503.2	-	0.00	19	0	C			32947844	+1	tier1	-	no_errors	ENST00000395289	ensembl	human	known	74_37	missense	34.78	15	8	SNP	1.000	T
BRD2	6046	genome.wustl.edu	37	6	32947844	32947844	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:32947844C>T	ENST00000374825.4	+	11	3782	c.2081C>T	c.(2080-2082)tCc>tTc	p.S694F	BRD2_ENST00000449085.2_Missense_Mutation_p.S647F|BRD2_ENST00000443797.2_Missense_Mutation_p.S574F|BRD2_ENST00000395289.2_Missense_Mutation_p.S729F|BRD2_ENST00000374831.4_Missense_Mutation_p.S694F|BRD2_ENST00000395287.1_Missense_Mutation_p.S729F	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	694	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CTCAAGCCATCCACACTTAGA	0.468																																																	0													76.0	77.0	77.0					6																	32947844		1509	2707	4216	SO:0001583	missense	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2081C>T	6.37:g.32947844C>T	ENSP00000363958:p.Ser694Phe		A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S729F	ENST00000374825.4	37	c.2186	CCDS4762.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.9|28.9	4.963192|4.963192	0.92791|0.92791	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.49139	.|0.79;0.79;0.79;0.79;0.79;0.79	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.49916	.|D	.|0.000131	T|T	0.69061|0.69061	0.3069|0.3069	M|M	0.87617|0.87617	2.895|2.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.998;0.995	.|D;D	.|0.78314	.|0.991;0.979	T|T	0.73467|0.73467	-0.3973|-0.3973	5|10	.|0.87932	.|D	.|0	-15.4865|-15.4865	16.9633|16.9633	0.86278|0.86278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|729;694	.|A2AAU0;P25440	.|.;BRD2_HUMAN	S|F	700|694;694;729;574;729;647	.|ENSP00000363958:S694F;ENSP00000363964:S694F;ENSP00000378704:S729F;ENSP00000413495:S574F;ENSP00000378702:S729F;ENSP00000409145:S647F	.|ENSP00000363958:S694F	P|S	+|+	1|2	0|0	BRD2|BRD2	33055822|33055822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.637000|7.637000	0.83313|0.83313	2.873000|2.873000	0.98535|0.98535	0.643000|0.643000	0.83706|0.83706	CCA|TCC	BRD2	-	NULL	ENSG00000204256		0.468	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	HGNC	protein_coding	OTTHUMT00000076503.2	-	0.00	29	0	C			32947844	+1	tier1	-	no_errors	ENST00000395289	ensembl	human	known	74_37	missense	34.78	15	8	SNP	1.000	T
LMNTD2	256329	genome.wustl.edu	37	11	556252	556252	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:556252G>A	ENST00000329451.3	-	10	1259	c.1197C>T	c.(1195-1197)ttC>ttT	p.F399F	RP11-496I9.1_ENST00000527620.1_RNA|RP11-496I9.1_ENST00000527113.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		399	LTD.									NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCGCTCCGGGAAGCCGCGCA	0.746																																																	0													6.0	8.0	7.0					11																	556252		1624	3033	4657	SO:0001819	synonymous_variant	0																														ENST00000329451.3:c.1197C>T	11.37:g.556252G>A				Silent	SNP	pfam_Lamin_tail_dom	p.F399	ENST00000329451.3	37	c.1197	CCDS7701.1	11																																																																																			C11orf35	-	pfam_Lamin_tail_dom	ENSG00000185522		0.746	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf35	HGNC	protein_coding	OTTHUMT00000254973.2	-	0.00	12	0	G			556252	-1	tier1	-	no_errors	ENST00000329451	ensembl	human	known	74_37	silent	23.08	20	6	SNP	0.913	A
C5orf60	285679	genome.wustl.edu	37	5	179069468	179069468	+	Missense_Mutation	SNP	A	A	G	rs62405726	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr5:179069468A>G	ENST00000448248.2	-	5	731	c.706T>C	c.(706-708)Tgg>Cgg	p.W236R	C5orf60_ENST00000506142.1_5'Flank	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	0	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						CCCTGCCTCCACCTGCCTGCA	0.572													a|||	2302	0.459665	0.2935	0.5548	5008	,	,		17330	0.6806		0.2753	False		,,,				2504	0.5787																0													60.0	54.0	56.0					5																	179069468		692	1589	2281	SO:0001583	missense	0			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.706T>C	5.37:g.179069468A>G	ENSP00000404583:p.Trp236Arg		A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	NULL	p.W236R	ENST00000448248.2	37	c.706	CCDS47353.1	5	.	.	.	.	.	.	.	.	.	.	a	0.017	-1.489861	0.01018	.	.	ENSG00000204661	ENST00000448248	T	0.19938	2.11	0.517	-1.03	0.10102	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.80722	P	0.0	D;D	0.58268	0.982;0.982	P;P	0.61592	0.891;0.891	T	0.25745	-1.0123	6	0.07175	T	0.84	.	.	.	.	rs62405726	240;236	A6NFR6-2;A6NFR6-4	.;.	R	236	ENSP00000404583:W236R	ENSP00000404583:W236R	W	-	1	0	C5orf60	179002074	0.006000	0.16342	0.002000	0.10522	0.006000	0.05464	0.475000	0.22164	-0.672000	0.05266	-0.967000	0.02615	TGG	C5orf60	-	NULL	ENSG00000204661		0.572	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf60	HGNC	protein_coding	OTTHUMT00000372148.2		0.00	94	0	A	NM_001142306		179069468	-1			no_errors	ENST00000448248	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.002	G
CAPS2	84698	genome.wustl.edu	37	12	75669885	75669885	+	3'UTR	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:75669885C>T	ENST00000409445.3	-	0	2008				RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409799.1_3'UTR|CAPS2_ENST00000409004.1_5'UTR	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2								calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TGATCAGAAACGAATACATCC	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.*138G>A	12.37:g.75669885C>T			Q6PH84|Q8N242|Q8NAY5	RNA	SNP	-	NULL	ENST00000409445.3	37	NULL	CCDS9008.2	12																																																																																			CAPS2	-	-	ENSG00000180881		0.348	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	-	0.00	30	0	C			75669885	-1	tier1	-	no_errors	ENST00000409004	ensembl	human	known	74_37	rna	37.84	23	14	SNP	0.000	T
CAPS2	84698	genome.wustl.edu	37	12	75669885	75669885	+	3'UTR	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:75669885C>T	ENST00000409445.3	-	0	2008				RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409799.1_3'UTR|CAPS2_ENST00000409004.1_5'UTR	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2								calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TGATCAGAAACGAATACATCC	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.*138G>A	12.37:g.75669885C>T			Q6PH84|Q8N242|Q8NAY5	RNA	SNP	-	NULL	ENST00000409445.3	37	NULL	CCDS9008.2	12																																																																																			CAPS2	-	-	ENSG00000180881		0.348	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	-	0.00	32	0	C			75669885	-1	tier1	-	no_errors	ENST00000409004	ensembl	human	known	74_37	rna	37.84	23	14	SNP	0.000	T
CCAR2	57805	genome.wustl.edu	37	8	22473699	22473699	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:22473699G>T	ENST00000308511.4	+	14	2032	c.1783G>T	c.(1783-1785)Gtc>Ttc	p.V595F	CCAR2_ENST00000389279.3_Missense_Mutation_p.V595F|CCAR2_ENST00000520861.1_Missense_Mutation_p.V270F|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	595					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										AGAGGAGGTGGTCAAGGAGCC	0.592																																																	0													95.0	95.0	95.0					8																	22473699		2203	4300	6503	SO:0001583	missense	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1783G>T	8.37:g.22473699G>T	ENSP00000310670:p.Val595Phe		A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold	p.V595F	ENST00000308511.4	37	c.1783	CCDS34863.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.89|13.89	2.370931|2.370931	0.42003|0.42003	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861|ENST00000520738	T;T;T|.	0.30182|.	1.54;1.54;1.54|.	5.54|5.54	2.74|2.74	0.32292|0.32292	.|.	0.609950|.	0.16459|.	N|.	0.213513|.	T|T	0.21962|0.21962	0.0529|0.0529	N|N	0.08118|0.08118	0|0	0.32284|0.32284	N|N	0.567201|0.567201	B;B|.	0.27117|.	0.168;0.031|.	B;B|.	0.30495|.	0.116;0.017|.	T|T	0.29640|0.29640	-1.0005|-1.0005	10|5	0.56958|.	D|.	0.05|.	-2.3646|-2.3646	7.7794|7.7794	0.29056|0.29056	0.0766:0.0:0.6345:0.2889|0.0766:0.0:0.6345:0.2889	.|.	270;595|.	G3V119;Q8N163|.	.;K1967_HUMAN|.	F|C	595;595;270|286	ENSP00000310670:V595F;ENSP00000373930:V595F;ENSP00000429773:V270F|.	ENSP00000310670:V595F|.	V|W	+|+	1|3	0|0	KIAA1967|KIAA1967	22529644|22529644	0.403000|0.403000	0.25319|0.25319	0.895000|0.895000	0.35142|0.35142	0.854000|0.854000	0.48673|0.48673	1.268000|1.268000	0.33062|0.33062	0.428000|0.428000	0.26173|0.26173	0.655000|0.655000	0.94253|0.94253	GTC|TGG	CCAR2	-	NULL	ENSG00000158941		0.592	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR2	HGNC	protein_coding	OTTHUMT00000375865.1		0.00	24	0	G	NM_021174		22473699	+1			no_errors	ENST00000308511	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.988	T
CCL20	6364	genome.wustl.edu	37	2	228680209	228680209	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:228680209G>T	ENST00000358813.4	+	2	174	c.116G>T	c.(115-117)cGt>cTt	p.R39L	CCL20_ENST00000473642.1_3'UTR|CCL20_ENST00000409189.3_Missense_Mutation_p.R38L			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20	39					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACACAGACCGTATTCTTCAT	0.368																																																	0													122.0	131.0	127.0					2																	228680209		2203	4300	6503	SO:0001583	missense	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.116G>T	2.37:g.228680209G>T	ENSP00000351671:p.Arg39Leu		Q53S51|Q99664	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R39L	ENST00000358813.4	37	c.116	CCDS2469.1	2	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785600	0.31593	.	.	ENSG00000115009	ENST00000409189;ENST00000358813	T;T	0.05925	3.37;3.37	4.74	-7.61	0.01299	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	2.082580	0.01863	N	0.036732	T	0.06554	0.0168	.	.	.	0.09310	N	1	B;B	0.32071	0.306;0.355	B;B	0.32805	0.095;0.153	T	0.22941	-1.0202	9	0.48119	T	0.1	8.4958	15.1427	0.72623	0.3105:0.0:0.6895:0.0	.	38;39	P78556-2;P78556	.;CCL20_HUMAN	L	38;39	ENSP00000386273:R38L;ENSP00000351671:R39L	ENSP00000351671:R39L	R	+	2	0	CCL20	228388453	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-3.934000	0.00331	-1.182000	0.02727	-0.455000	0.05494	CGT	CCL20	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000115009		0.368	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1	-	0.00	19	0	G	NM_004591		228680209	+1	tier1	-	no_errors	ENST00000358813	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.000	T
CCL20	6364	genome.wustl.edu	37	2	228680209	228680209	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:228680209G>T	ENST00000358813.4	+	2	174	c.116G>T	c.(115-117)cGt>cTt	p.R39L	CCL20_ENST00000473642.1_3'UTR|CCL20_ENST00000409189.3_Missense_Mutation_p.R38L			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20	39					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACACAGACCGTATTCTTCAT	0.368																																																	0													122.0	131.0	127.0					2																	228680209		2203	4300	6503	SO:0001583	missense	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.116G>T	2.37:g.228680209G>T	ENSP00000351671:p.Arg39Leu		Q53S51|Q99664	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R39L	ENST00000358813.4	37	c.116	CCDS2469.1	2	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785600	0.31593	.	.	ENSG00000115009	ENST00000409189;ENST00000358813	T;T	0.05925	3.37;3.37	4.74	-7.61	0.01299	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	2.082580	0.01863	N	0.036732	T	0.06554	0.0168	.	.	.	0.09310	N	1	B;B	0.32071	0.306;0.355	B;B	0.32805	0.095;0.153	T	0.22941	-1.0202	9	0.48119	T	0.1	8.4958	15.1427	0.72623	0.3105:0.0:0.6895:0.0	.	38;39	P78556-2;P78556	.;CCL20_HUMAN	L	38;39	ENSP00000386273:R38L;ENSP00000351671:R39L	ENSP00000351671:R39L	R	+	2	0	CCL20	228388453	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-3.934000	0.00331	-1.182000	0.02727	-0.455000	0.05494	CGT	CCL20	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000115009		0.368	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1	-	0.00	20	0	G	NM_004591		228680209	+1	tier1	-	no_errors	ENST00000358813	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.000	T
CDC27	996	genome.wustl.edu	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																																	0													44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P242S	ENST00000066544.3	37	c.724	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT	CDC27	-	NULL	ENSG00000004897		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	-	0.00	41	0	G			45234397	-1	tier1	rs7350908	no_errors	ENST00000531206	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	A
CDH19	28513	genome.wustl.edu	37	18	64172263	64172263	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:64172263T>C	ENST00000262150.2	-	12	2397	c.2105A>G	c.(2104-2106)aAg>aGg	p.K702R		NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TTCTTCGAGCTTTTCCAGAAT	0.502																																																	0													144.0	138.0	140.0					18																	64172263		2203	4300	6503	SO:0001583	missense	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2105A>G	18.37:g.64172263T>C	ENSP00000262150:p.Lys702Arg		O15098	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K702R	ENST00000262150.2	37	c.2105	CCDS11994.1	18	.	.	.	.	.	.	.	.	.	.	T	5.446	0.267423	0.10294	.	.	ENSG00000071991	ENST00000262150	T	0.76968	-1.06	5.19	5.19	0.71726	Cadherin, cytoplasmic domain (1);	0.049302	0.85682	D	0.000000	T	0.74137	0.3677	N	0.20483	0.58	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70876	-0.4753	10	0.02654	T	1	.	9.8268	0.40916	0.0:0.0771:0.0:0.9229	.	702	Q9H159	CAD19_HUMAN	R	702	ENSP00000262150:K702R	ENSP00000262150:K702R	K	-	2	0	CDH19	62323243	1.000000	0.71417	0.987000	0.45799	0.033000	0.12548	2.967000	0.49216	2.077000	0.62373	0.533000	0.62120	AAG	CDH19	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000071991		0.502	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000256219.1	-	0.00	27	0	T	NM_021153		64172263	-1	tier1	-	no_errors	ENST00000262150	ensembl	human	known	74_37	missense	10.71	50	6	SNP	1.000	C
CDH7	1005	genome.wustl.edu	37	18	63430217	63430217	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:63430217C>T	ENST00000397968.2	+	2	565	c.139C>T	c.(139-141)Cgc>Tgc	p.R47C	CDH7_ENST00000323011.3_Missense_Mutation_p.R47C|CDH7_ENST00000536984.2_Missense_Mutation_p.R47C	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	47					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R47C(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CCGGACCAAGCGCAGCTGGGT	0.478																																																	1	Substitution - Missense(1)	large_intestine(1)											97.0	91.0	93.0					18																	63430217		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.139C>T	18.37:g.63430217C>T	ENSP00000381058:p.Arg47Cys		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R47C	ENST00000397968.2	37	c.139	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067204	0.76301	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.00587	6.38;6.38;6.38	5.56	5.56	0.83823	.	0.117851	0.64402	D	0.000014	T	0.02727	0.0082	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	T	0.56733	-0.7930	10	0.87932	D	0	.	19.5386	0.95266	0.0:1.0:0.0:0.0	.	47;47	F5H5X9;Q9ULB5	.;CADH7_HUMAN	C	47	ENSP00000319166:R47C;ENSP00000443030:R47C;ENSP00000381058:R47C	ENSP00000319166:R47C	R	+	1	0	CDH7	61581197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.142000	0.58044	2.610000	0.88304	0.650000	0.86243	CGC	CDH7	-	NULL	ENSG00000081138		0.478	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	48	0	C	NM_033646		63430217	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	70.37	40	95	SNP	1.000	T
CDH7	1005	genome.wustl.edu	37	18	63430217	63430217	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:63430217C>T	ENST00000397968.2	+	2	565	c.139C>T	c.(139-141)Cgc>Tgc	p.R47C	CDH7_ENST00000323011.3_Missense_Mutation_p.R47C|CDH7_ENST00000536984.2_Missense_Mutation_p.R47C	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	47					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R47C(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CCGGACCAAGCGCAGCTGGGT	0.478																																																	1	Substitution - Missense(1)	large_intestine(1)											97.0	91.0	93.0					18																	63430217		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.139C>T	18.37:g.63430217C>T	ENSP00000381058:p.Arg47Cys		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R47C	ENST00000397968.2	37	c.139	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067204	0.76301	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.00587	6.38;6.38;6.38	5.56	5.56	0.83823	.	0.117851	0.64402	D	0.000014	T	0.02727	0.0082	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	T	0.56733	-0.7930	10	0.87932	D	0	.	19.5386	0.95266	0.0:1.0:0.0:0.0	.	47;47	F5H5X9;Q9ULB5	.;CADH7_HUMAN	C	47	ENSP00000319166:R47C;ENSP00000443030:R47C;ENSP00000381058:R47C	ENSP00000319166:R47C	R	+	1	0	CDH7	61581197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.142000	0.58044	2.610000	0.88304	0.650000	0.86243	CGC	CDH7	-	NULL	ENSG00000081138		0.478	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	-	0.00	64	0	C	NM_033646		63430217	+1	tier1	-	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	70.37	40	95	SNP	1.000	T
CDH19	28513	genome.wustl.edu	37	18	64211432	64211432	+	Silent	SNP	G	G	A	rs371022067		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:64211432G>A	ENST00000540086.1	-	7	1236	c.990C>T	c.(988-990)taC>taT	p.Y330Y	CDH19_ENST00000262150.2_Silent_p.Y330Y	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	438	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CTCTAATACCGTAGTGGTTCT	0.388																																																	0								G		0,4406		0,0,2203	127.0	114.0	119.0		990	-0.9	0.0	18		119	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	CDH19	NM_021153.2		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		330/773	64211432	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.990C>T	18.37:g.64211432G>A			O15098	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y330	ENST00000540086.1	37	c.990	CCDS59325.1	18																																																																																			CDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000071991		0.388	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	-	0.00	43	0	G	NM_021153		64211432	-1	tier1	-	no_errors	ENST00000262150	ensembl	human	known	74_37	silent	57.14	57	76	SNP	0.029	A
CDH19	28513	genome.wustl.edu	37	18	64211432	64211432	+	Silent	SNP	G	G	A	rs371022067		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:64211432G>A	ENST00000540086.1	-	7	1236	c.990C>T	c.(988-990)taC>taT	p.Y330Y	CDH19_ENST00000262150.2_Silent_p.Y330Y	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	438	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CTCTAATACCGTAGTGGTTCT	0.388																																																	0								G		0,4406		0,0,2203	127.0	114.0	119.0		990	-0.9	0.0	18		119	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	CDH19	NM_021153.2		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		330/773	64211432	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.990C>T	18.37:g.64211432G>A			O15098	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y330	ENST00000540086.1	37	c.990	CCDS59325.1	18																																																																																			CDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000071991		0.388	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	-	0.00	65	0	G	NM_021153		64211432	-1	tier1	-	no_errors	ENST00000262150	ensembl	human	known	74_37	silent	57.14	57	76	SNP	0.029	A
CDK13	8621	genome.wustl.edu	37	7	40027387	40027387	+	Silent	SNP	C	C	T	rs137937704		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:40027387C>T	ENST00000181839.4	+	2	2006	c.1401C>T	c.(1399-1401)gcC>gcT	p.A467A	CDK13_ENST00000340829.5_Silent_p.A467A	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	467					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						cagcaagagccgcagaagcag	0.498																																																	0								C	,	0,4406		0,0,2203	35.0	36.0	36.0		1401,1401	2.4	1.0	7	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CDK13	NM_003718.4,NM_031267.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	467/1513,467/1453	40027387	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1401C>T	7.37:g.40027387C>T			Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A467	ENST00000181839.4	37	c.1401	CCDS5461.1	7																																																																																			CDK13	-	NULL	ENSG00000065883		0.498	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	-	0.00	29	0	C	NM_003718		40027387	+1	tier1	rs137937704	no_errors	ENST00000181839	ensembl	human	known	74_37	silent	12.82	34	5	SNP	0.995	T
CDYL	9425	genome.wustl.edu	37	6	4954289	4954289	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:4954289G>A	ENST00000328908.5	+	9	1927	c.1796G>A	c.(1795-1797)tGa>tAa	p.*599*	CDYL_ENST00000343762.5_Silent_p.*413*|CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000397588.3_Silent_p.*545*|CDYL_ENST00000449732.2_Silent_p.*413*			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	0					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GATGAGTTCTGAGTGTCGGGC	0.567																																																	0													79.0	73.0	75.0					6																	4954289		2203	4300	6503	SO:0001819	synonymous_variant	0			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.1796G>A	6.37:g.4954289G>A			A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Silent	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.*599	ENST00000328908.5	37	c.1796		6																																																																																			CDYL	-	NULL	ENSG00000153046		0.567	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1		0.00	25	0	G	NM_004824		4954289	+1			no_errors	ENST00000328908	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.999	A
CEL	1056	genome.wustl.edu	37	9	135945988	135945988	+	Missense_Mutation	SNP	A	A	G	rs201074543	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:135945988A>G	ENST00000372080.4	+	10	1452	c.1436A>G	c.(1435-1437)cAa>cGa	p.Q479R	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	476					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TACCGGCCCCAAGACAGGACA	0.607													A|||	4	0.000798722	0.0	0.0058	5008	,	,		19512	0.0		0.0	False		,,,				2504	0.0																0													83.0	94.0	91.0					9																	135945988		1992	4156	6148	SO:0001583	missense	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1436A>G	9.37:g.135945988A>G	ENSP00000361151:p.Gln479Arg		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.Q479R	ENST00000372080.4	37	c.1436	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	A	10.08	1.253212	0.22965	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.66099	-0.19	5.69	4.52	0.55395	Carboxylesterase, type B (1);	0.353337	0.32785	N	0.005644	T	0.35364	0.0929	N	0.02315	-0.6	0.80722	D	1	B	0.23540	0.087	B	0.20184	0.028	T	0.13710	-1.0499	10	0.35671	T	0.21	.	11.3338	0.49492	0.8638:0.0:0.0:0.1362	.	476	P19835	CEL_HUMAN	R	479;478	ENSP00000361151:Q479R	ENSP00000304021:Q478R	Q	+	2	0	CEL	134935809	0.976000	0.34144	0.074000	0.20217	0.366000	0.29705	4.432000	0.59922	0.945000	0.37605	0.386000	0.25728	CAA	CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.607	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	-	0.00	43	0	A			135945988	+1	tier1	rs201074543	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	9.72	65	7	SNP	0.831	G
CHAF1A	10036	genome.wustl.edu	37	19	4423372	4423372	+	Missense_Mutation	SNP	C	C	T	rs573779621		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:4423372C>T	ENST00000301280.5	+	6	1389	c.1288C>T	c.(1288-1290)Cgg>Tgg	p.R430W		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	430	Arg/Glu/Lys-rich.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAAGAGAAACGGTTAAGAGA	0.498								Chromatin Structure																																									0													116.0	111.0	113.0					19																	4423372		2203	4300	6503	SO:0001583	missense	0			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1288C>T	19.37:g.4423372C>T	ENSP00000301280:p.Arg430Trp		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A	p.R430W	ENST00000301280.5	37	c.1288	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371332	0.61624	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.08193	3.12	4.69	4.69	0.59074	.	.	.	.	.	T	0.19485	0.0468	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01001	-1.1485	9	0.87932	D	0	-19.4484	15.1144	0.72388	0.0:1.0:0.0:0.0	.	430	Q13111	CAF1A_HUMAN	W	430	ENSP00000301280:R430W	ENSP00000301280:R430W	R	+	1	2	CHAF1A	4374372	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	3.426000	0.52778	2.318000	0.78349	0.561000	0.74099	CGG	CHAF1A	-	NULL	ENSG00000167670		0.498	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	-	0.00	23	0	C	NM_005483		4423372	+1	tier1	-	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	T
CHAF1A	10036	genome.wustl.edu	37	19	4423372	4423372	+	Missense_Mutation	SNP	C	C	T	rs573779621		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:4423372C>T	ENST00000301280.5	+	6	1389	c.1288C>T	c.(1288-1290)Cgg>Tgg	p.R430W		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	430	Arg/Glu/Lys-rich.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAAGAGAAACGGTTAAGAGA	0.498								Chromatin Structure																																									0													116.0	111.0	113.0					19																	4423372		2203	4300	6503	SO:0001583	missense	0			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1288C>T	19.37:g.4423372C>T	ENSP00000301280:p.Arg430Trp		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A	p.R430W	ENST00000301280.5	37	c.1288	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371332	0.61624	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.08193	3.12	4.69	4.69	0.59074	.	.	.	.	.	T	0.19485	0.0468	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01001	-1.1485	9	0.87932	D	0	-19.4484	15.1144	0.72388	0.0:1.0:0.0:0.0	.	430	Q13111	CAF1A_HUMAN	W	430	ENSP00000301280:R430W	ENSP00000301280:R430W	R	+	1	2	CHAF1A	4374372	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	3.426000	0.52778	2.318000	0.78349	0.561000	0.74099	CGG	CHAF1A	-	NULL	ENSG00000167670		0.498	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	-	0.00	34	0	C	NM_005483		4423372	+1	tier1	-	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	T
CHDC2	286464	genome.wustl.edu	37	X	36162682	36162682	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:36162682G>C	ENST00000313548.4	+	11	1451	c.1265G>C	c.(1264-1266)tGt>tCt	p.C422S		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	422	CH.					integral component of membrane (GO:0016021)											ttctaggtgtgtctgagggtg	0.428																																																	0													105.0	113.0	110.0					X																	36162682		2202	4300	6502	SO:0001583	missense	0			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1265G>C	X.37:g.36162682G>C	ENSP00000324767:p.Cys422Ser			Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain	p.C422S	ENST00000313548.4	37	c.1265	CCDS14238.1	X	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.944876	0.00479	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	0.559	-0.353	0.12594	.	6.375000	0.01639	U	0.023979	T	0.18045	0.0433	N	0.08118	0	0.09310	N	1	B	0.21688	0.059	B	0.16289	0.015	T	0.09122	-1.0689	8	0.19147	T	0.46	.	.	.	.	.	422	Q8N9S7	CX059_HUMAN	S	422	.	ENSP00000324767:C422S	C	+	2	0	CXorf59	36072603	0.351000	0.24887	0.052000	0.19188	0.050000	0.14768	-0.265000	0.08644	-0.263000	0.09378	-0.260000	0.10688	TGT	CHDC2	-	NULL	ENSG00000176034		0.428	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDC2	HGNC	protein_coding			0.00	25	0	G	NM_173695		36162682	+1			no_errors	ENST00000313548	ensembl	human	known	74_37	missense	18.75	26	6	SNP	0.050	C
CHSY1	22856	genome.wustl.edu	37	15	101718437	101718437	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:101718437G>C	ENST00000254190.3	-	3	2040	c.1565C>G	c.(1564-1566)tCg>tGg	p.S522W	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	522					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTCACTCTTCGACCCAGGGAG	0.443																																																	0													96.0	101.0	99.0					15																	101718437		2203	4300	6503	SO:0001583	missense	0			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1565C>G	15.37:g.101718437G>C	ENSP00000254190:p.Ser522Trp		Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.S522W	ENST00000254190.3	37	c.1565	CCDS10390.1	15	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207616	0.58343	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.35421	1.31	5.8	5.8	0.92144	.	0.067399	0.64402	D	0.000008	T	0.34861	0.0912	L	0.36672	1.1	0.80722	D	1	B	0.24576	0.106	B	0.26770	0.073	T	0.04855	-1.0922	10	0.37606	T	0.19	-17.3296	20.063	0.97692	0.0:0.0:1.0:0.0	.	522	Q86X52	CHSS1_HUMAN	W	522;250	ENSP00000254190:S522W	ENSP00000254190:S522W	S	-	2	0	CHSY1	99535960	1.000000	0.71417	0.041000	0.18516	0.821000	0.46438	9.622000	0.98378	2.735000	0.93741	0.655000	0.94253	TCG	CHSY1	-	pfam_Chond_GalNAc	ENSG00000131873		0.443	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY1	HGNC	protein_coding	OTTHUMT00000313624.1	-	0.00	30	0	G	NM_014918		101718437	-1	tier1	-	no_errors	ENST00000254190	ensembl	human	known	74_37	missense	20.00	40	10	SNP	0.872	C
CHSY1	22856	genome.wustl.edu	37	15	101718437	101718437	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:101718437G>C	ENST00000254190.3	-	3	2040	c.1565C>G	c.(1564-1566)tCg>tGg	p.S522W	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	522					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTCACTCTTCGACCCAGGGAG	0.443																																																	0													96.0	101.0	99.0					15																	101718437		2203	4300	6503	SO:0001583	missense	0			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1565C>G	15.37:g.101718437G>C	ENSP00000254190:p.Ser522Trp		Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.S522W	ENST00000254190.3	37	c.1565	CCDS10390.1	15	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207616	0.58343	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.35421	1.31	5.8	5.8	0.92144	.	0.067399	0.64402	D	0.000008	T	0.34861	0.0912	L	0.36672	1.1	0.80722	D	1	B	0.24576	0.106	B	0.26770	0.073	T	0.04855	-1.0922	10	0.37606	T	0.19	-17.3296	20.063	0.97692	0.0:0.0:1.0:0.0	.	522	Q86X52	CHSS1_HUMAN	W	522;250	ENSP00000254190:S522W	ENSP00000254190:S522W	S	-	2	0	CHSY1	99535960	1.000000	0.71417	0.041000	0.18516	0.821000	0.46438	9.622000	0.98378	2.735000	0.93741	0.655000	0.94253	TCG	CHSY1	-	pfam_Chond_GalNAc	ENSG00000131873		0.443	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY1	HGNC	protein_coding	OTTHUMT00000313624.1	-	0.00	31	0	G	NM_014918		101718437	-1	tier1	-	no_errors	ENST00000254190	ensembl	human	known	74_37	missense	20.00	40	10	SNP	0.872	C
COL6A3	1293	genome.wustl.edu	37	2	238280601	238280601	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:238280601G>A	ENST00000295550.4	-	9	4511	c.4059C>T	c.(4057-4059)gaC>gaT	p.D1353D	COL6A3_ENST00000346358.4_Silent_p.D1153D|COL6A3_ENST00000392003.2_Silent_p.D946D|COL6A3_ENST00000353578.4_Silent_p.D1147D|COL6A3_ENST00000392004.3_Silent_p.D1147D|COL6A3_ENST00000409809.1_Silent_p.D1147D|COL6A3_ENST00000347401.3_Silent_p.D1152D|COL6A3_ENST00000472056.1_Silent_p.D746D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1353	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.			DD -> VV (in Ref. 1; CAA36267). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCGCCGGGTCGTCCACCTCAT	0.612																																																	0													41.0	38.0	39.0					2																	238280601		2203	4300	6503	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4059C>T	2.37:g.238280601G>A			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.D1353	ENST00000295550.4	37	c.4059	CCDS33412.1	2																																																																																			COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	35	0	G	NM_004369		238280601	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	41.94	18	13	SNP	0.000	A
COL6A3	1293	genome.wustl.edu	37	2	238280601	238280601	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:238280601G>A	ENST00000295550.4	-	9	4511	c.4059C>T	c.(4057-4059)gaC>gaT	p.D1353D	COL6A3_ENST00000346358.4_Silent_p.D1153D|COL6A3_ENST00000392003.2_Silent_p.D946D|COL6A3_ENST00000353578.4_Silent_p.D1147D|COL6A3_ENST00000392004.3_Silent_p.D1147D|COL6A3_ENST00000409809.1_Silent_p.D1147D|COL6A3_ENST00000347401.3_Silent_p.D1152D|COL6A3_ENST00000472056.1_Silent_p.D746D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1353	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.			DD -> VV (in Ref. 1; CAA36267). {ECO:0000305}.	axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCGCCGGGTCGTCCACCTCAT	0.612																																																	0													41.0	38.0	39.0					2																	238280601		2203	4300	6503	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4059C>T	2.37:g.238280601G>A			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.D1353	ENST00000295550.4	37	c.4059	CCDS33412.1	2																																																																																			COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	39	0	G	NM_004369		238280601	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	41.94	18	13	SNP	0.000	A
COX8C	341947	genome.wustl.edu	37	14	93813699	93813699	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:93813699G>A	ENST00000342144.2	+	1	163	c.85G>A	c.(85-87)Gcc>Acc	p.A29T	UNC79_ENST00000256339.4_Intron	NM_182971.2	NP_892016.1	Q7Z4L0	COX8C_HUMAN	cytochrome c oxidase subunit VIIIC	29						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(1)|prostate(2)|skin(1)	5		all_cancers(154;0.083)		Epithelial(152;0.176)|all cancers(159;0.197)|COAD - Colon adenocarcinoma(157;0.202)		TCCCCGCTTCGCCCACTCGGG	0.756																																					GBM(134;630 1800 8342 13106 15419)												0													9.0	10.0	10.0					14																	93813699		2162	4150	6312	SO:0001583	missense	0			AY161004	CCDS9910.1	14q32.13	2011-07-04	2011-05-25			ENSG00000187581		"""Mitochondrial respiratory chain complex / Complex IV"""	24382	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit VIII isoform 3"""		"""cytochrome c oxidase subunit 8C"""			12909344	Standard	NM_182971		Approved	COX8-3	uc001ybt.1	Q7Z4L0		ENST00000342144.2:c.85G>A	14.37:g.93813699G>A	ENSP00000340568:p.Ala29Thr		Q495K7	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su8,superfamily_Cyt_c_oxidase_su8	p.A29T	ENST00000342144.2	37	c.85	CCDS9910.1	14	.	.	.	.	.	.	.	.	.	.	G	7.584	0.669319	0.14776	.	.	ENSG00000187581	ENST00000342144	.	.	.	2.6	-2.3	0.06785	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.09310	N	1	B	0.15719	0.014	B	0.16289	0.015	T	0.26430	-1.0103	7	0.62326	D	0.03	.	3.5519	0.07850	0.4705:0.2318:0.2978:0.0	.	29	Q7Z4L0	COX8C_HUMAN	T	29	.	ENSP00000340568:A29T	A	+	1	0	COX8C	92883452	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.535000	0.02210	-0.438000	0.07232	-0.361000	0.07541	GCC	COX8C	-	NULL	ENSG00000187581		0.756	COX8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX8C	HGNC	protein_coding	OTTHUMT00000412769.1	-	0.00	13	0	G	NM_182971		93813699	+1	tier1	-	no_errors	ENST00000342144	ensembl	human	known	74_37	missense	55.88	15	19	SNP	0.001	A
CSMD1	64478	genome.wustl.edu	37	8	2986325	2986326	+	5'UTR	INS	-	-	T	rs544200463	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:2986325_2986326insT	ENST00000523387.1	-	0	2570_2571				CSMD1_ENST00000520002.1_Intron|CSMD1_ENST00000537824.1_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCGAGTTTTTGTTTTTTTTTTA	0.332																																																	0																																										SO:0001623	5_prime_UTR_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000523387.1:c.-1419->A	8.37:g.2986335_2986335dupT			Q0H0J5|Q96QU9|Q96RM4	RNA	INS	-	NULL	ENST00000523387.1	37	NULL		8																																																																																			CSMD1	-	-	ENSG00000183117		0.332	CSMD1-007	KNOWN	basic	processed_transcript	CSMD1	HGNC	protein_coding	OTTHUMT00000374659.2		0.00	13	0	-	NM_033225		2986326	-1	tier1		no_errors	ENST00000523387	ensembl	human	known	74_37	rna	16.67	35	7	INS	0.000:0.001	T
CSMD1	64478	genome.wustl.edu	37	8	2986325	2986326	+	5'UTR	INS	-	-	T	rs544200463	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:2986325_2986326insT	ENST00000523387.1	-	0	2570_2571				CSMD1_ENST00000520002.1_Intron|CSMD1_ENST00000537824.1_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCGAGTTTTTGTTTTTTTTTTA	0.332																																																	0																																										SO:0001623	5_prime_UTR_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000523387.1:c.-1419->A	8.37:g.2986335_2986335dupT			Q0H0J5|Q96QU9|Q96RM4	RNA	INS	-	NULL	ENST00000523387.1	37	NULL		8																																																																																			CSMD1	-	-	ENSG00000183117		0.332	CSMD1-007	KNOWN	basic	processed_transcript	CSMD1	HGNC	protein_coding	OTTHUMT00000374659.2		0.00	16	0	-	NM_033225		2986326	-1	tier1		no_errors	ENST00000523387	ensembl	human	known	74_37	rna	16.67	35	7	INS	0.000:0.001	T
CXorf67	340602	genome.wustl.edu	37	X	51150911	51150911	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:51150911G>A	ENST00000342995.2	+	1	1145	c.1043G>A	c.(1042-1044)cGt>cAt	p.R348H				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	348	Ser-rich.									breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						CTCCGGAGCCGTTCCACCCAG	0.637																																																	0													32.0	27.0	28.0					X																	51150911		2203	4297	6500	SO:0001583	missense	0			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1043G>A	X.37:g.51150911G>A	ENSP00000342680:p.Arg348His			Missense_Mutation	SNP	NULL	p.R348H	ENST00000342995.2	37	c.1043		X	.	.	.	.	.	.	.	.	.	.	g	2.141	-0.396690	0.04899	.	.	ENSG00000187690	ENST00000342995	T	0.46063	0.88	3.42	-1.53	0.08611	.	2.314440	0.02051	N	0.050035	T	0.26484	0.0647	.	.	.	0.09310	N	1	B	0.20261	0.043	B	0.12837	0.008	T	0.07849	-1.0751	9	0.30078	T	0.28	-0.0472	4.3754	0.11269	0.3978:0.0:0.4499:0.1524	.	348	Q86X51	CX067_HUMAN	H	348	ENSP00000342680:R348H	ENSP00000342680:R348H	R	+	2	0	CXorf67	51167651	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.557000	0.06126	-0.855000	0.03028	CGT	CXorf67	-	NULL	ENSG00000187690		0.637	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	CXorf67	HGNC	protein_coding		-	0.00	104	0	G	NM_203407		51150911	+1	tier1	-	no_errors	ENST00000342995	ensembl	human	known	74_37	missense	10.58	92	11	SNP	0.000	A
CXorf67	340602	genome.wustl.edu	37	X	51150911	51150911	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:51150911G>A	ENST00000342995.2	+	1	1145	c.1043G>A	c.(1042-1044)cGt>cAt	p.R348H				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	348	Ser-rich.									breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						CTCCGGAGCCGTTCCACCCAG	0.637																																																	0													32.0	27.0	28.0					X																	51150911		2203	4297	6500	SO:0001583	missense	0			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1043G>A	X.37:g.51150911G>A	ENSP00000342680:p.Arg348His			Missense_Mutation	SNP	NULL	p.R348H	ENST00000342995.2	37	c.1043		X	.	.	.	.	.	.	.	.	.	.	g	2.141	-0.396690	0.04899	.	.	ENSG00000187690	ENST00000342995	T	0.46063	0.88	3.42	-1.53	0.08611	.	2.314440	0.02051	N	0.050035	T	0.26484	0.0647	.	.	.	0.09310	N	1	B	0.20261	0.043	B	0.12837	0.008	T	0.07849	-1.0751	9	0.30078	T	0.28	-0.0472	4.3754	0.11269	0.3978:0.0:0.4499:0.1524	.	348	Q86X51	CX067_HUMAN	H	348	ENSP00000342680:R348H	ENSP00000342680:R348H	R	+	2	0	CXorf67	51167651	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.557000	0.06126	-0.855000	0.03028	CGT	CXorf67	-	NULL	ENSG00000187690		0.637	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	CXorf67	HGNC	protein_coding		-	0.00	83	0	G	NM_203407		51150911	+1	tier1	-	no_errors	ENST00000342995	ensembl	human	known	74_37	missense	10.58	92	11	SNP	0.000	A
DEFB124	245937	genome.wustl.edu	37	20	30060720	30060721	+	Intron	INS	-	-	CA	rs111402081|rs376204645|rs111977476|rs367856414|rs112525788|rs34150499		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:30060720_30060721insCA	ENST00000317676.2	-	1	58				DEFB124_ENST00000481595.1_5'UTR|REM1_ENST00000201979.2_5'Flank	NM_001037500.1	NP_001032589.1	Q8NES8	DB124_HUMAN	defensin, beta 124						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)						Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			Gcacacatgtgcacacacacac	0.52																																																	0																																										SO:0001627	intron_variant	0			DQ119827	CCDS33457.1	20q11.1	2008-07-17			ENSG00000180383	ENSG00000180383		"""Defensins, beta"""	18104	protein-coding gene	gene with protein product	"""defensin, beta 24"""					11854508, 16033865	Standard	NM_001037500		Approved	DEFB-24	uc002wvz.1	Q8NES8	OTTHUMG00000159287	ENST00000317676.2:c.58+37->TG	20.37:g.30060729_30060730dupCA			Q30E74	RNA	INS	-	NULL	ENST00000317676.2	37	NULL	CCDS33457.1	20																																																																																			DEFB124	-	-	ENSG00000180383		0.520	DEFB124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB124	HGNC	protein_coding	OTTHUMT00000354416.1		0.00	8	0	-	NM_001037500		30060721	-1	tier1		no_errors	ENST00000481595	ensembl	human	known	74_37	rna	42.86	16	12	INS	0.259:0.435	CA
DMRTC1	63947	genome.wustl.edu	37	X	72094776	72094776	+	Missense_Mutation	SNP	G	G	A	rs200698413		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:72094776G>A	ENST00000373529.5	-	3	419	c.140C>T	c.(139-141)gCt>gTt	p.A47V	DMRTC1_ENST00000290273.5_Intron|DMRTC1_ENST00000373530.1_Intron	NM_033053.2	NP_149042.2	Q5HYR2	DMRTC_HUMAN	DMRT-like family C1	47					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)	2	Renal(35;0.156)					AAGCAGCAGAGCCCCTTGGGA	0.602													G|||	321	0.0850331	0.0779	0.0476	3775	,	,		10836	0.0208		0.1004	False		,,,				2504	0.0644																0													1.0	1.0	1.0					X																	72094776		297	1058	1355	SO:0001583	missense	0			AJ291670	CCDS35333.2	Xq13.2	2010-05-12			ENSG00000159123	ENSG00000269502			13910	protein-coding gene	gene with protein product		300878					Standard	NM_033053		Approved		uc004ebb.3	Q5HYR2	OTTHUMG00000021820	ENST00000373529.5:c.140C>T	X.37:g.72094776G>A	ENSP00000362629:p.Ala47Val		Q5HYR0|Q5U5K2|Q8N6L3|Q96SD3	Missense_Mutation	SNP	NULL	p.A47V	ENST00000373529.5	37	c.140	CCDS35333.2	X	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864893	0.32977	.	.	ENSG00000159123	ENST00000373529	.	.	.	2.32	1.44	0.22558	.	0.835608	0.09472	U	0.797592	T	0.25791	0.0628	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29852	-0.9998	6	0.30854	T	0.27	-2.249	4.3143	0.10986	0.2043:0.0:0.7957:0.0	.	.	.	.	V	47	.	ENSP00000362629:A47V	A	-	2	0	DMRTC1	72011501	0.000000	0.05858	0.001000	0.08648	0.956000	0.61745	0.146000	0.16180	0.409000	0.25649	0.429000	0.28392	GCT	DMRTC1	-	NULL	ENSG00000159123		0.602	DMRTC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC1	HGNC	protein_coding	OTTHUMT00000057216.3	-	0.00	9	0	G	NM_033053		72094776	-1	tier1	rs200698413	no_errors	ENST00000373529	ensembl	human	known	74_37	missense	50.00	4	4	SNP	0.001	A
DIAPH2	1730	genome.wustl.edu	37	X	96013192	96013192	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:96013192C>T	ENST00000324765.8	+	4	729	c.382C>T	c.(382-384)Cga>Tga	p.R128*	DIAPH2_ENST00000355827.4_Nonsense_Mutation_p.R128*|DIAPH2_ENST00000373054.4_Nonsense_Mutation_p.R117*|DIAPH2_ENST00000373049.4_Nonsense_Mutation_p.R128*|DIAPH2_ENST00000373061.3_Nonsense_Mutation_p.R128*			O60879	DIAP2_HUMAN	diaphanous-related formin 2	128	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AGCTCCTTTACGAAACAAAGA	0.388																																																	0													114.0	92.0	100.0					X																	96013192		2203	4300	6503	SO:0001587	stop_gained	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.382C>T	X.37:g.96013192C>T	ENSP00000321348:p.Arg128*		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Nonsense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.R128*	ENST00000324765.8	37	c.382	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	C	42	9.194227	0.99096	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	.	.	.	5.73	4.85	0.62838	.	0.000000	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	13.422	0.61003	0.2842:0.7158:0.0:0.0	.	.	.	.	X	128;117;128;128;128;128	.	ENSP00000321348:R128X	R	+	1	2	DIAPH2	95899848	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.637000	0.54324	1.144000	0.42321	0.600000	0.82982	CGA	DIAPH2	-	pfam_GTPase-bd,superfamily_ARM-type_fold	ENSG00000147202		0.388	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	-	0.00	33	0	C	NM_006729, NM_007309		96013192	+1	tier1	-	no_errors	ENST00000324765	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
DIAPH2	1730	genome.wustl.edu	37	X	96013192	96013192	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:96013192C>T	ENST00000324765.8	+	4	729	c.382C>T	c.(382-384)Cga>Tga	p.R128*	DIAPH2_ENST00000355827.4_Nonsense_Mutation_p.R128*|DIAPH2_ENST00000373054.4_Nonsense_Mutation_p.R117*|DIAPH2_ENST00000373049.4_Nonsense_Mutation_p.R128*|DIAPH2_ENST00000373061.3_Nonsense_Mutation_p.R128*			O60879	DIAP2_HUMAN	diaphanous-related formin 2	128	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AGCTCCTTTACGAAACAAAGA	0.388																																																	0													114.0	92.0	100.0					X																	96013192		2203	4300	6503	SO:0001587	stop_gained	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.382C>T	X.37:g.96013192C>T	ENSP00000321348:p.Arg128*		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Nonsense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.R128*	ENST00000324765.8	37	c.382	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	C	42	9.194227	0.99096	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	.	.	.	5.73	4.85	0.62838	.	0.000000	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	13.422	0.61003	0.2842:0.7158:0.0:0.0	.	.	.	.	X	128;117;128;128;128;128	.	ENSP00000321348:R128X	R	+	1	2	DIAPH2	95899848	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	3.637000	0.54324	1.144000	0.42321	0.600000	0.82982	CGA	DIAPH2	-	pfam_GTPase-bd,superfamily_ARM-type_fold	ENSG00000147202		0.388	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	-	0.00	34	0	C	NM_006729, NM_007309		96013192	+1	tier1	-	no_errors	ENST00000324765	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124256179	124256179	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:124256179A>G	ENST00000409039.3	+	3	172	c.147A>G	c.(145-147)ctA>ctG	p.L49L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	49	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCGAATCTCTAGGCCAACCTC	0.423																																																	0													92.0	83.0	86.0					12																	124256179		1874	4098	5972	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.147A>G	12.37:g.124256179A>G			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.L49	ENST00000409039.3	37	c.147	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.423	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	24	0	A			124256179	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	silent	42.86	20	15	SNP	0.000	G
DNAH10	196385	genome.wustl.edu	37	12	124256179	124256179	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:124256179A>G	ENST00000409039.3	+	3	172	c.147A>G	c.(145-147)ctA>ctG	p.L49L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	49	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCGAATCTCTAGGCCAACCTC	0.423																																																	0													92.0	83.0	86.0					12																	124256179		1874	4098	5972	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.147A>G	12.37:g.124256179A>G			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.L49	ENST00000409039.3	37	c.147	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.423	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	25	0	A			124256179	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	silent	42.86	20	15	SNP	0.000	G
DNAJC12	56521	genome.wustl.edu	37	10	69571381	69571381	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:69571381C>T	ENST00000225171.2	-	3	350	c.198G>A	c.(196-198)ctG>ctA	p.L66L	DNAJC12_ENST00000339758.7_Silent_p.L66L|DNAJC12_ENST00000483798.2_Silent_p.L96L	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	66	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.									breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						CTTCATTGGTCAGAATCTCCT	0.468																																																	0													123.0	109.0	114.0					10																	69571381		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.198G>A	10.37:g.69571381C>T			Q5JVQ1|Q9UKB2	Silent	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.L66	ENST00000225171.2	37	c.198	CCDS7271.1	10																																																																																			DNAJC12	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	ENSG00000108176		0.468	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC12	HGNC	protein_coding	OTTHUMT00000048291.1	-	0.00	38	0	C	NM_021800		69571381	-1	tier1	-	no_errors	ENST00000225171	ensembl	human	known	74_37	silent	48.72	20	19	SNP	1.000	T
DNAJC12	56521	genome.wustl.edu	37	10	69571381	69571381	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:69571381C>T	ENST00000225171.2	-	3	350	c.198G>A	c.(196-198)ctG>ctA	p.L66L	DNAJC12_ENST00000339758.7_Silent_p.L66L|DNAJC12_ENST00000483798.2_Silent_p.L96L	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	66	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.									breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						CTTCATTGGTCAGAATCTCCT	0.468																																																	0													123.0	109.0	114.0					10																	69571381		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.198G>A	10.37:g.69571381C>T			Q5JVQ1|Q9UKB2	Silent	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.L66	ENST00000225171.2	37	c.198	CCDS7271.1	10																																																																																			DNAJC12	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	ENSG00000108176		0.468	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC12	HGNC	protein_coding	OTTHUMT00000048291.1	-	0.00	48	0	C	NM_021800		69571381	-1	tier1	-	no_errors	ENST00000225171	ensembl	human	known	74_37	silent	48.72	20	19	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102304262	102304264	+	RNA	DEL	GCT	GCT	-	rs56043818|rs373408686		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:102304262_102304264delGCT	ENST00000561463.1	+	0	12308_12310									DNM1 pseudogene 47																		TCTTCTCAGAGCTGCTGTCCAAC	0.581																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304265_102304267delGCT				RNA	DEL	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.581	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1		0.00	9	0	GCT	NG_009149		102304264	+1	tier1		no_errors	ENST00000561463	ensembl	human	known	74_37	rna	37.50	5	3	DEL	0.999:1.000:1.000	-
DPP6	1804	genome.wustl.edu	37	7	154681223	154681223	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:154681223G>A	ENST00000377770.3	+	25	2575	c.2434G>A	c.(2434-2436)Gct>Act	p.A812T	DPP6_ENST00000427557.1_Missense_Mutation_p.A705T|DPP6_ENST00000404039.1_Missense_Mutation_p.A748T|DPP6_ENST00000332007.3_Missense_Mutation_p.A750T			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	812					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TAGGGGAAAGGCTAATTACAG	0.388																																					NSCLC(125;1384 1783 2490 7422 34254)												0													90.0	83.0	85.0					7																	154681223		1912	4132	6044	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2434G>A	7.37:g.154681223G>A	ENSP00000367001:p.Ala812Thr			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.A812T	ENST00000377770.3	37	c.2434		7	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654541	0.29425	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.95	3.11	0.35812	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.161766	0.53938	N	0.000044	T	0.45377	0.1339	L	0.29908	0.895	0.53005	D	0.999964	P;P;D;P	0.60160	0.736;0.928;0.987;0.942	B;B;P;P	0.61477	0.445;0.397;0.889;0.677	T	0.32428	-0.9907	10	0.54805	T	0.06	-7.5027	9.5996	0.39596	0.0739:0.0:0.7753:0.1508	.	705;750;812;748	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	T	748;812;750;705	ENSP00000385578:A748T;ENSP00000367001:A812T;ENSP00000328226:A750T;ENSP00000397303:A705T	ENSP00000328226:A750T	A	+	1	0	DPP6	154312156	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	4.822000	0.62686	0.469000	0.27268	-1.131000	0.01979	GCT	DPP6	-	pfam_Peptidase_S9	ENSG00000130226		0.388	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	29	0	G	NM_130797		154681223	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
DPP6	1804	genome.wustl.edu	37	7	154681223	154681223	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:154681223G>A	ENST00000377770.3	+	25	2575	c.2434G>A	c.(2434-2436)Gct>Act	p.A812T	DPP6_ENST00000427557.1_Missense_Mutation_p.A705T|DPP6_ENST00000404039.1_Missense_Mutation_p.A748T|DPP6_ENST00000332007.3_Missense_Mutation_p.A750T			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	812					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TAGGGGAAAGGCTAATTACAG	0.388																																					NSCLC(125;1384 1783 2490 7422 34254)												0													90.0	83.0	85.0					7																	154681223		1912	4132	6044	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2434G>A	7.37:g.154681223G>A	ENSP00000367001:p.Ala812Thr			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.A812T	ENST00000377770.3	37	c.2434		7	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654541	0.29425	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.95	3.11	0.35812	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.161766	0.53938	N	0.000044	T	0.45377	0.1339	L	0.29908	0.895	0.53005	D	0.999964	P;P;D;P	0.60160	0.736;0.928;0.987;0.942	B;B;P;P	0.61477	0.445;0.397;0.889;0.677	T	0.32428	-0.9907	10	0.54805	T	0.06	-7.5027	9.5996	0.39596	0.0739:0.0:0.7753:0.1508	.	705;750;812;748	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	T	748;812;750;705	ENSP00000385578:A748T;ENSP00000367001:A812T;ENSP00000328226:A750T;ENSP00000397303:A705T	ENSP00000328226:A750T	A	+	1	0	DPP6	154312156	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	4.822000	0.62686	0.469000	0.27268	-1.131000	0.01979	GCT	DPP6	-	pfam_Peptidase_S9	ENSG00000130226		0.388	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	34	0	G	NM_130797		154681223	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
DSEL	92126	genome.wustl.edu	37	18	65181541	65181541	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:65181541G>C	ENST00000310045.7	-	2	1808	c.335C>G	c.(334-336)aCa>aGa	p.T112R	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	102					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TAGGTAGTATGTTGGGTTGGA	0.423																																																	0													129.0	111.0	117.0					18																	65181541		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.335C>G	18.37:g.65181541G>C	ENSP00000310565:p.Thr112Arg		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.T112R	ENST00000310045.7	37	c.335	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	6.781	0.513042	0.12944	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.42900	0.96	4.79	3.01	0.34805	.	0.486738	0.20937	U	0.082990	T	0.24928	0.0605	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.20955	0.032	T	0.17077	-1.0381	10	0.16420	T	0.52	-8.2867	9.4937	0.38976	0.2512:0.0:0.7488:0.0	.	102	Q8IZU8	DSEL_HUMAN	R	112;102	ENSP00000310565:T112R	ENSP00000310565:T112R	T	-	2	0	DSEL	63332521	0.907000	0.30839	0.001000	0.08648	0.742000	0.42306	4.419000	0.59835	0.576000	0.29452	0.561000	0.74099	ACA	DSEL	-	NULL	ENSG00000171451		0.423	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	43	0	G	NM_032160		65181541	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	11.32	94	12	SNP	0.014	C
DSEL	92126	genome.wustl.edu	37	18	65181541	65181541	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:65181541G>C	ENST00000310045.7	-	2	1808	c.335C>G	c.(334-336)aCa>aGa	p.T112R	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	102					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TAGGTAGTATGTTGGGTTGGA	0.423																																																	0													129.0	111.0	117.0					18																	65181541		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.335C>G	18.37:g.65181541G>C	ENSP00000310565:p.Thr112Arg		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.T112R	ENST00000310045.7	37	c.335	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	6.781	0.513042	0.12944	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.42900	0.96	4.79	3.01	0.34805	.	0.486738	0.20937	U	0.082990	T	0.24928	0.0605	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.20955	0.032	T	0.17077	-1.0381	10	0.16420	T	0.52	-8.2867	9.4937	0.38976	0.2512:0.0:0.7488:0.0	.	102	Q8IZU8	DSEL_HUMAN	R	112;102	ENSP00000310565:T112R	ENSP00000310565:T112R	T	-	2	0	DSEL	63332521	0.907000	0.30839	0.001000	0.08648	0.742000	0.42306	4.419000	0.59835	0.576000	0.29452	0.561000	0.74099	ACA	DSEL	-	NULL	ENSG00000171451		0.423	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	68	0	G	NM_032160		65181541	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	11.32	94	12	SNP	0.014	C
DST	667	genome.wustl.edu	37	6	56494092	56494092	+	Silent	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:56494092T>C	ENST00000361203.3	-	28	3805	c.3798A>G	c.(3796-3798)caA>caG	p.Q1266Q	DST_ENST00000421834.2_Silent_p.Q1266Q|DST_ENST00000370769.4_Silent_p.Q1266Q|DST_ENST00000446842.2_Silent_p.Q940Q|DST_ENST00000370765.6_Silent_p.Q940Q|DST_ENST00000312431.6_Silent_p.Q1266Q|DST_ENST00000370788.2_Silent_p.Q1266Q|DST_ENST00000370754.5_Silent_p.Q1444Q|DST_ENST00000518935.1_Silent_p.Q940Q|DST_ENST00000244364.6_Silent_p.Q940Q			Q03001	DYST_HUMAN	dystonin	1266					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTCAACTAATTGATCTGCTT	0.353																																																	0													288.0	239.0	256.0					6																	56494092		2203	4300	6503	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3798A>G	6.37:g.56494092T>C			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q1444	ENST00000361203.3	37	c.4332		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.353	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	63	0	T	NM_001723		56494092	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	49.33	38	37	SNP	0.988	C
DST	667	genome.wustl.edu	37	6	56494092	56494092	+	Silent	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:56494092T>C	ENST00000361203.3	-	28	3805	c.3798A>G	c.(3796-3798)caA>caG	p.Q1266Q	DST_ENST00000421834.2_Silent_p.Q1266Q|DST_ENST00000370769.4_Silent_p.Q1266Q|DST_ENST00000446842.2_Silent_p.Q940Q|DST_ENST00000370765.6_Silent_p.Q940Q|DST_ENST00000312431.6_Silent_p.Q1266Q|DST_ENST00000370788.2_Silent_p.Q1266Q|DST_ENST00000370754.5_Silent_p.Q1444Q|DST_ENST00000518935.1_Silent_p.Q940Q|DST_ENST00000244364.6_Silent_p.Q940Q			Q03001	DYST_HUMAN	dystonin	1266					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTCAACTAATTGATCTGCTT	0.353																																																	0													288.0	239.0	256.0					6																	56494092		2203	4300	6503	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3798A>G	6.37:g.56494092T>C			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q1444	ENST00000361203.3	37	c.4332		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.353	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	76	0	T	NM_001723		56494092	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	49.33	38	37	SNP	0.988	C
DUOXA2	405753	genome.wustl.edu	37	15	45406923	45406923	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:45406923C>T	ENST00000323030.5	+	1	405	c.120C>T	c.(118-120)ctC>ctT	p.L40L	DUOX2_ENST00000389039.6_5'Flank|DUOX2_ENST00000603300.1_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	40					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCTTCCTGCTCATCTTGCCGG	0.572																																																	0													144.0	129.0	134.0					15																	45406923		2198	4298	6496	SO:0001819	synonymous_variant	0			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.120C>T	15.37:g.45406923C>T			B2RPI9|H0YNQ6	Silent	SNP	pfam_Dual_oxidase_maturation_fac	p.L40	ENST00000323030.5	37	c.120	CCDS10118.2	15																																																																																			DUOXA2	-	pfam_Dual_oxidase_maturation_fac	ENSG00000140274		0.572	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	HGNC	protein_coding	OTTHUMT00000254142.1	-	0.00	76	0	C	NM_207581		45406923	+1	tier1	-	no_errors	ENST00000323030	ensembl	human	known	74_37	silent	17.28	67	14	SNP	1.000	T
DUOXA2	405753	genome.wustl.edu	37	15	45406923	45406923	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:45406923C>T	ENST00000323030.5	+	1	405	c.120C>T	c.(118-120)ctC>ctT	p.L40L	DUOX2_ENST00000389039.6_5'Flank|DUOX2_ENST00000603300.1_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	40					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCTTCCTGCTCATCTTGCCGG	0.572																																																	0													144.0	129.0	134.0					15																	45406923		2198	4298	6496	SO:0001819	synonymous_variant	0			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.120C>T	15.37:g.45406923C>T			B2RPI9|H0YNQ6	Silent	SNP	pfam_Dual_oxidase_maturation_fac	p.L40	ENST00000323030.5	37	c.120	CCDS10118.2	15																																																																																			DUOXA2	-	pfam_Dual_oxidase_maturation_fac	ENSG00000140274		0.572	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	HGNC	protein_coding	OTTHUMT00000254142.1	-	0.00	84	0	C	NM_207581		45406923	+1	tier1	-	no_errors	ENST00000323030	ensembl	human	known	74_37	silent	17.28	67	14	SNP	1.000	T
EIF4G3	8672	genome.wustl.edu	37	1	21191175	21191175	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:21191175G>T	ENST00000264211.8	-	16	2826	c.2632C>A	c.(2632-2634)Ctg>Atg	p.L878M	EIF4G3_ENST00000374935.3_Missense_Mutation_p.L598M|EIF4G3_ENST00000537738.1_Missense_Mutation_p.L368M|EIF4G3_ENST00000602326.1_Missense_Mutation_p.L884M|EIF4G3_ENST00000400422.1_Missense_Mutation_p.L878M|EIF4G3_ENST00000536266.1_Missense_Mutation_p.L482M|EIF4G3_ENST00000374937.3_Missense_Mutation_p.L884M	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	878	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.|eIF3/EIF4A-binding. {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GCTTCTTCCAGTTCATCATGA	0.428																																																	0													109.0	101.0	104.0					1																	21191175		2203	4300	6503	SO:0001583	missense	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2632C>A	1.37:g.21191175G>T	ENSP00000264211:p.Leu878Met		B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.L884M	ENST00000264211.8	37	c.2650	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951217	0.92660	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79	5.41	5.41	0.78517	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.64402	D	0.000002	T	0.57403	0.2051	M	0.82193	2.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.997;1.0;0.997	D;D;D;D;D	0.97110	1.0;1.0;0.993;0.999;0.995	T	0.63111	-0.6710	10	0.87932	D	0	-8.2482	19.2046	0.93724	0.0:0.0:1.0:0.0	.	1073;598;482;884;878	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	M	878;1074;878;598;368;884;482	ENSP00000264211:L878M;ENSP00000383274:L878M;ENSP00000364071:L598M;ENSP00000442010:L368M;ENSP00000364073:L884M;ENSP00000444693:L482M	ENSP00000264211:L878M	L	-	1	2	EIF4G3	21063762	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.705000	0.74644	2.548000	0.85928	0.585000	0.79938	CTG	EIF4G3	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000075151		0.428	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3		0.00	36	0	G	NM_003760		21191175	-1			no_errors	ENST00000374937	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
EIF5	1983	genome.wustl.edu	37	14	103804756	103804757	+	In_Frame_Ins	INS	-	-	CAC	rs148191276|rs548001106		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:103804756_103804757insCAC	ENST00000216554.3	+	7	1208_1209	c.532_533insCAC	c.(532-534)aca>aCACca	p.185_186insP	SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000392715.2_In_Frame_Ins_p.185_186insP|EIF5_ENST00000558506.1_In_Frame_Ins_p.185_186insP	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	185					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			CAGCAGTGAGAcaccaccacca	0.436																																																	0																																										SO:0001652	inframe_insertion	0			U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.551_553dupCAC	14.37:g.103804763_103804765dupCAC	ENSP00000216554:p.Pro185_Pro185dup		Q53XB3|Q9H5N2|Q9UG48	In_Frame_Ins	INS	pfam_Transl_init_fac_IF2/IF5,pfam_W2_domain,superfamily_ARM-type_fold,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5,smart_W2_domain	p.182in_frame_insP	ENST00000216554.3	37	c.532_533	CCDS9980.1	14																																																																																			EIF5	-	NULL	ENSG00000100664		0.436	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5	HGNC	protein_coding	OTTHUMT00000415329.2		0.00	11	0	-	NM_001969		103804757	+1	tier1		no_errors	ENST00000216554	ensembl	human	known	74_37	in_frame_ins	39.13	14	9	INS	1.000:1.000	CAC
PRKCZ	5590	genome.wustl.edu	37	1	2113691	2113691	+	Intron	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:2113691G>T	ENST00000400921.2	+	14	1709				RP11-181G12.2_ENST00000536678.1_RNA|RP11-181G12.2_ENST00000333854.2_RNA|PRKCZ_ENST00000400920.1_Intron|PRKCZ_ENST00000479263.1_Intron|RP11-181G12.2_ENST00000444529.1_RNA	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta						actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	CAGTGGAGTGGGGGGCTGCAC	0.592																																																	0																																										SO:0001627	intron_variant	0			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.1027-2331G>T	1.37:g.2113691G>T			A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	RNA	SNP	-	NULL	ENST00000400921.2	37	NULL	CCDS41229.1	1																																																																																			RP11-181G12.2	-	-	ENSG00000182873		0.592	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	ENSG00000182873	Clone_based_vega_gene	protein_coding	OTTHUMT00000098533.3	-	0.00	61	0	G	NM_002744		2113691	-1	tier1	-	no_errors	ENST00000333854	ensembl	human	known	74_37	rna	34.48	38	20	SNP	0.004	T
PRKCZ	5590	genome.wustl.edu	37	1	2113691	2113691	+	Intron	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:2113691G>T	ENST00000400921.2	+	14	1709				RP11-181G12.2_ENST00000536678.1_RNA|RP11-181G12.2_ENST00000333854.2_RNA|PRKCZ_ENST00000400920.1_Intron|PRKCZ_ENST00000479263.1_Intron|RP11-181G12.2_ENST00000444529.1_RNA	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta						actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	CAGTGGAGTGGGGGGCTGCAC	0.592																																																	0																																										SO:0001627	intron_variant	0			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.1027-2331G>T	1.37:g.2113691G>T			A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	RNA	SNP	-	NULL	ENST00000400921.2	37	NULL	CCDS41229.1	1																																																																																			RP11-181G12.2	-	-	ENSG00000182873		0.592	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	ENSG00000182873	Clone_based_vega_gene	protein_coding	OTTHUMT00000098533.3	-	0.00	64	0	G	NM_002744		2113691	-1	tier1	-	no_errors	ENST00000333854	ensembl	human	known	74_37	rna	34.48	38	20	SNP	0.004	T
RP11-159F24.2	0	genome.wustl.edu	37	5	43348816	43348817	+	RNA	INS	-	-	A	rs553054916|rs574591852|rs140799200	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr5:43348816_43348817insA	ENST00000511991.1	+	0	430_431																											ACCAAACTCTTAAAAAAAAAAA	0.337																																																	0																																												0																															5.37:g.43348827_43348827dupA				RNA	INS	-	NULL	ENST00000511991.1	37	NULL		5																																																																																			RP11-159F24.2	-	-	ENSG00000188850		0.337	RP11-159F24.2-001	KNOWN	basic	processed_transcript	ENSG00000188850	Clone_based_vega_gene	pseudogene	OTTHUMT00000367972.1		0.00	11	0	-			43348817	+1	tier1		no_errors	ENST00000511991	ensembl	human	known	74_37	rna	21.43	11	3	INS	0.001:0.000	A
Unknown	0	genome.wustl.edu	37	GL000205.1	117787	117787	+	IGR	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrGL000205.1:117787G>A								None (None upstream) : None (None downstream)																							GGCCTTTGCAGGATGGGATCG	0.567																																																	0																																										SO:0001628	intergenic_variant	0																															GL000205.1.37:g.117787G>A				Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_cat_dom	p.G140R		37	c.418		GL000205.1																																																																																			AC011841.1	-	NULL	ENSG00000212884	0	0.567					ENSG00000212884	Clone_based_ensembl_gene			-	0.00	83	0	G			117787	+1	tier1	-	no_errors	ENST00000391571	ensembl	human	known	74_37	missense	19.61	82	20	SNP	NULL	A
HEBP1	50865	genome.wustl.edu	37	12	13153388	13153388	+	5'Flank	SNP	G	G	T	rs147879664|rs77117939	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:13153388G>T	ENST00000014930.4	-	0	0				HEBP1_ENST00000536942.1_5'Flank|RP11-377D9.3_ENST00000543321.1_lincRNA	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1						circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		CGGgcagcagggcagcagtgc	0.746																																																	0																																										SO:0001631	upstream_gene_variant	0			AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771		12.37:g.13153388G>T	Exception_encountered		A8K1G2|Q9Y5Z5	RNA	SNP	-	NULL	ENST00000014930.4	37	NULL	CCDS31749.1	12																																																																																			RP11-377D9.3	-	-	ENSG00000255621		0.746	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255621	Clone_based_vega_gene	protein_coding	OTTHUMT00000401001.1	-	0.00	13	0	G			13153388	+1	tier1	rs77117939	no_errors	ENST00000543321	ensembl	human	known	74_37	rna	40.00	6	4	SNP	0.055	T
CCNYL1	151195	genome.wustl.edu	37	2	208619067	208619067	+	3'UTR	SNP	G	G	A	rs74909259		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:208619067G>A	ENST00000295414.3	+	0	1936				RP11-801F7.1_ENST00000609146.1_RNA|CCNYL1_ENST00000339882.5_3'UTR|CCNYL1_ENST00000392209.3_3'UTR|MIR4775_ENST00000581168.1_RNA			Q8N7R7	CCYL1_HUMAN	cyclin Y-like 1						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					endometrium(1)|large_intestine(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0731)|Epithelial(149;0.139)|Lung(261;0.14)		GTCATAAACAGAGGAAGTATC	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095479	CCDS2377.1, CCDS46503.1	2q33.3	2008-02-05			ENSG00000163249	ENSG00000163249			26868	protein-coding gene	gene with protein product							Standard	NM_152523		Approved	FLJ40432	uc002vci.3	Q8N7R7	OTTHUMG00000132946	ENST00000295414.3:c.*645G>A	2.37:g.208619067G>A			Q6NX60	RNA	SNP	-	NULL	ENST00000295414.3	37	NULL		2																																																																																			RP11-801F7.1	-	-	ENSG00000272851		0.328	CCNYL1-003	KNOWN	basic	protein_coding	ENSG00000272851	Clone_based_vega_gene	protein_coding	OTTHUMT00000337062.1	-	0.00	32	0	G	NM_152523		208619067	-1	tier1	rs74909259	no_errors	ENST00000609146	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.000	A
EPHA1-AS1	285965	genome.wustl.edu	37	7	143219877	143219877	+	RNA	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:143219877G>C	ENST00000429289.1	+	0	4353					NR_033897.1				EPHA1 antisense RNA 1																		CCAGACTGTAGATTGACTGGT	0.423																																																	0																																												0			AL833583		7q35	2012-10-12	2012-08-15		ENSG00000229153	ENSG00000229153		"""Long non-coding RNAs"""	27799	non-coding RNA	RNA, long non-coding			"""EPHA1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033897		Approved		uc003wda.4		OTTHUMG00000155893		7.37:g.143219877G>C				RNA	SNP	-	NULL	ENST00000429289.1	37	NULL		7																																																																																			EPHA1-AS1	-	-	ENSG00000229153		0.423	EPHA1-AS1-001	KNOWN	basic	antisense	EPHA1-AS1	HGNC	antisense	OTTHUMT00000342151.1	-	0.00	18	0	G	NR_033897		143219877	+1	tier1	-	no_errors	ENST00000429289	ensembl	human	known	74_37	rna	19.15	38	9	SNP	0.018	C
EPHA1-AS1	285965	genome.wustl.edu	37	7	143219877	143219877	+	RNA	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:143219877G>C	ENST00000429289.1	+	0	4353					NR_033897.1				EPHA1 antisense RNA 1																		CCAGACTGTAGATTGACTGGT	0.423																																																	0																																												0			AL833583		7q35	2012-10-12	2012-08-15		ENSG00000229153	ENSG00000229153		"""Long non-coding RNAs"""	27799	non-coding RNA	RNA, long non-coding			"""EPHA1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033897		Approved		uc003wda.4		OTTHUMG00000155893		7.37:g.143219877G>C				RNA	SNP	-	NULL	ENST00000429289.1	37	NULL		7																																																																																			EPHA1-AS1	-	-	ENSG00000229153		0.423	EPHA1-AS1-001	KNOWN	basic	antisense	EPHA1-AS1	HGNC	antisense	OTTHUMT00000342151.1	-	0.00	20	0	G	NR_033897		143219877	+1	tier1	-	no_errors	ENST00000429289	ensembl	human	known	74_37	rna	19.15	38	9	SNP	0.018	C
ERBB3	2065	genome.wustl.edu	37	12	56494025	56494025	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:56494025G>T	ENST00000267101.3	+	26	3637	c.3197G>T	c.(3196-3198)tGc>tTc	p.C1066F	ERBB3_ENST00000415288.2_Missense_Mutation_p.C1007F|ERBB3_ENST00000450146.2_Missense_Mutation_p.C423F|ERBB3_ENST00000549832.1_Missense_Mutation_p.C186F|RP11-603J24.9_ENST00000548861.1_5'Flank|ERBB3_ENST00000553131.1_Missense_Mutation_p.C307F	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1066					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GGGGAGTCTTGCCAGGTAAGT	0.433																																																	0													129.0	128.0	128.0					12																	56494025		2203	4300	6503	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3197G>T	12.37:g.56494025G>T	ENSP00000267101:p.Cys1066Phe		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C1066F	ENST00000267101.3	37	c.3197	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.880679	0.00532	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.77620	-0.98;-0.89;-0.98;-1.11;-0.84	5.53	-0.656	0.11436	.	0.809070	0.11242	N	0.584580	T	0.53384	0.1793	N	0.14661	0.345	0.09310	N	1	B;B;B	0.18461	0.019;0.028;0.003	B;B;B	0.12837	0.008;0.008;0.004	T	0.34204	-0.9838	10	0.10111	T	0.7	.	5.4626	0.16626	0.1174:0.4379:0.3324:0.1122	.	1007;186;1066	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	F	1066;423;1007;189;307;186	ENSP00000267101:C1066F;ENSP00000399178:C423F;ENSP00000408340:C1007F;ENSP00000449129:C307F;ENSP00000448729:C186F	ENSP00000267101:C1066F	C	+	2	0	ERBB3	54780292	0.966000	0.33281	0.010000	0.14722	0.046000	0.14306	1.911000	0.39937	-0.275000	0.09219	-0.820000	0.03113	TGC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000065361		0.433	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	-	0.00	31	0	G			56494025	+1	tier1	-	no_errors	ENST00000267101	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.002	T
ERBB3	2065	genome.wustl.edu	37	12	56494025	56494025	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:56494025G>T	ENST00000267101.3	+	26	3637	c.3197G>T	c.(3196-3198)tGc>tTc	p.C1066F	ERBB3_ENST00000415288.2_Missense_Mutation_p.C1007F|ERBB3_ENST00000450146.2_Missense_Mutation_p.C423F|ERBB3_ENST00000549832.1_Missense_Mutation_p.C186F|RP11-603J24.9_ENST00000548861.1_5'Flank|ERBB3_ENST00000553131.1_Missense_Mutation_p.C307F	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1066					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GGGGAGTCTTGCCAGGTAAGT	0.433																																																	0													129.0	128.0	128.0					12																	56494025		2203	4300	6503	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3197G>T	12.37:g.56494025G>T	ENSP00000267101:p.Cys1066Phe		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C1066F	ENST00000267101.3	37	c.3197	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.880679	0.00532	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.77620	-0.98;-0.89;-0.98;-1.11;-0.84	5.53	-0.656	0.11436	.	0.809070	0.11242	N	0.584580	T	0.53384	0.1793	N	0.14661	0.345	0.09310	N	1	B;B;B	0.18461	0.019;0.028;0.003	B;B;B	0.12837	0.008;0.008;0.004	T	0.34204	-0.9838	10	0.10111	T	0.7	.	5.4626	0.16626	0.1174:0.4379:0.3324:0.1122	.	1007;186;1066	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	F	1066;423;1007;189;307;186	ENSP00000267101:C1066F;ENSP00000399178:C423F;ENSP00000408340:C1007F;ENSP00000449129:C307F;ENSP00000448729:C186F	ENSP00000267101:C1066F	C	+	2	0	ERBB3	54780292	0.966000	0.33281	0.010000	0.14722	0.046000	0.14306	1.911000	0.39937	-0.275000	0.09219	-0.820000	0.03113	TGC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000065361		0.433	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	-	0.00	35	0	G			56494025	+1	tier1	-	no_errors	ENST00000267101	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.002	T
ESR2	2100	genome.wustl.edu	37	14	64727213	64727213	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:64727213G>A	ENST00000341099.4	-	5	1323	c.906C>T	c.(904-906)gcC>gcT	p.A302A	ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000542956.1_Silent_p.A302A|ESR2_ENST00000267525.6_Silent_p.A302A|ESR2_ENST00000358599.5_Silent_p.A302A|ESR2_ENST00000553796.1_Silent_p.A302A|ESR2_ENST00000357782.2_Silent_p.A302A|ESR2_ENST00000554572.1_Silent_p.A302A|ESR2_ENST00000555278.1_Silent_p.A302A|ESR2_ENST00000353772.3_Silent_p.A302A|ESR2_ENST00000557772.1_Silent_p.A302A	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	302	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A302A(2)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	ACTCCTTGTCGGCCAACTTGG	0.582																																																	2	Substitution - coding silent(2)	lung(2)											102.0	103.0	103.0					14																	64727213		2203	4300	6503	SO:0001819	synonymous_variant	0			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.906C>T	14.37:g.64727213G>A			A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A302	ENST00000341099.4	37	c.906	CCDS9762.1	14																																																																																			ESR2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000140009		0.582	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	HGNC	protein_coding	OTTHUMT00000280621.1	-	0.00	51	0	G			64727213	-1	tier1	-	no_errors	ENST00000341099	ensembl	human	known	74_37	silent	36.99	46	27	SNP	0.007	A
ESR2	2100	genome.wustl.edu	37	14	64727213	64727213	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:64727213G>A	ENST00000341099.4	-	5	1323	c.906C>T	c.(904-906)gcC>gcT	p.A302A	ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000542956.1_Silent_p.A302A|ESR2_ENST00000267525.6_Silent_p.A302A|ESR2_ENST00000358599.5_Silent_p.A302A|ESR2_ENST00000553796.1_Silent_p.A302A|ESR2_ENST00000357782.2_Silent_p.A302A|ESR2_ENST00000554572.1_Silent_p.A302A|ESR2_ENST00000555278.1_Silent_p.A302A|ESR2_ENST00000353772.3_Silent_p.A302A|ESR2_ENST00000557772.1_Silent_p.A302A	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	302	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.A302A(2)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	ACTCCTTGTCGGCCAACTTGG	0.582																																																	2	Substitution - coding silent(2)	lung(2)											102.0	103.0	103.0					14																	64727213		2203	4300	6503	SO:0001819	synonymous_variant	0			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.906C>T	14.37:g.64727213G>A			A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A302	ENST00000341099.4	37	c.906	CCDS9762.1	14																																																																																			ESR2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000140009		0.582	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	HGNC	protein_coding	OTTHUMT00000280621.1	-	0.00	77	0	G			64727213	-1	tier1	-	no_errors	ENST00000341099	ensembl	human	known	74_37	silent	36.99	46	27	SNP	0.007	A
FAM126B	285172	genome.wustl.edu	37	2	201846546	201846546	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:201846546G>A	ENST00000418596.3	-	12	1227	c.1040C>T	c.(1039-1041)gCa>gTa	p.A347V	AC005037.3_ENST00000332935.6_RNA|AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	347						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						TCCTTCATCTGCATCATTCAG	0.443																																																	0													78.0	77.0	77.0					2																	201846546		2203	4300	6503	SO:0001583	missense	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.1040C>T	2.37:g.201846546G>A	ENSP00000393667:p.Ala347Val		B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	pfam_Hyccin	p.A347V	ENST00000418596.3	37	c.1040	CCDS2335.1	2	.	.	.	.	.	.	.	.	.	.	G	6.499	0.460327	0.12342	.	.	ENSG00000155744	ENST00000418596	T	0.76316	-1.01	5.86	5.86	0.93980	.	0.053051	0.85682	D	0.000000	T	0.60573	0.2279	N	0.04508	-0.205	0.58432	D	0.999999	P;P	0.47762	0.9;0.759	B;B	0.42214	0.38;0.259	T	0.62253	-0.6893	10	0.10377	T	0.69	-16.2935	20.2019	0.98263	0.0:0.0:1.0:0.0	.	153;347	B3KUG1;Q8IXS8	.;F126B_HUMAN	V	347	ENSP00000393667:A347V	ENSP00000393667:A347V	A	-	2	0	FAM126B	201554791	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.188000	0.94921	2.776000	0.95493	0.655000	0.94253	GCA	FAM126B	-	NULL	ENSG00000155744		0.443	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	-	0.00	19	0	G	NM_173822		201846546	-1	tier1	-	no_errors	ENST00000418596	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	A
FAM126B	285172	genome.wustl.edu	37	2	201846546	201846546	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:201846546G>A	ENST00000418596.3	-	12	1227	c.1040C>T	c.(1039-1041)gCa>gTa	p.A347V	AC005037.3_ENST00000332935.6_RNA|AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	347						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						TCCTTCATCTGCATCATTCAG	0.443																																																	0													78.0	77.0	77.0					2																	201846546		2203	4300	6503	SO:0001583	missense	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.1040C>T	2.37:g.201846546G>A	ENSP00000393667:p.Ala347Val		B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	pfam_Hyccin	p.A347V	ENST00000418596.3	37	c.1040	CCDS2335.1	2	.	.	.	.	.	.	.	.	.	.	G	6.499	0.460327	0.12342	.	.	ENSG00000155744	ENST00000418596	T	0.76316	-1.01	5.86	5.86	0.93980	.	0.053051	0.85682	D	0.000000	T	0.60573	0.2279	N	0.04508	-0.205	0.58432	D	0.999999	P;P	0.47762	0.9;0.759	B;B	0.42214	0.38;0.259	T	0.62253	-0.6893	10	0.10377	T	0.69	-16.2935	20.2019	0.98263	0.0:0.0:1.0:0.0	.	153;347	B3KUG1;Q8IXS8	.;F126B_HUMAN	V	347	ENSP00000393667:A347V	ENSP00000393667:A347V	A	-	2	0	FAM126B	201554791	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.188000	0.94921	2.776000	0.95493	0.655000	0.94253	GCA	FAM126B	-	NULL	ENSG00000155744		0.443	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	-	0.00	25	0	G	NM_173822		201846546	-1	tier1	-	no_errors	ENST00000418596	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	A
AC026369.1	0	genome.wustl.edu	37	12	148078	148078	+	IGR	SNP	G	G	A	rs8181620		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:148078G>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							cacaattgccgtgctccttgg	0.537																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.148078G>A				RNA	SNP	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			FAM138D	-	-	ENSG00000206114		0.537	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding		-	0.00	8	0	G			148078	-1	tier1	rs8181620	no_errors	ENST00000320165	ensembl	human	known	74_37	rna	58.33	5	7	SNP	0.000	A
FAM182B	728882	genome.wustl.edu	37	20	25745639	25745640	+	Splice_Site	INS	-	-	AGAG	rs554840468	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:25745639_25745640insAGAG	ENST00000478164.1	-	4	645		c.e4-2		FAM182B_ENST00000376404.2_Splice_Site			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						GTTTCTGTTCTAGAGAGAGAGA	0.49														15	0.00299521	0.0008	0.0	5008	,	,		23322	0.0		0.0139	False		,,,				2504	0.0																0																																										SO:0001630	splice_region_variant	0					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.348-2->CTCT	20.37:g.25745644_25745647dupAGAG			Q4G0Q1	Splice_Site	INS	-	e2-2	ENST00000478164.1	37	c.202-3_202-2		20																																																																																			FAM182B	-	-	ENSG00000175170		0.490	FAM182B-005	KNOWN	basic	processed_transcript	FAM182B	HGNC	protein_coding	OTTHUMT00000316665.1		0.00	23	0	-	NR_026714	Intron	25745640	-1	tier1		no_errors	ENST00000376404	ensembl	human	known	74_37	splice_site_ins	20.78	61	16	INS	0.078:0.082	AGAG
LRRC53	100144878	genome.wustl.edu	37	1	74957871	74957871	+	Intron	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:74957871A>G	ENST00000294635.4	-	2	89				FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S872G|TNNI3K_ENST00000370891.2_Missense_Mutation_p.S859G|TNNI3K_ENST00000326637.3_Missense_Mutation_p.S758G			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						ACCTGGCCGGAGTCATGTGGC	0.483																																																	0													198.0	201.0	200.0					1																	74957871		2203	4300	6503	SO:0001627	intron_variant	0					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8812T>C	1.37:g.74957871A>G				Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S872G	ENST00000294635.4	37	c.2614		1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.994062	0.54041	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.74947	-0.89;-0.89;-0.87	5.7	5.7	0.88788	.	0.082508	0.85682	D	0.000000	T	0.51568	0.1682	L	0.34521	1.04	0.49687	D	0.999817	B;B	0.33171	0.278;0.4	B;B	0.36464	0.039;0.225	T	0.55438	-0.8141	10	0.12103	T	0.63	.	15.9774	0.80079	1.0:0.0:0.0:0.0	.	758;859	Q59H18;Q59H18-1	TNI3K_HUMAN;.	G	859;859;758	ENSP00000450895:S859G;ENSP00000359928:S859G;ENSP00000322251:S758G	ENSP00000322251:S758G	S	+	1	0	RP11-653A5.2;AC093158.1	74730459	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	8.504000	0.90512	2.179000	0.69175	0.533000	0.62120	AGT	FPGT-TNNI3K	-	NULL	ENSG00000259030		0.483	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026515.2	-	0.00	51	0	A			74957871	+1	tier1	-	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	G
LRRC53	100144878	genome.wustl.edu	37	1	74957871	74957871	+	Intron	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:74957871A>G	ENST00000294635.4	-	2	89				FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S872G|TNNI3K_ENST00000370891.2_Missense_Mutation_p.S859G|TNNI3K_ENST00000326637.3_Missense_Mutation_p.S758G			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						ACCTGGCCGGAGTCATGTGGC	0.483																																																	0													198.0	201.0	200.0					1																	74957871		2203	4300	6503	SO:0001627	intron_variant	0					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8812T>C	1.37:g.74957871A>G				Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S872G	ENST00000294635.4	37	c.2614		1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.994062	0.54041	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.74947	-0.89;-0.89;-0.87	5.7	5.7	0.88788	.	0.082508	0.85682	D	0.000000	T	0.51568	0.1682	L	0.34521	1.04	0.49687	D	0.999817	B;B	0.33171	0.278;0.4	B;B	0.36464	0.039;0.225	T	0.55438	-0.8141	10	0.12103	T	0.63	.	15.9774	0.80079	1.0:0.0:0.0:0.0	.	758;859	Q59H18;Q59H18-1	TNI3K_HUMAN;.	G	859;859;758	ENSP00000450895:S859G;ENSP00000359928:S859G;ENSP00000322251:S758G	ENSP00000322251:S758G	S	+	1	0	RP11-653A5.2;AC093158.1	74730459	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	8.504000	0.90512	2.179000	0.69175	0.533000	0.62120	AGT	FPGT-TNNI3K	-	NULL	ENSG00000259030		0.483	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026515.2	-	0.00	59	0	A			74957871	+1	tier1	-	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	G
FCRL4	83417	genome.wustl.edu	37	1	157551430	157551430	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:157551430G>A	ENST00000271532.1	-	7	1275	c.1140C>T	c.(1138-1140)acC>acT	p.T380T	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	380					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TGTTGCCTGGGGTCTCTAAGG	0.587																																																	0													33.0	34.0	34.0					1																	157551430		2203	4300	6503	SO:0001819	synonymous_variant	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.1140C>T	1.37:g.157551430G>A			Q96PJ3|Q96RE0	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T380	ENST00000271532.1	37	c.1140	CCDS1166.1	1																																																																																			FCRL4	-	NULL	ENSG00000163518		0.587	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	-	0.00	25	0	G	NM_031282		157551430	-1	tier1	-	no_errors	ENST00000271532	ensembl	human	known	74_37	silent	27.66	34	13	SNP	0.000	A
FCRL4	83417	genome.wustl.edu	37	1	157551430	157551430	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:157551430G>A	ENST00000271532.1	-	7	1275	c.1140C>T	c.(1138-1140)acC>acT	p.T380T	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	380					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TGTTGCCTGGGGTCTCTAAGG	0.587																																																	0													33.0	34.0	34.0					1																	157551430		2203	4300	6503	SO:0001819	synonymous_variant	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.1140C>T	1.37:g.157551430G>A			Q96PJ3|Q96RE0	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T380	ENST00000271532.1	37	c.1140	CCDS1166.1	1																																																																																			FCRL4	-	NULL	ENSG00000163518		0.587	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	-	0.00	36	0	G	NM_031282		157551430	-1	tier1	-	no_errors	ENST00000271532	ensembl	human	known	74_37	silent	27.66	34	13	SNP	0.000	A
GABBR2	9568	genome.wustl.edu	37	9	101340276	101340276	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:101340276C>T	ENST00000259455.2	-	2	859	c.400G>A	c.(400-402)Gtc>Atc	p.V134I		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	134					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GATGGACAGACGCCTCCAAAC	0.498																																																	0													214.0	198.0	203.0					9																	101340276		2203	4300	6503	SO:0001583	missense	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.400G>A	9.37:g.101340276C>T	ENSP00000259455:p.Val134Ile		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.V134I	ENST00000259455.2	37	c.400	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	c	27.3	4.821819	0.90873	.	.	ENSG00000136928	ENST00000259455	D	0.83673	-1.75	4.59	4.59	0.56863	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000003	D	0.86104	0.5853	L	0.36672	1.1	0.43688	D	0.996139	D	0.76494	0.999	D	0.74674	0.984	D	0.85714	0.1321	10	0.39692	T	0.17	.	14.9707	0.71232	0.0:1.0:0.0:0.0	.	134	O75899	GABR2_HUMAN	I	134	ENSP00000259455:V134I	ENSP00000259455:V134I	V	-	1	0	GABBR2	100380097	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.724000	0.84798	2.113000	0.64589	0.550000	0.68814	GTC	GABBR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000136928		0.498	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	-	0.00	47	0	C			101340276	-1	tier1	-	no_errors	ENST00000259455	ensembl	human	known	74_37	missense	10.94	57	7	SNP	1.000	T
GABBR2	9568	genome.wustl.edu	37	9	101340276	101340276	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:101340276C>T	ENST00000259455.2	-	2	859	c.400G>A	c.(400-402)Gtc>Atc	p.V134I		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	134					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GATGGACAGACGCCTCCAAAC	0.498																																																	0													214.0	198.0	203.0					9																	101340276		2203	4300	6503	SO:0001583	missense	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.400G>A	9.37:g.101340276C>T	ENSP00000259455:p.Val134Ile		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.V134I	ENST00000259455.2	37	c.400	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	c	27.3	4.821819	0.90873	.	.	ENSG00000136928	ENST00000259455	D	0.83673	-1.75	4.59	4.59	0.56863	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000003	D	0.86104	0.5853	L	0.36672	1.1	0.43688	D	0.996139	D	0.76494	0.999	D	0.74674	0.984	D	0.85714	0.1321	10	0.39692	T	0.17	.	14.9707	0.71232	0.0:1.0:0.0:0.0	.	134	O75899	GABR2_HUMAN	I	134	ENSP00000259455:V134I	ENSP00000259455:V134I	V	-	1	0	GABBR2	100380097	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.724000	0.84798	2.113000	0.64589	0.550000	0.68814	GTC	GABBR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000136928		0.498	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	-	0.00	59	0	C			101340276	-1	tier1	-	no_errors	ENST00000259455	ensembl	human	known	74_37	missense	10.94	57	7	SNP	1.000	T
GIGYF2	26058	genome.wustl.edu	37	2	233651989	233651989	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:233651989G>A	ENST00000409547.1	+	11	973	c.662G>A	c.(661-663)cGa>cAa	p.R221Q	GIGYF2_ENST00000409480.1_Missense_Mutation_p.R243Q|GIGYF2_ENST00000373566.3_Missense_Mutation_p.R243Q|GIGYF2_ENST00000409196.3_Missense_Mutation_p.R221Q|GIGYF2_ENST00000409451.3_Missense_Mutation_p.R243Q|GIGYF2_ENST00000373563.4_Missense_Mutation_p.R221Q|GIGYF2_ENST00000452341.2_Missense_Mutation_p.R52Q	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	221	Arg-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GGAGGTTGGCGACTAGCTGGA	0.453																																																	0													122.0	124.0	123.0					2																	233651989		2203	4300	6503	SO:0001583	missense	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.662G>A	2.37:g.233651989G>A	ENSP00000386537:p.Arg221Gln		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.R243Q	ENST00000409547.1	37	c.728	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.519430	0.96416	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000445650;ENST00000452341;ENST00000421778	D;T;D;T;T;T;D;D;T;T	0.85629	-2.01;-1.46;-2.01;-1.46;-1.29;-1.35;-2.01;-1.51;-1.48;-1.17	5.83	5.83	0.93111	.	0.067711	0.64402	D	0.000019	D	0.91784	0.7401	M	0.61703	1.905	0.51767	D	0.999939	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.81914	0.986;0.995;0.978;0.991	D	0.91707	0.5378	10	0.72032	D	0.01	-12.4963	20.1152	0.97926	0.0:0.0:1.0:0.0	.	52;243;221;221	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	Q	243;170;221;243;221;221;170;221;243;221;52;52;48	ENSP00000362667:R243Q;ENSP00000362664:R221Q;ENSP00000386765:R243Q;ENSP00000386537:R221Q;ENSP00000404195:R170Q;ENSP00000387070:R221Q;ENSP00000387170:R243Q;ENSP00000410297:R221Q;ENSP00000392218:R52Q;ENSP00000411505:R52Q	ENSP00000362664:R221Q	R	+	2	0	GIGYF2	233360233	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	7.400000	0.79949	2.750000	0.94351	0.655000	0.94253	CGA	GIGYF2	-	NULL	ENSG00000204120		0.453	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	-	0.00	46	0	G	NM_001103146		233651989	+1	tier1	-	no_errors	ENST00000373566	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.999	A
GLI3	2737	genome.wustl.edu	37	7	42005959	42005959	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:42005959G>A	ENST00000395925.3	-	15	2796	c.2712C>T	c.(2710-2712)cgC>cgT	p.R904R	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	904					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CGCTGGAGCGGCGCGAGGCGT	0.721									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																																								0													21.0	25.0	24.0					7																	42005959		2200	4289	6489	SO:0001819	synonymous_variant	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2712C>T	7.37:g.42005959G>A			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R904	ENST00000395925.3	37	c.2712	CCDS5465.1	7																																																																																			GLI3	-	NULL	ENSG00000106571		0.721	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	-	0.00	36	0	G	NM_000168		42005959	-1	tier1	-	no_errors	ENST00000395925	ensembl	human	known	74_37	silent	38.78	30	19	SNP	1.000	A
GLUD2	2747	genome.wustl.edu	37	X	120182347	120182347	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:120182347C>A	ENST00000328078.1	+	1	886	c.809C>A	c.(808-810)tCt>tAt	p.S270Y		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	270					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GGACGCATCTCTGCTACTGGC	0.458																																																	0													124.0	95.0	105.0					X																	120182347		2203	4300	6503	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.809C>A	X.37:g.120182347C>A	ENSP00000327589:p.Ser270Tyr		B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.S270Y	ENST00000328078.1	37	c.809	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845192	0.51164	.	.	ENSG00000182890	ENST00000328078	D	0.95238	-3.65	2.33	1.44	0.22558	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95843	0.8647	M	0.74258	2.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.93951	0.7232	10	0.87932	D	0	-0.511	6.9006	0.24281	0.0:0.8432:0.0:0.1568	.	270	P49448	DHE4_HUMAN	Y	270	ENSP00000327589:S270Y	ENSP00000327589:S270Y	S	+	2	0	GLUD2	120010028	1.000000	0.71417	0.004000	0.12327	0.932000	0.56968	3.696000	0.54757	0.292000	0.22492	0.466000	0.42574	TCT	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	ENSG00000182890		0.458	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	-	0.00	103	0	C	NM_012084		120182347	+1	tier1	-	no_errors	ENST00000328078	ensembl	human	known	74_37	missense	15.32	105	19	SNP	0.995	A
GLUD2	2747	genome.wustl.edu	37	X	120182347	120182347	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:120182347C>A	ENST00000328078.1	+	1	886	c.809C>A	c.(808-810)tCt>tAt	p.S270Y		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	270					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GGACGCATCTCTGCTACTGGC	0.458																																																	0													124.0	95.0	105.0					X																	120182347		2203	4300	6503	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.809C>A	X.37:g.120182347C>A	ENSP00000327589:p.Ser270Tyr		B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.S270Y	ENST00000328078.1	37	c.809	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845192	0.51164	.	.	ENSG00000182890	ENST00000328078	D	0.95238	-3.65	2.33	1.44	0.22558	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95843	0.8647	M	0.74258	2.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.93951	0.7232	10	0.87932	D	0	-0.511	6.9006	0.24281	0.0:0.8432:0.0:0.1568	.	270	P49448	DHE4_HUMAN	Y	270	ENSP00000327589:S270Y	ENSP00000327589:S270Y	S	+	2	0	GLUD2	120010028	1.000000	0.71417	0.004000	0.12327	0.932000	0.56968	3.696000	0.54757	0.292000	0.22492	0.466000	0.42574	TCT	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	ENSG00000182890		0.458	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	-	0.00	117	0	C	NM_012084		120182347	+1	tier1	-	no_errors	ENST00000328078	ensembl	human	known	74_37	missense	15.32	105	19	SNP	0.995	A
GNG4	2786	genome.wustl.edu	37	1	235715256	235715256	+	3'UTR	SNP	C	C	T	rs527657436		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:235715256C>T	ENST00000366598.4	-	0	596				GNG4_ENST00000450593.1_3'UTR|GNG4_ENST00000366597.1_3'UTR|GNG4_ENST00000484517.1_5'UTR|GNG4_ENST00000391854.2_3'UTR			P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein), gamma 4						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell growth (GO:0030308)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			TTGAATGCCACGAAGAAAACA	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		18045	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	0			BC022485	CCDS1607.1	1q42.3	2008-02-05			ENSG00000168243	ENSG00000168243			4407	protein-coding gene	gene with protein product		604388				7665596	Standard	NM_001098721		Approved		uc001hxh.4	P50150	OTTHUMG00000040740	ENST00000366598.4:c.*153G>A	1.37:g.235715256C>T				RNA	SNP	-	NULL	ENST00000366598.4	37	NULL	CCDS1607.1	1																																																																																			GNG4	-	-	ENSG00000168243		0.398	GNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNG4	HGNC	protein_coding	OTTHUMT00000097906.1	-	0.00	8	0	C	NM_004485		235715256	-1	tier1	-	no_errors	ENST00000484517	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.000	T
GNG4	2786	genome.wustl.edu	37	1	235715256	235715256	+	3'UTR	SNP	C	C	T	rs527657436		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:235715256C>T	ENST00000366598.4	-	0	596				GNG4_ENST00000450593.1_3'UTR|GNG4_ENST00000366597.1_3'UTR|GNG4_ENST00000484517.1_5'UTR|GNG4_ENST00000391854.2_3'UTR			P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein), gamma 4						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell growth (GO:0030308)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			TTGAATGCCACGAAGAAAACA	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		18045	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	0			BC022485	CCDS1607.1	1q42.3	2008-02-05			ENSG00000168243	ENSG00000168243			4407	protein-coding gene	gene with protein product		604388				7665596	Standard	NM_001098721		Approved		uc001hxh.4	P50150	OTTHUMG00000040740	ENST00000366598.4:c.*153G>A	1.37:g.235715256C>T				RNA	SNP	-	NULL	ENST00000366598.4	37	NULL	CCDS1607.1	1																																																																																			GNG4	-	-	ENSG00000168243		0.398	GNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNG4	HGNC	protein_coding	OTTHUMT00000097906.1	-	0.00	9	0	C	NM_004485		235715256	-1	tier1	-	no_errors	ENST00000484517	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.000	T
GNPTAB	79158	genome.wustl.edu	37	12	102158696	102158696	+	Missense_Mutation	SNP	C	C	G	rs281864985		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:102158696C>G	ENST00000299314.7	-	13	2261	c.1999G>C	c.(1999-2001)Gag>Cag	p.E667Q	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	667					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GGAATATCCTCAAAAAGGATT	0.428																																																	0													86.0	86.0	86.0					12																	102158696		2203	4300	6503	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1999G>C	12.37:g.102158696C>G	ENSP00000299314:p.Glu667Gln		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.E667Q	ENST00000299314.7	37	c.1999	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533068	0.45073	.	.	ENSG00000111670	ENST00000299314	D	0.96554	-4.05	5.96	5.96	0.96718	.	0.164580	0.52532	D	0.000077	D	0.95516	0.8543	L	0.36672	1.1	0.80722	D	1	D	0.56035	0.974	P	0.49140	0.601	D	0.95182	0.8300	10	0.52906	T	0.07	-31.1381	20.422	0.99049	0.0:1.0:0.0:0.0	.	667	Q3T906	GNPTA_HUMAN	Q	667	ENSP00000299314:E667Q	ENSP00000299314:E667Q	E	-	1	0	GNPTAB	100682827	1.000000	0.71417	0.993000	0.49108	0.106000	0.19336	3.450000	0.52957	2.832000	0.97577	0.655000	0.94253	GAG	GNPTAB	-	NULL	ENSG00000111670		0.428	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	-	0.00	27	0	C			102158696	-1	tier1	-	no_errors	ENST00000299314	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	G
GNPTAB	79158	genome.wustl.edu	37	12	102158696	102158696	+	Missense_Mutation	SNP	C	C	G	rs281864985		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:102158696C>G	ENST00000299314.7	-	13	2261	c.1999G>C	c.(1999-2001)Gag>Cag	p.E667Q	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	667					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GGAATATCCTCAAAAAGGATT	0.428																																																	0													86.0	86.0	86.0					12																	102158696		2203	4300	6503	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1999G>C	12.37:g.102158696C>G	ENSP00000299314:p.Glu667Gln		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.E667Q	ENST00000299314.7	37	c.1999	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533068	0.45073	.	.	ENSG00000111670	ENST00000299314	D	0.96554	-4.05	5.96	5.96	0.96718	.	0.164580	0.52532	D	0.000077	D	0.95516	0.8543	L	0.36672	1.1	0.80722	D	1	D	0.56035	0.974	P	0.49140	0.601	D	0.95182	0.8300	10	0.52906	T	0.07	-31.1381	20.422	0.99049	0.0:1.0:0.0:0.0	.	667	Q3T906	GNPTA_HUMAN	Q	667	ENSP00000299314:E667Q	ENSP00000299314:E667Q	E	-	1	0	GNPTAB	100682827	1.000000	0.71417	0.993000	0.49108	0.106000	0.19336	3.450000	0.52957	2.832000	0.97577	0.655000	0.94253	GAG	GNPTAB	-	NULL	ENSG00000111670		0.428	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	-	0.00	32	0	C			102158696	-1	tier1	-	no_errors	ENST00000299314	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	G
GOT1L1	137362	genome.wustl.edu	37	8	37791833	37791834	+	Frame_Shift_Ins	INS	-	-	T	rs370114090	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:37791833_37791834insT	ENST00000307599.4	-	9	1342_1343	c.1243_1244insA	c.(1243-1245)acafs	p.T415fs		NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	415					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCCAATCAGTGTTTTTTTTTCC	0.371													?|TTTTTTTTT|TTTTTTTTTT|unsure	7	0.00139776	0.0	0.0	5008	,	,		21654	0.0069		0.0	False		,,,				2504	0.0																0																																										SO:0001589	frameshift_variant	0			BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.1244dupA	8.37:g.37791842_37791842dupT	ENSP00000303077:p.Thr415fs		A8MWL4	Frame_Shift_Ins	INS	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,prints_Asp_trans	p.T415fs	ENST00000307599.4	37	c.1244_1243	CCDS47839.1	8																																																																																			GOT1L1	-	NULL	ENSG00000169154		0.371	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1L1	HGNC	protein_coding	OTTHUMT00000376823.1		0.00	45	0	0	NM_152413		37791834	-1			no_errors	ENST00000307599	ensembl	human	known	74_37	frame_shift_ins	8.73	115	11	INS	0.000:0.000	T
HEATR4	399671	genome.wustl.edu	37	14	73962027	73962027	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:73962027C>T	ENST00000553558.1	-	16	3011	c.2690G>A	c.(2689-2691)gGa>gAa	p.G897E	C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.G850E|HEATR4_ENST00000334988.2_Missense_Mutation_p.G897E	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	897										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CCTCACTTTTCCCATGACCAT	0.383																																																	0													181.0	154.0	163.0					14																	73962027		2203	4300	6503	SO:0001583	missense	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2690G>A	14.37:g.73962027C>T	ENSP00000450444:p.Gly897Glu		B7Z7V9|E9KL41	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.G897E	ENST00000553558.1	37	c.2690	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.380636	0.00205	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.19250	2.16	4.96	-5.29	0.02747	.	2.235850	0.01505	N	0.017693	T	0.10680	0.0261	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36114	-0.9761	10	0.06365	T	0.9	4.5947	9.9837	0.41828	0.0:0.1526:0.1225:0.7249	.	897	Q86WZ0	HEAT4_HUMAN	E	897;850	ENSP00000450444:G897E	ENSP00000335447:G850E	G	-	2	0	HEATR4	73031780	0.000000	0.05858	0.002000	0.10522	0.052000	0.14988	-1.795000	0.01752	-1.027000	0.03325	-0.175000	0.13238	GGA	HEATR4	-	NULL	ENSG00000187105		0.383	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	-	0.00	54	0	C	NM_203309		73962027	-1	tier1	-	no_errors	ENST00000334988	ensembl	human	known	74_37	missense	32.05	53	25	SNP	0.000	T
HEATR4	399671	genome.wustl.edu	37	14	73962027	73962027	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:73962027C>T	ENST00000553558.1	-	16	3011	c.2690G>A	c.(2689-2691)gGa>gAa	p.G897E	C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.G850E|HEATR4_ENST00000334988.2_Missense_Mutation_p.G897E	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	897										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CCTCACTTTTCCCATGACCAT	0.383																																																	0													181.0	154.0	163.0					14																	73962027		2203	4300	6503	SO:0001583	missense	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2690G>A	14.37:g.73962027C>T	ENSP00000450444:p.Gly897Glu		B7Z7V9|E9KL41	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.G897E	ENST00000553558.1	37	c.2690	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.380636	0.00205	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.19250	2.16	4.96	-5.29	0.02747	.	2.235850	0.01505	N	0.017693	T	0.10680	0.0261	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36114	-0.9761	10	0.06365	T	0.9	4.5947	9.9837	0.41828	0.0:0.1526:0.1225:0.7249	.	897	Q86WZ0	HEAT4_HUMAN	E	897;850	ENSP00000450444:G897E	ENSP00000335447:G850E	G	-	2	0	HEATR4	73031780	0.000000	0.05858	0.002000	0.10522	0.052000	0.14988	-1.795000	0.01752	-1.027000	0.03325	-0.175000	0.13238	GGA	HEATR4	-	NULL	ENSG00000187105		0.383	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	-	0.00	63	0	C	NM_203309		73962027	-1	tier1	-	no_errors	ENST00000334988	ensembl	human	known	74_37	missense	32.05	53	25	SNP	0.000	T
HM13	81502	genome.wustl.edu	37	20	30142485	30142485	+	Intron	DEL	A	A	-	rs375749810		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:30142485delA	ENST00000340852.5	+	8	848				HM13_ENST00000492709.1_Intron|HM13_ENST00000335574.5_Intron|HM13_ENST00000398174.3_Intron|HM13_ENST00000376127.3_Intron	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13						membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			actccgtctcaaaaaaaaaaa	0.552																																																	0																																										SO:0001627	intron_variant	0			AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.725-64A>-	20.37:g.30142485delA			B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	RNA	DEL	-	NULL	ENST00000340852.5	37	NULL	CCDS13182.1	20																																																																																			HM13	-	-	ENSG00000101294		0.552	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	HM13	HGNC	protein_coding	OTTHUMT00000078527.2		0.00	17	0	A	NM_178580		30142485	+1	tier1		no_errors	ENST00000474466	ensembl	human	known	74_37	rna	15.79	32	6	DEL	0.172	-
HOOK2	29911	genome.wustl.edu	37	19	12874386	12874386	+	Missense_Mutation	SNP	G	G	A	rs370952243		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:12874386G>A	ENST00000397668.3	-	22	2039	c.1966C>T	c.(1966-1968)Cgg>Tgg	p.R656W	HOOK2_ENST00000264827.5_Missense_Mutation_p.R654W|HOOK2_ENST00000589965.1_5'Flank	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	656	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TCCTGCTCCCGCTGACTTCGG	0.532																																																	0								G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	205.0	216.0	213.0		1960,1966	0.6	1.0	19		213	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense	HOOK2	NM_001100176.1,NM_013312.2	101,101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	654/718,656/720	12874386	2,13004	2203	4300	6503	SO:0001583	missense	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1966C>T	19.37:g.12874386G>A	ENSP00000380785:p.Arg656Trp		O60562	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.R656W	ENST00000397668.3	37	c.1966	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237297	0.79800	0.0	2.33E-4	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.21932	1.98;1.98	5.57	0.594	0.17485	.	0.125119	0.53938	D	0.000060	T	0.39036	0.1063	M	0.75085	2.285	0.29770	N	0.834816	D;D	0.71674	0.998;0.998	P;P	0.57846	0.629;0.828	T	0.50558	-0.8814	10	0.87932	D	0	-34.3832	14.6511	0.68797	0.0:0.0:0.5062:0.4938	.	654;656	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	W	656;654	ENSP00000380785:R656W;ENSP00000264827:R654W	ENSP00000264827:R654W	R	-	1	2	HOOK2	12735386	1.000000	0.71417	0.969000	0.41365	0.984000	0.73092	2.182000	0.42556	0.268000	0.21939	-0.148000	0.13756	CGG	HOOK2	-	pfam_Hook-related_fam	ENSG00000095066		0.532	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	-	0.00	48	0	G	NM_013312		12874386	-1	tier1	-	no_errors	ENST00000397668	ensembl	human	known	74_37	missense	32.20	40	19	SNP	1.000	A
HOOK2	29911	genome.wustl.edu	37	19	12874386	12874386	+	Missense_Mutation	SNP	G	G	A	rs370952243		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:12874386G>A	ENST00000397668.3	-	22	2039	c.1966C>T	c.(1966-1968)Cgg>Tgg	p.R656W	HOOK2_ENST00000264827.5_Missense_Mutation_p.R654W|HOOK2_ENST00000589965.1_5'Flank	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	656	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TCCTGCTCCCGCTGACTTCGG	0.532																																																	0								G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	205.0	216.0	213.0		1960,1966	0.6	1.0	19		213	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense	HOOK2	NM_001100176.1,NM_013312.2	101,101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	654/718,656/720	12874386	2,13004	2203	4300	6503	SO:0001583	missense	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1966C>T	19.37:g.12874386G>A	ENSP00000380785:p.Arg656Trp		O60562	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.R656W	ENST00000397668.3	37	c.1966	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237297	0.79800	0.0	2.33E-4	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.21932	1.98;1.98	5.57	0.594	0.17485	.	0.125119	0.53938	D	0.000060	T	0.39036	0.1063	M	0.75085	2.285	0.29770	N	0.834816	D;D	0.71674	0.998;0.998	P;P	0.57846	0.629;0.828	T	0.50558	-0.8814	10	0.87932	D	0	-34.3832	14.6511	0.68797	0.0:0.0:0.5062:0.4938	.	654;656	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	W	656;654	ENSP00000380785:R656W;ENSP00000264827:R654W	ENSP00000264827:R654W	R	-	1	2	HOOK2	12735386	1.000000	0.71417	0.969000	0.41365	0.984000	0.73092	2.182000	0.42556	0.268000	0.21939	-0.148000	0.13756	CGG	HOOK2	-	pfam_Hook-related_fam	ENSG00000095066		0.532	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	-	0.00	57	0	G	NM_013312		12874386	-1	tier1	-	no_errors	ENST00000397668	ensembl	human	known	74_37	missense	32.20	40	19	SNP	1.000	A
HSPA2	3306	genome.wustl.edu	37	14	65009115	65009115	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:65009115C>T	ENST00000394709.1	+	2	1624	c.1548C>T	c.(1546-1548)gaC>gaT	p.D516D	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Silent_p.D516D			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	516					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		TGAGCAAGGACGACATTGACC	0.547																																					Pancreas(136;1211 1835 24894 31984 38227)												0													74.0	77.0	76.0					14																	65009115		2203	4300	6503	SO:0001819	synonymous_variant	0			L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1548C>T	14.37:g.65009115C>T			Q15508|Q53XM3|Q9UE78	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.D516	ENST00000394709.1	37	c.1548	CCDS9766.1	14																																																																																			HSPA2	-	pfam_Hsp_70_fam	ENSG00000126803		0.547	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	HGNC	protein_coding	OTTHUMT00000280651.1		0.00	21	0	C			65009115	+1			no_errors	ENST00000247207	ensembl	human	known	74_37	silent	6.52	43	3	SNP	1.000	T
HTR1E	3354	genome.wustl.edu	37	6	87725546	87725546	+	Missense_Mutation	SNP	G	G	A	rs373132619		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:87725546G>A	ENST00000305344.5	+	2	1197	c.494G>A	c.(493-495)cGc>cAc	p.R165H		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	165					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AGCCACCGCCGCCTAAGCCCT	0.547																																																	0								G	HIS/ARG	0,4406		0,0,2203	103.0	96.0	99.0		494	-7.9	0.5	6		99	1,8599	1.2+/-3.3	0,1,4299	no	missense	HTR1E	NM_000865.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	165/366	87725546	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.494G>A	6.37:g.87725546G>A	ENSP00000307766:p.Arg165His		E1P503|Q9P1Y1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.R165H	ENST00000305344.5	37	c.494	CCDS5006.1	6	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716608	0.30413	0.0	1.16E-4	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.72394	-0.65;-0.65	4.26	-7.87	0.01183	GPCR, rhodopsin-like superfamily (1);	1.926230	0.03766	U	0.259050	T	0.27241	0.0668	N	0.19112	0.55	0.09310	N	1	B	0.18013	0.025	B	0.15870	0.014	T	0.15925	-1.0420	10	0.33141	T	0.24	.	6.2194	0.20673	0.2616:0.0:0.4907:0.2477	.	165	P28566	5HT1E_HUMAN	H	165	ENSP00000307766:R165H;ENSP00000358597:R165H	ENSP00000307766:R165H	R	+	2	0	HTR1E	87782265	0.001000	0.12720	0.479000	0.27329	0.765000	0.43378	-0.130000	0.10498	-0.671000	0.05274	0.404000	0.27445	CGC	HTR1E	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000168830		0.547	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1E	HGNC	protein_coding	OTTHUMT00000472488.2	-	0.00	31	0	G	NM_000865		87725546	+1	tier1	-	no_errors	ENST00000305344	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.080	A
HTR1E	3354	genome.wustl.edu	37	6	87725546	87725546	+	Missense_Mutation	SNP	G	G	A	rs373132619		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:87725546G>A	ENST00000305344.5	+	2	1197	c.494G>A	c.(493-495)cGc>cAc	p.R165H		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	165					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AGCCACCGCCGCCTAAGCCCT	0.547																																																	0								G	HIS/ARG	0,4406		0,0,2203	103.0	96.0	99.0		494	-7.9	0.5	6		99	1,8599	1.2+/-3.3	0,1,4299	no	missense	HTR1E	NM_000865.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	165/366	87725546	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.494G>A	6.37:g.87725546G>A	ENSP00000307766:p.Arg165His		E1P503|Q9P1Y1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.R165H	ENST00000305344.5	37	c.494	CCDS5006.1	6	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716608	0.30413	0.0	1.16E-4	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.72394	-0.65;-0.65	4.26	-7.87	0.01183	GPCR, rhodopsin-like superfamily (1);	1.926230	0.03766	U	0.259050	T	0.27241	0.0668	N	0.19112	0.55	0.09310	N	1	B	0.18013	0.025	B	0.15870	0.014	T	0.15925	-1.0420	10	0.33141	T	0.24	.	6.2194	0.20673	0.2616:0.0:0.4907:0.2477	.	165	P28566	5HT1E_HUMAN	H	165	ENSP00000307766:R165H;ENSP00000358597:R165H	ENSP00000307766:R165H	R	+	2	0	HTR1E	87782265	0.001000	0.12720	0.479000	0.27329	0.765000	0.43378	-0.130000	0.10498	-0.671000	0.05274	0.404000	0.27445	CGC	HTR1E	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000168830		0.547	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1E	HGNC	protein_coding	OTTHUMT00000472488.2	-	0.00	34	0	G	NM_000865		87725546	+1	tier1	-	no_errors	ENST00000305344	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.080	A
HTR7	3363	genome.wustl.edu	37	10	92503625	92503625	+	Intron	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:92503625C>A	ENST00000336152.3	-	3	1322				HTR7_ENST00000371719.2_Intron|HTR7_ENST00000371721.3_Missense_Mutation_p.C459F|HTR7_ENST00000277874.6_Intron	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled						blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AAAGTATTCACAGCTTTTCCT	0.348																																																	0																																										SO:0001627	intron_variant	0			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.1296-178G>T	10.37:g.92503625C>A			B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT_7_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.C459F	ENST00000336152.3	37	c.1376	CCDS7408.1	10	.	.	.	.	.	.	.	.	.	.	C	0.629	-0.818002	0.02776	.	.	ENSG00000148680	ENST00000371721	T	0.63417	-0.04	3.66	-1.03	0.10102	.	.	.	.	.	T	0.52613	0.1745	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50742	-0.8792	6	0.62326	D	0.03	.	3.7246	0.08470	0.0:0.2612:0.2075:0.5314	.	.	.	.	F	459	ENSP00000360786:C459F	ENSP00000360786:C459F	C	-	2	0	HTR7	92493605	0.000000	0.05858	0.000000	0.03702	0.265000	0.26407	-1.594000	0.02094	-0.180000	0.10637	-0.140000	0.14226	TGT	HTR7	-	NULL	ENSG00000148680		0.348	HTR7-001	KNOWN	basic|CCDS	protein_coding	HTR7	HGNC	protein_coding	OTTHUMT00000049343.1	-	0.00	22	0	C	NM_000872		92503625	-1	tier1	-	no_errors	ENST00000371721	ensembl	human	known	74_37	missense	63.64	16	28	SNP	0.001	A
HTR7	3363	genome.wustl.edu	37	10	92503625	92503625	+	Intron	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:92503625C>A	ENST00000336152.3	-	3	1322				HTR7_ENST00000371719.2_Intron|HTR7_ENST00000371721.3_Missense_Mutation_p.C459F|HTR7_ENST00000277874.6_Intron	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled						blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AAAGTATTCACAGCTTTTCCT	0.348																																																	0																																										SO:0001627	intron_variant	0			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.1296-178G>T	10.37:g.92503625C>A			B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT_7_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.C459F	ENST00000336152.3	37	c.1376	CCDS7408.1	10	.	.	.	.	.	.	.	.	.	.	C	0.629	-0.818002	0.02776	.	.	ENSG00000148680	ENST00000371721	T	0.63417	-0.04	3.66	-1.03	0.10102	.	.	.	.	.	T	0.52613	0.1745	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50742	-0.8792	6	0.62326	D	0.03	.	3.7246	0.08470	0.0:0.2612:0.2075:0.5314	.	.	.	.	F	459	ENSP00000360786:C459F	ENSP00000360786:C459F	C	-	2	0	HTR7	92493605	0.000000	0.05858	0.000000	0.03702	0.265000	0.26407	-1.594000	0.02094	-0.180000	0.10637	-0.140000	0.14226	TGT	HTR7	-	NULL	ENSG00000148680		0.348	HTR7-001	KNOWN	basic|CCDS	protein_coding	HTR7	HGNC	protein_coding	OTTHUMT00000049343.1	-	0.00	34	0	C	NM_000872		92503625	-1	tier1	-	no_errors	ENST00000371721	ensembl	human	known	74_37	missense	63.64	16	28	SNP	0.001	A
IGSF10	285313	genome.wustl.edu	37	3	151165454	151165454	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:151165454C>T	ENST00000282466.3	-	4	2314	c.2315G>A	c.(2314-2316)cGa>cAa	p.R772Q		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	772					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGTATTTTCTCGCTTGTCTGG	0.507																																																	0													83.0	76.0	78.0					3																	151165454		2203	4300	6503	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.2315G>A	3.37:g.151165454C>T	ENSP00000282466:p.Arg772Gln		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R772Q	ENST00000282466.3	37	c.2315	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	C	9.154	1.017072	0.19355	.	.	ENSG00000152580	ENST00000282466	T	0.66280	-0.2	5.31	-10.6	0.00265	.	1.818850	0.03473	N	0.213939	T	0.26231	0.0640	N	0.02802	-0.49	0.09310	N	1	B	0.18166	0.026	B	0.04013	0.001	T	0.10894	-1.0610	10	0.09084	T	0.74	.	5.6045	0.17371	0.1391:0.1412:0.1386:0.581	.	772	Q6WRI0	IGS10_HUMAN	Q	772	ENSP00000282466:R772Q	ENSP00000282466:R772Q	R	-	2	0	IGSF10	152648144	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-2.589000	0.00900	-2.407000	0.00574	-0.218000	0.12543	CGA	IGSF10	-	NULL	ENSG00000152580		0.507	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	-	0.00	54	0	C	NM_178822		151165454	-1	tier1	-	no_errors	ENST00000282466	ensembl	human	known	74_37	missense	5.79	114	7	SNP	0.000	T
IGSF22	283284	genome.wustl.edu	37	11	18741278	18741278	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:18741278C>G	ENST00000513874.1	-	7	820	c.681G>C	c.(679-681)aaG>aaC	p.K227N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	227	Lys-rich.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CCTCTACTTTCTTCTTCATCT	0.522																																																	0													113.0	115.0	114.0					11																	18741278		1915	4125	6040	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.681G>C	11.37:g.18741278C>G	ENSP00000421191:p.Lys227Asn		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K227N	ENST00000513874.1	37	c.681	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	13.91	2.376785	0.42105	.	.	ENSG00000179057	ENST00000513874	T	0.57107	0.42	2.46	2.46	0.29980	.	0.000000	0.40302	N	0.001133	T	0.61640	0.2363	M	0.72479	2.2	0.23855	N	0.996657	D	0.57899	0.981	D	0.69824	0.966	T	0.49643	-0.8918	10	0.20519	T	0.43	.	4.8195	0.13383	0.0:0.7302:0.0:0.2698	.	227	D6RGV7	.	N	227	ENSP00000421191:K227N	ENSP00000322422:K227N	K	-	3	2	IGSF22	18697854	0.981000	0.34729	0.998000	0.56505	0.932000	0.56968	0.084000	0.14891	1.049000	0.40321	0.650000	0.86243	AAG	IGSF22	-	NULL	ENSG00000179057		0.522	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	-	0.00	56	0	C	NM_173588		18741278	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	44.94	49	40	SNP	1.000	G
IGSF22	283284	genome.wustl.edu	37	11	18741278	18741278	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:18741278C>G	ENST00000513874.1	-	7	820	c.681G>C	c.(679-681)aaG>aaC	p.K227N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	227	Lys-rich.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CCTCTACTTTCTTCTTCATCT	0.522																																																	0													113.0	115.0	114.0					11																	18741278		1915	4125	6040	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.681G>C	11.37:g.18741278C>G	ENSP00000421191:p.Lys227Asn		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K227N	ENST00000513874.1	37	c.681	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	13.91	2.376785	0.42105	.	.	ENSG00000179057	ENST00000513874	T	0.57107	0.42	2.46	2.46	0.29980	.	0.000000	0.40302	N	0.001133	T	0.61640	0.2363	M	0.72479	2.2	0.23855	N	0.996657	D	0.57899	0.981	D	0.69824	0.966	T	0.49643	-0.8918	10	0.20519	T	0.43	.	4.8195	0.13383	0.0:0.7302:0.0:0.2698	.	227	D6RGV7	.	N	227	ENSP00000421191:K227N	ENSP00000322422:K227N	K	-	3	2	IGSF22	18697854	0.981000	0.34729	0.998000	0.56505	0.932000	0.56968	0.084000	0.14891	1.049000	0.40321	0.650000	0.86243	AAG	IGSF22	-	NULL	ENSG00000179057		0.522	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	-	0.00	79	0	C	NM_173588		18741278	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	44.94	49	40	SNP	1.000	G
IL22RA1	58985	genome.wustl.edu	37	1	24447957	24447957	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:24447957C>T	ENST00000270800.1	-	7	1101	c.1063G>A	c.(1063-1065)Gct>Act	p.A355T		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	355					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TCAGGGGCAGCGTTTGGGGCA	0.612																																																	0													96.0	102.0	100.0					1																	24447957		2203	4300	6503	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.1063G>A	1.37:g.24447957C>T	ENSP00000270800:p.Ala355Thr		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.A355T	ENST00000270800.1	37	c.1063	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426554	0.25726	.	.	ENSG00000142677	ENST00000270800	T	0.10099	2.91	5.12	-1.02	0.10135	.	0.815512	0.10923	N	0.619173	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.45556	-0.9253	10	0.12766	T	0.61	-19.2556	3.6259	0.08113	0.1739:0.3785:0.0:0.4476	.	287;355	B4E2V9;Q8N6P7	.;I22R1_HUMAN	T	355	ENSP00000270800:A355T	ENSP00000270800:A355T	A	-	1	0	IL22RA1	24320544	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.511000	0.06321	0.202000	0.20498	-0.464000	0.05259	GCT	IL22RA1	-	NULL	ENSG00000142677		0.612	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	-	0.00	81	0	C			24447957	-1	tier1	-	no_errors	ENST00000270800	ensembl	human	novel	74_37	missense	11.11	72	9	SNP	0.000	T
IL22RA1	58985	genome.wustl.edu	37	1	24447957	24447957	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:24447957C>T	ENST00000270800.1	-	7	1101	c.1063G>A	c.(1063-1065)Gct>Act	p.A355T		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	355					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TCAGGGGCAGCGTTTGGGGCA	0.612																																																	0													96.0	102.0	100.0					1																	24447957		2203	4300	6503	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.1063G>A	1.37:g.24447957C>T	ENSP00000270800:p.Ala355Thr		A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.A355T	ENST00000270800.1	37	c.1063	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.426554	0.25726	.	.	ENSG00000142677	ENST00000270800	T	0.10099	2.91	5.12	-1.02	0.10135	.	0.815512	0.10923	N	0.619173	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.45556	-0.9253	10	0.12766	T	0.61	-19.2556	3.6259	0.08113	0.1739:0.3785:0.0:0.4476	.	287;355	B4E2V9;Q8N6P7	.;I22R1_HUMAN	T	355	ENSP00000270800:A355T	ENSP00000270800:A355T	A	-	1	0	IL22RA1	24320544	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-0.511000	0.06321	0.202000	0.20498	-0.464000	0.05259	GCT	IL22RA1	-	NULL	ENSG00000142677		0.612	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	-	0.00	83	0	C			24447957	-1	tier1	-	no_errors	ENST00000270800	ensembl	human	novel	74_37	missense	11.11	72	9	SNP	0.000	T
IQCE	23288	genome.wustl.edu	37	7	2638117	2638117	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:2638117C>T	ENST00000402050.2	+	17	1643	c.1459C>T	c.(1459-1461)Ccc>Tcc	p.P487S	IQCE_ENST00000438376.2_Missense_Mutation_p.P471S|IQCE_ENST00000325979.7_Missense_Mutation_p.P422S|IQCE_ENST00000404984.1_Missense_Mutation_p.P436S	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	487						mitochondrion (GO:0005739)		p.P487S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GCTCCCAGCTCCCACTCCCAG	0.627																																																	1	Substitution - Missense(1)	breast(1)											90.0	104.0	99.0					7																	2638117		2000	4146	6146	SO:0001583	missense	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1459C>T	7.37:g.2638117C>T	ENSP00000385597:p.Pro487Ser		Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.P487S	ENST00000402050.2	37	c.1459	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	C	8.434	0.849384	0.17034	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	T;T;T;T;T	0.26957	2.85;2.84;2.85;2.85;1.7	4.93	-2.89	0.05665	.	1.902400	0.02435	N	0.083982	T	0.15955	0.0384	N	0.21583	0.68	0.09310	N	1	B;B;B;B;B;B	0.23442	0.017;0.017;0.018;0.085;0.017;0.037	B;B;B;B;B;B	0.18561	0.009;0.009;0.007;0.015;0.006;0.022	T	0.22452	-1.0216	10	0.10111	T	0.7	-2.9415	9.3497	0.38131	0.0:0.7407:0.131:0.1284	.	422;471;422;487;487;471	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	S	487;436;471;422;67	ENSP00000385597:P487S;ENSP00000385945:P436S;ENSP00000396178:P471S;ENSP00000313772:P422S;ENSP00000405982:P67S	ENSP00000313772:P422S	P	+	1	0	IQCE	2604643	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-1.580000	0.02121	-1.133000	0.02903	-0.345000	0.07892	CCC	IQCE	-	NULL	ENSG00000106012		0.627	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	61	0	C	NM_152558		2638117	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	missense	39.18	59	38	SNP	0.000	T
IQCE	23288	genome.wustl.edu	37	7	2638117	2638117	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:2638117C>T	ENST00000402050.2	+	17	1643	c.1459C>T	c.(1459-1461)Ccc>Tcc	p.P487S	IQCE_ENST00000438376.2_Missense_Mutation_p.P471S|IQCE_ENST00000325979.7_Missense_Mutation_p.P422S|IQCE_ENST00000404984.1_Missense_Mutation_p.P436S	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	487						mitochondrion (GO:0005739)		p.P487S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GCTCCCAGCTCCCACTCCCAG	0.627																																																	1	Substitution - Missense(1)	breast(1)											90.0	104.0	99.0					7																	2638117		2000	4146	6146	SO:0001583	missense	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1459C>T	7.37:g.2638117C>T	ENSP00000385597:p.Pro487Ser		Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.P487S	ENST00000402050.2	37	c.1459	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	C	8.434	0.849384	0.17034	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	T;T;T;T;T	0.26957	2.85;2.84;2.85;2.85;1.7	4.93	-2.89	0.05665	.	1.902400	0.02435	N	0.083982	T	0.15955	0.0384	N	0.21583	0.68	0.09310	N	1	B;B;B;B;B;B	0.23442	0.017;0.017;0.018;0.085;0.017;0.037	B;B;B;B;B;B	0.18561	0.009;0.009;0.007;0.015;0.006;0.022	T	0.22452	-1.0216	10	0.10111	T	0.7	-2.9415	9.3497	0.38131	0.0:0.7407:0.131:0.1284	.	422;471;422;487;487;471	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	S	487;436;471;422;67	ENSP00000385597:P487S;ENSP00000385945:P436S;ENSP00000396178:P471S;ENSP00000313772:P422S;ENSP00000405982:P67S	ENSP00000313772:P422S	P	+	1	0	IQCE	2604643	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-1.580000	0.02121	-1.133000	0.02903	-0.345000	0.07892	CCC	IQCE	-	NULL	ENSG00000106012		0.627	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	76	0	C	NM_152558		2638117	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	missense	39.18	59	38	SNP	0.000	T
ITPR2	3709	genome.wustl.edu	37	12	26774191	26774191	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:26774191G>T	ENST00000381340.3	-	26	3743	c.3327C>A	c.(3325-3327)taC>taA	p.Y1109*	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'UTR	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1109					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGATTTGCTTGTAGTTATCTA	0.373																																																	0													260.0	228.0	238.0					12																	26774191		1860	4123	5983	SO:0001587	stop_gained	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3327C>A	12.37:g.26774191G>T	ENSP00000370744:p.Tyr1109*		O94773	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.Y1109*	ENST00000381340.3	37	c.3327	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	45	11.534383	0.99573	.	.	ENSG00000123104	ENST00000381340	.	.	.	4.82	4.82	0.62117	.	0.255861	0.40818	N	0.001007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1004	0.89504	0.0:0.0:1.0:0.0	.	.	.	.	X	1109	.	ENSP00000370744:Y1109X	Y	-	3	2	ITPR2	26665458	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.968000	0.56809	2.501000	0.84356	0.650000	0.86243	TAC	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.373	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	-	0.00	38	0	G	NM_002223		26774191	-1	tier1	-	no_errors	ENST00000381340	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	T
ITPR2	3709	genome.wustl.edu	37	12	26774191	26774191	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:26774191G>T	ENST00000381340.3	-	26	3743	c.3327C>A	c.(3325-3327)taC>taA	p.Y1109*	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'UTR	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1109					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGATTTGCTTGTAGTTATCTA	0.373																																																	0													260.0	228.0	238.0					12																	26774191		1860	4123	5983	SO:0001587	stop_gained	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3327C>A	12.37:g.26774191G>T	ENSP00000370744:p.Tyr1109*		O94773	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.Y1109*	ENST00000381340.3	37	c.3327	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	45	11.534383	0.99573	.	.	ENSG00000123104	ENST00000381340	.	.	.	4.82	4.82	0.62117	.	0.255861	0.40818	N	0.001007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1004	0.89504	0.0:0.0:1.0:0.0	.	.	.	.	X	1109	.	ENSP00000370744:Y1109X	Y	-	3	2	ITPR2	26665458	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.968000	0.56809	2.501000	0.84356	0.650000	0.86243	TAC	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.373	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	-	0.00	66	0	G	NM_002223		26774191	-1	tier1	-	no_errors	ENST00000381340	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	T
JMY	133746	genome.wustl.edu	37	5	78610246	78610246	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr5:78610246G>A	ENST00000396137.4	+	9	2693	c.2231G>A	c.(2230-2232)cGt>cAt	p.R744H	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	744					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		AGAGTCAAGCGTGGGCCATCA	0.468																																																	0													131.0	141.0	138.0					5																	78610246		2131	4251	6382	SO:0001583	missense	0			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2231G>A	5.37:g.78610246G>A	ENSP00000379441:p.Arg744His		A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	pfscan_WH2_dom	p.R744H	ENST00000396137.4	37	c.2231	CCDS4047.3	5	.	.	.	.	.	.	.	.	.	.	G	3.077	-0.189781	0.06299	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.74315	-0.83	4.36	0.517	0.17025	.	1.578950	0.04125	N	0.316954	T	0.49115	0.1538	N	0.08118	0	0.09310	N	1	P	0.39782	0.688	B	0.34722	0.188	T	0.44143	-0.9347	10	0.39692	T	0.17	.	0.5582	0.00674	0.166:0.2423:0.1884:0.4034	.	744	Q8N9B5	JMY_HUMAN	H	744	ENSP00000379441:R744H	ENSP00000282259:R744H	R	+	2	0	JMY	78646002	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.249000	0.18216	-0.156000	0.11079	-1.623000	0.00790	CGT	JMY	-	NULL	ENSG00000152409		0.468	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMY	HGNC	protein_coding	OTTHUMT00000254070.4		0.00	37	0	G	NM_152405		78610246	+1			no_errors	ENST00000396137	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.000	A
KCNT2	343450	genome.wustl.edu	37	1	196459055	196459055	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:196459055C>T	ENST00000294725.9	-	3	1103	c.188G>A	c.(187-189)cGc>cAc	p.R63H	KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.R63H|KCNT2_ENST00000367433.5_Missense_Mutation_p.R63H|KCNT2_ENST00000609185.1_Missense_Mutation_p.R63H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	63					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R63P(1)|p.R63H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						ATTGAACAGGCGTATCCTTAG	0.289																																																	2	Substitution - Missense(2)	prostate(1)|lung(1)											90.0	97.0	94.0					1																	196459055		2203	4291	6494	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.188G>A	1.37:g.196459055C>T	ENSP00000294725:p.Arg63His		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.R63H	ENST00000294725.9	37	c.188	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785763	0.90282	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.21361	2.01;2.04;2.27	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000007	T	0.51787	0.1695	M	0.86178	2.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.79784	0.978;0.993;0.954;0.978	T	0.54111	-0.8342	10	0.51188	T	0.08	-6.2909	17.1485	0.86772	0.0:1.0:0.0:0.0	.	63;63;63;63	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	H	63	ENSP00000356403:R63H;ENSP00000356401:R63H;ENSP00000294725:R63H	ENSP00000294725:R63H	R	-	2	0	KCNT2	194725678	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.744000	0.74854	2.723000	0.93209	0.655000	0.94253	CGC	KCNT2	-	NULL	ENSG00000162687		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	18	0	C	NM_198503		196459055	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	42.86	8	6	SNP	1.000	T
KCNT2	343450	genome.wustl.edu	37	1	196459055	196459055	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:196459055C>T	ENST00000294725.9	-	3	1103	c.188G>A	c.(187-189)cGc>cAc	p.R63H	KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.R63H|KCNT2_ENST00000367433.5_Missense_Mutation_p.R63H|KCNT2_ENST00000609185.1_Missense_Mutation_p.R63H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	63					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.R63P(1)|p.R63H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						ATTGAACAGGCGTATCCTTAG	0.289																																																	2	Substitution - Missense(2)	prostate(1)|lung(1)											90.0	97.0	94.0					1																	196459055		2203	4291	6494	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.188G>A	1.37:g.196459055C>T	ENSP00000294725:p.Arg63His		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.R63H	ENST00000294725.9	37	c.188	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785763	0.90282	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.21361	2.01;2.04;2.27	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000007	T	0.51787	0.1695	M	0.86178	2.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.79784	0.978;0.993;0.954;0.978	T	0.54111	-0.8342	10	0.51188	T	0.08	-6.2909	17.1485	0.86772	0.0:1.0:0.0:0.0	.	63;63;63;63	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	H	63	ENSP00000356403:R63H;ENSP00000356401:R63H;ENSP00000294725:R63H	ENSP00000294725:R63H	R	-	2	0	KCNT2	194725678	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.744000	0.74854	2.723000	0.93209	0.655000	0.94253	CGC	KCNT2	-	NULL	ENSG00000162687		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	22	0	C	NM_198503		196459055	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	42.86	8	6	SNP	1.000	T
KDM4C	23081	genome.wustl.edu	37	9	6793029	6793029	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:6793029G>T	ENST00000381309.3	+	2	606	c.41G>T	c.(40-42)tGt>tTt	p.C14F	KDM4C_ENST00000401787.3_Missense_Mutation_p.C14F|KDM4C_ENST00000535193.1_Missense_Mutation_p.C36F|KDM4C_ENST00000381306.3_Missense_Mutation_p.C14F|KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000543771.1_Missense_Mutation_p.C14F	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	14					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AACCCCAGCTGTAAGATAATG	0.493																																																	0													146.0	153.0	151.0					9																	6793029		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.41G>T	9.37:g.6793029G>T	ENSP00000370710:p.Cys14Phe		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.C14F	ENST00000381309.3	37	c.41	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264705	0.80358	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.20069	2.12;2.1;2.22;2.28;2.18	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.48205	0.1487	M	0.69823	2.125	0.80722	D	1	D;D;B;P;P;P	0.76494	0.999;0.999;0.069;0.902;0.7;0.801	D;D;B;P;B;P	0.77004	0.989;0.952;0.019;0.653;0.36;0.563	T	0.45920	-0.9228	10	0.72032	D	0.01	-7.8889	18.3414	0.90307	0.0:0.0:1.0:0.0	.	14;14;14;36;14;14	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	F	36;14;14;14;14	ENSP00000442382:C36F;ENSP00000445427:C14F;ENSP00000383990:C14F;ENSP00000370710:C14F;ENSP00000370707:C14F	ENSP00000370707:C14F	C	+	2	0	KDM4C	6783029	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.785000	0.91822	2.597000	0.87782	0.655000	0.94253	TGT	KDM4C	-	NULL	ENSG00000107077		0.493	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	32	0	G	NM_015061		6793029	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KDM4C	23081	genome.wustl.edu	37	9	6793029	6793029	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:6793029G>T	ENST00000381309.3	+	2	606	c.41G>T	c.(40-42)tGt>tTt	p.C14F	KDM4C_ENST00000401787.3_Missense_Mutation_p.C14F|KDM4C_ENST00000535193.1_Missense_Mutation_p.C36F|KDM4C_ENST00000381306.3_Missense_Mutation_p.C14F|KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000543771.1_Missense_Mutation_p.C14F	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	14					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AACCCCAGCTGTAAGATAATG	0.493																																																	0													146.0	153.0	151.0					9																	6793029		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.41G>T	9.37:g.6793029G>T	ENSP00000370710:p.Cys14Phe		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.C14F	ENST00000381309.3	37	c.41	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264705	0.80358	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.20069	2.12;2.1;2.22;2.28;2.18	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.48205	0.1487	M	0.69823	2.125	0.80722	D	1	D;D;B;P;P;P	0.76494	0.999;0.999;0.069;0.902;0.7;0.801	D;D;B;P;B;P	0.77004	0.989;0.952;0.019;0.653;0.36;0.563	T	0.45920	-0.9228	10	0.72032	D	0.01	-7.8889	18.3414	0.90307	0.0:0.0:1.0:0.0	.	14;14;14;36;14;14	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	F	36;14;14;14;14	ENSP00000442382:C36F;ENSP00000445427:C14F;ENSP00000383990:C14F;ENSP00000370710:C14F;ENSP00000370707:C14F	ENSP00000370707:C14F	C	+	2	0	KDM4C	6783029	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.785000	0.91822	2.597000	0.87782	0.655000	0.94253	TGT	KDM4C	-	NULL	ENSG00000107077		0.493	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	45	0	G	NM_015061		6793029	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KHNYN	23351	genome.wustl.edu	37	14	24900129	24900130	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:24900129_24900130delAG	ENST00000251343.5	+	2	332_333	c.193_194delAG	c.(193-195)agafs	p.R65fs	CBLN3_ENST00000267406.6_5'Flank|CBLN3_ENST00000555436.1_5'UTR|KHNYN_ENST00000556842.1_Frame_Shift_Del_p.R65fs|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Frame_Shift_Del_p.R65fs			O15037	KHNYN_HUMAN	KH and NYN domain containing	65							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						AAACGCCAGCAGAGCCAAGGTG	0.653																																																	0																																										SO:0001589	frameshift_variant	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.193_194delAG	14.37:g.24900131_24900132delAG	ENSP00000251343:p.Arg65fs		Q86TZ6|Q8IUQ2|Q96BA9	Frame_Shift_Del	DEL	pfam_RNase_Zc3h12	p.R65fs	ENST00000251343.5	37	c.193_194	CCDS32058.1	14																																																																																			KHNYN	-	NULL	ENSG00000100441		0.653	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	HGNC	protein_coding	OTTHUMT00000412928.1		0.00	41	0	AG			24900130	+1	tier1		no_errors	ENST00000251343	ensembl	human	known	74_37	frame_shift_del	39.53	26	17	DEL	1.000:1.000	-
KHNYN	23351	genome.wustl.edu	37	14	24900129	24900130	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:24900129_24900130delAG	ENST00000251343.5	+	2	332_333	c.193_194delAG	c.(193-195)agafs	p.R65fs	CBLN3_ENST00000267406.6_5'Flank|CBLN3_ENST00000555436.1_5'UTR|KHNYN_ENST00000556842.1_Frame_Shift_Del_p.R65fs|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Frame_Shift_Del_p.R65fs			O15037	KHNYN_HUMAN	KH and NYN domain containing	65							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						AAACGCCAGCAGAGCCAAGGTG	0.653																																																	0																																										SO:0001589	frameshift_variant	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.193_194delAG	14.37:g.24900131_24900132delAG	ENSP00000251343:p.Arg65fs		Q86TZ6|Q8IUQ2|Q96BA9	Frame_Shift_Del	DEL	pfam_RNase_Zc3h12	p.R65fs	ENST00000251343.5	37	c.193_194	CCDS32058.1	14																																																																																			KHNYN	-	NULL	ENSG00000100441		0.653	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	HGNC	protein_coding	OTTHUMT00000412928.1		0.00	53	0	AG			24900130	+1	tier1		no_errors	ENST00000251343	ensembl	human	known	74_37	frame_shift_del	39.53	26	17	DEL	1.000:1.000	-
KIAA1211L	343990	genome.wustl.edu	37	2	99449396	99449396	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:99449396C>T	ENST00000397899.2	-	4	635	c.304G>A	c.(304-306)Gga>Aga	p.G102R	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	102								p.G102R(1)									GCGTCCTGTCCGGACTCAGGA	0.547																																																	1	Substitution - Missense(1)	lung(1)											133.0	145.0	141.0					2																	99449396		1932	4131	6063	SO:0001583	missense	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.304G>A	2.37:g.99449396C>T	ENSP00000380996:p.Gly102Arg			Missense_Mutation	SNP	NULL	p.G102R	ENST00000397899.2	37	c.304	CCDS42720.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933629	0.73442	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.46063	0.88	4.82	3.92	0.45320	.	0.000000	0.46145	D	0.000315	T	0.59197	0.2176	M	0.63843	1.955	0.27825	N	0.941662	D	0.89917	1.0	D	0.79784	0.993	T	0.53019	-0.8497	10	0.72032	D	0.01	-9.9826	12.73	0.57193	0.0:0.9185:0.0:0.0815	.	102	Q6NV74	CB055_HUMAN	R	102;130;116;116	ENSP00000380996:G102R	ENSP00000380996:G102R	G	-	1	0	C2orf55	98815828	0.909000	0.30893	0.994000	0.49952	0.969000	0.65631	2.112000	0.41892	2.487000	0.83934	0.561000	0.74099	GGA	KIAA1211L	-	NULL	ENSG00000196872		0.547	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	-	0.00	22	0	C	NM_207362		99449396	-1	tier1	-	no_errors	ENST00000397899	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.702	T
KIAA1211L	343990	genome.wustl.edu	37	2	99449396	99449396	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:99449396C>T	ENST00000397899.2	-	4	635	c.304G>A	c.(304-306)Gga>Aga	p.G102R	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	102								p.G102R(1)									GCGTCCTGTCCGGACTCAGGA	0.547																																																	1	Substitution - Missense(1)	lung(1)											133.0	145.0	141.0					2																	99449396		1932	4131	6063	SO:0001583	missense	0			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.304G>A	2.37:g.99449396C>T	ENSP00000380996:p.Gly102Arg			Missense_Mutation	SNP	NULL	p.G102R	ENST00000397899.2	37	c.304	CCDS42720.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933629	0.73442	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.46063	0.88	4.82	3.92	0.45320	.	0.000000	0.46145	D	0.000315	T	0.59197	0.2176	M	0.63843	1.955	0.27825	N	0.941662	D	0.89917	1.0	D	0.79784	0.993	T	0.53019	-0.8497	10	0.72032	D	0.01	-9.9826	12.73	0.57193	0.0:0.9185:0.0:0.0815	.	102	Q6NV74	CB055_HUMAN	R	102;130;116;116	ENSP00000380996:G102R	ENSP00000380996:G102R	G	-	1	0	C2orf55	98815828	0.909000	0.30893	0.994000	0.49952	0.969000	0.65631	2.112000	0.41892	2.487000	0.83934	0.561000	0.74099	GGA	KIAA1211L	-	NULL	ENSG00000196872		0.547	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211L	HGNC	protein_coding	OTTHUMT00000329933.1	-	0.00	24	0	C	NM_207362		99449396	-1	tier1	-	no_errors	ENST00000397899	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.702	T
KLF7	8609	genome.wustl.edu	37	2	207945782	207945783	+	3'UTR	DEL	TA	TA	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:207945782_207945783delTA	ENST00000309446.6	-	0	1439_1440				KLF7_ENST00000423015.1_3'UTR|KLF7_ENST00000467833.1_5'UTR|KLF7_ENST00000412414.2_3'UTR|KLF7_ENST00000421199.1_3'UTR|KLF7_ENST00000458272.1_3'UTR	NM_003709.3	NP_003700.1	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)						axon guidance (GO:0007411)|dendrite morphogenesis (GO:0048813)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|large_intestine(3)|liver(1)|lung(4)|skin(1)	11				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		tgagtgtgtgtatatgtgtgtg	0.46																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB015132	CCDS2373.1, CCDS59438.1, CCDS59439.1, CCDS59440.1	2q32	2013-01-08			ENSG00000118263	ENSG00000118263		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6350	protein-coding gene	gene with protein product		604865				9774444	Standard	NM_003709		Approved	UKLF	uc010zix.2	O75840	OTTHUMG00000132935	ENST00000309446.6:c.*155TA>-	2.37:g.207945784_207945785delTA			B2RB03|B7Z4F7|C9JF04|E7EWH1|L0R4P2|Q7Z3H8|Q96E51	RNA	DEL	-	NULL	ENST00000309446.6	37	NULL	CCDS2373.1	2																																																																																			KLF7	-	-	ENSG00000118263		0.460	KLF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF7	HGNC	protein_coding	OTTHUMT00000256466.2		0.00	45	0	TA	NM_003709		207945783	-1	tier1		no_errors	ENST00000467833	ensembl	human	putative	74_37	rna	13.33	26	4	DEL	0.958:0.994	-
KLHL26	55295	genome.wustl.edu	37	19	18779978	18779978	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:18779978G>A	ENST00000300976.4	+	3	1861	c.1771G>A	c.(1771-1773)Gac>Aac	p.D591N	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	591										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GTGGGAGCGGGACCTGCACTT	0.662																																																	0													27.0	31.0	30.0					19																	18779978		2202	4294	6496	SO:0001583	missense	0				CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.1771G>A	19.37:g.18779978G>A	ENSP00000300976:p.Asp591Asn		Q8TAP0|Q9NUX3	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D591N	ENST00000300976.4	37	c.1771	CCDS12384.1	19	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395422	0.83011	.	.	ENSG00000167487	ENST00000300976	T	0.66280	-0.2	4.34	4.34	0.51931	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	L	0.27053	0.805	0.80722	D	1	P	0.47841	0.901	P	0.45474	0.482	T	0.53436	-0.8439	9	.	.	.	.	15.8375	0.78811	0.0:0.0:1.0:0.0	.	591	Q53HC5	KLH26_HUMAN	N	591	ENSP00000300976:D591N	.	D	+	1	0	KLHL26	18640978	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.569000	0.98170	1.980000	0.57719	0.462000	0.41574	GAC	KLHL26	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000167487		0.662	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL26	HGNC	protein_coding	OTTHUMT00000465145.1	-	0.00	45	0	G	NM_018316		18779978	+1	tier1	-	no_errors	ENST00000300976	ensembl	human	known	74_37	missense	15.22	78	14	SNP	1.000	A
KLHL26	55295	genome.wustl.edu	37	19	18779978	18779978	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:18779978G>A	ENST00000300976.4	+	3	1861	c.1771G>A	c.(1771-1773)Gac>Aac	p.D591N	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	591										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GTGGGAGCGGGACCTGCACTT	0.662																																																	0													27.0	31.0	30.0					19																	18779978		2202	4294	6496	SO:0001583	missense	0				CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.1771G>A	19.37:g.18779978G>A	ENSP00000300976:p.Asp591Asn		Q8TAP0|Q9NUX3	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D591N	ENST00000300976.4	37	c.1771	CCDS12384.1	19	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395422	0.83011	.	.	ENSG00000167487	ENST00000300976	T	0.66280	-0.2	4.34	4.34	0.51931	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	L	0.27053	0.805	0.80722	D	1	P	0.47841	0.901	P	0.45474	0.482	T	0.53436	-0.8439	9	.	.	.	.	15.8375	0.78811	0.0:0.0:1.0:0.0	.	591	Q53HC5	KLH26_HUMAN	N	591	ENSP00000300976:D591N	.	D	+	1	0	KLHL26	18640978	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.569000	0.98170	1.980000	0.57719	0.462000	0.41574	GAC	KLHL26	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000167487		0.662	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL26	HGNC	protein_coding	OTTHUMT00000465145.1	-	0.00	63	0	G	NM_018316		18779978	+1	tier1	-	no_errors	ENST00000300976	ensembl	human	known	74_37	missense	15.22	78	14	SNP	1.000	A
LILRB3	11025	genome.wustl.edu	37	19	54721222	54721222	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:54721222C>G	ENST00000391750.1	-	13	1851	c.1715G>C	c.(1714-1716)aGa>aCa	p.R572T	LILRA6_ENST00000270464.5_Missense_Mutation_p.R573T|LILRB3_ENST00000424807.1_Missense_Mutation_p.R572T|LILRA6_ENST00000440558.2_Missense_Mutation_p.R572T|LILRA6_ENST00000391735.3_3'UTR|LILRB3_ENST00000346401.6_Missense_Mutation_p.R584T|LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000419410.2_Missense_Mutation_p.R573T|LILRB3_ENST00000245620.9_Missense_Mutation_p.R573T|LILRB3_ENST00000407860.2_Missense_Mutation_p.R589T			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	572					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTCCACCTGTCTGTCCTTTGT	0.592																																																	0													101.0	100.0	100.0					19																	54721222		2192	4300	6492	SO:0001583	missense	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1715G>C	19.37:g.54721222C>G	ENSP00000375630:p.Arg572Thr		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R589T	ENST00000391750.1	37	c.1766	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	G	0.985	-0.695874	0.03279	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482;ENSG00000244482;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000440558;ENST00000270464;ENST00000419410	T;T;T;T;T;T;T;T	0.00587	6.38;6.38;6.45;6.41;6.41;6.38;6.39;6.42	2.41	-4.82	0.03171	.	.	.	.	.	T	0.00271	0.0008	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B	0.12156	0.0;0.0;0.0;0.0;0.001;0.0;0.007	T	0.39231	-0.9624	9	0.23891	T	0.37	.	5.6465	0.17592	0.0:0.3451:0.3656:0.2893	.	589;572;573;584;589;572;573	B5MCX0;F8WCY4;D3YTC4;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;.;.;LIRB3_HUMAN;.	T	572;572;584;573;589;572;573;573	ENSP00000375630:R572T;ENSP00000412771:R572T;ENSP00000345184:R584T;ENSP00000245620:R573T;ENSP00000384274:R589T;ENSP00000390120:R572T;ENSP00000270464:R573T;ENSP00000411227:R573T	ENSP00000270464:R573T	R	-	2	0	LILRB3;LILRA6	59413034	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.412000	0.07132	-2.115000	0.00831	-2.761000	0.00122	AGA	LILRB3	-	NULL	ENSG00000204577		0.592	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	-	0.00	101	0	C	NM_006864		54721222	-1	tier1	-	no_errors	ENST00000407860	ensembl	human	known	74_37	missense	17.89	101	22	SNP	0.000	G
LILRB3	11025	genome.wustl.edu	37	19	54721222	54721222	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:54721222C>G	ENST00000391750.1	-	13	1851	c.1715G>C	c.(1714-1716)aGa>aCa	p.R572T	LILRA6_ENST00000270464.5_Missense_Mutation_p.R573T|LILRB3_ENST00000424807.1_Missense_Mutation_p.R572T|LILRA6_ENST00000440558.2_Missense_Mutation_p.R572T|LILRA6_ENST00000391735.3_3'UTR|LILRB3_ENST00000346401.6_Missense_Mutation_p.R584T|LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000419410.2_Missense_Mutation_p.R573T|LILRB3_ENST00000245620.9_Missense_Mutation_p.R573T|LILRB3_ENST00000407860.2_Missense_Mutation_p.R589T			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	572					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTCCACCTGTCTGTCCTTTGT	0.592																																																	0													101.0	100.0	100.0					19																	54721222		2192	4300	6492	SO:0001583	missense	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1715G>C	19.37:g.54721222C>G	ENSP00000375630:p.Arg572Thr		C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R589T	ENST00000391750.1	37	c.1766	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	G	0.985	-0.695874	0.03279	.	.	ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000204577;ENSG00000244482;ENSG00000244482;ENSG00000244482	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000440558;ENST00000270464;ENST00000419410	T;T;T;T;T;T;T;T	0.00587	6.38;6.38;6.45;6.41;6.41;6.38;6.39;6.42	2.41	-4.82	0.03171	.	.	.	.	.	T	0.00271	0.0008	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B	0.12156	0.0;0.0;0.0;0.0;0.001;0.0;0.007	T	0.39231	-0.9624	9	0.23891	T	0.37	.	5.6465	0.17592	0.0:0.3451:0.3656:0.2893	.	589;572;573;584;589;572;573	B5MCX0;F8WCY4;D3YTC4;F8W6G6;O75022-2;O75022;O75022-3	.;.;.;.;.;LIRB3_HUMAN;.	T	572;572;584;573;589;572;573;573	ENSP00000375630:R572T;ENSP00000412771:R572T;ENSP00000345184:R584T;ENSP00000245620:R573T;ENSP00000384274:R589T;ENSP00000390120:R572T;ENSP00000270464:R573T;ENSP00000411227:R573T	ENSP00000270464:R573T	R	-	2	0	LILRB3;LILRA6	59413034	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.412000	0.07132	-2.115000	0.00831	-2.761000	0.00122	AGA	LILRB3	-	NULL	ENSG00000204577		0.592	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	-	0.00	80	0	C	NM_006864		54721222	-1	tier1	-	no_errors	ENST00000407860	ensembl	human	known	74_37	missense	17.89	101	22	SNP	0.000	G
SMG1P7	100506060	genome.wustl.edu	37	16	70269011	70269011	+	RNA	SNP	A	A	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:70269011A>C	ENST00000459379.1	-	0	0																											AGCTCCATCAAACAAAGGAGG	0.348																																																	0																																												0																															16.37:g.70269011A>C				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.348	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	140	0	A			70269011	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	23.30	158	48	SNP	1.000	C
SMG1P7	100506060	genome.wustl.edu	37	16	70269011	70269011	+	RNA	SNP	A	A	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:70269011A>C	ENST00000459379.1	-	0	0																											AGCTCCATCAAACAAAGGAGG	0.348																																																	0																																												0																															16.37:g.70269011A>C				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.348	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	148	0	A			70269011	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	23.30	158	48	SNP	1.000	C
LRRC74B	400891	genome.wustl.edu	37	22	21403732	21403732	+	3'UTR	SNP	C	C	T	rs116878923		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr22:21403732C>T	ENST00000543388.1	+	0	1692				AC002472.13_ENST00000342608.4_Intron|AC002472.13_ENST00000497328.1_Intron																lung(2)	2						acaatgttaacaacatcattc	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000543388.1:c.*1200C>T	22.37:g.21403732C>T				RNA	SNP	-	NULL	ENST00000543388.1	37	NULL		22																																																																																			AC002472.13	-	-	ENSG00000187905		0.443	AC002472.13-202	KNOWN	basic	protein_coding	LOC400891	Clone_based_vega_gene	protein_coding		-	0.00	39	0	C			21403732	+1	tier1	rs116878923	no_errors	ENST00000473769	ensembl	human	known	74_37	rna	16.67	50	10	SNP	0.006	T
GOLGA2P9	440518	genome.wustl.edu	37	19	22785662	22785662	+	RNA	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:22785662C>T	ENST00000599738.1	+	0	0				CTC-457E21.3_ENST00000600260.1_RNA|RN7SL860P_ENST00000473738.2_RNA|AC011467.1_ENST00000408863.1_RNA																							GGAGCACATCCACAGGCTAGC	0.667																																																	0																																												0																															19.37:g.22785662C>T				RNA	SNP	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.667	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC440518	Clone_based_vega_gene	processed_transcript	OTTHUMT00000464575.1	-	0.00	73	0	C			22785662	+1	tier1	-	no_errors	ENST00000600260	ensembl	human	known	74_37	rna	5.83	97	6	SNP	0.997	T
GOLGA2P9	440518	genome.wustl.edu	37	19	22785662	22785662	+	RNA	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:22785662C>T	ENST00000599738.1	+	0	0				CTC-457E21.3_ENST00000600260.1_RNA|RN7SL860P_ENST00000473738.2_RNA|AC011467.1_ENST00000408863.1_RNA																							GGAGCACATCCACAGGCTAGC	0.667																																																	0																																												0																															19.37:g.22785662C>T				RNA	SNP	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.667	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC440518	Clone_based_vega_gene	processed_transcript	OTTHUMT00000464575.1	-	0.00	81	0	C			22785662	+1	tier1	-	no_errors	ENST00000600260	ensembl	human	known	74_37	rna	5.83	97	6	SNP	0.997	T
LRRC37A3	374819	genome.wustl.edu	37	17	62855003	62855004	+	Splice_Site	INS	-	-	A	rs540207138		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr17:62855003_62855004insA	ENST00000584306.1	-	12	5235		c.e12-2		LRRC37A3_ENST00000319651.5_Splice_Site|LRRC37A3_ENST00000400877.3_Splice_Site|LRRC37A3_ENST00000339474.5_Splice_Site|LRRC37A3_ENST00000334962.5_Splice_Site	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3							integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTTTGTGAACTAAAAAAAAAAA	0.351																																																	0																																										SO:0001630	splice_region_variant	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4705-2->T	17.37:g.62855014_62855014dupA			Q49A01|Q49A80|Q8NB33	Splice_Site	INS	-	e10-2	ENST00000584306.1	37	c.4705-3_4705-2	CCDS32708.1	17																																																																																			LRRC37A3	-	-	ENSG00000176809		0.351	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1		0.00	40	0	-	NM_199340	Intron	62855004	-1	tier1		no_errors	ENST00000319651	ensembl	human	known	74_37	splice_site_ins	11.36	39	5	INS	0.379:0.384	A
LRRC61	65999	genome.wustl.edu	37	7	150034279	150034279	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:150034279C>A	ENST00000359623.4	+	3	917	c.329C>A	c.(328-330)gCc>gAc	p.A110D	LRRC61_ENST00000493307.1_Missense_Mutation_p.A110D|LRRC61_ENST00000323078.7_Missense_Mutation_p.A110D	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	110										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			AACCTACTGGCCACCCCGGGC	0.637																																																	0													28.0	30.0	29.0					7																	150034279		2203	4300	6503	SO:0001583	missense	0			BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.329C>A	7.37:g.150034279C>A	ENSP00000352642:p.Ala110Asp		B3KUW0|D3DWY8	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.A110D	ENST00000359623.4	37	c.329	CCDS5901.1	7	.	.	.	.	.	.	.	.	.	.	C	7.054	0.564997	0.13498	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.23552	1.9;1.9;1.9	4.66	2.82	0.32997	.	0.297068	0.32719	N	0.005734	T	0.15652	0.0377	L	0.39514	1.22	0.24394	N	0.99473	B	0.06786	0.001	B	0.04013	0.001	T	0.25950	-1.0117	10	0.17369	T	0.5	-7.7128	3.6929	0.08353	0.1695:0.5734:0.1644:0.0926	.	110	Q9BV99	LRC61_HUMAN	D	110	ENSP00000339047:A110D;ENSP00000352642:A110D;ENSP00000420560:A110D	ENSP00000339047:A110D	A	+	2	0	LRRC61	149665212	0.009000	0.17119	0.359000	0.25824	0.181000	0.23173	0.976000	0.29462	0.393000	0.25203	0.485000	0.47835	GCC	LRRC61	-	NULL	ENSG00000127399		0.637	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC61	HGNC	protein_coding	OTTHUMT00000350696.1	-	0.00	43	0	C	NM_023942		150034279	+1	tier1	-	no_errors	ENST00000323078	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.589	A
LRRC61	65999	genome.wustl.edu	37	7	150034279	150034279	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:150034279C>A	ENST00000359623.4	+	3	917	c.329C>A	c.(328-330)gCc>gAc	p.A110D	LRRC61_ENST00000493307.1_Missense_Mutation_p.A110D|LRRC61_ENST00000323078.7_Missense_Mutation_p.A110D	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	110										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			AACCTACTGGCCACCCCGGGC	0.637																																																	0													28.0	30.0	29.0					7																	150034279		2203	4300	6503	SO:0001583	missense	0			BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.329C>A	7.37:g.150034279C>A	ENSP00000352642:p.Ala110Asp		B3KUW0|D3DWY8	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.A110D	ENST00000359623.4	37	c.329	CCDS5901.1	7	.	.	.	.	.	.	.	.	.	.	C	7.054	0.564997	0.13498	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.23552	1.9;1.9;1.9	4.66	2.82	0.32997	.	0.297068	0.32719	N	0.005734	T	0.15652	0.0377	L	0.39514	1.22	0.24394	N	0.99473	B	0.06786	0.001	B	0.04013	0.001	T	0.25950	-1.0117	10	0.17369	T	0.5	-7.7128	3.6929	0.08353	0.1695:0.5734:0.1644:0.0926	.	110	Q9BV99	LRC61_HUMAN	D	110	ENSP00000339047:A110D;ENSP00000352642:A110D;ENSP00000420560:A110D	ENSP00000339047:A110D	A	+	2	0	LRRC61	149665212	0.009000	0.17119	0.359000	0.25824	0.181000	0.23173	0.976000	0.29462	0.393000	0.25203	0.485000	0.47835	GCC	LRRC61	-	NULL	ENSG00000127399		0.637	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC61	HGNC	protein_coding	OTTHUMT00000350696.1	-	0.00	70	0	C	NM_023942		150034279	+1	tier1	-	no_errors	ENST00000323078	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.589	A
MAGEB6	158809	genome.wustl.edu	37	X	26213165	26213165	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:26213165G>C	ENST00000379034.1	+	2	1351	c.1202G>C	c.(1201-1203)aGa>aCa	p.R401T		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	401										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GAGGTAGAGAGAGCATTGAGA	0.502																																																	0													118.0	109.0	112.0					X																	26213165		2202	4300	6502	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1202G>C	X.37:g.26213165G>C	ENSP00000368320:p.Arg401Thr		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R401T	ENST00000379034.1	37	c.1202	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548896	0.27652	.	.	ENSG00000176746	ENST00000379034	T	0.03124	4.04	3.29	-1.64	0.08318	.	0.769745	0.11298	U	0.578531	T	0.11153	0.0272	M	0.72576	2.205	0.09310	N	1	D	0.67145	0.996	P	0.61070	0.883	T	0.07597	-1.0764	10	0.72032	D	0.01	.	7.6546	0.28369	0.6203:0.0:0.3797:0.0	.	401	Q8N7X4	MAGB6_HUMAN	T	401	ENSP00000368320:R401T	ENSP00000368320:R401T	R	+	2	0	MAGEB6	26123086	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.295000	0.08298	-0.628000	0.05582	-0.197000	0.12766	AGA	MAGEB6	-	NULL	ENSG00000176746		0.502	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	71	0	G	NM_173523		26213165	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	47.56	42	39	SNP	0.000	C
MAGEB6	158809	genome.wustl.edu	37	X	26213165	26213165	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:26213165G>C	ENST00000379034.1	+	2	1351	c.1202G>C	c.(1201-1203)aGa>aCa	p.R401T		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	401										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GAGGTAGAGAGAGCATTGAGA	0.502																																																	0													118.0	109.0	112.0					X																	26213165		2202	4300	6502	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1202G>C	X.37:g.26213165G>C	ENSP00000368320:p.Arg401Thr		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R401T	ENST00000379034.1	37	c.1202	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548896	0.27652	.	.	ENSG00000176746	ENST00000379034	T	0.03124	4.04	3.29	-1.64	0.08318	.	0.769745	0.11298	U	0.578531	T	0.11153	0.0272	M	0.72576	2.205	0.09310	N	1	D	0.67145	0.996	P	0.61070	0.883	T	0.07597	-1.0764	10	0.72032	D	0.01	.	7.6546	0.28369	0.6203:0.0:0.3797:0.0	.	401	Q8N7X4	MAGB6_HUMAN	T	401	ENSP00000368320:R401T	ENSP00000368320:R401T	R	+	2	0	MAGEB6	26123086	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.295000	0.08298	-0.628000	0.05582	-0.197000	0.12766	AGA	MAGEB6	-	NULL	ENSG00000176746		0.502	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	86	0	G	NM_173523		26213165	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	47.56	42	39	SNP	0.000	C
MAGEL2	54551	genome.wustl.edu	37	15	23889169	23889169	+	Missense_Mutation	SNP	C	C	T	rs555657199	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:23889169C>T	ENST00000532292.1	-	1	2006	c.1912G>A	c.(1912-1914)Ggc>Agc	p.G638S		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	521					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTGGTGGGGCCGTGGGCACTG	0.587													C|||	4	0.000798722	0.0	0.0	5008	,	,		16329	0.004		0.0	False		,,,				2504	0.0																0													32.0	36.0	35.0					15																	23889169		2045	4187	6232	SO:0001583	missense	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1912G>A	15.37:g.23889169C>T	ENSP00000433433:p.Gly638Ser			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.G638S	ENST00000532292.1	37	c.1912		15																																																																																			MAGEL2	-	NULL	ENSG00000254585		0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	13	0	C	NM_019066		23889169	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.027	T
MAGEL2	54551	genome.wustl.edu	37	15	23889169	23889169	+	Missense_Mutation	SNP	C	C	T	rs555657199	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:23889169C>T	ENST00000532292.1	-	1	2006	c.1912G>A	c.(1912-1914)Ggc>Agc	p.G638S		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	521					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTGGTGGGGCCGTGGGCACTG	0.587													C|||	4	0.000798722	0.0	0.0	5008	,	,		16329	0.004		0.0	False		,,,				2504	0.0																0													32.0	36.0	35.0					15																	23889169		2045	4187	6232	SO:0001583	missense	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1912G>A	15.37:g.23889169C>T	ENSP00000433433:p.Gly638Ser			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.G638S	ENST00000532292.1	37	c.1912		15																																																																																			MAGEL2	-	NULL	ENSG00000254585		0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	23	0	C	NM_019066		23889169	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.027	T
MAP3K1	4214	genome.wustl.edu	37	5	56189381	56189381	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr5:56189381A>G	ENST00000399503.3	+	20	4413	c.4413A>G	c.(4411-4413)ccA>ccG	p.P1471P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CTACTGCTCCATCGATCCCTT	0.448																																																	0													129.0	124.0	126.0					5																	56189381		1992	4159	6151	SO:0001819	synonymous_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4413A>G	5.37:g.56189381A>G				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_dom	p.P1471	ENST00000399503.3	37	c.4413	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	-	0.00	27	0	A	XM_042066		56189381	+1	tier1	-	no_errors	ENST00000399503	ensembl	human	novel	74_37	silent	66.67	8	16	SNP	0.804	G
MAP3K1	4214	genome.wustl.edu	37	5	56189381	56189381	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr5:56189381A>G	ENST00000399503.3	+	20	4413	c.4413A>G	c.(4411-4413)ccA>ccG	p.P1471P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CTACTGCTCCATCGATCCCTT	0.448																																																	0													129.0	124.0	126.0					5																	56189381		1992	4159	6151	SO:0001819	synonymous_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4413A>G	5.37:g.56189381A>G				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_dom	p.P1471	ENST00000399503.3	37	c.4413	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	-	0.00	38	0	A	XM_042066		56189381	+1	tier1	-	no_errors	ENST00000399503	ensembl	human	novel	74_37	silent	66.67	8	16	SNP	0.804	G
MC5R	4161	genome.wustl.edu	37	18	13826394	13826394	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:13826394C>T	ENST00000324750.3	+	1	852	c.630C>T	c.(628-630)ctC>ctT	p.L210L	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	210					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						ACATGTTCCTCCTGGCGCGGA	0.602																																																	0													425.0	358.0	381.0					18																	13826394		2203	4300	6503	SO:0001819	synonymous_variant	0			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.630C>T	18.37:g.13826394C>T			B0YJ34|Q502V1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melancort_rcpt_5,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	p.L210	ENST00000324750.3	37	c.630	CCDS11868.1	18																																																																																			MC5R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176136		0.602	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC5R	HGNC	protein_coding	OTTHUMT00000254638.1	-	0.00	45	0	C	NM_005913		13826394	+1	tier1	-	no_errors	ENST00000324750	ensembl	human	known	74_37	silent	19.05	68	16	SNP	1.000	T
MC5R	4161	genome.wustl.edu	37	18	13826394	13826394	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:13826394C>T	ENST00000324750.3	+	1	852	c.630C>T	c.(628-630)ctC>ctT	p.L210L	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	210					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						ACATGTTCCTCCTGGCGCGGA	0.602																																																	0													425.0	358.0	381.0					18																	13826394		2203	4300	6503	SO:0001819	synonymous_variant	0			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.630C>T	18.37:g.13826394C>T			B0YJ34|Q502V1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melancort_rcpt_5,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	p.L210	ENST00000324750.3	37	c.630	CCDS11868.1	18																																																																																			MC5R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176136		0.602	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC5R	HGNC	protein_coding	OTTHUMT00000254638.1	-	0.00	68	0	C	NM_005913		13826394	+1	tier1	-	no_errors	ENST00000324750	ensembl	human	known	74_37	silent	19.05	68	16	SNP	1.000	T
MFN2	9927	genome.wustl.edu	37	1	12066704	12066704	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:12066704C>G	ENST00000235329.5	+	16	2148	c.1826C>G	c.(1825-1827)tCc>tGc	p.S609C	MFN2_ENST00000444836.1_Missense_Mutation_p.S609C	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	609					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GGCCTGGCCTCCTTGACATCC	0.642																																																	0													104.0	94.0	97.0					1																	12066704		2203	4300	6503	SO:0001583	missense	0			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1826C>G	1.37:g.12066704C>G	ENSP00000235329:p.Ser609Cys		A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.S609C	ENST00000235329.5	37	c.1826	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592612	0.66219	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.97529	-4.42;-4.42	4.79	4.79	0.61399	Fzo/mitofusin HR2 domain (1);	0.126144	0.53938	D	0.000044	D	0.97498	0.9181	M	0.88377	2.95	0.80722	D	1	B	0.30664	0.289	B	0.37451	0.25	D	0.98190	1.0462	10	0.87932	D	0	-23.4325	17.3712	0.87379	0.0:1.0:0.0:0.0	.	609	O95140	MFN2_HUMAN	C	609;609;307	ENSP00000416338:S609C;ENSP00000235329:S609C	ENSP00000235329:S609C	S	+	2	0	MFN2	11989291	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.278000	0.78587	2.633000	0.89246	0.655000	0.94253	TCC	MFN2	-	pfam_Fzo/mitofusin_HR2	ENSG00000116688		0.642	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	HGNC	protein_coding	OTTHUMT00000006859.2	-	0.00	50	0	C	NM_014874		12066704	+1	tier1	-	no_errors	ENST00000235329	ensembl	human	known	74_37	missense	31.51	50	23	SNP	1.000	G
MFN2	9927	genome.wustl.edu	37	1	12066704	12066704	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:12066704C>G	ENST00000235329.5	+	16	2148	c.1826C>G	c.(1825-1827)tCc>tGc	p.S609C	MFN2_ENST00000444836.1_Missense_Mutation_p.S609C	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	609					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GGCCTGGCCTCCTTGACATCC	0.642																																																	0													104.0	94.0	97.0					1																	12066704		2203	4300	6503	SO:0001583	missense	0			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1826C>G	1.37:g.12066704C>G	ENSP00000235329:p.Ser609Cys		A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.S609C	ENST00000235329.5	37	c.1826	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592612	0.66219	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.97529	-4.42;-4.42	4.79	4.79	0.61399	Fzo/mitofusin HR2 domain (1);	0.126144	0.53938	D	0.000044	D	0.97498	0.9181	M	0.88377	2.95	0.80722	D	1	B	0.30664	0.289	B	0.37451	0.25	D	0.98190	1.0462	10	0.87932	D	0	-23.4325	17.3712	0.87379	0.0:1.0:0.0:0.0	.	609	O95140	MFN2_HUMAN	C	609;609;307	ENSP00000416338:S609C;ENSP00000235329:S609C	ENSP00000235329:S609C	S	+	2	0	MFN2	11989291	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.278000	0.78587	2.633000	0.89246	0.655000	0.94253	TCC	MFN2	-	pfam_Fzo/mitofusin_HR2	ENSG00000116688		0.642	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	HGNC	protein_coding	OTTHUMT00000006859.2	-	0.00	72	0	C	NM_014874		12066704	+1	tier1	-	no_errors	ENST00000235329	ensembl	human	known	74_37	missense	31.51	50	23	SNP	1.000	G
FAM65C	140876	genome.wustl.edu	37	20	49231294	49231294	+	Intron	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:49231294G>A	ENST00000327979.2	-	4	748				FAM65C_ENST00000535356.1_Intron|MIR1302-5_ENST00000408164.1_RNA|FAM65C_ENST00000045083.2_Intron			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C											endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						tgatttgtctgaaaaaccaat	0.393																																																	0													39.0	34.0	35.0					20																	49231294		692	1591	2283	SO:0001627	intron_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.336+1244C>T	20.37:g.49231294G>A			Q5QPB6|Q9NQQ2	RNA	SNP	-	NULL	ENST00000327979.2	37	NULL	CCDS13431.2	20																																																																																			MIR1302-5	-	-	ENSG00000221091		0.393	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1302-5	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	45	0	G			49231294	-1	tier1	-	no_errors	ENST00000408164	ensembl	human	known	74_37	rna	11.21	95	12	SNP	0.006	A
FAM65C	140876	genome.wustl.edu	37	20	49231294	49231294	+	Intron	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:49231294G>A	ENST00000327979.2	-	4	748				FAM65C_ENST00000535356.1_Intron|MIR1302-5_ENST00000408164.1_RNA|FAM65C_ENST00000045083.2_Intron			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C											endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						tgatttgtctgaaaaaccaat	0.393																																																	0													39.0	34.0	35.0					20																	49231294		692	1591	2283	SO:0001627	intron_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.336+1244C>T	20.37:g.49231294G>A			Q5QPB6|Q9NQQ2	RNA	SNP	-	NULL	ENST00000327979.2	37	NULL	CCDS13431.2	20																																																																																			MIR1302-5	-	-	ENSG00000221091		0.393	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1302-5	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	46	0	G			49231294	-1	tier1	-	no_errors	ENST00000408164	ensembl	human	known	74_37	rna	11.21	95	12	SNP	0.006	A
MIR4300HG	101928989	genome.wustl.edu	37	11	81601792	81601792	+	lincRNA	SNP	A	A	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:81601792A>C	ENST00000500502.1	-	0	940				MIR4300_ENST00000581016.1_RNA																							ATATTGGTTCAGAAGTAGTCC	0.423																																																	0																																												0																															11.37:g.81601792A>C				RNA	SNP	-	NULL	ENST00000500502.1	37	NULL		11																																																																																			MIR4300	-	-	ENSG00000264110		0.423	RP11-179A16.1-001	KNOWN	basic	lincRNA	MIR4300	HGNC	lincRNA	OTTHUMT00000391561.2	-	0.00	52	0	A			81601792	-1	tier1	-	no_errors	ENST00000581016	ensembl	human	known	74_37	rna	16.13	78	15	SNP	0.003	C
MIR4300HG	101928989	genome.wustl.edu	37	11	81601792	81601792	+	lincRNA	SNP	A	A	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:81601792A>C	ENST00000500502.1	-	0	940				MIR4300_ENST00000581016.1_RNA																							ATATTGGTTCAGAAGTAGTCC	0.423																																																	0																																												0																															11.37:g.81601792A>C				RNA	SNP	-	NULL	ENST00000500502.1	37	NULL		11																																																																																			MIR4300	-	-	ENSG00000264110		0.423	RP11-179A16.1-001	KNOWN	basic	lincRNA	MIR4300	HGNC	lincRNA	OTTHUMT00000391561.2	-	0.00	53	0	A			81601792	-1	tier1	-	no_errors	ENST00000581016	ensembl	human	known	74_37	rna	16.13	78	15	SNP	0.003	C
MMP13	4322	genome.wustl.edu	37	11	102826188	102826188	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:102826188A>T	ENST00000260302.3	-	2	183	c.155T>A	c.(154-156)cTc>cAc	p.L52H	MMP13_ENST00000340273.4_Missense_Mutation_p.L52H	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	52					bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	GATTCCCGCGAGATTTGTAGG	0.463																																																	0													157.0	152.0	153.0					11																	102826188		2202	4299	6501	SO:0001583	missense	0			X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.155T>A	11.37:g.102826188A>T	ENSP00000260302:p.Leu52His		A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.L52H	ENST00000260302.3	37	c.155	CCDS8324.1	11	.	.	.	.	.	.	.	.	.	.	A	12.96	2.093532	0.36952	.	.	ENSG00000137745	ENST00000260302;ENST00000546012;ENST00000340273	T;T	0.38240	1.15;1.15	5.77	2.43	0.29744	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	1.701590	0.02588	N	0.099694	T	0.46852	0.1414	L	0.40543	1.245	0.40322	D	0.978839	D	0.58970	0.984	P	0.55577	0.779	T	0.08229	-1.0732	10	0.49607	T	0.09	.	8.7101	0.34378	0.3138:0.0:0.6862:0.0	.	52	P45452	MMP13_HUMAN	H	52	ENSP00000260302:L52H;ENSP00000339672:L52H	ENSP00000260302:L52H	L	-	2	0	MMP13	102331398	0.913000	0.31002	0.972000	0.41901	0.225000	0.24961	1.480000	0.35464	0.229000	0.21039	0.533000	0.62120	CTC	MMP13	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_Metazoans	ENSG00000137745		0.463	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MMP13	HGNC	protein_coding	OTTHUMT00000386648.1		0.00	39	0	A	NM_002427		102826188	-1			no_errors	ENST00000340273	ensembl	human	novel	74_37	missense	5.88	48	3	SNP	0.980	T
MRPS15	64960	genome.wustl.edu	37	1	36923529	36923529	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:36923529G>A	ENST00000373116.5	-	6	600	c.439C>T	c.(439-441)Cga>Tga	p.R147*	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	147					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTTACCTTTCGATGTTTCTCC	0.507																																																	0													152.0	133.0	139.0					1																	36923529		2203	4300	6503	SO:0001587	stop_gained	0			AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.439C>T	1.37:g.36923529G>A	ENSP00000362208:p.Arg147*		B2RD82|Q9H2K1	Nonsense_Mutation	SNP	pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	p.R147*	ENST00000373116.5	37	c.439	CCDS411.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.814139	0.97857	.	.	ENSG00000116898	ENST00000373116	.	.	.	5.49	5.49	0.81192	.	0.137493	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5622	18.3538	0.90348	0.0:0.0:1.0:0.0	.	.	.	.	X	147	.	ENSP00000362208:R147X	R	-	1	2	MRPS15	36696116	1.000000	0.71417	0.950000	0.38849	0.907000	0.53573	6.296000	0.72751	2.559000	0.86315	0.563000	0.77884	CGA	MRPS15	-	pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	ENSG00000116898		0.507	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS15	HGNC	protein_coding	OTTHUMT00000022052.2	-	0.00	48	0	G	NM_031280		36923529	-1	tier1	-	no_errors	ENST00000373116	ensembl	human	known	74_37	nonsense	25.93	60	21	SNP	0.996	A
MRPS15	64960	genome.wustl.edu	37	1	36923529	36923529	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:36923529G>A	ENST00000373116.5	-	6	600	c.439C>T	c.(439-441)Cga>Tga	p.R147*	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	147					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTTACCTTTCGATGTTTCTCC	0.507																																																	0													152.0	133.0	139.0					1																	36923529		2203	4300	6503	SO:0001587	stop_gained	0			AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.439C>T	1.37:g.36923529G>A	ENSP00000362208:p.Arg147*		B2RD82|Q9H2K1	Nonsense_Mutation	SNP	pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	p.R147*	ENST00000373116.5	37	c.439	CCDS411.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.814139	0.97857	.	.	ENSG00000116898	ENST00000373116	.	.	.	5.49	5.49	0.81192	.	0.137493	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.5622	18.3538	0.90348	0.0:0.0:1.0:0.0	.	.	.	.	X	147	.	ENSP00000362208:R147X	R	-	1	2	MRPS15	36696116	1.000000	0.71417	0.950000	0.38849	0.907000	0.53573	6.296000	0.72751	2.559000	0.86315	0.563000	0.77884	CGA	MRPS15	-	pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	ENSG00000116898		0.507	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS15	HGNC	protein_coding	OTTHUMT00000022052.2	-	0.00	68	0	G	NM_031280		36923529	-1	tier1	-	no_errors	ENST00000373116	ensembl	human	known	74_37	nonsense	25.93	60	21	SNP	0.996	A
MRVI1	10335	genome.wustl.edu	37	11	10650303	10650303	+	Missense_Mutation	SNP	G	G	A	rs373371120		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:10650303G>A	ENST00000436272.1	-	5	698	c.620C>T	c.(619-621)cCg>cTg	p.P207L	MRVI1_ENST00000532037.1_5'Flank|MRVI1_ENST00000423302.2_Missense_Mutation_p.P216L|MRVI1_ENST00000421747.1_Missense_Mutation_p.P207L|MRVI1_ENST00000531107.1_Missense_Mutation_p.P207L|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000541483.1_Missense_Mutation_p.P216L|MRVI1_ENST00000552103.1_Missense_Mutation_p.P125L|MRVI1_ENST00000547195.1_Missense_Mutation_p.P125L|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000527509.2_Missense_Mutation_p.P125L			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	207					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTCACCTGGCGGGGTGGGGAC	0.632																																																	0								G	LEU/PRO,LEU/PRO,,LEU/PRO,,LEU/PRO	0,3996		0,0,1998	38.0	49.0	45.0		620,374,,647,,647	0.4	0.0	11		45	2,8322		0,2,4160	no	missense,missense,utr-5,missense,utr-5,missense	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	98,98,,98,,98	0,2,6158	AA,AG,GG		0.024,0.0,0.0162	benign,benign,,benign,,benign	207/905,125/822,,216/707,,216/913	10650303	2,12318	1998	4162	6160	SO:0001583	missense	0			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.620C>T	11.37:g.10650303G>A	ENSP00000412229:p.Pro207Leu		B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	pfam_MRVI1	p.P207L	ENST00000436272.1	37	c.620		11	.	.	.	.	.	.	.	.	.	.	G	8.504	0.865021	0.17250	0.0	2.4E-4	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T	0.15017	3.05;3.03;2.47;2.47;2.88;2.46;3.05;2.47	5.7	0.396	0.16309	.	0.640448	0.16295	N	0.220706	T	0.13756	0.0333	L	0.56769	1.78	0.20638	N	0.999877	B;B;B;B	0.13594	0.008;0.004;0.004;0.007	B;B;B;B	0.12156	0.003;0.003;0.003;0.007	T	0.23904	-1.0175	10	0.46703	T	0.11	-0.2006	2.5027	0.04638	0.2102:0.1274:0.5307:0.1317	.	216;207;207;207	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	L	207;208;207;125;125;216;216;207;125	ENSP00000414598:P207L;ENSP00000412229:P207L;ENSP00000448278:P125L;ENSP00000446764:P125L;ENSP00000412130:P216L;ENSP00000437784:P216L;ENSP00000432436:P207L;ENSP00000432067:P125L	ENSP00000307885:P208L	P	-	2	0	MRVI1	10606879	0.013000	0.17824	0.004000	0.12327	0.024000	0.10985	0.648000	0.24828	0.080000	0.16959	-0.140000	0.14226	CCG	MRVI1	-	NULL	ENSG00000072952		0.632	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	HGNC	protein_coding		-	0.00	30	0	G	NM_001098579		10650303	-1	tier1	-	no_errors	ENST00000421747	ensembl	human	known	74_37	missense	21.28	36	10	SNP	0.016	A
MRVI1	10335	genome.wustl.edu	37	11	10650303	10650303	+	Missense_Mutation	SNP	G	G	A	rs373371120		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:10650303G>A	ENST00000436272.1	-	5	698	c.620C>T	c.(619-621)cCg>cTg	p.P207L	MRVI1_ENST00000532037.1_5'Flank|MRVI1_ENST00000423302.2_Missense_Mutation_p.P216L|MRVI1_ENST00000421747.1_Missense_Mutation_p.P207L|MRVI1_ENST00000531107.1_Missense_Mutation_p.P207L|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000541483.1_Missense_Mutation_p.P216L|MRVI1_ENST00000552103.1_Missense_Mutation_p.P125L|MRVI1_ENST00000547195.1_Missense_Mutation_p.P125L|MRVI1_ENST00000545852.1_5'UTR|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000527509.2_Missense_Mutation_p.P125L			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	207					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTCACCTGGCGGGGTGGGGAC	0.632																																																	0								G	LEU/PRO,LEU/PRO,,LEU/PRO,,LEU/PRO	0,3996		0,0,1998	38.0	49.0	45.0		620,374,,647,,647	0.4	0.0	11		45	2,8322		0,2,4160	no	missense,missense,utr-5,missense,utr-5,missense	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	98,98,,98,,98	0,2,6158	AA,AG,GG		0.024,0.0,0.0162	benign,benign,,benign,,benign	207/905,125/822,,216/707,,216/913	10650303	2,12318	1998	4162	6160	SO:0001583	missense	0			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.620C>T	11.37:g.10650303G>A	ENSP00000412229:p.Pro207Leu		B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	pfam_MRVI1	p.P207L	ENST00000436272.1	37	c.620		11	.	.	.	.	.	.	.	.	.	.	G	8.504	0.865021	0.17250	0.0	2.4E-4	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T	0.15017	3.05;3.03;2.47;2.47;2.88;2.46;3.05;2.47	5.7	0.396	0.16309	.	0.640448	0.16295	N	0.220706	T	0.13756	0.0333	L	0.56769	1.78	0.20638	N	0.999877	B;B;B;B	0.13594	0.008;0.004;0.004;0.007	B;B;B;B	0.12156	0.003;0.003;0.003;0.007	T	0.23904	-1.0175	10	0.46703	T	0.11	-0.2006	2.5027	0.04638	0.2102:0.1274:0.5307:0.1317	.	216;207;207;207	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	L	207;208;207;125;125;216;216;207;125	ENSP00000414598:P207L;ENSP00000412229:P207L;ENSP00000448278:P125L;ENSP00000446764:P125L;ENSP00000412130:P216L;ENSP00000437784:P216L;ENSP00000432436:P207L;ENSP00000432067:P125L	ENSP00000307885:P208L	P	-	2	0	MRVI1	10606879	0.013000	0.17824	0.004000	0.12327	0.024000	0.10985	0.648000	0.24828	0.080000	0.16959	-0.140000	0.14226	CCG	MRVI1	-	NULL	ENSG00000072952		0.632	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	HGNC	protein_coding		-	0.00	34	0	G	NM_001098579		10650303	-1	tier1	-	no_errors	ENST00000421747	ensembl	human	known	74_37	missense	21.28	36	10	SNP	0.016	A
MT-ATP6	4508	genome.wustl.edu	37	M	9010	9010	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrM:9010G>T	ENST00000361899.2	+	1	484	c.484G>T	c.(484-486)Gct>Tct	p.A162S	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	162					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TACGCCTAACCGCTAACATTA	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.484G>T	M.37:g.9010G>T	ENSP00000354632:p.Ala162Ser		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.A162S	ENST00000361899.2	37	c.484		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	ENSG00000198899		0.468	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		-	0.00	35	0	G	YP_003024031		9010	+1	tier1	-	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	15.38	11	2	SNP	NULL	T
MT-ATP6	4508	genome.wustl.edu	37	M	9010	9010	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrM:9010G>T	ENST00000361899.2	+	1	484	c.484G>T	c.(484-486)Gct>Tct	p.A162S	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	162					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TACGCCTAACCGCTAACATTA	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.484G>T	M.37:g.9010G>T	ENSP00000354632:p.Ala162Ser		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.A162S	ENST00000361899.2	37	c.484		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	ENSG00000198899		0.468	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		-	0.00	69	0	G	YP_003024031		9010	+1	tier1	-	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	15.38	11	2	SNP	NULL	T
MT-ATP6	4508	genome.wustl.edu	37	M	9098	9098	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrM:9098T>C	ENST00000361899.2	+	1	572	c.572T>C	c.(571-573)aTc>aCc	p.I191T	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	191					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CTCTACACTTATCATCTTCAC	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.572T>C	M.37:g.9098T>C	ENSP00000354632:p.Ile191Thr		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.I191T	ENST00000361899.2	37	c.572		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	ENSG00000198899		0.453	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		-	0.00	62	0	T	YP_003024031		9098	+1	tier1	rs201559119	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	100.00	0	15	SNP	NULL	C
MT-ND5	4540	genome.wustl.edu	37	M	13413	13413	+	Silent	SNP	A	A	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrM:13413A>C	ENST00000361567.2	+	1	1077	c.1077A>C	c.(1075-1077)atA>atC	p.I359I	MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	359					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATTCGAAAAATAGGAGGACTA	0.443																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1077A>C	M.37:g.13413A>C			Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.M359I	ENST00000361567.2	37	c.1077		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.443	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	61	0	A	YP_003024036		13413	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	15.38	11	2	SNP	NULL	C
MYH14	79784	genome.wustl.edu	37	19	50713840	50713840	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:50713840delA	ENST00000596571.1	+	1	218	c.218delA	c.(217-219)gaafs	p.E73fs	MYH14_ENST00000440075.2_Frame_Shift_Del_p.E73fs|MYH14_ENST00000376970.2_Frame_Shift_Del_p.E73fs|MYH14_ENST00000425460.1_Frame_Shift_Del_p.E73fs|MYH14_ENST00000601313.1_Frame_Shift_Del_p.E73fs|MYH14_ENST00000598205.1_Frame_Shift_Del_p.E73fs|MYH14_ENST00000262269.8_Frame_Shift_Del_p.E73fs			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	73					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CTGCGGGACGAAGGCGAGGAG	0.721																																																	0													7.0	12.0	10.0					19																	50713840		2092	4164	6256	SO:0001589	frameshift_variant	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.218delA	19.37:g.50713840delA	ENSP00000472819:p.Glu73fs		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G74fs	ENST00000596571.1	37	c.218	CCDS59411.1	19																																																																																			MYH14	-	pfam_Myosin_N,superfamily_P-loop_NTPase	ENSG00000105357		0.721	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2		0.00	17	0	A	NM_024729		50713840	+1	tier1		no_errors	ENST00000262269	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	1.000	-
MYT1L	23040	genome.wustl.edu	37	2	1926292	1926292	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:1926292A>G	ENST00000399161.2	-	10	1996	c.1249T>C	c.(1249-1251)Tcg>Ccg	p.S417P	MYT1L_ENST00000428368.2_Missense_Mutation_p.S417P	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	417					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GACCTGTCCGAGTTCACAGAG	0.582																																																	0													89.0	89.0	89.0					2																	1926292		2129	4231	6360	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1249T>C	2.37:g.1926292A>G	ENSP00000382114:p.Ser417Pro		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.S417P	ENST00000399161.2	37	c.1249		2	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198692	0.58126	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.56103	0.49;0.48	5.97	5.97	0.96955	.	0.246048	0.43110	D	0.000611	T	0.64249	0.2581	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.66999	-0.5781	10	0.72032	D	0.01	-17.6463	16.4608	0.84044	1.0:0.0:0.0:0.0	.	417;417	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	P	417;365;417	ENSP00000382114:S417P;ENSP00000396103:S417P	ENSP00000295067:S365P	S	-	1	0	MYT1L	1905299	1.000000	0.71417	0.703000	0.30354	0.036000	0.12997	9.257000	0.95545	2.288000	0.76882	0.533000	0.62120	TCG	MYT1L	-	NULL	ENSG00000186487		0.582	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	49	0	A	NM_015025		1926292	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1926292	1926292	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:1926292A>G	ENST00000399161.2	-	10	1996	c.1249T>C	c.(1249-1251)Tcg>Ccg	p.S417P	MYT1L_ENST00000428368.2_Missense_Mutation_p.S417P	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	417					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GACCTGTCCGAGTTCACAGAG	0.582																																																	0													89.0	89.0	89.0					2																	1926292		2129	4231	6360	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1249T>C	2.37:g.1926292A>G	ENSP00000382114:p.Ser417Pro		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.S417P	ENST00000399161.2	37	c.1249		2	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198692	0.58126	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.56103	0.49;0.48	5.97	5.97	0.96955	.	0.246048	0.43110	D	0.000611	T	0.64249	0.2581	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.66999	-0.5781	10	0.72032	D	0.01	-17.6463	16.4608	0.84044	1.0:0.0:0.0:0.0	.	417;417	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	P	417;365;417	ENSP00000382114:S417P;ENSP00000396103:S417P	ENSP00000295067:S365P	S	-	1	0	MYT1L	1905299	1.000000	0.71417	0.703000	0.30354	0.036000	0.12997	9.257000	0.95545	2.288000	0.76882	0.533000	0.62120	TCG	MYT1L	-	NULL	ENSG00000186487		0.582	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	63	0	A	NM_015025		1926292	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	G
MZF1	7593	genome.wustl.edu	37	19	59074805	59074805	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:59074805G>T	ENST00000215057.2	-	6	1399	c.839C>A	c.(838-840)cCc>cAc	p.P280H	MZF1_ENST00000599369.1_Missense_Mutation_p.P280H|AC016629.8_ENST00000600534.1_RNA|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000594234.1_Intron	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	280					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GAGGTCCCAGGGGACGTGGAG	0.607																																																	0													49.0	45.0	46.0					19																	59074805		2200	4298	6498	SO:0001583	missense	0			M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.839C>A	19.37:g.59074805G>T	ENSP00000215057:p.Pro280His		M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P280H	ENST00000215057.2	37	c.839	CCDS12988.1	19	.	.	.	.	.	.	.	.	.	.	.	17.31	3.357587	0.61293	.	.	ENSG00000099326	ENST00000215057	T	0.07114	3.22	3.76	3.76	0.43208	.	0.000000	0.38778	N	0.001570	T	0.05593	0.0147	N	0.08118	0	0.29939	N	0.821225	D	0.58620	0.983	P	0.47075	0.536	T	0.23691	-1.0181	10	0.22706	T	0.39	-15.9587	11.3815	0.49761	0.0:0.0:1.0:0.0	.	280	P28698	MZF1_HUMAN	H	280	ENSP00000215057:P280H	ENSP00000215057:P280H	P	-	2	0	MZF1	63766617	0.994000	0.37717	0.865000	0.33974	0.593000	0.36681	3.503000	0.53340	2.379000	0.81126	0.467000	0.42956	CCC	MZF1	-	NULL	ENSG00000099326		0.607	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MZF1	HGNC	protein_coding	OTTHUMT00000467112.1	-	0.00	52	0	G	NM_198055		59074805	-1	tier1	-	no_errors	ENST00000215057	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.764	T
NAALAD2	10003	genome.wustl.edu	37	11	89882244	89882244	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:89882244A>T	ENST00000534061.1	+	4	682	c.452A>T	c.(451-453)tAt>tTt	p.Y151F	NAALAD2_ENST00000525171.1_Missense_Mutation_p.Y151F|NAALAD2_ENST00000321955.4_Missense_Mutation_p.Y151F|NAALAD2_ENST00000375944.3_Missense_Mutation_p.Y151F	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	151					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GTGCCACCATATAATGCTTTC	0.348																																																	0													83.0	85.0	84.0					11																	89882244		2197	4287	6484	SO:0001583	missense	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.452A>T	11.37:g.89882244A>T	ENSP00000432481:p.Tyr151Phe		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.Y151F	ENST00000534061.1	37	c.452	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	A	7.220	0.597231	0.13875	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944;ENST00000526637	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000006	T	0.31327	0.0793	L	0.33293	1	0.58432	D	0.999998	B;B;B;B;B	0.34061	0.007;0.004;0.003;0.436;0.007	B;B;B;B;B	0.28553	0.016;0.013;0.008;0.091;0.013	T	0.07986	-1.0744	9	.	.	.	-16.7126	15.444	0.75213	1.0:0.0:0.0:0.0	.	151;151;151;151;151	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	F	151;151;151;151;97	ENSP00000432481:Y151F;ENSP00000320083:Y151F;ENSP00000435249:Y151F;ENSP00000365111:Y151F;ENSP00000435670:Y97F	.	Y	+	2	0	NAALAD2	89521892	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.965000	0.63708	2.043000	0.60533	0.451000	0.29950	TAT	NAALAD2	-	NULL	ENSG00000077616		0.348	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	-	0.00	106	0	A	NM_005467		89882244	+1	tier1	-	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	34.73	109	58	SNP	1.000	T
NAALAD2	10003	genome.wustl.edu	37	11	89882244	89882244	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:89882244A>T	ENST00000534061.1	+	4	682	c.452A>T	c.(451-453)tAt>tTt	p.Y151F	NAALAD2_ENST00000525171.1_Missense_Mutation_p.Y151F|NAALAD2_ENST00000321955.4_Missense_Mutation_p.Y151F|NAALAD2_ENST00000375944.3_Missense_Mutation_p.Y151F	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	151					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GTGCCACCATATAATGCTTTC	0.348																																																	0													83.0	85.0	84.0					11																	89882244		2197	4287	6484	SO:0001583	missense	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.452A>T	11.37:g.89882244A>T	ENSP00000432481:p.Tyr151Phe		B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.Y151F	ENST00000534061.1	37	c.452	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	A	7.220	0.597231	0.13875	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944;ENST00000526637	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000006	T	0.31327	0.0793	L	0.33293	1	0.58432	D	0.999998	B;B;B;B;B	0.34061	0.007;0.004;0.003;0.436;0.007	B;B;B;B;B	0.28553	0.016;0.013;0.008;0.091;0.013	T	0.07986	-1.0744	9	.	.	.	-16.7126	15.444	0.75213	1.0:0.0:0.0:0.0	.	151;151;151;151;151	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	F	151;151;151;151;97	ENSP00000432481:Y151F;ENSP00000320083:Y151F;ENSP00000435249:Y151F;ENSP00000365111:Y151F;ENSP00000435670:Y97F	.	Y	+	2	0	NAALAD2	89521892	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.965000	0.63708	2.043000	0.60533	0.451000	0.29950	TAT	NAALAD2	-	NULL	ENSG00000077616		0.348	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	-	0.00	109	0	A	NM_005467		89882244	+1	tier1	-	no_errors	ENST00000534061	ensembl	human	known	74_37	missense	34.73	109	58	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101890252	101890252	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr13:101890252C>A	ENST00000251127.6	-	12	1369	c.1288G>T	c.(1288-1290)Gat>Tat	p.D430Y	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.D430Y	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	430					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCTTCCAAATCAAAAAGTACT	0.313																																																	0													95.0	102.0	100.0					13																	101890252		2203	4299	6502	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1288G>T	13.37:g.101890252C>A	ENSP00000251127:p.Asp430Tyr		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D430Y	ENST00000251127.6	37	c.1288	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059861	0.76074	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98400	-4.91;-4.91	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	L	0.57536	1.79	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.996	D;D;D	0.72625	0.978;0.945;0.959	D	0.99880	1.1111	10	0.72032	D	0.01	.	19.1638	0.93546	0.0:1.0:0.0:0.0	.	430;430;430	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	Y	430	ENSP00000251127:D430Y;ENSP00000365367:D430Y	ENSP00000251127:D430Y	D	-	1	0	NALCN	100688253	1.000000	0.71417	0.998000	0.56505	0.769000	0.43574	7.441000	0.80485	2.593000	0.87608	0.491000	0.48974	GAT	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.313	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2		0.00	27	0	C	NM_052867		101890252	-1			no_errors	ENST00000251127	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
NCOR2	9612	genome.wustl.edu	37	12	124904564	124904564	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:124904564delT	ENST00000405201.1	-	13	1421	c.1421delA	c.(1420-1422)aagfs	p.K475fs	NCOR2_ENST00000404121.2_Frame_Shift_Del_p.K45fs|NCOR2_ENST00000356219.3_Frame_Shift_Del_p.K475fs|NCOR2_ENST00000429285.2_Frame_Shift_Del_p.K474fs|NCOR2_ENST00000404621.1_Frame_Shift_Del_p.K474fs|NCOR2_ENST00000397355.1_Frame_Shift_Del_p.K475fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	475	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTCATTCTTCTTAGTCAGGTA	0.572																																																	0													110.0	117.0	115.0					12																	124904564		1997	4165	6162	SO:0001589	frameshift_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1421delA	12.37:g.124904564delT	ENSP00000384018:p.Lys475fs		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.K474fs	ENST00000405201.1	37	c.1421	CCDS41858.2	12																																																																																			NCOR2	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000196498		0.572	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	33	0	T	NM_006312		124904564	-1	tier1		no_errors	ENST00000356219	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
NCOR2	9612	genome.wustl.edu	37	12	124904564	124904564	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:124904564delT	ENST00000405201.1	-	13	1421	c.1421delA	c.(1420-1422)aagfs	p.K475fs	NCOR2_ENST00000404121.2_Frame_Shift_Del_p.K45fs|NCOR2_ENST00000356219.3_Frame_Shift_Del_p.K475fs|NCOR2_ENST00000429285.2_Frame_Shift_Del_p.K474fs|NCOR2_ENST00000404621.1_Frame_Shift_Del_p.K474fs|NCOR2_ENST00000397355.1_Frame_Shift_Del_p.K475fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	475	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTCATTCTTCTTAGTCAGGTA	0.572																																																	0													110.0	117.0	115.0					12																	124904564		1997	4165	6162	SO:0001589	frameshift_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1421delA	12.37:g.124904564delT	ENSP00000384018:p.Lys475fs		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.K474fs	ENST00000405201.1	37	c.1421	CCDS41858.2	12																																																																																			NCOR2	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000196498		0.572	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	34	0	T	NM_006312		124904564	-1	tier1		no_errors	ENST00000356219	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
NEBL	10529	genome.wustl.edu	37	10	21108359	21108359	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:21108359C>T	ENST00000377122.4	-	20	2445	c.2049G>A	c.(2047-2049)ctG>ctA	p.L683L	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	683					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTGCCGCACTCAGCTGCTCCT	0.423																																																	0													171.0	162.0	165.0					10																	21108359		2203	4300	6503	SO:0001819	synonymous_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2049G>A	10.37:g.21108359C>T			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.L683	ENST00000377122.4	37	c.2049	CCDS7134.1	10																																																																																			NEBL	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif	ENSG00000078114		0.423	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	-	0.00	37	0	C	NM_006393		21108359	-1	tier1	-	no_errors	ENST00000377122	ensembl	human	known	74_37	silent	31.58	26	12	SNP	1.000	T
NEBL	10529	genome.wustl.edu	37	10	21108359	21108359	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:21108359C>T	ENST00000377122.4	-	20	2445	c.2049G>A	c.(2047-2049)ctG>ctA	p.L683L	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	683					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTGCCGCACTCAGCTGCTCCT	0.423																																																	0													171.0	162.0	165.0					10																	21108359		2203	4300	6503	SO:0001819	synonymous_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2049G>A	10.37:g.21108359C>T			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.L683	ENST00000377122.4	37	c.2049	CCDS7134.1	10																																																																																			NEBL	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif	ENSG00000078114		0.423	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	-	0.00	55	0	C	NM_006393		21108359	-1	tier1	-	no_errors	ENST00000377122	ensembl	human	known	74_37	silent	31.58	26	12	SNP	1.000	T
NIN	51199	genome.wustl.edu	37	14	51238069	51238069	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:51238069C>A	ENST00000382041.3	-	10	1289	c.1099G>T	c.(1099-1101)Gct>Tct	p.A367S	NIN_ENST00000324330.9_Missense_Mutation_p.A367S|NIN_ENST00000389868.3_Missense_Mutation_p.A367S|NIN_ENST00000453196.1_Missense_Mutation_p.A367S|NIN_ENST00000382043.4_Missense_Mutation_p.A367S|NIN_ENST00000245441.5_Missense_Mutation_p.A367S|NIN_ENST00000530997.2_Missense_Mutation_p.A367S	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	367					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CGGATTTCAGCCTTAAAGCTG	0.478			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													110.0	100.0	103.0					14																	51238069		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1099G>T	14.37:g.51238069C>A	ENSP00000371472:p.Ala367Ser		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.A367S	ENST00000382041.3	37	c.1099	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925427	0.52759	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.67	4.68	0.58851	.	0.148398	0.64402	D	0.000008	T	0.14917	0.0360	N	0.02539	-0.55	0.44175	D	0.99698	P;B;D;P;D	0.71674	0.832;0.427;0.978;0.639;0.998	B;B;P;B;D	0.80764	0.297;0.082;0.712;0.122;0.994	T	0.30060	-0.9991	10	0.11485	T	0.65	-10.5403	5.4021	0.16301	0.1944:0.6551:0.0:0.1504	.	373;367;367;367;367	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	S	367;367;367;367;373;367;367;367;329	ENSP00000245441:A367S;ENSP00000374518:A367S;ENSP00000371474:A367S;ENSP00000371472:A367S;ENSP00000324210:A367S;ENSP00000412391:A367S;ENSP00000398641:A329S	ENSP00000245441:A367S	A	-	1	0	NIN	50307819	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.960000	0.49161	2.670000	0.90874	0.555000	0.69702	GCT	NIN	-	NULL	ENSG00000100503		0.478	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	36	0	C	NM_182946		51238069	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
NIN	51199	genome.wustl.edu	37	14	51238069	51238069	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:51238069C>A	ENST00000382041.3	-	10	1289	c.1099G>T	c.(1099-1101)Gct>Tct	p.A367S	NIN_ENST00000324330.9_Missense_Mutation_p.A367S|NIN_ENST00000389868.3_Missense_Mutation_p.A367S|NIN_ENST00000453196.1_Missense_Mutation_p.A367S|NIN_ENST00000382043.4_Missense_Mutation_p.A367S|NIN_ENST00000245441.5_Missense_Mutation_p.A367S|NIN_ENST00000530997.2_Missense_Mutation_p.A367S	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	367					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CGGATTTCAGCCTTAAAGCTG	0.478			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													110.0	100.0	103.0					14																	51238069		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1099G>T	14.37:g.51238069C>A	ENSP00000371472:p.Ala367Ser		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.A367S	ENST00000382041.3	37	c.1099	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925427	0.52759	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.67	4.68	0.58851	.	0.148398	0.64402	D	0.000008	T	0.14917	0.0360	N	0.02539	-0.55	0.44175	D	0.99698	P;B;D;P;D	0.71674	0.832;0.427;0.978;0.639;0.998	B;B;P;B;D	0.80764	0.297;0.082;0.712;0.122;0.994	T	0.30060	-0.9991	10	0.11485	T	0.65	-10.5403	5.4021	0.16301	0.1944:0.6551:0.0:0.1504	.	373;367;367;367;367	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	S	367;367;367;367;373;367;367;367;329	ENSP00000245441:A367S;ENSP00000374518:A367S;ENSP00000371474:A367S;ENSP00000371472:A367S;ENSP00000324210:A367S;ENSP00000412391:A367S;ENSP00000398641:A329S	ENSP00000245441:A367S	A	-	1	0	NIN	50307819	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.960000	0.49161	2.670000	0.90874	0.555000	0.69702	GCT	NIN	-	NULL	ENSG00000100503		0.478	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	38	0	C	NM_182946		51238069	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
NINL	22981	genome.wustl.edu	37	20	25434171	25434171	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:25434171C>T	ENST00000278886.6	-	24	4138	c.4065G>A	c.(4063-4065)gaG>gaA	p.E1355E	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Silent_p.E1006E	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1355					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGCTTTGTTTCTCGGCGCCTC	0.547																																																	0													81.0	82.0	82.0					20																	25434171		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4065G>A	20.37:g.25434171C>T			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.E1355	ENST00000278886.6	37	c.4065	CCDS33452.1	20																																																																																			NINL	-	NULL	ENSG00000101004		0.547	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	-	0.00	36	0	C	NM_025176		25434171	-1	tier1	-	no_errors	ENST00000278886	ensembl	human	known	74_37	silent	21.88	75	21	SNP	0.998	T
NINL	22981	genome.wustl.edu	37	20	25434213	25434213	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:25434213C>T	ENST00000278886.6	-	24	4096	c.4023G>A	c.(4021-4023)gtG>gtA	p.V1341V	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Silent_p.V992V	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1341					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GAAGTGCTCTCACCAGGTGGG	0.552																																																	0													91.0	83.0	86.0					20																	25434213		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4023G>A	20.37:g.25434213C>T			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.V1341	ENST00000278886.6	37	c.4023	CCDS33452.1	20																																																																																			NINL	-	NULL	ENSG00000101004		0.552	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	-	0.00	36	0	C	NM_025176		25434213	-1	tier1	-	no_errors	ENST00000278886	ensembl	human	known	74_37	silent	19.10	72	17	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25434213	25434213	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:25434213C>T	ENST00000278886.6	-	24	4096	c.4023G>A	c.(4021-4023)gtG>gtA	p.V1341V	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Silent_p.V992V	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1341					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GAAGTGCTCTCACCAGGTGGG	0.552																																																	0													91.0	83.0	86.0					20																	25434213		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.4023G>A	20.37:g.25434213C>T			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.V1341	ENST00000278886.6	37	c.4023	CCDS33452.1	20																																																																																			NINL	-	NULL	ENSG00000101004		0.552	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	-	0.00	37	0	C	NM_025176		25434213	-1	tier1	-	no_errors	ENST00000278886	ensembl	human	known	74_37	silent	19.10	72	17	SNP	1.000	T
NOBOX	135935	genome.wustl.edu	37	7	144096926	144096926	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:144096926G>A	ENST00000467773.1	-	6	1077	c.1078C>T	c.(1078-1080)Cga>Tga	p.R360*	NOBOX_ENST00000483238.1_Nonsense_Mutation_p.R328*|NOBOX_ENST00000223140.5_Nonsense_Mutation_p.R243*	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	360			R -> Q. {ECO:0000269|PubMed:17701902}.		oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TCCATTTTTCGCCACTTGGCC	0.532																																																	0													90.0	94.0	93.0					7																	144096926		1959	4155	6114	SO:0001587	stop_gained	0					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1078C>T	7.37:g.144096926G>A	ENSP00000419457:p.Arg360*		A6NCD3|A8MZN5	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R360*	ENST00000467773.1	37	c.1078		7	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883019	0.91740	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	.	.	.	5.55	-3.12	0.05282	.	0.319059	0.26832	N	0.022267	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9644	12.9878	0.58602	0.0:0.0995:0.2518:0.6487	.	.	.	.	X	328;360;243;117	.	ENSP00000223140:R243X	R	-	1	2	NOBOX	143727859	0.994000	0.37717	0.514000	0.27761	0.826000	0.46750	0.286000	0.18902	-1.083000	0.03097	-0.284000	0.09977	CGA	NOBOX	-	superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000106410		0.532	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	-	0.00	48	0	G	XM_001134420		144096926	-1	tier1	-	no_errors	ENST00000467773	ensembl	human	known	74_37	nonsense	36.84	36	21	SNP	0.978	A
NOBOX	135935	genome.wustl.edu	37	7	144096926	144096926	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:144096926G>A	ENST00000467773.1	-	6	1077	c.1078C>T	c.(1078-1080)Cga>Tga	p.R360*	NOBOX_ENST00000483238.1_Nonsense_Mutation_p.R328*|NOBOX_ENST00000223140.5_Nonsense_Mutation_p.R243*	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	360			R -> Q. {ECO:0000269|PubMed:17701902}.		oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TCCATTTTTCGCCACTTGGCC	0.532																																																	0													90.0	94.0	93.0					7																	144096926		1959	4155	6114	SO:0001587	stop_gained	0					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1078C>T	7.37:g.144096926G>A	ENSP00000419457:p.Arg360*		A6NCD3|A8MZN5	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R360*	ENST00000467773.1	37	c.1078		7	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883019	0.91740	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	.	.	.	5.55	-3.12	0.05282	.	0.319059	0.26832	N	0.022267	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9644	12.9878	0.58602	0.0:0.0995:0.2518:0.6487	.	.	.	.	X	328;360;243;117	.	ENSP00000223140:R243X	R	-	1	2	NOBOX	143727859	0.994000	0.37717	0.514000	0.27761	0.826000	0.46750	0.286000	0.18902	-1.083000	0.03097	-0.284000	0.09977	CGA	NOBOX	-	superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000106410		0.532	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	-	0.00	53	0	G	XM_001134420		144096926	-1	tier1	-	no_errors	ENST00000467773	ensembl	human	known	74_37	nonsense	36.84	36	21	SNP	0.978	A
NRSN1	140767	genome.wustl.edu	37	6	24145969	24145969	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:24145969C>T	ENST00000378491.4	+	4	684	c.383C>T	c.(382-384)aCg>aTg	p.T128M		NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						ATTGGAGGCACGTCCATGGCA	0.488																																																	0													96.0	84.0	88.0					6																	24145969		2203	4300	6503	SO:0001583	missense	0			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.383C>T	6.37:g.24145969C>T	ENSP00000367752:p.Thr128Met			Missense_Mutation	SNP	NULL	p.T128M	ENST00000378491.4	37	c.383	CCDS4549.1	6	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048845	0.36181	.	.	ENSG00000152954	ENST00000378491;ENST00000378477	T	0.17528	2.27	5.37	2.16	0.27623	.	0.146770	0.64402	D	0.000010	T	0.04907	0.0132	L	0.33485	1.01	0.80722	D	1	B	0.26902	0.163	B	0.15484	0.013	T	0.21245	-1.0251	10	0.34782	T	0.22	-7.8784	11.7034	0.51583	0.0:0.7726:0.0:0.2274	.	128	Q8IZ57	NRSN1_HUMAN	M	128	ENSP00000367752:T128M	ENSP00000367738:T128M	T	+	2	0	NRSN1	24253948	0.812000	0.29077	0.770000	0.31555	0.959000	0.62525	1.549000	0.36212	0.653000	0.30826	0.557000	0.71058	ACG	NRSN1	-	NULL	ENSG00000152954		0.488	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN1	HGNC	protein_coding	OTTHUMT00000043866.1	-	0.00	48	0	C	NM_080723		24145969	+1	tier1	-	no_errors	ENST00000378491	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.819	T
NRSN1	140767	genome.wustl.edu	37	6	24145969	24145969	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:24145969C>T	ENST00000378491.4	+	4	684	c.383C>T	c.(382-384)aCg>aTg	p.T128M		NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						ATTGGAGGCACGTCCATGGCA	0.488																																																	0													96.0	84.0	88.0					6																	24145969		2203	4300	6503	SO:0001583	missense	0			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.383C>T	6.37:g.24145969C>T	ENSP00000367752:p.Thr128Met			Missense_Mutation	SNP	NULL	p.T128M	ENST00000378491.4	37	c.383	CCDS4549.1	6	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048845	0.36181	.	.	ENSG00000152954	ENST00000378491;ENST00000378477	T	0.17528	2.27	5.37	2.16	0.27623	.	0.146770	0.64402	D	0.000010	T	0.04907	0.0132	L	0.33485	1.01	0.80722	D	1	B	0.26902	0.163	B	0.15484	0.013	T	0.21245	-1.0251	10	0.34782	T	0.22	-7.8784	11.7034	0.51583	0.0:0.7726:0.0:0.2274	.	128	Q8IZ57	NRSN1_HUMAN	M	128	ENSP00000367752:T128M	ENSP00000367738:T128M	T	+	2	0	NRSN1	24253948	0.812000	0.29077	0.770000	0.31555	0.959000	0.62525	1.549000	0.36212	0.653000	0.30826	0.557000	0.71058	ACG	NRSN1	-	NULL	ENSG00000152954		0.488	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN1	HGNC	protein_coding	OTTHUMT00000043866.1	-	0.00	52	0	C	NM_080723		24145969	+1	tier1	-	no_errors	ENST00000378491	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.819	T
NUMBL	9253	genome.wustl.edu	37	19	41173866	41173868	+	In_Frame_Del	DEL	TGC	TGC	-	rs201081747	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:41173866_41173868delTGC	ENST00000252891.4	-	10	1502_1504	c.1335_1337delGCA	c.(1333-1338)cagcaa>caa	p.445_446QQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.404_405QQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.404_405QQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	445	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			TGAGgctgcttgctgctgttgct	0.67														104	0.0207668	0.0144	0.0331	5008	,	,		15968	0.0		0.0507	False		,,,				2504	0.0112																0										86,4074		5,76,1999						-4.0	0.1			9	263,7789		20,223,3783	no	coding	NUMBL	NM_004756.3		25,299,5782	A1A1,A1R,RR		3.2663,2.0673,2.8578				349,11863				SO:0001651	inframe_deletion	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1335_1337delGCA	19.37:g.41173869_41173871delTGC	ENSP00000252891:p.Gln446del		Q7Z4J9	In_Frame_Del	DEL	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.Q446in_frame_del	ENST00000252891.4	37	c.1337_1335	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.670	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2		0.00	18	0	TGC	NM_004756		41173868	-1	tier1		no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	30.77	18	8	DEL	0.321:0.944:0.964	-
NUMBL	9253	genome.wustl.edu	37	19	41173889	41173889	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:41173889C>T	ENST00000252891.4	-	10	1481	c.1314G>A	c.(1312-1314)caG>caA	p.Q438Q	NUMBL_ENST00000598779.1_Silent_p.Q397Q|NUMBL_ENST00000540131.1_Silent_p.Q397Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	438	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgctgctgctgtt	0.662																																																	0													8.0	8.0	8.0					19																	41173889		2113	4120	6233	SO:0001819	synonymous_variant	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1314G>A	19.37:g.41173889C>T			Q7Z4J9	Silent	SNP	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.Q438	ENST00000252891.4	37	c.1314	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	-	0.00	18	0	C	NM_004756		41173889	-1	tier1	-	no_errors	ENST00000252891	ensembl	human	known	74_37	silent	27.27	24	9	SNP	1.000	T
NUMBL	9253	genome.wustl.edu	37	19	41173896	41173898	+	In_Frame_Del	DEL	TGT	TGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:41173896_41173898delTGT	ENST00000252891.4	-	10	1472_1474	c.1305_1307delACA	c.(1303-1308)caacag>cag	p.435_436QQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.394_395QQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.394_395QQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgttgctgttgct	0.67																																																	0																																										SO:0001651	inframe_deletion	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1307delACA	19.37:g.41173896_41173898delTGT	ENSP00000252891:p.Gln446del		Q7Z4J9	In_Frame_Del	DEL	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.Q439in_frame_del	ENST00000252891.4	37	c.1307_1305	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.670	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2		0.00	19	0	TGT	NM_004756		41173898	-1	tier1		no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	25.71	26	9	DEL	1.000:1.000:0.998	-
OBSCN	84033	genome.wustl.edu	37	1	228511299	228511299	+	Missense_Mutation	SNP	G	G	A	rs375864261		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:228511299G>A	ENST00000422127.1	+	56	15688	c.15644G>A	c.(15643-15645)cGt>cAt	p.R5215H	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2849H|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6172H|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5215H|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2334H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5215	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGAGCTCCGTGTGGACTGT	0.582																																																	0								G	HIS/ARG,HIS/ARG	0,4324		0,0,2162	59.0	61.0	60.0		15644,15644	5.4	1.0	1		60	1,8531		0,1,4265	no	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	29,29	0,1,6427	AA,AG,GG		0.0117,0.0,0.0078	probably-damaging,probably-damaging	5215/7969,5215/6621	228511299	1,12855	2162	4266	6428	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15644G>A	1.37:g.228511299G>A	ENSP00000409493:p.Arg5215His		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R5215H	ENST00000422127.1	37	c.15644	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.260971	0.95368	0.0	1.17E-4	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.41	5.41	0.78517	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069529	0.56097	D	0.000040	T	0.77705	0.4170	L	0.45228	1.405	0.45822	D	0.998695	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.77827	-0.2443	10	0.59425	D	0.04	.	19.3855	0.94554	0.0:0.0:1.0:0.0	.	5215;5215	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	5215;5215;2849;2334	ENSP00000284548:R5215H;ENSP00000409493:R5215H;ENSP00000355668:R2849H;ENSP00000355670:R2334H	ENSP00000284548:R5215H	R	+	2	0	OBSCN	226577922	1.000000	0.71417	0.983000	0.44433	0.917000	0.54804	7.370000	0.79589	2.808000	0.96608	0.655000	0.94253	CGT	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	63	0	G	NM_052843		228511299	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	29.85	47	20	SNP	0.998	A
OBSCN	84033	genome.wustl.edu	37	1	228511299	228511299	+	Missense_Mutation	SNP	G	G	A	rs375864261		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:228511299G>A	ENST00000422127.1	+	56	15688	c.15644G>A	c.(15643-15645)cGt>cAt	p.R5215H	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2849H|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6172H|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5215H|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2334H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5215	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGAGCTCCGTGTGGACTGT	0.582																																																	0								G	HIS/ARG,HIS/ARG	0,4324		0,0,2162	59.0	61.0	60.0		15644,15644	5.4	1.0	1		60	1,8531		0,1,4265	no	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	29,29	0,1,6427	AA,AG,GG		0.0117,0.0,0.0078	probably-damaging,probably-damaging	5215/7969,5215/6621	228511299	1,12855	2162	4266	6428	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15644G>A	1.37:g.228511299G>A	ENSP00000409493:p.Arg5215His		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R5215H	ENST00000422127.1	37	c.15644	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.260971	0.95368	0.0	1.17E-4	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.41	5.41	0.78517	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.069529	0.56097	D	0.000040	T	0.77705	0.4170	L	0.45228	1.405	0.45822	D	0.998695	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.77827	-0.2443	10	0.59425	D	0.04	.	19.3855	0.94554	0.0:0.0:1.0:0.0	.	5215;5215	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	5215;5215;2849;2334	ENSP00000284548:R5215H;ENSP00000409493:R5215H;ENSP00000355668:R2849H;ENSP00000355670:R2334H	ENSP00000284548:R5215H	R	+	2	0	OBSCN	226577922	1.000000	0.71417	0.983000	0.44433	0.917000	0.54804	7.370000	0.79589	2.808000	0.96608	0.655000	0.94253	CGT	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	69	0	G	NM_052843		228511299	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	29.85	47	20	SNP	0.998	A
ODF2	4957	genome.wustl.edu	37	9	131250255	131250255	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:131250255G>A	ENST00000434106.3	+	14	1850	c.1487G>A	c.(1486-1488)cGt>cAt	p.R496H	ODF2_ENST00000351030.3_Missense_Mutation_p.R491H|ODF2_ENST00000393527.3_Missense_Mutation_p.R472H|ODF2_ENST00000546203.1_Missense_Mutation_p.R477H|ODF2_ENST00000372814.3_Missense_Mutation_p.R540H|ODF2_ENST00000372791.3_Missense_Mutation_p.R477H|ODF2_ENST00000372807.5_Missense_Mutation_p.R491H|ODF2_ENST00000604420.1_Missense_Mutation_p.R496H|ODF2_ENST00000444119.2_Missense_Mutation_p.R472H|ODF2_ENST00000393533.2_Missense_Mutation_p.R496H|ODF2_ENST00000448249.3_Missense_Mutation_p.R415H	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	496					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						AGACTACACCGTCAGACTGCT	0.557																																																	0													108.0	94.0	99.0					9																	131250255		2203	4300	6503	SO:0001583	missense	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1487G>A	9.37:g.131250255G>A	ENSP00000403453:p.Arg496His		B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	NULL	p.R496H	ENST00000434106.3	37	c.1487	CCDS56588.1	9	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512981	0.44660	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.31247	1.51;1.5;1.95;1.93;1.95;1.52;1.52;1.52	5.7	4.81	0.61882	.	0.329628	0.34750	N	0.003714	T	0.18425	0.0442	N	0.25647	0.755	0.80722	D	1	B;B;B;B;B;B;B;B	0.32717	0.181;0.177;0.072;0.177;0.381;0.181;0.177;0.09	B;B;B;B;B;B;B;B	0.24269	0.025;0.018;0.009;0.018;0.052;0.025;0.018;0.013	T	0.06092	-1.0846	10	0.38643	T	0.18	-16.5362	8.8042	0.34927	0.1691:0.0:0.8309:0.0	.	477;491;415;430;496;477;496;472	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;ODFP2_HUMAN;.	H	496;540;491;496;472;415;477;477	ENSP00000377166:R496H;ENSP00000361901:R540H;ENSP00000342581:R491H;ENSP00000361882:R496H;ENSP00000307781:R472H;ENSP00000396687:R415H;ENSP00000437579:R477H;ENSP00000361877:R477H	ENSP00000307781:R472H	R	+	2	0	ODF2	130290076	0.990000	0.36364	0.996000	0.52242	0.931000	0.56810	2.736000	0.47385	1.419000	0.47118	-0.140000	0.14226	CGT	ODF2	-	NULL	ENSG00000136811		0.557	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	-	0.00	50	0	G			131250255	+1	tier1	-	no_errors	ENST00000434106	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.955	A
OMP	4975	genome.wustl.edu	37	11	76814312	76814312	+	Missense_Mutation	SNP	G	G	A	rs376786233		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:76814312G>A	ENST00000529803.1	+	1	427	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000456580.2_Intron|CAPN5_ENST00000529629.1_Intron|CAPN5_ENST00000278559.3_Intron	NM_006189.1	NP_006180.1	P47874	OMP_HUMAN	olfactory marker protein	143					neurogenesis (GO:0022008)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GTACTTCCTCGTCACCTTTGG	0.607																																																	0								A	,ILE/VAL	1,4015		0,1,2007	60.0	65.0	64.0		,427	2.9	1.0	11		64	1,8329		0,1,4164	no	intron,missense	CAPN5,OMP	NM_004055.4,NM_006189.1	,29	0,2,6171	AA,AG,GG		0.012,0.0249,0.0162	,benign	,143/164	76814312	2,12344	2008	4165	6173	SO:0001583	missense	0			U01212	CCDS53682.1	11q14-q21	2008-07-21				ENSG00000254550			8136	protein-coding gene	gene with protein product		164340				8499899	Standard	NM_006189		Approved		uc010rsk.2	P47874		ENST00000529803.1:c.427G>A	11.37:g.76814312G>A	ENSP00000436376:p.Val143Ile		Q562G2	Missense_Mutation	SNP	pfam_Olfactory_marker,superfamily_Olfactory_marker	p.V143I	ENST00000529803.1	37	c.427	CCDS53682.1	11	.	.	.	.	.	.	.	.	.	.	A	1.616	-0.522777	0.04141	2.49E-4	1.2E-4	ENSG00000254550	ENST00000529803	T	0.25250	1.81	5.29	2.89	0.33648	.	.	.	.	.	T	0.07638	0.0192	N	0.03608	-0.345	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.38845	-0.9642	9	0.02654	T	1	.	1.5336	0.02541	0.4293:0.2897:0.1546:0.1264	.	143	P47874	OMP_HUMAN	I	143	ENSP00000436376:V143I	ENSP00000436376:V143I	V	+	1	0	OMP	76491960	0.990000	0.36364	0.999000	0.59377	0.770000	0.43624	0.576000	0.23744	0.101000	0.17610	-0.521000	0.04368	GTC	OMP	-	pfam_Olfactory_marker,superfamily_Olfactory_marker	ENSG00000254550		0.607	OMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMP	HGNC	protein_coding	OTTHUMT00000382570.1	-	0.00	30	0	G	NM_006189		76814312	+1	tier1	-	no_errors	ENST00000529803	ensembl	human	known	74_37	missense	13.24	59	9	SNP	0.997	A
OMP	4975	genome.wustl.edu	37	11	76814312	76814312	+	Missense_Mutation	SNP	G	G	A	rs376786233		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:76814312G>A	ENST00000529803.1	+	1	427	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000456580.2_Intron|CAPN5_ENST00000529629.1_Intron|CAPN5_ENST00000278559.3_Intron	NM_006189.1	NP_006180.1	P47874	OMP_HUMAN	olfactory marker protein	143					neurogenesis (GO:0022008)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GTACTTCCTCGTCACCTTTGG	0.607																																																	0								A	,ILE/VAL	1,4015		0,1,2007	60.0	65.0	64.0		,427	2.9	1.0	11		64	1,8329		0,1,4164	no	intron,missense	CAPN5,OMP	NM_004055.4,NM_006189.1	,29	0,2,6171	AA,AG,GG		0.012,0.0249,0.0162	,benign	,143/164	76814312	2,12344	2008	4165	6173	SO:0001583	missense	0			U01212	CCDS53682.1	11q14-q21	2008-07-21				ENSG00000254550			8136	protein-coding gene	gene with protein product		164340				8499899	Standard	NM_006189		Approved		uc010rsk.2	P47874		ENST00000529803.1:c.427G>A	11.37:g.76814312G>A	ENSP00000436376:p.Val143Ile		Q562G2	Missense_Mutation	SNP	pfam_Olfactory_marker,superfamily_Olfactory_marker	p.V143I	ENST00000529803.1	37	c.427	CCDS53682.1	11	.	.	.	.	.	.	.	.	.	.	A	1.616	-0.522777	0.04141	2.49E-4	1.2E-4	ENSG00000254550	ENST00000529803	T	0.25250	1.81	5.29	2.89	0.33648	.	.	.	.	.	T	0.07638	0.0192	N	0.03608	-0.345	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.38845	-0.9642	9	0.02654	T	1	.	1.5336	0.02541	0.4293:0.2897:0.1546:0.1264	.	143	P47874	OMP_HUMAN	I	143	ENSP00000436376:V143I	ENSP00000436376:V143I	V	+	1	0	OMP	76491960	0.990000	0.36364	0.999000	0.59377	0.770000	0.43624	0.576000	0.23744	0.101000	0.17610	-0.521000	0.04368	GTC	OMP	-	pfam_Olfactory_marker,superfamily_Olfactory_marker	ENSG00000254550		0.607	OMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMP	HGNC	protein_coding	OTTHUMT00000382570.1	-	0.00	52	0	G	NM_006189		76814312	+1	tier1	-	no_errors	ENST00000529803	ensembl	human	known	74_37	missense	13.24	59	9	SNP	0.997	A
OR4D5	219875	genome.wustl.edu	37	11	123810418	123810418	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:123810418C>G	ENST00000307033.2	+	1	169	c.95C>G	c.(94-96)tCt>tGt	p.S32C		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACTGTTTTCTCTGCTGTGTAT	0.453																																																	0													114.0	107.0	109.0					11																	123810418		2202	4299	6501	SO:0001583	missense	0			BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.95C>G	11.37:g.123810418C>G	ENSP00000305970:p.Ser32Cys		B9EGZ4|Q6IFE6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S32C	ENST00000307033.2	37	c.95	CCDS31699.1	11	.	.	.	.	.	.	.	.	.	.	C	3.885	-0.025157	0.07589	.	.	ENSG00000171014	ENST00000307033	T	0.00575	6.46	5.28	3.12	0.35913	.	0.549745	0.15365	N	0.266145	T	0.00496	0.0016	L	0.31752	0.955	0.19575	N	0.999969	B	0.02656	0.0	B	0.04013	0.001	T	0.49725	-0.8909	10	0.56958	D	0.05	-2.5159	2.5797	0.04815	0.0:0.4291:0.2941:0.2769	.	32	Q8NGN0	OR4D5_HUMAN	C	32	ENSP00000305970:S32C	ENSP00000305970:S32C	S	+	2	0	OR4D5	123315628	0.003000	0.15002	0.879000	0.34478	0.079000	0.17450	1.608000	0.36847	1.185000	0.42971	0.655000	0.94253	TCT	OR4D5	-	prints_GPCR_Rhodpsn	ENSG00000171014		0.453	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D5	HGNC	protein_coding	OTTHUMT00000387263.1	-	0.00	62	0	C	NM_001001965		123810418	+1	tier1	-	no_errors	ENST00000307033	ensembl	human	known	74_37	missense	11.88	89	12	SNP	0.283	G
OR4D5	219875	genome.wustl.edu	37	11	123810418	123810418	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:123810418C>G	ENST00000307033.2	+	1	169	c.95C>G	c.(94-96)tCt>tGt	p.S32C		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACTGTTTTCTCTGCTGTGTAT	0.453																																																	0													114.0	107.0	109.0					11																	123810418		2202	4299	6501	SO:0001583	missense	0			BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.95C>G	11.37:g.123810418C>G	ENSP00000305970:p.Ser32Cys		B9EGZ4|Q6IFE6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S32C	ENST00000307033.2	37	c.95	CCDS31699.1	11	.	.	.	.	.	.	.	.	.	.	C	3.885	-0.025157	0.07589	.	.	ENSG00000171014	ENST00000307033	T	0.00575	6.46	5.28	3.12	0.35913	.	0.549745	0.15365	N	0.266145	T	0.00496	0.0016	L	0.31752	0.955	0.19575	N	0.999969	B	0.02656	0.0	B	0.04013	0.001	T	0.49725	-0.8909	10	0.56958	D	0.05	-2.5159	2.5797	0.04815	0.0:0.4291:0.2941:0.2769	.	32	Q8NGN0	OR4D5_HUMAN	C	32	ENSP00000305970:S32C	ENSP00000305970:S32C	S	+	2	0	OR4D5	123315628	0.003000	0.15002	0.879000	0.34478	0.079000	0.17450	1.608000	0.36847	1.185000	0.42971	0.655000	0.94253	TCT	OR4D5	-	prints_GPCR_Rhodpsn	ENSG00000171014		0.453	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D5	HGNC	protein_coding	OTTHUMT00000387263.1	-	0.00	67	0	C	NM_001001965		123810418	+1	tier1	-	no_errors	ENST00000307033	ensembl	human	known	74_37	missense	11.88	89	12	SNP	0.283	G
OR4N4	283694	genome.wustl.edu	37	15	22382852	22382852	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:22382852G>T	ENST00000328795.4	+	1	471	c.380G>T	c.(379-381)tGc>tTc	p.C127F	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATCGCCATCTGCCGGCCTCTG	0.522																																																	0													161.0	142.0	149.0					15																	22382852		2189	4261	6450	SO:0001583	missense	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.380G>T	15.37:g.22382852G>T	ENSP00000332500:p.Cys127Phe		Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C127F	ENST00000328795.4	37	c.380	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	13.71	2.318715	0.41096	.	.	ENSG00000183706	ENST00000328795	T	0.34472	1.36	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000056	T	0.73281	0.3567	H	0.98721	4.31	0.43761	D	0.996272	D	0.89917	1.0	D	0.83275	0.996	D	0.83437	0.0041	10	0.72032	D	0.01	-8.5394	12.2756	0.54733	0.0:0.0:1.0:0.0	.	127	Q8N0Y3	OR4N4_HUMAN	F	127	ENSP00000332500:C127F	ENSP00000332500:C127F	C	+	2	0	OR4N4	19884216	1.000000	0.71417	0.948000	0.38648	0.326000	0.28443	5.879000	0.69690	1.793000	0.52555	0.184000	0.17185	TGC	OR4N4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183706		0.522	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	-	0.00	123	0	G			22382852	+1	tier1	-	no_errors	ENST00000328795	ensembl	human	known	74_37	missense	7.52	123	10	SNP	0.997	T
OR4N4	283694	genome.wustl.edu	37	15	22382852	22382852	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:22382852G>T	ENST00000328795.4	+	1	471	c.380G>T	c.(379-381)tGc>tTc	p.C127F	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATCGCCATCTGCCGGCCTCTG	0.522																																																	0													161.0	142.0	149.0					15																	22382852		2189	4261	6450	SO:0001583	missense	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.380G>T	15.37:g.22382852G>T	ENSP00000332500:p.Cys127Phe		Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C127F	ENST00000328795.4	37	c.380	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	13.71	2.318715	0.41096	.	.	ENSG00000183706	ENST00000328795	T	0.34472	1.36	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000056	T	0.73281	0.3567	H	0.98721	4.31	0.43761	D	0.996272	D	0.89917	1.0	D	0.83275	0.996	D	0.83437	0.0041	10	0.72032	D	0.01	-8.5394	12.2756	0.54733	0.0:0.0:1.0:0.0	.	127	Q8N0Y3	OR4N4_HUMAN	F	127	ENSP00000332500:C127F	ENSP00000332500:C127F	C	+	2	0	OR4N4	19884216	1.000000	0.71417	0.948000	0.38648	0.326000	0.28443	5.879000	0.69690	1.793000	0.52555	0.184000	0.17185	TGC	OR4N4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183706		0.522	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	-	0.00	87	0	G			22382852	+1	tier1	-	no_errors	ENST00000328795	ensembl	human	known	74_37	missense	7.52	123	10	SNP	0.997	T
OR5L2	26338	genome.wustl.edu	37	11	55595411	55595411	+	Silent	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:55595411C>A	ENST00000378397.1	+	1	717	c.717C>A	c.(715-717)tcC>tcA	p.S239S		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				AAGCTTTCTCCACCTGTGCCT	0.483										HNSCC(27;0.073)																																							0													171.0	146.0	154.0					11																	55595411		2200	4296	6496	SO:0001819	synonymous_variant	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.717C>A	11.37:g.55595411C>A			Q6IF66|Q96RB2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S239	ENST00000378397.1	37	c.717	CCDS31511.1	11																																																																																			OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000205030		0.483	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	-	0.00	65	0	C	NM_001004739		55595411	+1	tier1	-	no_errors	ENST00000378397	ensembl	human	known	74_37	silent	17.35	81	17	SNP	0.990	A
OR5L2	26338	genome.wustl.edu	37	11	55595411	55595411	+	Silent	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:55595411C>A	ENST00000378397.1	+	1	717	c.717C>A	c.(715-717)tcC>tcA	p.S239S		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				AAGCTTTCTCCACCTGTGCCT	0.483										HNSCC(27;0.073)																																							0													171.0	146.0	154.0					11																	55595411		2200	4296	6496	SO:0001819	synonymous_variant	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.717C>A	11.37:g.55595411C>A			Q6IF66|Q96RB2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S239	ENST00000378397.1	37	c.717	CCDS31511.1	11																																																																																			OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000205030		0.483	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	-	0.00	69	0	C	NM_001004739		55595411	+1	tier1	-	no_errors	ENST00000378397	ensembl	human	known	74_37	silent	17.35	81	17	SNP	0.990	A
OR8J3	81168	genome.wustl.edu	37	11	55904509	55904509	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:55904509C>T	ENST00000301529.1	-	1	685	c.686G>A	c.(685-687)cGt>cAt	p.R229H		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TTCTGGTGAACGTATCCTTAG	0.368																																																	0													100.0	94.0	96.0					11																	55904509		2201	4296	6497	SO:0001583	missense	0				CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.686G>A	11.37:g.55904509C>T	ENSP00000301529:p.Arg229His		Q6IFB6|Q96RC2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R229H	ENST00000301529.1	37	c.686	CCDS31520.1	11	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.083109	0.00371	.	.	ENSG00000167822	ENST00000301529	T	0.39229	1.09	3.27	-6.55	0.01854	GPCR, rhodopsin-like superfamily (1);	0.402874	0.24590	N	0.037233	T	0.14700	0.0355	N	0.10874	0.06	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.13176	-1.0519	10	0.19147	T	0.46	.	5.743	0.18104	0.0953:0.5073:0.1477:0.2496	.	229	Q8NGG0	OR8J3_HUMAN	H	229	ENSP00000301529:R229H	ENSP00000301529:R229H	R	-	2	0	OR8J3	55661085	0.000000	0.05858	0.000000	0.03702	0.155000	0.21991	-5.180000	0.00144	-1.489000	0.01844	-1.892000	0.00534	CGT	OR8J3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000167822		0.368	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8J3	HGNC	protein_coding	OTTHUMT00000391542.1	-	0.00	33	0	C	NM_001004064		55904509	-1	tier1	-	no_errors	ENST00000301529	ensembl	human	known	74_37	missense	44.44	20	16	SNP	0.000	T
OR8J3	81168	genome.wustl.edu	37	11	55904509	55904509	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:55904509C>T	ENST00000301529.1	-	1	685	c.686G>A	c.(685-687)cGt>cAt	p.R229H		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					TTCTGGTGAACGTATCCTTAG	0.368																																																	0													100.0	94.0	96.0					11																	55904509		2201	4296	6497	SO:0001583	missense	0				CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.686G>A	11.37:g.55904509C>T	ENSP00000301529:p.Arg229His		Q6IFB6|Q96RC2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R229H	ENST00000301529.1	37	c.686	CCDS31520.1	11	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.083109	0.00371	.	.	ENSG00000167822	ENST00000301529	T	0.39229	1.09	3.27	-6.55	0.01854	GPCR, rhodopsin-like superfamily (1);	0.402874	0.24590	N	0.037233	T	0.14700	0.0355	N	0.10874	0.06	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.13176	-1.0519	10	0.19147	T	0.46	.	5.743	0.18104	0.0953:0.5073:0.1477:0.2496	.	229	Q8NGG0	OR8J3_HUMAN	H	229	ENSP00000301529:R229H	ENSP00000301529:R229H	R	-	2	0	OR8J3	55661085	0.000000	0.05858	0.000000	0.03702	0.155000	0.21991	-5.180000	0.00144	-1.489000	0.01844	-1.892000	0.00534	CGT	OR8J3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000167822		0.368	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8J3	HGNC	protein_coding	OTTHUMT00000391542.1	-	0.00	34	0	C	NM_001004064		55904509	-1	tier1	-	no_errors	ENST00000301529	ensembl	human	known	74_37	missense	44.44	20	16	SNP	0.000	T
OR5R1	219479	genome.wustl.edu	37	11	56185376	56185376	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:56185376C>T	ENST00000312253.1	-	1	332	c.333G>A	c.(331-333)gaG>gaA	p.E111E		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					GAAGGAAACACTCAGTGATCA	0.463																																																	0													105.0	100.0	101.0					11																	56185376		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.333G>A	11.37:g.56185376C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E111	ENST00000312253.1	37	c.333	CCDS31530.1	11																																																																																			OR5R1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174942		0.463	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	-	0.00	27	0	C	NM_001004744		56185376	-1	tier1	-	no_errors	ENST00000312253	ensembl	human	known	74_37	silent	53.49	20	23	SNP	0.304	T
OR5R1	219479	genome.wustl.edu	37	11	56185376	56185376	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:56185376C>T	ENST00000312253.1	-	1	332	c.333G>A	c.(331-333)gaG>gaA	p.E111E		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					GAAGGAAACACTCAGTGATCA	0.463																																																	0													105.0	100.0	101.0					11																	56185376		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.333G>A	11.37:g.56185376C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E111	ENST00000312253.1	37	c.333	CCDS31530.1	11																																																																																			OR5R1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174942		0.463	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	-	0.00	28	0	C	NM_001004744		56185376	-1	tier1	-	no_errors	ENST00000312253	ensembl	human	known	74_37	silent	53.49	20	23	SNP	0.304	T
OTUD4	54726	genome.wustl.edu	37	4	146059597	146059597	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr4:146059597T>A	ENST00000447906.2	-	21	2517	c.2330A>T	c.(2329-2331)aAt>aTt	p.N777I	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.N712I			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	777					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CATTTGACCATTAACACTGGC	0.483																																																	0													94.0	84.0	87.0					4																	146059597		2203	4300	6503	SO:0001583	missense	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2330A>T	4.37:g.146059597T>A	ENSP00000395487:p.Asn777Ile		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.N777I	ENST00000447906.2	37	c.2330		4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012487	0.75161	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.36520	1.26;1.25	5.79	5.79	0.91817	.	0.139589	0.50627	D	0.000115	T	0.49915	0.1585	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71656	0.974;0.942	T	0.52245	-0.8601	10	0.87932	D	0	-22.5476	16.1175	0.81319	0.0:0.0:0.0:1.0	.	777;776	G3V0I6;Q01804	.;OTUD4_HUMAN	I	712;777	ENSP00000409279:N712I;ENSP00000395487:N777I	ENSP00000395487:N777I	N	-	2	0	OTUD4	146279047	0.983000	0.35010	1.000000	0.80357	0.983000	0.72400	2.976000	0.49289	2.211000	0.71520	0.460000	0.39030	AAT	OTUD4	-	NULL	ENSG00000164164		0.483	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	-	0.00	64	0	T	NM_017493		146059597	-1	tier1	-	no_errors	ENST00000447906	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	A
OTUD4	54726	genome.wustl.edu	37	4	146059597	146059597	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr4:146059597T>A	ENST00000447906.2	-	21	2517	c.2330A>T	c.(2329-2331)aAt>aTt	p.N777I	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.N712I			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	777					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					CATTTGACCATTAACACTGGC	0.483																																																	0													94.0	84.0	87.0					4																	146059597		2203	4300	6503	SO:0001583	missense	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2330A>T	4.37:g.146059597T>A	ENSP00000395487:p.Asn777Ile		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.N777I	ENST00000447906.2	37	c.2330		4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012487	0.75161	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.36520	1.26;1.25	5.79	5.79	0.91817	.	0.139589	0.50627	D	0.000115	T	0.49915	0.1585	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71656	0.974;0.942	T	0.52245	-0.8601	10	0.87932	D	0	-22.5476	16.1175	0.81319	0.0:0.0:0.0:1.0	.	777;776	G3V0I6;Q01804	.;OTUD4_HUMAN	I	712;777	ENSP00000409279:N712I;ENSP00000395487:N777I	ENSP00000395487:N777I	N	-	2	0	OTUD4	146279047	0.983000	0.35010	1.000000	0.80357	0.983000	0.72400	2.976000	0.49289	2.211000	0.71520	0.460000	0.39030	AAT	OTUD4	-	NULL	ENSG00000164164		0.483	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	-	0.00	66	0	T	NM_017493		146059597	-1	tier1	-	no_errors	ENST00000447906	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	A
OTUD6B	51633	genome.wustl.edu	37	8	92097035	92097035	+	Nonsense_Mutation	SNP	T	T	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:92097035T>G	ENST00000285420.4	+	7	1010	c.911T>G	c.(910-912)tTa>tGa	p.L304*	OTUD6B_ENST00000404789.3_Nonsense_Mutation_p.L173*	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	274							cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			GCATATGGCTTAGGAGAACAT	0.254																																																	0													76.0	72.0	73.0					8																	92097035		2203	4297	6500	SO:0001587	stop_gained	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.911T>G	8.37:g.92097035T>G	ENSP00000285420:p.Leu304*		A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Nonsense_Mutation	SNP	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.L304*	ENST00000285420.4	37	c.911	CCDS6253.2	8	.	.	.	.	.	.	.	.	.	.	T	40	8.043776	0.98624	.	.	ENSG00000155100	ENST00000285420;ENST00000404789	.	.	.	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.0595	16.143	0.81539	0.0:0.0:0.0:1.0	.	.	.	.	X	304;173	.	ENSP00000285420:L304X	L	+	2	0	OTUD6B	92166211	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.842000	0.75379	2.289000	0.77006	0.482000	0.46254	TTA	OTUD6B	-	pfam_OTU,pfscan_OTU	ENSG00000155100		0.254	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1		0.00	13	0	T	NM_016023		92097035	+1			no_errors	ENST00000285420	ensembl	human	known	74_37	nonsense	12.00	22	3	SNP	1.000	G
PAPPA2	60676	genome.wustl.edu	37	1	176664899	176664899	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:176664899T>G	ENST00000367662.3	+	7	3814	c.2650T>G	c.(2650-2652)Tgc>Ggc	p.C884G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	884					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTGTGGCGCTTGCACTGAAGA	0.532																																																	0													95.0	97.0	96.0					1																	176664899		2078	4232	6310	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2650T>G	1.37:g.176664899T>G	ENSP00000356634:p.Cys884Gly		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.C884G	ENST00000367662.3	37	c.2650	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104111	0.76983	.	.	ENSG00000116183	ENST00000367662	T	0.10288	2.89	5.51	5.51	0.81932	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.34221	0.0890	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08391	-1.0724	10	0.87932	D	0	-20.741	15.2975	0.73922	0.0:0.0:0.0:1.0	.	884	Q9BXP8	PAPP2_HUMAN	G	884	ENSP00000356634:C884G	ENSP00000356634:C884G	C	+	1	0	PAPPA2	174931522	1.000000	0.71417	0.990000	0.47175	0.550000	0.35303	7.895000	0.87343	2.098000	0.63641	0.460000	0.39030	TGC	PAPPA2	-	superfamily_Fibronectin_type3	ENSG00000116183		0.532	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	66	0	T			176664899	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	12.35	71	10	SNP	0.999	G
PAPPA2	60676	genome.wustl.edu	37	1	176664899	176664899	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:176664899T>G	ENST00000367662.3	+	7	3814	c.2650T>G	c.(2650-2652)Tgc>Ggc	p.C884G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	884					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTGTGGCGCTTGCACTGAAGA	0.532																																																	0													95.0	97.0	96.0					1																	176664899		2078	4232	6310	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2650T>G	1.37:g.176664899T>G	ENSP00000356634:p.Cys884Gly		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.C884G	ENST00000367662.3	37	c.2650	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.104111	0.76983	.	.	ENSG00000116183	ENST00000367662	T	0.10288	2.89	5.51	5.51	0.81932	Fibronectin, type III (2);	0.000000	0.85682	D	0.000000	T	0.34221	0.0890	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08391	-1.0724	10	0.87932	D	0	-20.741	15.2975	0.73922	0.0:0.0:0.0:1.0	.	884	Q9BXP8	PAPP2_HUMAN	G	884	ENSP00000356634:C884G	ENSP00000356634:C884G	C	+	1	0	PAPPA2	174931522	1.000000	0.71417	0.990000	0.47175	0.550000	0.35303	7.895000	0.87343	2.098000	0.63641	0.460000	0.39030	TGC	PAPPA2	-	superfamily_Fibronectin_type3	ENSG00000116183		0.532	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	74	0	T			176664899	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	12.35	71	10	SNP	0.999	G
PCYT1B	9468	genome.wustl.edu	37	X	24625955	24625955	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:24625955C>T	ENST00000379144.2	-	3	371	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	PCYT1B_ENST00000356768.4_Missense_Mutation_p.A81T|PCYT1B_ENST00000379145.1_Missense_Mutation_p.A63T	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	81					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	ATTCCATCGGCGTATACTCTG	0.448																																																	0													78.0	71.0	73.0					X																	24625955		2203	4300	6503	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.241G>A	X.37:g.24625955C>T	ENSP00000368439:p.Ala81Thr		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_Cyt_trans-like	p.A81T	ENST00000379144.2	37	c.241	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	C	29.9	5.047036	0.93740	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96802	-4.13;-4.13;-4.13	5.19	5.19	0.71726	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.103999	0.64402	D	0.000004	D	0.97158	0.9071	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.958;0.958	D	0.98087	1.0407	10	0.72032	D	0.01	0.001	17.8268	0.88668	0.0:1.0:0.0:0.0	.	81;63;81	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	T	63;81;81	ENSP00000368440:A63T;ENSP00000368439:A81T;ENSP00000349211:A81T	ENSP00000349211:A81T	A	-	1	0	PCYT1B	24535876	1.000000	0.71417	0.703000	0.30354	0.982000	0.71751	7.320000	0.79064	2.398000	0.81561	0.544000	0.68410	GCC	PCYT1B	-	pfam_Cyt_trans-like,tigrfam_Cyt_trans-like	ENSG00000102230		0.448	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	-	0.00	22	0	C	NM_004845		24625955	-1	tier1	-	no_errors	ENST00000379144	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	T
PCYT1B	9468	genome.wustl.edu	37	X	24625955	24625955	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:24625955C>T	ENST00000379144.2	-	3	371	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	PCYT1B_ENST00000356768.4_Missense_Mutation_p.A81T|PCYT1B_ENST00000379145.1_Missense_Mutation_p.A63T	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	81					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	ATTCCATCGGCGTATACTCTG	0.448																																																	0													78.0	71.0	73.0					X																	24625955		2203	4300	6503	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.241G>A	X.37:g.24625955C>T	ENSP00000368439:p.Ala81Thr		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_Cyt_trans-like	p.A81T	ENST00000379144.2	37	c.241	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	C	29.9	5.047036	0.93740	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96802	-4.13;-4.13;-4.13	5.19	5.19	0.71726	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.103999	0.64402	D	0.000004	D	0.97158	0.9071	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.958;0.958	D	0.98087	1.0407	10	0.72032	D	0.01	0.001	17.8268	0.88668	0.0:1.0:0.0:0.0	.	81;63;81	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	T	63;81;81	ENSP00000368440:A63T;ENSP00000368439:A81T;ENSP00000349211:A81T	ENSP00000349211:A81T	A	-	1	0	PCYT1B	24535876	1.000000	0.71417	0.703000	0.30354	0.982000	0.71751	7.320000	0.79064	2.398000	0.81561	0.544000	0.68410	GCC	PCYT1B	-	pfam_Cyt_trans-like,tigrfam_Cyt_trans-like	ENSG00000102230		0.448	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	-	0.00	26	0	C	NM_004845		24625955	-1	tier1	-	no_errors	ENST00000379144	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	T
PDE11A	50940	genome.wustl.edu	37	2	178681580	178681580	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:178681580C>G	ENST00000286063.6	-	9	2030	c.1713G>C	c.(1711-1713)tgG>tgC	p.W571C	PDE11A_ENST00000389683.3_Missense_Mutation_p.W127C|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Missense_Mutation_p.W213C|PDE11A_ENST00000449286.2_Missense_Mutation_p.W213C|PDE11A_ENST00000358450.4_Missense_Mutation_p.W321C	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	571					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	ACTGCTTGGCCCAGGACTTCT	0.393									Primary Pigmented Nodular Adrenocortical Disease, Familial																																								0													149.0	139.0	142.0					2																	178681580		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1713G>C	2.37:g.178681580C>G	ENSP00000286063:p.Trp571Cys		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.W571C	ENST00000286063.6	37	c.1713	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787042	0.70337	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.67382	0.951;0.887	T	0.76269	-0.3021	10	0.62326	D	0.03	.	18.8421	0.92188	0.0:1.0:0.0:0.0	.	321;571	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	C	571;321;213;127;213	ENSP00000286063:W571C;ENSP00000351232:W321C;ENSP00000386539:W213C;ENSP00000374333:W127C;ENSP00000390599:W213C	ENSP00000286063:W571C	W	-	3	0	PDE11A	178389826	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.667000	0.68067	2.744000	0.94065	0.655000	0.94253	TGG	PDE11A	-	NULL	ENSG00000128655		0.393	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2	-	0.00	11	0	C			178681580	-1	tier1	-	no_errors	ENST00000286063	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	G
PDE11A	50940	genome.wustl.edu	37	2	178681580	178681580	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:178681580C>G	ENST00000286063.6	-	9	2030	c.1713G>C	c.(1711-1713)tgG>tgC	p.W571C	PDE11A_ENST00000389683.3_Missense_Mutation_p.W127C|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Missense_Mutation_p.W213C|PDE11A_ENST00000449286.2_Missense_Mutation_p.W213C|PDE11A_ENST00000358450.4_Missense_Mutation_p.W321C	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	571					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	ACTGCTTGGCCCAGGACTTCT	0.393									Primary Pigmented Nodular Adrenocortical Disease, Familial																																								0													149.0	139.0	142.0					2																	178681580		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1713G>C	2.37:g.178681580C>G	ENSP00000286063:p.Trp571Cys		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.W571C	ENST00000286063.6	37	c.1713	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787042	0.70337	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.67382	0.951;0.887	T	0.76269	-0.3021	10	0.62326	D	0.03	.	18.8421	0.92188	0.0:1.0:0.0:0.0	.	321;571	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	C	571;321;213;127;213	ENSP00000286063:W571C;ENSP00000351232:W321C;ENSP00000386539:W213C;ENSP00000374333:W127C;ENSP00000390599:W213C	ENSP00000286063:W571C	W	-	3	0	PDE11A	178389826	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.667000	0.68067	2.744000	0.94065	0.655000	0.94253	TGG	PDE11A	-	NULL	ENSG00000128655		0.393	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2	-	0.00	12	0	C			178681580	-1	tier1	-	no_errors	ENST00000286063	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	G
PDE4DIP	9659	genome.wustl.edu	37	1	145039744	145039744	+	5'UTR	SNP	C	C	A	rs367568901	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:145039744C>A	ENST00000493130.2	-	0	27				PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000478649.2_5'UTR|PDE4DIP_ENST00000313382.9_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTTTCTGCGTCGGCGGCGAAG	0.587			T	PDGFRB	MPD								C|||	477	0.0952476	0.1392	0.0663	5008	,	,		61387	0.0357		0.0905	False		,,,				2504	0.1227							Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001623	5_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000493130.2:c.-135G>T	1.37:g.145039744C>A			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000493130.2	37	NULL		1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.587	PDE4DIP-027	PUTATIVE	basic|exp_conf	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000099618.2	-	0.00	38	0	C	NM_022359		145039744	-1	tier1	-	no_errors	ENST00000485062	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.000	A
PDPR	55066	genome.wustl.edu	37	16	70154430	70154430	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:70154430G>A	ENST00000288050.4	+	3	992	c.35G>A	c.(34-36)aGa>aAa	p.R12K	PDPR_ENST00000568530.1_Missense_Mutation_p.R12K|PDPR_ENST00000398122.3_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	12					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ATTGTTGGAAGACAAAGAGCC	0.522																																																	0													45.0	49.0	48.0					16																	70154430		2093	4236	6329	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.35G>A	16.37:g.70154430G>A	ENSP00000288050:p.Arg12Lys		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.R12K	ENST00000288050.4	37	c.35	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	G	0.614	-0.823670	0.02755	.	.	ENSG00000090857	ENST00000288050	T	0.69040	-0.37	4.13	2.06	0.26882	.	0.963426	0.08588	N	0.923510	T	0.43366	0.1244	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.31475	-0.9942	10	0.02654	T	1	.	5.0569	0.14537	0.2025:0.1686:0.6289:0.0	.	12	Q8NCN5	PDPR_HUMAN	K	12	ENSP00000288050:R12K	ENSP00000288050:R12K	R	+	2	0	PDPR	68711931	0.994000	0.37717	0.002000	0.10522	0.024000	0.10985	2.733000	0.47360	0.270000	0.21984	-0.366000	0.07423	AGA	PDPR	-	NULL	ENSG00000090857		0.522	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	116	0	G	NM_017990		70154430	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	missense	9.55	161	17	SNP	0.005	A
PDPR	55066	genome.wustl.edu	37	16	70154430	70154430	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:70154430G>A	ENST00000288050.4	+	3	992	c.35G>A	c.(34-36)aGa>aAa	p.R12K	PDPR_ENST00000568530.1_Missense_Mutation_p.R12K|PDPR_ENST00000398122.3_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	12					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ATTGTTGGAAGACAAAGAGCC	0.522																																																	0													45.0	49.0	48.0					16																	70154430		2093	4236	6329	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.35G>A	16.37:g.70154430G>A	ENSP00000288050:p.Arg12Lys		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.R12K	ENST00000288050.4	37	c.35	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	G	0.614	-0.823670	0.02755	.	.	ENSG00000090857	ENST00000288050	T	0.69040	-0.37	4.13	2.06	0.26882	.	0.963426	0.08588	N	0.923510	T	0.43366	0.1244	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.31475	-0.9942	10	0.02654	T	1	.	5.0569	0.14537	0.2025:0.1686:0.6289:0.0	.	12	Q8NCN5	PDPR_HUMAN	K	12	ENSP00000288050:R12K	ENSP00000288050:R12K	R	+	2	0	PDPR	68711931	0.994000	0.37717	0.002000	0.10522	0.024000	0.10985	2.733000	0.47360	0.270000	0.21984	-0.366000	0.07423	AGA	PDPR	-	NULL	ENSG00000090857		0.522	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	118	0	G	NM_017990		70154430	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	missense	9.55	161	17	SNP	0.005	A
PEG3	5178	genome.wustl.edu	37	19	57325604	57325604	+	Silent	SNP	G	G	A	rs141987198	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:57325604G>A	ENST00000326441.9	-	10	4569	c.4206C>T	c.(4204-4206)gcC>gcT	p.A1402A	PEG3_ENST00000598410.1_Silent_p.A1278A|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Silent_p.A1276A|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.A1402A	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1402	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A1402A(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTTCTGGCTCGGCAGCCTCCA	0.577																																																	2	Substitution - coding silent(2)	lung(2)						G	,,,,,,,	1,4345		0,1,2172	43.0	46.0	45.0		4206,3828,4206,3834,,,4206,	-7.2	0.0	19	dbSNP_134	45	1,8413		0,1,4206	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron,coding-synonymous,intron	PEG3,ZIM2	NM_001146184.1,NM_001146185.1,NM_001146186.1,NM_001146187.1,NM_001146326.1,NM_001146327.1,NM_006210.2,NM_015363.4	,,,,,,,	0,2,6378	AA,AG,GG		0.0119,0.023,0.0157	,,,,,,,	1402/1589,1276/1463,1402/1589,1278/1465,,,1402/1589,	57325604	2,12758	2173	4207	6380	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4206C>T	19.37:g.57325604G>A			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A1402	ENST00000326441.9	37	c.4206	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.577	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	55	0	G			57325604	-1	tier1	rs141987198	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	19.12	55	13	SNP	0.011	A
PEG3	5178	genome.wustl.edu	37	19	57325604	57325604	+	Silent	SNP	G	G	A	rs141987198	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:57325604G>A	ENST00000326441.9	-	10	4569	c.4206C>T	c.(4204-4206)gcC>gcT	p.A1402A	PEG3_ENST00000598410.1_Silent_p.A1278A|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Silent_p.A1276A|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.A1402A	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1402	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.A1402A(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTTCTGGCTCGGCAGCCTCCA	0.577																																																	2	Substitution - coding silent(2)	lung(2)						G	,,,,,,,	1,4345		0,1,2172	43.0	46.0	45.0		4206,3828,4206,3834,,,4206,	-7.2	0.0	19	dbSNP_134	45	1,8413		0,1,4206	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,intron,coding-synonymous,intron	PEG3,ZIM2	NM_001146184.1,NM_001146185.1,NM_001146186.1,NM_001146187.1,NM_001146326.1,NM_001146327.1,NM_006210.2,NM_015363.4	,,,,,,,	0,2,6378	AA,AG,GG		0.0119,0.023,0.0157	,,,,,,,	1402/1589,1276/1463,1402/1589,1278/1465,,,1402/1589,	57325604	2,12758	2173	4207	6380	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4206C>T	19.37:g.57325604G>A			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A1402	ENST00000326441.9	37	c.4206	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.577	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	63	0	G			57325604	-1	tier1	rs141987198	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	19.12	55	13	SNP	0.011	A
PHF21A	51317	genome.wustl.edu	37	11	45991391	45991391	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:45991391G>A	ENST00000418153.2	-	8	873	c.674C>T	c.(673-675)aCt>aTt	p.T225I	PHF21A_ENST00000323180.6_Missense_Mutation_p.T226I|PHF21A_ENST00000257821.4_Missense_Mutation_p.T226I			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	225					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TGGACGTGGAGTGAGTCTAGG	0.448																																																	0													103.0	94.0	97.0					11																	45991391		2202	4299	6501	SO:0001583	missense	0			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.674C>T	11.37:g.45991391G>A	ENSP00000398824:p.Thr225Ile		D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.T226I	ENST00000418153.2	37	c.677	CCDS44578.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423867	0.83667	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	T;T;T	0.48836	0.8;0.8;0.8	5.5	5.5	0.81552	.	0.100286	0.64402	D	0.000002	T	0.55497	0.1924	L	0.51422	1.61	0.49299	D	0.999779	P;P	0.51537	0.928;0.946	P;P	0.51453	0.574;0.67	T	0.49341	-0.8950	10	0.32370	T	0.25	-7.1047	19.3979	0.94614	0.0:0.0:1.0:0.0	.	225;226	Q96BD5;Q96BD5-2	PF21A_HUMAN;.	I	226;226;225	ENSP00000257821:T226I;ENSP00000323152:T226I;ENSP00000398824:T225I	ENSP00000257821:T226I	T	-	2	0	PHF21A	45947967	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.015000	0.70791	2.595000	0.87683	0.655000	0.94253	ACT	PHF21A	-	NULL	ENSG00000135365		0.448	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF21A	HGNC	protein_coding	OTTHUMT00000392583.1	-	0.00	59	0	G	NM_016621		45991391	-1	tier1	-	no_errors	ENST00000257821	ensembl	human	known	74_37	missense	20.72	88	23	SNP	1.000	A
PHF21A	51317	genome.wustl.edu	37	11	45991391	45991391	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:45991391G>A	ENST00000418153.2	-	8	873	c.674C>T	c.(673-675)aCt>aTt	p.T225I	PHF21A_ENST00000323180.6_Missense_Mutation_p.T226I|PHF21A_ENST00000257821.4_Missense_Mutation_p.T226I			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	225					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TGGACGTGGAGTGAGTCTAGG	0.448																																																	0													103.0	94.0	97.0					11																	45991391		2202	4299	6501	SO:0001583	missense	0			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.674C>T	11.37:g.45991391G>A	ENSP00000398824:p.Thr225Ile		D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.T226I	ENST00000418153.2	37	c.677	CCDS44578.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423867	0.83667	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	T;T;T	0.48836	0.8;0.8;0.8	5.5	5.5	0.81552	.	0.100286	0.64402	D	0.000002	T	0.55497	0.1924	L	0.51422	1.61	0.49299	D	0.999779	P;P	0.51537	0.928;0.946	P;P	0.51453	0.574;0.67	T	0.49341	-0.8950	10	0.32370	T	0.25	-7.1047	19.3979	0.94614	0.0:0.0:1.0:0.0	.	225;226	Q96BD5;Q96BD5-2	PF21A_HUMAN;.	I	226;226;225	ENSP00000257821:T226I;ENSP00000323152:T226I;ENSP00000398824:T225I	ENSP00000257821:T226I	T	-	2	0	PHF21A	45947967	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.015000	0.70791	2.595000	0.87683	0.655000	0.94253	ACT	PHF21A	-	NULL	ENSG00000135365		0.448	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF21A	HGNC	protein_coding	OTTHUMT00000392583.1	-	0.00	65	0	G	NM_016621		45991391	-1	tier1	-	no_errors	ENST00000257821	ensembl	human	known	74_37	missense	20.72	88	23	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110417360	110417360	+	Splice_Site	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:110417360G>C	ENST00000378402.5	+	16	1773		c.e16+1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAAAAACTGGTAAGTTATAA	0.308										HNSCC(38;0.096)																																							0													18.0	18.0	18.0					8																	110417360		1772	4042	5814	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1669+1G>C	8.37:g.110417360G>C			Q567P2|Q9UF27	Splice_Site	SNP	-	e16+1	ENST00000378402.5	37	c.1669+1	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574248	0.65878	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2279	0.86975	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKHD1L1	110486536	1.000000	0.71417	0.999000	0.59377	0.726000	0.41606	5.648000	0.67930	2.672000	0.90937	0.650000	0.86243	.	PKHD1L1	-	-	ENSG00000205038		0.308	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	30	0	G	NM_177531	Intron	110417360	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	splice_site	27.42	45	17	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110417360	110417360	+	Splice_Site	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:110417360G>C	ENST00000378402.5	+	16	1773		c.e16+1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAAAAACTGGTAAGTTATAA	0.308										HNSCC(38;0.096)																																							0													18.0	18.0	18.0					8																	110417360		1772	4042	5814	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1669+1G>C	8.37:g.110417360G>C			Q567P2|Q9UF27	Splice_Site	SNP	-	e16+1	ENST00000378402.5	37	c.1669+1	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574248	0.65878	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2279	0.86975	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKHD1L1	110486536	1.000000	0.71417	0.999000	0.59377	0.726000	0.41606	5.648000	0.67930	2.672000	0.90937	0.650000	0.86243	.	PKHD1L1	-	-	ENSG00000205038		0.308	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	37	0	G	NM_177531	Intron	110417360	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	splice_site	27.42	45	17	SNP	1.000	C
PKP4	8502	genome.wustl.edu	37	2	159526239	159526239	+	Silent	SNP	C	C	T	rs138568714		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:159526239C>T	ENST00000389759.3	+	17	2848	c.2736C>T	c.(2734-2736)taC>taT	p.Y912Y	PKP4_ENST00000389757.3_Silent_p.Y912Y|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	912					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CAGGCAAATACGCCATGCGAG	0.502										HNSCC(62;0.18)																																							0								C	,	1,4405	2.1+/-5.4	0,1,2202	48.0	51.0	50.0		2736,2736	-3.0	1.0	2	dbSNP_134	50	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PKP4	NM_001005476.1,NM_003628.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	912/1150,912/1193	159526239	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2736C>T	2.37:g.159526239C>T			Q86W91	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Y912	ENST00000389759.3	37	c.2736	CCDS33305.1	2																																																																																			PKP4	-	superfamily_ARM-type_fold	ENSG00000144283		0.502	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	-	0.00	24	0	C			159526239	+1	tier1	rs138568714	no_errors	ENST00000389759	ensembl	human	known	74_37	silent	28.57	25	10	SNP	0.936	T
PKP4	8502	genome.wustl.edu	37	2	159526239	159526239	+	Silent	SNP	C	C	T	rs138568714		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:159526239C>T	ENST00000389759.3	+	17	2848	c.2736C>T	c.(2734-2736)taC>taT	p.Y912Y	PKP4_ENST00000389757.3_Silent_p.Y912Y|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	912					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CAGGCAAATACGCCATGCGAG	0.502										HNSCC(62;0.18)																																							0								C	,	1,4405	2.1+/-5.4	0,1,2202	48.0	51.0	50.0		2736,2736	-3.0	1.0	2	dbSNP_134	50	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PKP4	NM_001005476.1,NM_003628.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	912/1150,912/1193	159526239	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2736C>T	2.37:g.159526239C>T			Q86W91	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Y912	ENST00000389759.3	37	c.2736	CCDS33305.1	2																																																																																			PKP4	-	superfamily_ARM-type_fold	ENSG00000144283		0.502	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	-	0.00	25	0	C			159526239	+1	tier1	rs138568714	no_errors	ENST00000389759	ensembl	human	known	74_37	silent	28.57	25	10	SNP	0.936	T
PLCL1	5334	genome.wustl.edu	37	2	198949317	198949317	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:198949317G>T	ENST00000428675.1	+	2	1474	c.1076G>T	c.(1075-1077)aGa>aTa	p.R359I	PLCL1_ENST00000437704.2_Missense_Mutation_p.R261I	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	359					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ATCATAAGGAGATACGAACTT	0.388																																																	0													107.0	101.0	103.0					2																	198949317		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1076G>T	2.37:g.198949317G>T	ENSP00000402861:p.Arg359Ile		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R359I	ENST00000428675.1	37	c.1076	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667748	0.47677	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.46451	0.87;0.87	5.94	5.94	0.96194	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.42810	0.1219	L	0.60455	1.87	0.58432	D	0.999994	P;P	0.37276	0.589;0.589	B;B	0.39299	0.296;0.296	T	0.21999	-1.0229	9	.	.	.	.	13.5478	0.61715	0.0708:0.0:0.9292:0.0	.	359;285	Q15111;B4DYZ4	PLCL1_HUMAN;.	I	359;261	ENSP00000402861:R359I;ENSP00000414138:R261I	.	R	+	2	0	PLCL1	198657562	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.181000	0.65054	2.826000	0.97356	0.561000	0.74099	AGA	PLCL1	-	pfam_PLipase_C_EF-hand-like	ENSG00000115896		0.388	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	46	0	G	NM_006226		198949317	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	T
PLCL1	5334	genome.wustl.edu	37	2	198949317	198949317	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:198949317G>T	ENST00000428675.1	+	2	1474	c.1076G>T	c.(1075-1077)aGa>aTa	p.R359I	PLCL1_ENST00000437704.2_Missense_Mutation_p.R261I	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	359					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ATCATAAGGAGATACGAACTT	0.388																																																	0													107.0	101.0	103.0					2																	198949317		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1076G>T	2.37:g.198949317G>T	ENSP00000402861:p.Arg359Ile		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R359I	ENST00000428675.1	37	c.1076	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667748	0.47677	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.46451	0.87;0.87	5.94	5.94	0.96194	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.42810	0.1219	L	0.60455	1.87	0.58432	D	0.999994	P;P	0.37276	0.589;0.589	B;B	0.39299	0.296;0.296	T	0.21999	-1.0229	9	.	.	.	.	13.5478	0.61715	0.0708:0.0:0.9292:0.0	.	359;285	Q15111;B4DYZ4	PLCL1_HUMAN;.	I	359;261	ENSP00000402861:R359I;ENSP00000414138:R261I	.	R	+	2	0	PLCL1	198657562	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.181000	0.65054	2.826000	0.97356	0.561000	0.74099	AGA	PLCL1	-	pfam_PLipase_C_EF-hand-like	ENSG00000115896		0.388	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	49	0	G	NM_006226		198949317	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	T
PPFIBP2	8495	genome.wustl.edu	37	11	7598559	7598560	+	Intron	INS	-	-	GTGC	rs544618288|rs201728813|rs139232467|rs371139225	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:7598559_7598560insGTGC	ENST00000299492.4	+	3	667				PPFIBP2_ENST00000533792.1_Intron	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)						cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		tgcgtgtgtgtgtgtgtgtgtg	0.515																																																	0																																										SO:0001627	intron_variant	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.279+11561->GTGC	11.37:g.7598559_7598560insGTGC			B7Z433|E9PK77|O75337|Q8WW26	RNA	INS	-	NULL	ENST00000299492.4	37	NULL	CCDS31419.1	11																																																																																			PPFIBP2	-	-	ENSG00000166387		0.515	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2		0.00	8	0	-	NM_003621		7598560	+1	tier1		no_errors	ENST00000529021	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.008:0.018	GTGC
PPP4R4	57718	genome.wustl.edu	37	14	94710984	94710984	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:94710984C>T	ENST00000304338.3	+	12	1433	c.1279C>T	c.(1279-1281)Ctg>Ttg	p.L427L		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	427					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						ATCTAAGCTTCTGAATTCTGG	0.254																																																	0													51.0	60.0	57.0					14																	94710984		2176	4267	6443	SO:0001819	synonymous_variant	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1279C>T	14.37:g.94710984C>T			Q9BUF8|Q9HCF0	Silent	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L427	ENST00000304338.3	37	c.1279	CCDS9921.1	14																																																																																			PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.254	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	-	0.00	10	0	C	NM_058237		94710984	+1	tier1	-	no_errors	ENST00000304338	ensembl	human	known	74_37	silent	24.00	19	6	SNP	1.000	T
PPP4R4	57718	genome.wustl.edu	37	14	94710984	94710984	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:94710984C>T	ENST00000304338.3	+	12	1433	c.1279C>T	c.(1279-1281)Ctg>Ttg	p.L427L		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	427					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						ATCTAAGCTTCTGAATTCTGG	0.254																																																	0													51.0	60.0	57.0					14																	94710984		2176	4267	6443	SO:0001819	synonymous_variant	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1279C>T	14.37:g.94710984C>T			Q9BUF8|Q9HCF0	Silent	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L427	ENST00000304338.3	37	c.1279	CCDS9921.1	14																																																																																			PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.254	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	-	0.00	22	0	C	NM_058237		94710984	+1	tier1	-	no_errors	ENST00000304338	ensembl	human	known	74_37	silent	24.00	19	6	SNP	1.000	T
PRDM16	63976	genome.wustl.edu	37	1	3329081	3329081	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:3329081G>T	ENST00000270722.5	+	9	2369	c.2320G>T	c.(2320-2322)Gat>Tat	p.D774Y	PRDM16_ENST00000442529.2_Missense_Mutation_p.D774Y|PRDM16_ENST00000511072.1_Missense_Mutation_p.D775Y|PRDM16_ENST00000514189.1_Missense_Mutation_p.D775Y|PRDM16_ENST00000378398.3_Missense_Mutation_p.D775Y|PRDM16_ENST00000378391.2_Missense_Mutation_p.D774Y|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.D774Y			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	774	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GTGCCCCTTTGATCTCACCAC	0.682			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													40.0	46.0	44.0					1																	3329081		2005	4164	6169	SO:0001583	missense	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2320G>T	1.37:g.3329081G>T	ENSP00000270722:p.Asp774Tyr		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.D774Y	ENST00000270722.5	37	c.2320	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498152	0.44455	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.12255	2.73;2.74;2.75;2.74;2.72;2.76;2.74;2.7;2.71	4.41	4.41	0.53225	.	0.000000	0.51477	U	0.000094	T	0.39332	0.1074	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	0.963;0.997;1.0;0.995	P;P;D;P	0.71414	0.603;0.905;0.973;0.82	T	0.43048	-0.9415	10	0.87932	D	0	.	17.3359	0.87281	0.0:0.0:1.0:0.0	.	774;774;774;774	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	Y	775;775;774;774;774;775;774;590;590;583	ENSP00000426975:D775Y;ENSP00000367651:D775Y;ENSP00000407968:D774Y;ENSP00000405253:D774Y;ENSP00000367643:D774Y;ENSP00000421400:D775Y;ENSP00000270722:D774Y;ENSP00000422504:D590Y;ENSP00000425796:D583Y	ENSP00000270722:D774Y	D	+	1	0	PRDM16	3318941	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	9.131000	0.94446	2.169000	0.68431	0.453000	0.30009	GAT	PRDM16	-	NULL	ENSG00000142611		0.682	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	103	0	G	NM_022114		3329081	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	19.23	63	15	SNP	1.000	T
PRDM16	63976	genome.wustl.edu	37	1	3329081	3329081	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:3329081G>T	ENST00000270722.5	+	9	2369	c.2320G>T	c.(2320-2322)Gat>Tat	p.D774Y	PRDM16_ENST00000442529.2_Missense_Mutation_p.D774Y|PRDM16_ENST00000511072.1_Missense_Mutation_p.D775Y|PRDM16_ENST00000514189.1_Missense_Mutation_p.D775Y|PRDM16_ENST00000378398.3_Missense_Mutation_p.D775Y|PRDM16_ENST00000378391.2_Missense_Mutation_p.D774Y|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.D774Y			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	774	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GTGCCCCTTTGATCTCACCAC	0.682			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													40.0	46.0	44.0					1																	3329081		2005	4164	6169	SO:0001583	missense	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2320G>T	1.37:g.3329081G>T	ENSP00000270722:p.Asp774Tyr		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.D774Y	ENST00000270722.5	37	c.2320	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498152	0.44455	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.12255	2.73;2.74;2.75;2.74;2.72;2.76;2.74;2.7;2.71	4.41	4.41	0.53225	.	0.000000	0.51477	U	0.000094	T	0.39332	0.1074	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	0.963;0.997;1.0;0.995	P;P;D;P	0.71414	0.603;0.905;0.973;0.82	T	0.43048	-0.9415	10	0.87932	D	0	.	17.3359	0.87281	0.0:0.0:1.0:0.0	.	774;774;774;774	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	Y	775;775;774;774;774;775;774;590;590;583	ENSP00000426975:D775Y;ENSP00000367651:D775Y;ENSP00000407968:D774Y;ENSP00000405253:D774Y;ENSP00000367643:D774Y;ENSP00000421400:D775Y;ENSP00000270722:D774Y;ENSP00000422504:D590Y;ENSP00000425796:D583Y	ENSP00000270722:D774Y	D	+	1	0	PRDM16	3318941	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	9.131000	0.94446	2.169000	0.68431	0.453000	0.30009	GAT	PRDM16	-	NULL	ENSG00000142611		0.682	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	78	0	G	NM_022114		3329081	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	19.23	63	15	SNP	1.000	T
PRKD3	23683	genome.wustl.edu	37	2	37513341	37513341	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:37513341G>A	ENST00000379066.1	-	6	1651	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	PRKD3_ENST00000234179.2_Missense_Mutation_p.R297C			O94806	KPCD3_HUMAN	protein kinase D3	297					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATTCCTTGGCGAAAGAGGCCT	0.373																																					Melanoma(80;621 1355 8613 11814 51767)												0													120.0	98.0	105.0					2																	37513341		2203	4300	6503	SO:0001583	missense	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.889C>T	2.37:g.37513341G>A	ENSP00000368356:p.Arg297Cys		D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.R297C	ENST00000379066.1	37	c.889	CCDS1789.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.398183	0.96030	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	D;D	0.92699	-3.09;-3.09	5.71	5.71	0.89125	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.97346	0.9132	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97842	1.0269	10	0.87932	D	0	-5.8143	19.8677	0.96824	0.0:0.0:1.0:0.0	.	297;297	O94806-2;O94806	.;KPCD3_HUMAN	C	297	ENSP00000368356:R297C;ENSP00000234179:R297C	ENSP00000234179:R297C	R	-	1	0	PRKD3	37366845	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.903000	0.87398	2.709000	0.92574	0.655000	0.94253	CGC	PRKD3	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000115825		0.373	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	-	0.00	39	0	G	NM_005813		37513341	-1	tier1	-	no_errors	ENST00000234179	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	A
PRKD3	23683	genome.wustl.edu	37	2	37513341	37513341	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:37513341G>A	ENST00000379066.1	-	6	1651	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	PRKD3_ENST00000234179.2_Missense_Mutation_p.R297C			O94806	KPCD3_HUMAN	protein kinase D3	297					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATTCCTTGGCGAAAGAGGCCT	0.373																																					Melanoma(80;621 1355 8613 11814 51767)												0													120.0	98.0	105.0					2																	37513341		2203	4300	6503	SO:0001583	missense	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.889C>T	2.37:g.37513341G>A	ENSP00000368356:p.Arg297Cys		D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.R297C	ENST00000379066.1	37	c.889	CCDS1789.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.398183	0.96030	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	D;D	0.92699	-3.09;-3.09	5.71	5.71	0.89125	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.97346	0.9132	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97842	1.0269	10	0.87932	D	0	-5.8143	19.8677	0.96824	0.0:0.0:1.0:0.0	.	297;297	O94806-2;O94806	.;KPCD3_HUMAN	C	297	ENSP00000368356:R297C;ENSP00000234179:R297C	ENSP00000234179:R297C	R	-	1	0	PRKD3	37366845	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.903000	0.87398	2.709000	0.92574	0.655000	0.94253	CGC	PRKD3	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000115825		0.373	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	-	0.00	43	0	G	NM_005813		37513341	-1	tier1	-	no_errors	ENST00000234179	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	A
PRPF39	55015	genome.wustl.edu	37	14	45564717	45564717	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr14:45564717C>A	ENST00000355765.6	+	2	445	c.275C>A	c.(274-276)cCt>cAt	p.P92H		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	92					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						GAAAATAATCCTCAGGATTTT	0.363																																																	0													20.0	20.0	20.0					14																	45564717		1851	4100	5951	SO:0001583	missense	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.275C>A	14.37:g.45564717C>A	ENSP00000348010:p.Pro92His		Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	smart_HAT	p.P92H	ENST00000355765.6	37	c.275	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936948	0.52972	.	.	ENSG00000185246	ENST00000355765;ENST00000553605	T;T	0.61040	0.14;0.14	5.87	4.88	0.63580	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.71986	0.3405	M	0.73430	2.235	0.54753	D	0.999986	P	0.47604	0.898	P	0.59424	0.857	T	0.74645	-0.3596	9	0.87932	D	0	-11.0116	13.1888	0.59697	0.0:0.8937:0.0:0.1063	.	92	Q86UA1	PRP39_HUMAN	H	92	ENSP00000348010:P92H;ENSP00000452428:P92H	ENSP00000348010:P92H	P	+	2	0	PRPF39	44634467	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.504000	0.53347	2.779000	0.95612	0.591000	0.81541	CCT	PRPF39	-	NULL	ENSG00000185246		0.363	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2	-	0.00	8	0	C			45564717	+1	tier1	-	no_errors	ENST00000355765	ensembl	human	known	74_37	missense	42.86	8	6	SNP	1.000	A
PRRC2B	84726	genome.wustl.edu	37	9	134363281	134363281	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:134363281G>T	ENST00000357304.4	+	27	6078	c.6023G>T	c.(6022-6024)aGc>aTc	p.S2008I	SNORD62A_ENST00000428514.1_RNA|PRRC2B_ENST00000458550.1_Missense_Mutation_p.S1314I|PRRC2B_ENST00000405995.1_Missense_Mutation_p.S1314I|PRRC2B_ENST00000372249.1_Missense_Mutation_p.S105I|SNORD62B_ENST00000426867.1_RNA	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2008							poly(A) RNA binding (GO:0044822)	p.S2008N(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TCACCGCCCAGCACCATGATC	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											51.0	57.0	55.0					9																	134363281		2107	4235	6342	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6023G>T	9.37:g.134363281G>T	ENSP00000349856:p.Ser2008Ile		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.S2008I	ENST00000357304.4	37	c.6023	CCDS48044.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.66|18.66	3.671615|3.671615	0.67928|0.67928	.|.	.|.	ENSG00000130723|ENSG00000130723	ENST00000320547|ENST00000405995;ENST00000357304;ENST00000458550;ENST00000372249	.|T;T;T	.|0.04502	.|3.61;3.94;3.61	4.82|4.82	3.91|3.91	0.45181|0.45181	.|.	.|0.129482	.|0.34110	.|U	.|0.004243	T|T	0.09024|0.09024	0.0223|0.0223	L|L	0.59436|0.59436	1.845|1.845	0.53688|0.53688	D|D	0.999976|0.999976	.|P;P	.|0.44478	.|0.813;0.836	.|P;B	.|0.45856	.|0.495;0.244	T|T	0.02093|0.02093	-1.1215|-1.1215	5|10	.|0.72032	.|D	.|0.01	-28.3942|-28.3942	11.898|11.898	0.52667|0.52667	0.0856:0.0:0.9144:0.0|0.0856:0.0:0.9144:0.0	.|.	.|1314;2008	.|Q5JSZ5-5;Q5JSZ5	.|.;PRC2B_HUMAN	H|I	14|1314;2008;1314;105	.|ENSP00000384606:S1314I;ENSP00000349856:S2008I;ENSP00000398853:S1314I	.|ENSP00000349856:S2008I	Q|S	+|+	3|2	2|0	PRRC2B|PRRC2B	133353102|133353102	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	1.826000|1.826000	0.39092|0.39092	2.382000|2.382000	0.81193|0.81193	0.561000|0.561000	0.74099|0.74099	CAG|AGC	PRRC2B	-	NULL	ENSG00000130723		0.607	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		-	0.00	55	0	G			134363281	+1	tier1	-	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	31.65	54	25	SNP	1.000	T
PRRC2B	84726	genome.wustl.edu	37	9	134363281	134363281	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:134363281G>T	ENST00000357304.4	+	27	6078	c.6023G>T	c.(6022-6024)aGc>aTc	p.S2008I	SNORD62A_ENST00000428514.1_RNA|PRRC2B_ENST00000458550.1_Missense_Mutation_p.S1314I|PRRC2B_ENST00000405995.1_Missense_Mutation_p.S1314I|PRRC2B_ENST00000372249.1_Missense_Mutation_p.S105I|SNORD62B_ENST00000426867.1_RNA	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2008							poly(A) RNA binding (GO:0044822)	p.S2008N(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TCACCGCCCAGCACCATGATC	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											51.0	57.0	55.0					9																	134363281		2107	4235	6342	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6023G>T	9.37:g.134363281G>T	ENSP00000349856:p.Ser2008Ile		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.S2008I	ENST00000357304.4	37	c.6023	CCDS48044.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.66|18.66	3.671615|3.671615	0.67928|0.67928	.|.	.|.	ENSG00000130723|ENSG00000130723	ENST00000320547|ENST00000405995;ENST00000357304;ENST00000458550;ENST00000372249	.|T;T;T	.|0.04502	.|3.61;3.94;3.61	4.82|4.82	3.91|3.91	0.45181|0.45181	.|.	.|0.129482	.|0.34110	.|U	.|0.004243	T|T	0.09024|0.09024	0.0223|0.0223	L|L	0.59436|0.59436	1.845|1.845	0.53688|0.53688	D|D	0.999976|0.999976	.|P;P	.|0.44478	.|0.813;0.836	.|P;B	.|0.45856	.|0.495;0.244	T|T	0.02093|0.02093	-1.1215|-1.1215	5|10	.|0.72032	.|D	.|0.01	-28.3942|-28.3942	11.898|11.898	0.52667|0.52667	0.0856:0.0:0.9144:0.0|0.0856:0.0:0.9144:0.0	.|.	.|1314;2008	.|Q5JSZ5-5;Q5JSZ5	.|.;PRC2B_HUMAN	H|I	14|1314;2008;1314;105	.|ENSP00000384606:S1314I;ENSP00000349856:S2008I;ENSP00000398853:S1314I	.|ENSP00000349856:S2008I	Q|S	+|+	3|2	2|0	PRRC2B|PRRC2B	133353102|133353102	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	1.826000|1.826000	0.39092|0.39092	2.382000|2.382000	0.81193|0.81193	0.561000|0.561000	0.74099|0.74099	CAG|AGC	PRRC2B	-	NULL	ENSG00000130723		0.607	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		-	0.00	65	0	G			134363281	+1	tier1	-	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	31.65	54	25	SNP	1.000	T
PSMD6	9861	genome.wustl.edu	37	3	64004295	64004295	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:64004295G>T	ENST00000295901.4	-	5	946	c.806C>A	c.(805-807)tCt>tAt	p.S269Y	PSMD6_ENST00000394431.2_Missense_Mutation_p.S231Y|RP11-245J9.6_ENST00000605919.1_RNA|PSMD6_ENST00000482510.1_Missense_Mutation_p.S230Y|PSMD6_ENST00000492933.1_Missense_Mutation_p.S322Y|RP11-245J9.4_ENST00000462717.1_RNA	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	269	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		GAAGAAAACAGAGTAACGGCA	0.373																																																	0													81.0	75.0	77.0					3																	64004295		2203	4299	6502	SO:0001583	missense	0			AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.806C>A	3.37:g.64004295G>T	ENSP00000295901:p.Ser269Tyr		A8K2E0|E9PHI9|Q6UV22	Missense_Mutation	SNP	pfam_26S_proteasome_reg_su-Rpn7,pfam_PCI_dom,smart_PCI_dom	p.S269Y	ENST00000295901.4	37	c.806	CCDS2901.1	3	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165031	0.57476	.	.	ENSG00000163636	ENST00000295901;ENST00000492933;ENST00000394431;ENST00000482510	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.94	5.94	0.96194	Proteasome component (PCI) domain (1);	0.179095	0.51477	D	0.000098	T	0.47893	0.1470	L	0.52126	1.63	0.54753	D	0.999984	P;B;P;B	0.48911	0.808;0.046;0.917;0.173	P;B;P;B	0.53266	0.447;0.063;0.722;0.389	T	0.39375	-0.9617	10	0.66056	D	0.02	.	15.8014	0.78456	0.0:0.1353:0.8647:0.0	.	231;230;322;269	Q6UV22;E9PHI9;C9IZE4;Q15008	.;.;.;PSMD6_HUMAN	Y	269;322;231;230	ENSP00000295901:S269Y;ENSP00000418695:S322Y;ENSP00000377952:S231Y;ENSP00000419227:S230Y	ENSP00000295901:S269Y	S	-	2	0	PSMD6	63979335	1.000000	0.71417	0.871000	0.34182	0.732000	0.41865	7.884000	0.87274	2.826000	0.97356	0.561000	0.74099	TCT	PSMD6	-	pfam_PCI_dom	ENSG00000163636		0.373	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD6	HGNC	protein_coding	OTTHUMT00000352082.1		0.00	28	0	G	NM_014814		64004295	-1			no_errors	ENST00000295901	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.998	T
PSME4	23198	genome.wustl.edu	37	2	54133795	54133795	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:54133795T>A	ENST00000404125.1	-	26	2938	c.2883A>T	c.(2881-2883)aaA>aaT	p.K961N	PSME4_ENST00000421748.2_Missense_Mutation_p.K105N	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	961					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GATGTATCTTTTTGTATTCAC	0.358																																																	0													155.0	154.0	155.0					2																	54133795		2203	4300	6503	SO:0001583	missense	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2883A>T	2.37:g.54133795T>A	ENSP00000384211:p.Lys961Asn		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.K961N	ENST00000404125.1	37	c.2883	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	T	15.18	2.758074	0.49468	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.11604	2.76;2.76	5.51	4.36	0.52297	Armadillo-type fold (1);	0.042967	0.85682	D	0.000000	T	0.10551	0.0258	L	0.44542	1.39	0.49915	D	0.999835	P;P;P	0.43094	0.799;0.763;0.698	B;B;B	0.41764	0.366;0.288;0.201	T	0.19516	-1.0303	10	0.15066	T	0.55	-13.3679	11.5373	0.50645	0.0:0.0704:0.0:0.9296	.	336;105;961	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	N	105;961	ENSP00000410830:K105N;ENSP00000384211:K961N	ENSP00000384211:K961N	K	-	3	2	PSME4	53987299	1.000000	0.71417	0.931000	0.37212	0.985000	0.73830	2.184000	0.42575	1.028000	0.39785	0.528000	0.53228	AAA	PSME4	-	superfamily_ARM-type_fold	ENSG00000068878		0.358	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	-	0.00	31	0	T	XM_040158		54133795	-1	tier1	-	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	35.71	36	20	SNP	1.000	A
PSME4	23198	genome.wustl.edu	37	2	54133795	54133795	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:54133795T>A	ENST00000404125.1	-	26	2938	c.2883A>T	c.(2881-2883)aaA>aaT	p.K961N	PSME4_ENST00000421748.2_Missense_Mutation_p.K105N	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	961					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GATGTATCTTTTTGTATTCAC	0.358																																																	0													155.0	154.0	155.0					2																	54133795		2203	4300	6503	SO:0001583	missense	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2883A>T	2.37:g.54133795T>A	ENSP00000384211:p.Lys961Asn		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.K961N	ENST00000404125.1	37	c.2883	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	T	15.18	2.758074	0.49468	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.11604	2.76;2.76	5.51	4.36	0.52297	Armadillo-type fold (1);	0.042967	0.85682	D	0.000000	T	0.10551	0.0258	L	0.44542	1.39	0.49915	D	0.999835	P;P;P	0.43094	0.799;0.763;0.698	B;B;B	0.41764	0.366;0.288;0.201	T	0.19516	-1.0303	10	0.15066	T	0.55	-13.3679	11.5373	0.50645	0.0:0.0704:0.0:0.9296	.	336;105;961	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	N	105;961	ENSP00000410830:K105N;ENSP00000384211:K961N	ENSP00000384211:K961N	K	-	3	2	PSME4	53987299	1.000000	0.71417	0.931000	0.37212	0.985000	0.73830	2.184000	0.42575	1.028000	0.39785	0.528000	0.53228	AAA	PSME4	-	superfamily_ARM-type_fold	ENSG00000068878		0.358	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	-	0.00	36	0	T	XM_040158		54133795	-1	tier1	-	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	35.71	36	20	SNP	1.000	A
RAB33B	83452	genome.wustl.edu	37	4	140394184	140394184	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr4:140394184G>T	ENST00000305626.5	+	2	983	c.594G>T	c.(592-594)aaG>aaT	p.K198N		NM_031296.1	NP_112586.1	Q9H082	RB33B_HUMAN	RAB33B, member RAS oncogene family	198					autophagy (GO:0006914)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of retrograde vesicle-mediated transport, Golgi to ER (GO:2000156)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4	all_hematologic(180;0.162)					TGGCTCATAAGCTTAAGAGCC	0.413																																																	0													99.0	97.0	98.0					4																	140394184		2203	4300	6503	SO:0001583	missense	0			AF350420	CCDS3747.1	4q28	2008-02-05			ENSG00000172007	ENSG00000172007		"""RAB, member RAS oncogene"""	16075	protein-coding gene	gene with protein product		605950					Standard	NM_031296		Approved	DKFZP434G099	uc003ihv.3	Q9H082	OTTHUMG00000133384	ENST00000305626.5:c.594G>T	4.37:g.140394184G>T	ENSP00000306496:p.Lys198Asn		B2R987|Q4W5B0	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K198N	ENST00000305626.5	37	c.594	CCDS3747.1	4	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563490	0.65651	.	.	ENSG00000172007	ENST00000305626	T	0.77750	-1.12	5.82	3.07	0.35406	.	0.042072	0.85682	D	0.000000	T	0.74038	0.3664	N	0.11845	0.185	0.58432	D	0.999993	D	0.60160	0.987	D	0.66497	0.944	T	0.74112	-0.3770	10	0.66056	D	0.02	.	9.2631	0.37625	0.2845:0.0:0.7155:0.0	.	198	Q9H082	RB33B_HUMAN	N	198	ENSP00000306496:K198N	ENSP00000306496:K198N	K	+	3	2	RAB33B	140613634	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.353000	0.44089	0.325000	0.23359	0.561000	0.74099	AAG	RAB33B	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase	ENSG00000172007		0.413	RAB33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB33B	HGNC	protein_coding	OTTHUMT00000257235.2	-	0.00	24	0	G	NM_031296		140394184	+1	tier1	-	no_errors	ENST00000305626	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	T
RECQL	5965	genome.wustl.edu	37	12	21639443	21639443	+	Silent	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:21639443T>C	ENST00000444129.2	-	5	939	c.471A>G	c.(469-471)tcA>tcG	p.S157S	RECQL_ENST00000421138.2_Silent_p.S157S	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	157	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						ACATGGTTGCTGAAATTCCTA	0.308								Other identified genes with known or suspected DNA repair function																																									0													65.0	64.0	64.0					12																	21639443		2203	4298	6501	SO:0001819	synonymous_variant	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.471A>G	12.37:g.21639443T>C			A8K6G2	Silent	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S157	ENST00000444129.2	37	c.471	CCDS31756.1	12																																																																																			RECQL	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.308	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1		0.00	85	0	T	NM_002907		21639443	-1			no_errors	ENST00000421138	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	C
REG3G	130120	genome.wustl.edu	37	2	79255036	79255036	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:79255036G>T	ENST00000272324.5	+	5	621	c.437G>T	c.(436-438)tGt>tTt	p.C146F	REG3G_ENST00000393897.2_Missense_Mutation_p.C146F|REG3G_ENST00000409471.1_Missense_Mutation_p.C100F	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	146	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTGGCCACTGTGGGAGCCTG	0.493																																																	0													105.0	108.0	107.0					2																	79255036		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.437G>T	2.37:g.79255036G>T	ENSP00000272324:p.Cys146Phe		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.C146F	ENST00000272324.5	37	c.437	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187231	0.78789	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.62105	0.05;0.05;0.06	4.73	4.73	0.59995	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	D	0.000027	D	0.85991	0.5826	H	0.98048	4.135	0.44611	D	0.997588	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90163	0.4229	10	0.72032	D	0.01	.	13.4227	0.61007	0.0:0.0:1.0:0.0	.	100;146	Q3SYE6;Q6UW15	.;REG3G_HUMAN	F	146;146;100	ENSP00000377475:C146F;ENSP00000272324:C146F;ENSP00000387105:C100F	ENSP00000272324:C146F	C	+	2	0	REG3G	79108544	1.000000	0.71417	0.764000	0.31436	0.699000	0.40488	3.984000	0.56923	2.621000	0.88768	0.650000	0.86243	TGT	REG3G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000143954		0.493	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	37	0	G	NM_198448		79255036	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	8.47	54	5	SNP	0.862	T
REG3G	130120	genome.wustl.edu	37	2	79255036	79255036	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:79255036G>T	ENST00000272324.5	+	5	621	c.437G>T	c.(436-438)tGt>tTt	p.C146F	REG3G_ENST00000393897.2_Missense_Mutation_p.C146F|REG3G_ENST00000409471.1_Missense_Mutation_p.C100F	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	146	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTGGCCACTGTGGGAGCCTG	0.493																																																	0													105.0	108.0	107.0					2																	79255036		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.437G>T	2.37:g.79255036G>T	ENSP00000272324:p.Cys146Phe		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.C146F	ENST00000272324.5	37	c.437	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187231	0.78789	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.62105	0.05;0.05;0.06	4.73	4.73	0.59995	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	D	0.000027	D	0.85991	0.5826	H	0.98048	4.135	0.44611	D	0.997588	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90163	0.4229	10	0.72032	D	0.01	.	13.4227	0.61007	0.0:0.0:1.0:0.0	.	100;146	Q3SYE6;Q6UW15	.;REG3G_HUMAN	F	146;146;100	ENSP00000377475:C146F;ENSP00000272324:C146F;ENSP00000387105:C100F	ENSP00000272324:C146F	C	+	2	0	REG3G	79108544	1.000000	0.71417	0.764000	0.31436	0.699000	0.40488	3.984000	0.56923	2.621000	0.88768	0.650000	0.86243	TGT	REG3G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000143954		0.493	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	69	0	G	NM_198448		79255036	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	8.47	54	5	SNP	0.862	T
RRN3	54700	genome.wustl.edu	37	16	15159153	15159153	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:15159153G>A	ENST00000198767.6	-	16	1712	c.1629C>T	c.(1627-1629)acC>acT	p.T543T	PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000540462.1_Silent_p.T361T|RRN3_ENST00000327307.7_Silent_p.T510T|RRN3_ENST00000429751.2_Silent_p.T513T|RRN3_ENST00000563559.1_Silent_p.T543T	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	543	Interaction with TWISTNB.				cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CTCCTCCAGCGGTACTCCTAA	0.483																																																	0													125.0	109.0	114.0					16																	15159153		2197	4300	6497	SO:0001819	synonymous_variant	0			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1629C>T	16.37:g.15159153G>A			A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Silent	SNP	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.T543	ENST00000198767.6	37	c.1629	CCDS10559.1	16																																																																																			RRN3	-	pfam_RNA_pol_I_trans_ini_fac_RRN3	ENSG00000085721		0.483	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	HGNC	protein_coding	OTTHUMT00000252087.2	-	0.00	65	0	G	NM_018427		15159153	-1	tier1	-	no_errors	ENST00000198767	ensembl	human	known	74_37	silent	11.29	110	14	SNP	0.012	A
RRN3	54700	genome.wustl.edu	37	16	15159153	15159153	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:15159153G>A	ENST00000198767.6	-	16	1712	c.1629C>T	c.(1627-1629)acC>acT	p.T543T	PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000540462.1_Silent_p.T361T|RRN3_ENST00000327307.7_Silent_p.T510T|RRN3_ENST00000429751.2_Silent_p.T513T|RRN3_ENST00000563559.1_Silent_p.T543T	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	543	Interaction with TWISTNB.				cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CTCCTCCAGCGGTACTCCTAA	0.483																																																	0													125.0	109.0	114.0					16																	15159153		2197	4300	6497	SO:0001819	synonymous_variant	0			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1629C>T	16.37:g.15159153G>A			A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Silent	SNP	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.T543	ENST00000198767.6	37	c.1629	CCDS10559.1	16																																																																																			RRN3	-	pfam_RNA_pol_I_trans_ini_fac_RRN3	ENSG00000085721		0.483	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	HGNC	protein_coding	OTTHUMT00000252087.2	-	0.00	88	0	G	NM_018427		15159153	-1	tier1	-	no_errors	ENST00000198767	ensembl	human	known	74_37	silent	11.29	110	14	SNP	0.012	A
SESTD1	91404	genome.wustl.edu	37	2	179986657	179986657	+	Splice_Site	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:179986657C>G	ENST00000428443.3	-	13	1599		c.e13-1			NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1								phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AATCCCACATCTAAAACAAAA	0.418																																																	0													76.0	75.0	75.0					2																	179986657		2203	4300	6503	SO:0001630	splice_region_variant	0			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1283-1G>C	2.37:g.179986657C>G			Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Splice_Site	SNP	-	e12-1	ENST00000428443.3	37	c.1283-1	CCDS33338.1	2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068848	0.76301	.	.	ENSG00000187231	ENST00000428443	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0499	0.89344	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SESTD1	179694902	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.667000	0.74451	2.584000	0.87258	0.467000	0.42956	.	SESTD1	-	-	ENSG00000187231		0.418	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	HGNC	protein_coding	OTTHUMT00000335916.2	-	0.00	30	0	C	NM_178123	Intron	179986657	-1	tier1	-	no_errors	ENST00000428443	ensembl	human	known	74_37	splice_site	30.77	27	12	SNP	1.000	G
SESTD1	91404	genome.wustl.edu	37	2	179986657	179986657	+	Splice_Site	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:179986657C>G	ENST00000428443.3	-	13	1599		c.e13-1			NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1								phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AATCCCACATCTAAAACAAAA	0.418																																																	0													76.0	75.0	75.0					2																	179986657		2203	4300	6503	SO:0001630	splice_region_variant	0			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1283-1G>C	2.37:g.179986657C>G			Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Splice_Site	SNP	-	e12-1	ENST00000428443.3	37	c.1283-1	CCDS33338.1	2	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068848	0.76301	.	.	ENSG00000187231	ENST00000428443	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0499	0.89344	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SESTD1	179694902	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.667000	0.74451	2.584000	0.87258	0.467000	0.42956	.	SESTD1	-	-	ENSG00000187231		0.418	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	HGNC	protein_coding	OTTHUMT00000335916.2	-	0.00	33	0	C	NM_178123	Intron	179986657	-1	tier1	-	no_errors	ENST00000428443	ensembl	human	known	74_37	splice_site	30.77	27	12	SNP	1.000	G
SETD8	387893	genome.wustl.edu	37	12	123879766	123879766	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:123879766G>T	ENST00000402868.3	+	4	888	c.462G>T	c.(460-462)aaG>aaT	p.K154N	SETD8_ENST00000330479.4_Missense_Mutation_p.K154N|SETD8_ENST00000478781.2_3'UTR			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	195					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		CCATCGCCAAGCAAGCCCTGA	0.502																																																	0													19.0	21.0	20.0					12																	123879766		2203	4297	6500	SO:0001583	missense	0			AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.462G>T	12.37:g.123879766G>T	ENSP00000384629:p.Lys154Asn		A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pirsf_Hist_H4-K20_MeTrfase,pfscan_SET_dom	p.K154N	ENST00000402868.3	37	c.462	CCDS9247.1	12	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038065	0.54896	.	.	ENSG00000183955	ENST00000402868;ENST00000330479;ENST00000437502	D;D	0.98493	-4.96;-4.96	5.7	5.7	0.88788	.	0.126462	0.51477	D	0.000086	D	0.96700	0.8923	L	0.59436	1.845	0.48901	D	0.999726	P;B	0.36683	0.565;0.162	B;B	0.38712	0.28;0.109	D	0.95242	0.8352	10	0.33141	T	0.24	-21.0846	12.3463	0.55122	0.0771:0.0:0.9229:0.0	.	195;154	Q9NQR1;Q9NQR1-2	SETD8_HUMAN;.	N	154;154;145	ENSP00000384629:K154N;ENSP00000332995:K154N	ENSP00000332995:K154N	K	+	3	2	SETD8	122445719	1.000000	0.71417	0.990000	0.47175	0.823000	0.46562	3.362000	0.52314	2.711000	0.92665	0.561000	0.74099	AAG	SETD8	-	pirsf_Hist_H4-K20_MeTrfase	ENSG00000183955		0.502	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD8	HGNC	protein_coding	OTTHUMT00000318263.1	-	0.00	32	0	G	NM_020382		123879766	+1	tier1	-	no_errors	ENST00000330479	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
SETD8	387893	genome.wustl.edu	37	12	123879766	123879766	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:123879766G>T	ENST00000402868.3	+	4	888	c.462G>T	c.(460-462)aaG>aaT	p.K154N	SETD8_ENST00000330479.4_Missense_Mutation_p.K154N|SETD8_ENST00000478781.2_3'UTR			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	195					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		CCATCGCCAAGCAAGCCCTGA	0.502																																																	0													19.0	21.0	20.0					12																	123879766		2203	4297	6500	SO:0001583	missense	0			AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.462G>T	12.37:g.123879766G>T	ENSP00000384629:p.Lys154Asn		A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pirsf_Hist_H4-K20_MeTrfase,pfscan_SET_dom	p.K154N	ENST00000402868.3	37	c.462	CCDS9247.1	12	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038065	0.54896	.	.	ENSG00000183955	ENST00000402868;ENST00000330479;ENST00000437502	D;D	0.98493	-4.96;-4.96	5.7	5.7	0.88788	.	0.126462	0.51477	D	0.000086	D	0.96700	0.8923	L	0.59436	1.845	0.48901	D	0.999726	P;B	0.36683	0.565;0.162	B;B	0.38712	0.28;0.109	D	0.95242	0.8352	10	0.33141	T	0.24	-21.0846	12.3463	0.55122	0.0771:0.0:0.9229:0.0	.	195;154	Q9NQR1;Q9NQR1-2	SETD8_HUMAN;.	N	154;154;145	ENSP00000384629:K154N;ENSP00000332995:K154N	ENSP00000332995:K154N	K	+	3	2	SETD8	122445719	1.000000	0.71417	0.990000	0.47175	0.823000	0.46562	3.362000	0.52314	2.711000	0.92665	0.561000	0.74099	AAG	SETD8	-	pirsf_Hist_H4-K20_MeTrfase	ENSG00000183955		0.502	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD8	HGNC	protein_coding	OTTHUMT00000318263.1	-	0.00	34	0	G	NM_020382		123879766	+1	tier1	-	no_errors	ENST00000330479	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
SIRT3	23410	genome.wustl.edu	37	11	233167	233167	+	Silent	SNP	C	C	T	rs148488998		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:233167C>T	ENST00000382743.4	-	3	624	c.522G>A	c.(520-522)ccG>ccA	p.P174P	SIRT3_ENST00000525319.1_Silent_p.P93P|SIRT3_ENST00000532956.1_Silent_p.P174P|SIRT3_ENST00000524564.1_Silent_p.P110P|SIRT3_ENST00000529382.1_Silent_p.P32P|SIRT3_ENST00000528702.1_5'UTR	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	174	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		CCTCGGGGTACGGGAGATCGT	0.547																																																	0									,	0,4406		0,0,2203	76.0	79.0	78.0		96,522	-10.7	0.1	11	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SIRT3	NM_001017524.2,NM_012239.5	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	32/258,174/400	233167	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.522G>A	11.37:g.233167C>T			B7Z5U6|Q9Y6E8	Silent	SNP	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.P174	ENST00000382743.4	37	c.522	CCDS7691.1	11																																																																																			SIRT3	-	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	ENSG00000142082		0.547	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	-	0.00	35	0	C			233167	-1	tier1	rs148488998	no_errors	ENST00000382743	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.002	T
SIRT3	23410	genome.wustl.edu	37	11	233167	233167	+	Silent	SNP	C	C	T	rs148488998		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:233167C>T	ENST00000382743.4	-	3	624	c.522G>A	c.(520-522)ccG>ccA	p.P174P	SIRT3_ENST00000525319.1_Silent_p.P93P|SIRT3_ENST00000532956.1_Silent_p.P174P|SIRT3_ENST00000524564.1_Silent_p.P110P|SIRT3_ENST00000529382.1_Silent_p.P32P|SIRT3_ENST00000528702.1_5'UTR	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	174	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		CCTCGGGGTACGGGAGATCGT	0.547																																																	0									,	0,4406		0,0,2203	76.0	79.0	78.0		96,522	-10.7	0.1	11	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SIRT3	NM_001017524.2,NM_012239.5	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	32/258,174/400	233167	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.522G>A	11.37:g.233167C>T			B7Z5U6|Q9Y6E8	Silent	SNP	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.P174	ENST00000382743.4	37	c.522	CCDS7691.1	11																																																																																			SIRT3	-	pfam_Sirtuin,pirsf_NAD-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	ENSG00000142082		0.547	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	-	0.00	39	0	C			233167	-1	tier1	rs148488998	no_errors	ENST00000382743	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.002	T
SLC12A8	84561	genome.wustl.edu	37	3	124854513	124854513	+	Splice_Site	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:124854513C>A	ENST00000393469.4	-	5	785	c.736G>T	c.(736-738)Gga>Tga	p.G246*	SLC12A8_ENST00000423114.2_Splice_Site_p.G275*|SLC12A8_ENST00000314584.7_De_novo_Start_OutOfFrame|SLC12A8_ENST00000469902.1_Splice_Site_p.G246*	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	246					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						ATTACAATACCTGTAGCCGCT	0.448																																																	0													49.0	47.0	48.0					3																	124854513		1838	4093	5931	SO:0001630	splice_region_variant	0				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.736+1G>T	3.37:g.124854513C>A			C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Nonsense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,superfamily_ABC1_TM_dom	p.G275*	ENST00000393469.4	37	c.823	CCDS43143.1	3	.	.	.	.	.	.	.	.	.	.	c	36	5.664565	0.96745	.	.	ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902;ENST00000479826	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6479	0.77068	0.0:1.0:0.0:0.0	.	.	.	.	X	246;275;246;128	.	.	G	-	1	0	SLC12A8	126337203	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.441000	0.73439	2.664000	0.90586	0.550000	0.68814	GGA	SLC12A8	-	pfam_AA-permease/SLC12A_dom	ENSG00000221955		0.448	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A8	HGNC	protein_coding	OTTHUMT00000355711.4	-	0.00	26	0	C	NM_024628	Nonsense_Mutation	124854513	-1	tier1	-	no_errors	ENST00000423114	ensembl	human	known	74_37	nonsense	11.11	32	4	SNP	1.000	A
SLC9A5	6553	genome.wustl.edu	37	16	67288942	67288942	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:67288942G>T	ENST00000299798.11	+	3	574	c.509G>T	c.(508-510)gGc>gTc	p.G170V	SLC9A5_ENST00000561472.2_3'UTR	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	170					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GTGCAGGCTGGCTTACTGGAC	0.587																																																	0													77.0	83.0	81.0					16																	67288942		2106	4255	6361	SO:0001583	missense	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.509G>T	16.37:g.67288942G>T	ENSP00000299798:p.Gly170Val		A5PKY7|Q9Y626	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.G170V	ENST00000299798.11	37	c.509	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932764	0.52866	.	.	ENSG00000135740	ENST00000299798	T	0.15718	2.4	5.93	4.97	0.65823	Cation/H+ exchanger (1);	0.171277	0.51477	D	0.000093	T	0.38931	0.1059	M	0.85462	2.755	0.80722	D	1	P	0.51147	0.942	P	0.54140	0.743	T	0.34700	-0.9818	10	0.87932	D	0	.	14.5157	0.67818	0.071:0.0:0.929:0.0	.	170	Q14940	SL9A5_HUMAN	V	170	ENSP00000299798:G170V	ENSP00000299798:G170V	G	+	2	0	SLC9A5	65846443	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.552000	0.73914	2.814000	0.96858	0.655000	0.94253	GGC	SLC9A5	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000135740		0.587	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	-	0.00	64	0	G			67288942	+1	tier1	-	no_errors	ENST00000299798	ensembl	human	known	74_37	missense	43.09	70	53	SNP	1.000	T
SLC9A5	6553	genome.wustl.edu	37	16	67288942	67288942	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:67288942G>T	ENST00000299798.11	+	3	574	c.509G>T	c.(508-510)gGc>gTc	p.G170V	SLC9A5_ENST00000561472.2_3'UTR	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	170					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GTGCAGGCTGGCTTACTGGAC	0.587																																																	0													77.0	83.0	81.0					16																	67288942		2106	4255	6361	SO:0001583	missense	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.509G>T	16.37:g.67288942G>T	ENSP00000299798:p.Gly170Val		A5PKY7|Q9Y626	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.G170V	ENST00000299798.11	37	c.509	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932764	0.52866	.	.	ENSG00000135740	ENST00000299798	T	0.15718	2.4	5.93	4.97	0.65823	Cation/H+ exchanger (1);	0.171277	0.51477	D	0.000093	T	0.38931	0.1059	M	0.85462	2.755	0.80722	D	1	P	0.51147	0.942	P	0.54140	0.743	T	0.34700	-0.9818	10	0.87932	D	0	.	14.5157	0.67818	0.071:0.0:0.929:0.0	.	170	Q14940	SL9A5_HUMAN	V	170	ENSP00000299798:G170V	ENSP00000299798:G170V	G	+	2	0	SLC9A5	65846443	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.552000	0.73914	2.814000	0.96858	0.655000	0.94253	GGC	SLC9A5	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000135740		0.587	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	-	0.00	90	0	G			67288942	+1	tier1	-	no_errors	ENST00000299798	ensembl	human	known	74_37	missense	43.09	70	53	SNP	1.000	T
SLC38A8	146167	genome.wustl.edu	37	16	84050269	84050269	+	Silent	SNP	G	G	A	rs144115936		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:84050269G>A	ENST00000299709.3	-	8	1016	c.1017C>T	c.(1015-1017)gcC>gcT	p.A339A		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	339					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTGAGGGGTCGGCCAGGGCGC	0.647																																																	0								G		0,4400		0,0,2200	45.0	49.0	48.0		1017	-7.8	0.6	16	dbSNP_134	48	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	SLC38A8	NM_001080442.1		0,1,6498	AA,AG,GG		0.0116,0.0,0.0077		339/436	84050269	1,12997	2200	4299	6499	SO:0001819	synonymous_variant	0				CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.1017C>T	16.37:g.84050269G>A				Silent	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.A339	ENST00000299709.3	37	c.1017	CCDS32495.1	16																																																																																			SLC38A8	-	pfam_AA_transpt_TM	ENSG00000166558		0.647	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	HGNC	protein_coding	OTTHUMT00000432623.1	-	0.00	11	0	G	NM_001080442		84050269	-1	tier1	rs144115936	no_errors	ENST00000299709	ensembl	human	known	74_37	silent	29.03	22	9	SNP	0.017	A
SLC38A8	146167	genome.wustl.edu	37	16	84050269	84050269	+	Silent	SNP	G	G	A	rs144115936		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr16:84050269G>A	ENST00000299709.3	-	8	1016	c.1017C>T	c.(1015-1017)gcC>gcT	p.A339A		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	339					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTGAGGGGTCGGCCAGGGCGC	0.647																																																	0								G		0,4400		0,0,2200	45.0	49.0	48.0		1017	-7.8	0.6	16	dbSNP_134	48	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	SLC38A8	NM_001080442.1		0,1,6498	AA,AG,GG		0.0116,0.0,0.0077		339/436	84050269	1,12997	2200	4299	6499	SO:0001819	synonymous_variant	0				CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.1017C>T	16.37:g.84050269G>A				Silent	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.A339	ENST00000299709.3	37	c.1017	CCDS32495.1	16																																																																																			SLC38A8	-	pfam_AA_transpt_TM	ENSG00000166558		0.647	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	HGNC	protein_coding	OTTHUMT00000432623.1	-	0.00	25	0	G	NM_001080442		84050269	-1	tier1	rs144115936	no_errors	ENST00000299709	ensembl	human	known	74_37	silent	29.03	22	9	SNP	0.017	A
SLC9C2	284525	genome.wustl.edu	37	1	173502849	173502849	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:173502849A>G	ENST00000367714.3	-	17	2484	c.2062T>C	c.(2062-2064)Tgt>Cgt	p.C688R	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_3'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	688	Ion transport-like. {ECO:0000250}.				sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AAGTATACACAAAAGATATCA	0.289																																																	0													60.0	68.0	65.0					1																	173502849		2201	4294	6495	SO:0001583	missense	0			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2062T>C	1.37:g.173502849A>G	ENSP00000356687:p.Cys688Arg		Q86UF3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.C688R	ENST00000367714.3	37	c.2062	CCDS1308.1	1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296511	0.23650	.	.	ENSG00000162753	ENST00000367714	D	0.97279	-4.32	5.26	4.1	0.47936	Ion transport (1);	0.219310	0.32624	N	0.005846	D	0.95255	0.8461	L	0.50333	1.59	0.09310	N	0.999991	D	0.61080	0.989	P	0.58077	0.832	D	0.90978	0.4825	10	0.72032	D	0.01	-7.9352	9.2859	0.37758	0.8182:0.1818:0.0:0.0	.	688	Q5TAH2	S9A11_HUMAN	R	688	ENSP00000356687:C688R	ENSP00000356687:C688R	C	-	1	0	SLC9A11	171769472	0.150000	0.22732	0.002000	0.10522	0.004000	0.04260	1.845000	0.39279	0.914000	0.36822	0.528000	0.53228	TGT	SLC9C2	-	NULL	ENSG00000162753		0.289	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	HGNC	protein_coding	OTTHUMT00000084205.1	-	0.00	43	0	A	NM_178527		173502849	-1	tier1	-	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.010	G
SLC9C2	284525	genome.wustl.edu	37	1	173502849	173502849	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:173502849A>G	ENST00000367714.3	-	17	2484	c.2062T>C	c.(2062-2064)Tgt>Cgt	p.C688R	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_3'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	688	Ion transport-like. {ECO:0000250}.				sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										AAGTATACACAAAAGATATCA	0.289																																																	0													60.0	68.0	65.0					1																	173502849		2201	4294	6495	SO:0001583	missense	0			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2062T>C	1.37:g.173502849A>G	ENSP00000356687:p.Cys688Arg		Q86UF3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.C688R	ENST00000367714.3	37	c.2062	CCDS1308.1	1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296511	0.23650	.	.	ENSG00000162753	ENST00000367714	D	0.97279	-4.32	5.26	4.1	0.47936	Ion transport (1);	0.219310	0.32624	N	0.005846	D	0.95255	0.8461	L	0.50333	1.59	0.09310	N	0.999991	D	0.61080	0.989	P	0.58077	0.832	D	0.90978	0.4825	10	0.72032	D	0.01	-7.9352	9.2859	0.37758	0.8182:0.1818:0.0:0.0	.	688	Q5TAH2	S9A11_HUMAN	R	688	ENSP00000356687:C688R	ENSP00000356687:C688R	C	-	1	0	SLC9A11	171769472	0.150000	0.22732	0.002000	0.10522	0.004000	0.04260	1.845000	0.39279	0.914000	0.36822	0.528000	0.53228	TGT	SLC9C2	-	NULL	ENSG00000162753		0.289	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	HGNC	protein_coding	OTTHUMT00000084205.1	-	0.00	51	0	A	NM_178527		173502849	-1	tier1	-	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.010	G
SNAI2	6591	genome.wustl.edu	37	8	49832626	49832626	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:49832626C>T	ENST00000396822.1	-	3	811	c.454G>A	c.(454-456)Gat>Aat	p.D152N	SNAI2_ENST00000020945.1_Missense_Mutation_p.D152N			O43623	SNAI2_HUMAN	snail family zinc finger 2	152					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GACTGGGCATCGCAGTGCAGC	0.453																																																	0													87.0	86.0	87.0					8																	49832626		2203	4300	6503	SO:0001583	missense	0			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.454G>A	8.37:g.49832626C>T	ENSP00000380034:p.Asp152Asn		B2R6P6|Q53FC1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D152N	ENST00000396822.1	37	c.454	CCDS6146.1	8	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834059	0.91036	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.29397	1.57;1.57	5.38	5.38	0.77491	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.23688	0.0573	L	0.29908	0.895	0.80722	D	1	P	0.38677	0.642	B	0.30105	0.111	T	0.03423	-1.1038	10	0.42905	T	0.14	-15.9243	19.1193	0.93355	0.0:1.0:0.0:0.0	.	152	O43623	SNAI2_HUMAN	N	152	ENSP00000020945:D152N;ENSP00000380034:D152N	ENSP00000020945:D152N	D	-	1	0	SNAI2	49995179	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	7.487000	0.81328	2.516000	0.84829	0.561000	0.74099	GAT	SNAI2	-	pfscan_Znf_C2H2	ENSG00000019549		0.453	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	HGNC	protein_coding	OTTHUMT00000313873.2	-	0.00	50	0	C	NM_003068		49832626	-1	tier1	-	no_errors	ENST00000020945	ensembl	human	known	74_37	missense	15.69	86	16	SNP	1.000	T
SNAI2	6591	genome.wustl.edu	37	8	49832626	49832626	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:49832626C>T	ENST00000396822.1	-	3	811	c.454G>A	c.(454-456)Gat>Aat	p.D152N	SNAI2_ENST00000020945.1_Missense_Mutation_p.D152N			O43623	SNAI2_HUMAN	snail family zinc finger 2	152					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GACTGGGCATCGCAGTGCAGC	0.453																																																	0													87.0	86.0	87.0					8																	49832626		2203	4300	6503	SO:0001583	missense	0			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.454G>A	8.37:g.49832626C>T	ENSP00000380034:p.Asp152Asn		B2R6P6|Q53FC1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D152N	ENST00000396822.1	37	c.454	CCDS6146.1	8	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834059	0.91036	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.29397	1.57;1.57	5.38	5.38	0.77491	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.23688	0.0573	L	0.29908	0.895	0.80722	D	1	P	0.38677	0.642	B	0.30105	0.111	T	0.03423	-1.1038	10	0.42905	T	0.14	-15.9243	19.1193	0.93355	0.0:1.0:0.0:0.0	.	152	O43623	SNAI2_HUMAN	N	152	ENSP00000020945:D152N;ENSP00000380034:D152N	ENSP00000020945:D152N	D	-	1	0	SNAI2	49995179	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	7.487000	0.81328	2.516000	0.84829	0.561000	0.74099	GAT	SNAI2	-	pfscan_Znf_C2H2	ENSG00000019549		0.453	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	HGNC	protein_coding	OTTHUMT00000313873.2	-	0.00	66	0	C	NM_003068		49832626	-1	tier1	-	no_errors	ENST00000020945	ensembl	human	known	74_37	missense	15.69	86	16	SNP	1.000	T
SNTA1	6640	genome.wustl.edu	37	20	31997973	31997973	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:31997973C>T	ENST00000217381.2	-	6	1476	c.1205G>A	c.(1204-1206)cGg>cAg	p.R402Q		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	402					muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						CTCGGCGGCCCGGTGACAGCC	0.632																																																	0																																										SO:0001583	missense	0			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.1205G>A	20.37:g.31997973C>T	ENSP00000217381:p.Arg402Gln		A8K7H9|B4DX40|E1P5N1|Q16438	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.R402Q	ENST00000217381.2	37	c.1205	CCDS13220.1	20	.	.	.	.	.	.	.	.	.	.	c	10.95	1.496340	0.26861	.	.	ENSG00000101400	ENST00000217381	T	0.71698	-0.59	5.01	3.85	0.44370	Pleckstrin homology domain (1);	0.175453	0.46442	D	0.000296	T	0.29158	0.0725	N	0.01048	-1.04	0.27315	N	0.95722	P;P	0.48089	0.684;0.905	B;B	0.26693	0.05;0.072	T	0.30001	-0.9993	10	0.13108	T	0.6	-8.656	11.9282	0.52831	0.0:0.8504:0.0:0.1496	.	327;402	B4DX40;Q13424	.;SNTA1_HUMAN	Q	402	ENSP00000217381:R402Q	ENSP00000217381:R402Q	R	-	2	0	SNTA1	31461634	0.156000	0.22821	1.000000	0.80357	0.997000	0.91878	0.107000	0.15375	2.331000	0.79229	0.558000	0.71614	CGG	SNTA1	-	smart_Pleckstrin_homology	ENSG00000101400		0.632	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTA1	HGNC	protein_coding	OTTHUMT00000078704.2	-	0.00	46	0	C	NM_003098		31997973	-1	tier1	-	no_errors	ENST00000217381	ensembl	human	known	74_37	missense	20.00	95	24	SNP	0.999	T
SNTA1	6640	genome.wustl.edu	37	20	31997973	31997973	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr20:31997973C>T	ENST00000217381.2	-	6	1476	c.1205G>A	c.(1204-1206)cGg>cAg	p.R402Q		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	402					muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)			breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						CTCGGCGGCCCGGTGACAGCC	0.632																																																	0																																										SO:0001583	missense	0			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.1205G>A	20.37:g.31997973C>T	ENSP00000217381:p.Arg402Gln		A8K7H9|B4DX40|E1P5N1|Q16438	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.R402Q	ENST00000217381.2	37	c.1205	CCDS13220.1	20	.	.	.	.	.	.	.	.	.	.	c	10.95	1.496340	0.26861	.	.	ENSG00000101400	ENST00000217381	T	0.71698	-0.59	5.01	3.85	0.44370	Pleckstrin homology domain (1);	0.175453	0.46442	D	0.000296	T	0.29158	0.0725	N	0.01048	-1.04	0.27315	N	0.95722	P;P	0.48089	0.684;0.905	B;B	0.26693	0.05;0.072	T	0.30001	-0.9993	10	0.13108	T	0.6	-8.656	11.9282	0.52831	0.0:0.8504:0.0:0.1496	.	327;402	B4DX40;Q13424	.;SNTA1_HUMAN	Q	402	ENSP00000217381:R402Q	ENSP00000217381:R402Q	R	-	2	0	SNTA1	31461634	0.156000	0.22821	1.000000	0.80357	0.997000	0.91878	0.107000	0.15375	2.331000	0.79229	0.558000	0.71614	CGG	SNTA1	-	smart_Pleckstrin_homology	ENSG00000101400		0.632	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTA1	HGNC	protein_coding	OTTHUMT00000078704.2	-	0.00	51	0	C	NM_003098		31997973	-1	tier1	-	no_errors	ENST00000217381	ensembl	human	known	74_37	missense	20.00	95	24	SNP	0.999	T
SPTBN2	6712	genome.wustl.edu	37	11	66458832	66458832	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:66458832G>A	ENST00000533211.1	-	27	5819	c.5488C>T	c.(5488-5490)Cgc>Tgc	p.R1830C	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1830C|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1830C			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1830					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TTGAGGTCGCGGCCAGTCCCG	0.692																																																	0													40.0	44.0	42.0					11																	66458832		2200	4290	6490	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5488C>T	11.37:g.66458832G>A	ENSP00000432568:p.Arg1830Cys		O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1830C	ENST00000533211.1	37	c.5488	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495604	0.85069	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.52057	0.68;0.68;0.68	4.76	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.75102	-0.3436	10	0.51188	T	0.08	.	11.2973	0.49286	0.0:0.0:0.6691:0.3309	.	1830	O15020	SPTN2_HUMAN	C	1830	ENSP00000432568:R1830C;ENSP00000311489:R1830C;ENSP00000433593:R1830C	ENSP00000311489:R1830C	R	-	1	0	SPTBN2	66215408	1.000000	0.71417	0.988000	0.46212	0.925000	0.55904	1.608000	0.36847	1.208000	0.43306	0.655000	0.94253	CGC	SPTBN2	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000173898		0.692	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	-	0.00	35	0	G	NM_006946		66458832	-1	tier1	-	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	22.41	45	13	SNP	1.000	A
SPTBN2	6712	genome.wustl.edu	37	11	66458832	66458832	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:66458832G>A	ENST00000533211.1	-	27	5819	c.5488C>T	c.(5488-5490)Cgc>Tgc	p.R1830C	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1830C|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1830C			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1830					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TTGAGGTCGCGGCCAGTCCCG	0.692																																																	0													40.0	44.0	42.0					11																	66458832		2200	4290	6490	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5488C>T	11.37:g.66458832G>A	ENSP00000432568:p.Arg1830Cys		O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1830C	ENST00000533211.1	37	c.5488	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495604	0.85069	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.52057	0.68;0.68;0.68	4.76	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.75102	-0.3436	10	0.51188	T	0.08	.	11.2973	0.49286	0.0:0.0:0.6691:0.3309	.	1830	O15020	SPTN2_HUMAN	C	1830	ENSP00000432568:R1830C;ENSP00000311489:R1830C;ENSP00000433593:R1830C	ENSP00000311489:R1830C	R	-	1	0	SPTBN2	66215408	1.000000	0.71417	0.988000	0.46212	0.925000	0.55904	1.608000	0.36847	1.208000	0.43306	0.655000	0.94253	CGC	SPTBN2	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000173898		0.692	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	-	0.00	66	0	G	NM_006946		66458832	-1	tier1	-	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	22.41	45	13	SNP	1.000	A
SUGP2	10147	genome.wustl.edu	37	19	19120669	19120669	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:19120669G>T	ENST00000601879.1	-	5	2630	c.2333C>A	c.(2332-2334)gCt>gAt	p.A778D	SUGP2_ENST00000456085.2_Missense_Mutation_p.A547D|SUGP2_ENST00000600377.1_Missense_Mutation_p.A792D|SUGP2_ENST00000337018.6_Missense_Mutation_p.A778D|SUGP2_ENST00000452918.2_Missense_Mutation_p.A778D			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	778					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCCACTGTCAGCAGATGGGCA	0.607																																																	0													73.0	77.0	76.0					19																	19120669		2203	4300	6503	SO:0001583	missense	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2333C>A	19.37:g.19120669G>T	ENSP00000472286:p.Ala778Asp		C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.A778D	ENST00000601879.1	37	c.2333	CCDS12392.1	19	.	.	.	.	.	.	.	.	.	.	G	5.066	0.197925	0.09652	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.23	1.64	0.23874	.	0.701155	0.13343	N	0.395040	T	0.19644	0.0472	N	0.12182	0.205	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.08055	0.003;0.002;0.001	T	0.18713	-1.0328	10	0.20519	T	0.43	-1.2491	3.9963	0.09559	0.0807:0.1378:0.4985:0.2829	.	547;778;778	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	D	778;778;778;547	ENSP00000337926:A778D;ENSP00000332373:A778D;ENSP00000389380:A778D;ENSP00000409603:A547D	ENSP00000332373:A778D	A	-	2	0	SUGP2	18981669	0.441000	0.25626	0.083000	0.20561	0.660000	0.38997	2.415000	0.44635	0.574000	0.29417	0.655000	0.94253	GCT	SUGP2	-	superfamily_Surp	ENSG00000064607		0.607	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1		0.00	34	0	G	NM_001017392		19120669	-1			no_errors	ENST00000337018	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.015	T
SYBU	55638	genome.wustl.edu	37	8	110587571	110587571	+	Missense_Mutation	SNP	G	G	A	rs372495769		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:110587571G>A	ENST00000422135.1	-	8	2071	c.1556C>T	c.(1555-1557)gCg>gTg	p.A519V	SYBU_ENST00000528647.1_Missense_Mutation_p.A518V|SYBU_ENST00000528331.1_Missense_Mutation_p.A400V|SYBU_ENST00000419099.1_Missense_Mutation_p.A518V|SYBU_ENST00000533895.1_Missense_Mutation_p.A518V|SYBU_ENST00000424158.2_Missense_Mutation_p.A524V|SYBU_ENST00000433638.1_Missense_Mutation_p.A519V|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000408908.2_Missense_Mutation_p.A519V|SYBU_ENST00000529175.1_Missense_Mutation_p.A313V|SYBU_ENST00000533171.1_Missense_Mutation_p.A519V|SYBU_ENST00000529690.1_Missense_Mutation_p.A389V|SYBU_ENST00000446070.2_Missense_Mutation_p.A518V|SYBU_ENST00000408889.3_Missense_Mutation_p.A400V|SYBU_ENST00000532779.1_Missense_Mutation_p.A451V|SYBU_ENST00000399066.3_Missense_Mutation_p.A516V|SYBU_ENST00000533065.1_Missense_Mutation_p.A400V|SYBU_ENST00000276646.9_Missense_Mutation_p.A519V|SYBU_ENST00000440310.1_Missense_Mutation_p.A519V	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	519					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						ATCAGGGGACGCCAAGCTCGA	0.562																																																	0								G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	2,3974		0,2,1986	53.0	57.0	56.0		1553,1556,1556,1199,1553,1556,1199,1556,1553,1556,1553,1556,1199,1547,1553	2.0	0.0	8		56	0,8344		0,0,4172	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	SYBU	NM_001099743.1,NM_001099744.1,NM_001099745.1,NM_001099746.1,NM_001099747.1,NM_001099748.1,NM_001099749.1,NM_001099750.1,NM_001099751.1,NM_001099752.1,NM_001099753.1,NM_001099754.1,NM_001099755.1,NM_001099756.1,NM_017786.5	64,64,64,64,64,64,64,64,64,64,64,64,64,64,64	0,2,6158	AA,AG,GG		0.0,0.0503,0.0162	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	518/663,519/664,519/664,400/545,518/663,519/664,400/545,519/664,518/663,519/664,518/663,519/664,400/545,516/661,518/663	110587571	2,12318	1988	4172	6160	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1556C>T	8.37:g.110587571G>A	ENSP00000407118:p.Ala519Val		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.A519V	ENST00000422135.1	37	c.1556	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	1.811	-0.474733	0.04414	5.03E-4	0.0	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.84	1.95	0.26073	.	0.858234	0.10668	N	0.647902	T	0.25344	0.0616	L	0.48642	1.525	0.09310	N	1	P;P;P;P;P	0.36378	0.55;0.55;0.55;0.55;0.55	B;B;B;B;B	0.28465	0.09;0.09;0.062;0.09;0.057	T	0.11916	-1.0568	9	0.36615	T	0.2	-0.0395	5.6208	0.17455	0.1452:0.0:0.5772:0.2776	.	389;451;518;519;516	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	V	518;524;451;516;518;400;313;519;518;519;518;519;519;519;400;400;389;519	.	ENSP00000276646:A519V	A	-	2	0	SYBU	110656747	0.154000	0.22792	0.000000	0.03702	0.006000	0.05464	2.071000	0.41500	0.076000	0.16826	0.655000	0.94253	GCG	SYBU	-	NULL	ENSG00000147642		0.562	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	-	0.00	28	0	G	NM_017786		110587571	-1	tier1	-	no_errors	ENST00000276646	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.000	A
SYBU	55638	genome.wustl.edu	37	8	110587571	110587571	+	Missense_Mutation	SNP	G	G	A	rs372495769		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:110587571G>A	ENST00000422135.1	-	8	2071	c.1556C>T	c.(1555-1557)gCg>gTg	p.A519V	SYBU_ENST00000528647.1_Missense_Mutation_p.A518V|SYBU_ENST00000528331.1_Missense_Mutation_p.A400V|SYBU_ENST00000419099.1_Missense_Mutation_p.A518V|SYBU_ENST00000533895.1_Missense_Mutation_p.A518V|SYBU_ENST00000424158.2_Missense_Mutation_p.A524V|SYBU_ENST00000433638.1_Missense_Mutation_p.A519V|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000408908.2_Missense_Mutation_p.A519V|SYBU_ENST00000529175.1_Missense_Mutation_p.A313V|SYBU_ENST00000533171.1_Missense_Mutation_p.A519V|SYBU_ENST00000529690.1_Missense_Mutation_p.A389V|SYBU_ENST00000446070.2_Missense_Mutation_p.A518V|SYBU_ENST00000408889.3_Missense_Mutation_p.A400V|SYBU_ENST00000532779.1_Missense_Mutation_p.A451V|SYBU_ENST00000399066.3_Missense_Mutation_p.A516V|SYBU_ENST00000533065.1_Missense_Mutation_p.A400V|SYBU_ENST00000276646.9_Missense_Mutation_p.A519V|SYBU_ENST00000440310.1_Missense_Mutation_p.A519V	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	519					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						ATCAGGGGACGCCAAGCTCGA	0.562																																																	0								G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	2,3974		0,2,1986	53.0	57.0	56.0		1553,1556,1556,1199,1553,1556,1199,1556,1553,1556,1553,1556,1199,1547,1553	2.0	0.0	8		56	0,8344		0,0,4172	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	SYBU	NM_001099743.1,NM_001099744.1,NM_001099745.1,NM_001099746.1,NM_001099747.1,NM_001099748.1,NM_001099749.1,NM_001099750.1,NM_001099751.1,NM_001099752.1,NM_001099753.1,NM_001099754.1,NM_001099755.1,NM_001099756.1,NM_017786.5	64,64,64,64,64,64,64,64,64,64,64,64,64,64,64	0,2,6158	AA,AG,GG		0.0,0.0503,0.0162	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	518/663,519/664,519/664,400/545,518/663,519/664,400/545,519/664,518/663,519/664,518/663,519/664,400/545,516/661,518/663	110587571	2,12318	1988	4172	6160	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1556C>T	8.37:g.110587571G>A	ENSP00000407118:p.Ala519Val		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.A519V	ENST00000422135.1	37	c.1556	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	1.811	-0.474733	0.04414	5.03E-4	0.0	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.84	1.95	0.26073	.	0.858234	0.10668	N	0.647902	T	0.25344	0.0616	L	0.48642	1.525	0.09310	N	1	P;P;P;P;P	0.36378	0.55;0.55;0.55;0.55;0.55	B;B;B;B;B	0.28465	0.09;0.09;0.062;0.09;0.057	T	0.11916	-1.0568	9	0.36615	T	0.2	-0.0395	5.6208	0.17455	0.1452:0.0:0.5772:0.2776	.	389;451;518;519;516	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	V	518;524;451;516;518;400;313;519;518;519;518;519;519;519;400;400;389;519	.	ENSP00000276646:A519V	A	-	2	0	SYBU	110656747	0.154000	0.22792	0.000000	0.03702	0.006000	0.05464	2.071000	0.41500	0.076000	0.16826	0.655000	0.94253	GCG	SYBU	-	NULL	ENSG00000147642		0.562	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	-	0.00	49	0	G	NM_017786		110587571	-1	tier1	-	no_errors	ENST00000276646	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.000	A
SYTL3	94120	genome.wustl.edu	37	6	159178395	159178395	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:159178395G>T	ENST00000297239.9	+	13	1484	c.1290G>T	c.(1288-1290)tgG>tgT	p.W430C	SYTL3_ENST00000360448.3_Missense_Mutation_p.W362C|SYTL3_ENST00000367081.3_Missense_Mutation_p.W156C			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	430					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CCTTCCGCTGGCATCCGCTCC	0.532																																																	0													90.0	77.0	82.0					6																	159178395		2203	4300	6503	SO:0001583	missense	0			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1290G>T	6.37:g.159178395G>T	ENSP00000297239:p.Trp430Cys		Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.W430C	ENST00000297239.9	37	c.1290	CCDS56458.1	6	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441462	0.43326	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.12984	2.63;2.63;2.63	5.07	5.07	0.68467	C2 calcium/lipid-binding domain, CaLB (1);	0.213328	0.43416	D	0.000571	T	0.26593	0.0650	M	0.74881	2.28	0.80722	D	1	P;P;D	0.54772	0.876;0.908;0.968	B;B;P	0.58210	0.409;0.338;0.835	T	0.03684	-1.1013	10	0.72032	D	0.01	.	18.4301	0.90622	0.0:0.0:1.0:0.0	.	156;430;362	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	C	362;430;430;156	ENSP00000353631:W362C;ENSP00000297239:W430C;ENSP00000356048:W156C	ENSP00000297239:W430C	W	+	3	0	SYTL3	159098383	1.000000	0.71417	0.850000	0.33497	0.123000	0.20343	6.857000	0.75455	2.356000	0.79943	0.491000	0.48974	TGG	SYTL3	-	superfamily_C2_dom	ENSG00000164674		0.532	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	HGNC	protein_coding	OTTHUMT00000042876.1	-	0.00	42	0	G			159178395	+1	tier1	-	no_errors	ENST00000297239	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
SYTL3	94120	genome.wustl.edu	37	6	159178395	159178395	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:159178395G>T	ENST00000297239.9	+	13	1484	c.1290G>T	c.(1288-1290)tgG>tgT	p.W430C	SYTL3_ENST00000360448.3_Missense_Mutation_p.W362C|SYTL3_ENST00000367081.3_Missense_Mutation_p.W156C			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	430					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CCTTCCGCTGGCATCCGCTCC	0.532																																																	0													90.0	77.0	82.0					6																	159178395		2203	4300	6503	SO:0001583	missense	0			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1290G>T	6.37:g.159178395G>T	ENSP00000297239:p.Trp430Cys		Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.W430C	ENST00000297239.9	37	c.1290	CCDS56458.1	6	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441462	0.43326	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.12984	2.63;2.63;2.63	5.07	5.07	0.68467	C2 calcium/lipid-binding domain, CaLB (1);	0.213328	0.43416	D	0.000571	T	0.26593	0.0650	M	0.74881	2.28	0.80722	D	1	P;P;D	0.54772	0.876;0.908;0.968	B;B;P	0.58210	0.409;0.338;0.835	T	0.03684	-1.1013	10	0.72032	D	0.01	.	18.4301	0.90622	0.0:0.0:1.0:0.0	.	156;430;362	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	C	362;430;430;156	ENSP00000353631:W362C;ENSP00000297239:W430C;ENSP00000356048:W156C	ENSP00000297239:W430C	W	+	3	0	SYTL3	159098383	1.000000	0.71417	0.850000	0.33497	0.123000	0.20343	6.857000	0.75455	2.356000	0.79943	0.491000	0.48974	TGG	SYTL3	-	superfamily_C2_dom	ENSG00000164674		0.532	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	HGNC	protein_coding	OTTHUMT00000042876.1	-	0.00	59	0	G			159178395	+1	tier1	-	no_errors	ENST00000297239	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TBXA2R	6915	genome.wustl.edu	37	19	3600557	3600557	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:3600557C>T	ENST00000375190.4	-	2	469	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	TBXA2R_ENST00000411851.3_Missense_Mutation_p.A26T|TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000589966.1_Missense_Mutation_p.A26T	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	26					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CAGGGCGAGGCGATCAGCCGT	0.692																																																	0													20.0	26.0	24.0					19																	3600557		2084	4191	6275	SO:0001583	missense	0				CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.76G>A	19.37:g.3600557C>T	ENSP00000364336:p.Ala26Thr		O75228|Q6DK52|Q9UCY1|Q9UCY2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thbox_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.A26T	ENST00000375190.4	37	c.76	CCDS42467.1	19	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942703	0.34283	.	.	ENSG00000006638	ENST00000411851;ENST00000375190	T;T	0.37584	1.19;1.19	4.55	4.55	0.56014	.	0.295124	0.31554	N	0.007449	T	0.13927	0.0337	N	0.17082	0.46	0.31306	N	0.687737	B;P	0.42375	0.123;0.778	B;B	0.26864	0.022;0.074	T	0.08953	-1.0697	10	0.12103	T	0.63	-35.8476	7.4669	0.27326	0.0:0.811:0.0:0.189	.	26;26	P21731;E2QRJ2	TA2R_HUMAN;.	T	26	ENSP00000393333:A26T;ENSP00000364336:A26T	ENSP00000364336:A26T	A	-	1	0	TBXA2R	3551557	0.966000	0.33281	1.000000	0.80357	0.584000	0.36387	0.478000	0.22212	2.233000	0.73108	0.305000	0.20034	GCC	TBXA2R	-	prints_Thbox_rcpt,prints_GPCR_Rhodpsn	ENSG00000006638		0.692	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBXA2R	HGNC	protein_coding	OTTHUMT00000453081.2	-	0.00	45	0	C			3600557	-1	tier1	-	no_errors	ENST00000411851	ensembl	human	known	74_37	missense	19.35	50	12	SNP	1.000	T
TBXA2R	6915	genome.wustl.edu	37	19	3600557	3600557	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:3600557C>T	ENST00000375190.4	-	2	469	c.76G>A	c.(76-78)Gcc>Acc	p.A26T	TBXA2R_ENST00000411851.3_Missense_Mutation_p.A26T|TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000589966.1_Missense_Mutation_p.A26T	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	26					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	CAGGGCGAGGCGATCAGCCGT	0.692																																																	0													20.0	26.0	24.0					19																	3600557		2084	4191	6275	SO:0001583	missense	0				CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.76G>A	19.37:g.3600557C>T	ENSP00000364336:p.Ala26Thr		O75228|Q6DK52|Q9UCY1|Q9UCY2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thbox_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.A26T	ENST00000375190.4	37	c.76	CCDS42467.1	19	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942703	0.34283	.	.	ENSG00000006638	ENST00000411851;ENST00000375190	T;T	0.37584	1.19;1.19	4.55	4.55	0.56014	.	0.295124	0.31554	N	0.007449	T	0.13927	0.0337	N	0.17082	0.46	0.31306	N	0.687737	B;P	0.42375	0.123;0.778	B;B	0.26864	0.022;0.074	T	0.08953	-1.0697	10	0.12103	T	0.63	-35.8476	7.4669	0.27326	0.0:0.811:0.0:0.189	.	26;26	P21731;E2QRJ2	TA2R_HUMAN;.	T	26	ENSP00000393333:A26T;ENSP00000364336:A26T	ENSP00000364336:A26T	A	-	1	0	TBXA2R	3551557	0.966000	0.33281	1.000000	0.80357	0.584000	0.36387	0.478000	0.22212	2.233000	0.73108	0.305000	0.20034	GCC	TBXA2R	-	prints_Thbox_rcpt,prints_GPCR_Rhodpsn	ENSG00000006638		0.692	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBXA2R	HGNC	protein_coding	OTTHUMT00000453081.2	-	0.00	61	0	C			3600557	-1	tier1	-	no_errors	ENST00000411851	ensembl	human	known	74_37	missense	19.35	50	12	SNP	1.000	T
TCEB3B	51224	genome.wustl.edu	37	18	44560933	44560933	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:44560933G>T	ENST00000332567.4	-	1	1055	c.703C>A	c.(703-705)Cgc>Agc	p.R235S	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	235					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CACAAGGGGCGTTTTTCCTGG	0.607																																																	0													41.0	43.0	42.0					18																	44560933		2203	4300	6503	SO:0001583	missense	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.703C>A	18.37:g.44560933G>T	ENSP00000331302:p.Arg235Ser		Q9P2V9	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.R235S	ENST00000332567.4	37	c.703	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	G	0.322	-0.961284	0.02249	.	.	ENSG00000206181	ENST00000332567	T	0.06768	3.26	1.8	-3.6	0.04570	.	0.739872	0.11067	U	0.603332	T	0.04907	0.0132	L	0.38175	1.15	0.09310	N	1	B	0.29646	0.253	B	0.23419	0.046	T	0.36696	-0.9737	10	0.21540	T	0.41	.	4.5545	0.12130	0.2876:0.3307:0.3817:0.0	.	235	Q8IYF1	ELOA2_HUMAN	S	235	ENSP00000331302:R235S	ENSP00000331302:R235S	R	-	1	0	TCEB3B	42814931	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	-0.184000	0.09698	-1.813000	0.01226	-1.598000	0.00824	CGC	TCEB3B	-	NULL	ENSG00000206181		0.607	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	-	0.00	37	0	G	NM_016427		44560933	-1	tier1	-	no_errors	ENST00000332567	ensembl	human	known	74_37	missense	7.04	66	5	SNP	0.000	T
TCEB3B	51224	genome.wustl.edu	37	18	44560933	44560933	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr18:44560933G>T	ENST00000332567.4	-	1	1055	c.703C>A	c.(703-705)Cgc>Agc	p.R235S	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	235					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CACAAGGGGCGTTTTTCCTGG	0.607																																																	0													41.0	43.0	42.0					18																	44560933		2203	4300	6503	SO:0001583	missense	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.703C>A	18.37:g.44560933G>T	ENSP00000331302:p.Arg235Ser		Q9P2V9	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.R235S	ENST00000332567.4	37	c.703	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	G	0.322	-0.961284	0.02249	.	.	ENSG00000206181	ENST00000332567	T	0.06768	3.26	1.8	-3.6	0.04570	.	0.739872	0.11067	U	0.603332	T	0.04907	0.0132	L	0.38175	1.15	0.09310	N	1	B	0.29646	0.253	B	0.23419	0.046	T	0.36696	-0.9737	10	0.21540	T	0.41	.	4.5545	0.12130	0.2876:0.3307:0.3817:0.0	.	235	Q8IYF1	ELOA2_HUMAN	S	235	ENSP00000331302:R235S	ENSP00000331302:R235S	R	-	1	0	TCEB3B	42814931	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	-0.184000	0.09698	-1.813000	0.01226	-1.598000	0.00824	CGC	TCEB3B	-	NULL	ENSG00000206181		0.607	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	-	0.00	59	0	G	NM_016427		44560933	-1	tier1	-	no_errors	ENST00000332567	ensembl	human	known	74_37	missense	7.04	66	5	SNP	0.000	T
TCTN1	79600	genome.wustl.edu	37	12	111072534	111072534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:111072534G>T	ENST00000551590.1	+	6	928	c.772G>T	c.(772-774)Gaa>Taa	p.E258*	TCTN1_ENST00000397659.4_Nonsense_Mutation_p.E258*|AC144522.1_ENST00000408319.1_RNA|TCTN1_ENST00000551555.2_Intron|TCTN1_ENST00000397655.3_Intron|TCTN1_ENST00000377654.3_Nonsense_Mutation_p.E80*|HVCN1_ENST00000548312.1_Intron			Q2MV58	TECT1_HUMAN	tectonic family member 1	258					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						ACAGTGTGAAGAAATTGAAGC	0.363																																																	0													53.0	51.0	51.0					12																	111072534		1805	4073	5878	SO:0001587	stop_gained	0			AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.772G>T	12.37:g.111072534G>T	ENSP00000448735:p.Glu258*		A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Nonsense_Mutation	SNP	pfam_DUF1619	p.E258*	ENST00000551590.1	37	c.772	CCDS41835.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.066088	0.97251	.	.	ENSG00000204852	ENST00000397650;ENST00000551590;ENST00000377654;ENST00000548095;ENST00000397657;ENST00000397659;ENST00000397652	.	.	.	5.66	-0.589	0.11683	.	0.882738	0.10251	N	0.697125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-6.7643	5.8843	0.18872	0.3876:0.1295:0.4829:0.0	.	.	.	.	X	198;258;80;258;80;258;202	.	ENSP00000366882:E80X	E	+	1	0	TCTN1	109556917	0.000000	0.05858	0.130000	0.21974	0.383000	0.30230	0.071000	0.14594	-0.069000	0.12931	-0.894000	0.02916	GAA	TCTN1	-	pfam_DUF1619	ENSG00000204852		0.363	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	TCTN1	HGNC	protein_coding	OTTHUMT00000316016.2	-	0.00	27	0	G	NM_024549		111072534	+1	tier1	-	no_errors	ENST00000397659	ensembl	human	known	74_37	nonsense	11.36	39	5	SNP	0.133	T
TCTN1	79600	genome.wustl.edu	37	12	111072534	111072534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr12:111072534G>T	ENST00000551590.1	+	6	928	c.772G>T	c.(772-774)Gaa>Taa	p.E258*	TCTN1_ENST00000397659.4_Nonsense_Mutation_p.E258*|AC144522.1_ENST00000408319.1_RNA|TCTN1_ENST00000551555.2_Intron|TCTN1_ENST00000397655.3_Intron|TCTN1_ENST00000377654.3_Nonsense_Mutation_p.E80*|HVCN1_ENST00000548312.1_Intron			Q2MV58	TECT1_HUMAN	tectonic family member 1	258					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						ACAGTGTGAAGAAATTGAAGC	0.363																																																	0													53.0	51.0	51.0					12																	111072534		1805	4073	5878	SO:0001587	stop_gained	0			AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.772G>T	12.37:g.111072534G>T	ENSP00000448735:p.Glu258*		A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Nonsense_Mutation	SNP	pfam_DUF1619	p.E258*	ENST00000551590.1	37	c.772	CCDS41835.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.066088	0.97251	.	.	ENSG00000204852	ENST00000397650;ENST00000551590;ENST00000377654;ENST00000548095;ENST00000397657;ENST00000397659;ENST00000397652	.	.	.	5.66	-0.589	0.11683	.	0.882738	0.10251	N	0.697125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-6.7643	5.8843	0.18872	0.3876:0.1295:0.4829:0.0	.	.	.	.	X	198;258;80;258;80;258;202	.	ENSP00000366882:E80X	E	+	1	0	TCTN1	109556917	0.000000	0.05858	0.130000	0.21974	0.383000	0.30230	0.071000	0.14594	-0.069000	0.12931	-0.894000	0.02916	GAA	TCTN1	-	pfam_DUF1619	ENSG00000204852		0.363	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	TCTN1	HGNC	protein_coding	OTTHUMT00000316016.2	-	0.00	35	0	G	NM_024549		111072534	+1	tier1	-	no_errors	ENST00000397659	ensembl	human	known	74_37	nonsense	11.36	39	5	SNP	0.133	T
TDO2	6999	genome.wustl.edu	37	4	156831333	156831333	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr4:156831333G>A	ENST00000536354.2	+	6	652	c.588G>A	c.(586-588)gaG>gaA	p.E196E		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		TTAAATCTGAGCAGGAAAAGA	0.328																																					Colon(57;928 1036 2595 6946 26094)												0													65.0	69.0	68.0					4																	156831333		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.588G>A	4.37:g.156831333G>A				Silent	SNP	pfam_Trp_2_3_dOase	p.E196	ENST00000536354.2	37	c.588	CCDS34086.1	4																																																																																			TDO2	-	pfam_Trp_2_3_dOase	ENSG00000151790		0.328	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDO2	HGNC	protein_coding	OTTHUMT00000366209.3	-	0.00	14	0	G	NM_005651		156831333	+1	tier1	-	no_errors	ENST00000536354	ensembl	human	known	74_37	silent	30.43	16	7	SNP	1.000	A
TDO2	6999	genome.wustl.edu	37	4	156831333	156831333	+	Silent	SNP	G	G	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr4:156831333G>A	ENST00000536354.2	+	6	652	c.588G>A	c.(586-588)gaG>gaA	p.E196E		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		TTAAATCTGAGCAGGAAAAGA	0.328																																					Colon(57;928 1036 2595 6946 26094)												0													65.0	69.0	68.0					4																	156831333		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.588G>A	4.37:g.156831333G>A				Silent	SNP	pfam_Trp_2_3_dOase	p.E196	ENST00000536354.2	37	c.588	CCDS34086.1	4																																																																																			TDO2	-	pfam_Trp_2_3_dOase	ENSG00000151790		0.328	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDO2	HGNC	protein_coding	OTTHUMT00000366209.3	-	0.00	23	0	G	NM_005651		156831333	+1	tier1	-	no_errors	ENST00000536354	ensembl	human	known	74_37	silent	30.43	16	7	SNP	1.000	A
THSD1	55901	genome.wustl.edu	37	13	52951806	52951806	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr13:52951806G>T	ENST00000258613.4	-	5	2477	c.2299C>A	c.(2299-2301)Cac>Aac	p.H767N	THSD1_ENST00000349258.4_Missense_Mutation_p.H714N|THSD1_ENST00000544466.1_Missense_Mutation_p.H388N	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	767					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ACACTCTTGTGACTGGGGGAC	0.542																																																	0													128.0	136.0	133.0					13																	52951806		2203	4300	6503	SO:0001583	missense	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.2299C>A	13.37:g.52951806G>T	ENSP00000258613:p.His767Asn		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.H767N	ENST00000258613.4	37	c.2299	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306941	0.40795	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.32272	2.19;1.46;2.37	5.38	3.53	0.40419	.	0.348195	0.32719	N	0.005723	T	0.31949	0.0813	M	0.65975	2.015	0.27276	N	0.958245	P;P	0.37914	0.493;0.611	B;B	0.39379	0.298;0.159	T	0.21827	-1.0234	10	0.48119	T	0.1	-10.8397	8.8976	0.35474	0.0776:0.2657:0.6567:0.0	.	714;767	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	N	714;388;767	ENSP00000340650:H714N;ENSP00000438512:H388N;ENSP00000258613:H767N	ENSP00000258613:H767N	H	-	1	0	THSD1	51849807	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.664000	0.54525	1.410000	0.46936	0.502000	0.49764	CAC	THSD1	-	NULL	ENSG00000136114		0.542	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3		0.00	62	0	G			52951806	-1			no_errors	ENST00000258613	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
TIGIT	201633	genome.wustl.edu	37	3	114018535	114018535	+	Silent	SNP	C	C	A	rs372970765		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:114018535C>A	ENST00000486257.1	+	4	740	c.483C>A	c.(481-483)gtC>gtA	p.V161V	TIGIT_ENST00000481065.1_Silent_p.V228V|TIGIT_ENST00000383671.3_Silent_p.V161V			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	161					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						TCGTGGTGGTCGCGTTGACTA	0.602																																																	0													72.0	59.0	63.0					3																	114018535		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.483C>A	3.37:g.114018535C>A			Q495A3|Q5JPD8|Q6MZS2|Q8N877	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.V161	ENST00000486257.1	37	c.483	CCDS2980.1	3																																																																																			TIGIT	-	NULL	ENSG00000181847		0.602	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	-	0.00	34	0	C	NM_173799		114018535	+1	tier1	-	no_errors	ENST00000383671	ensembl	human	known	74_37	silent	56.92	28	37	SNP	0.000	A
TIGIT	201633	genome.wustl.edu	37	3	114018535	114018535	+	Silent	SNP	C	C	A	rs372970765		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:114018535C>A	ENST00000486257.1	+	4	740	c.483C>A	c.(481-483)gtC>gtA	p.V161V	TIGIT_ENST00000481065.1_Silent_p.V228V|TIGIT_ENST00000383671.3_Silent_p.V161V			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	161					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						TCGTGGTGGTCGCGTTGACTA	0.602																																																	0													72.0	59.0	63.0					3																	114018535		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.483C>A	3.37:g.114018535C>A			Q495A3|Q5JPD8|Q6MZS2|Q8N877	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.V161	ENST00000486257.1	37	c.483	CCDS2980.1	3																																																																																			TIGIT	-	NULL	ENSG00000181847		0.602	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	-	0.00	65	0	C	NM_173799		114018535	+1	tier1	-	no_errors	ENST00000383671	ensembl	human	known	74_37	silent	56.92	28	37	SNP	0.000	A
TMEM178B	100507421	genome.wustl.edu	37	7	140912469	140912469	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:140912469C>T	ENST00000565468.1	+	2	540	c.461C>T	c.(460-462)aCg>aTg	p.T154M		NM_001195278.1	NP_001182207.1	H3BS89	T178B_HUMAN	transmembrane protein 178B	154						integral component of membrane (GO:0016021)											TTCAATATCACGAAGACCATC	0.498																																																	0																																										SO:0001583	missense	0				CCDS59086.1	7q34	2012-06-29			ENSG00000261115	ENSG00000261115			44112	protein-coding gene	gene with protein product							Standard	NM_001195278		Approved	DKFZp547G036	uc003vwg.2	H3BS89	OTTHUMG00000172737	ENST00000565468.1:c.461C>T	7.37:g.140912469C>T	ENSP00000456594:p.Thr154Met			Missense_Mutation	SNP	NULL	p.T154M	ENST00000565468.1	37	c.461	CCDS59086.1	7																																																																																			TMEM178B	-	NULL	ENSG00000261115		0.498	TMEM178B-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM178B	HGNC	protein_coding	OTTHUMT00000420337.4	-	0.00	59	0	C			140912469	+1	tier1	-	no_errors	ENST00000565468	ensembl	human	putative	74_37	missense	8.33	66	6	SNP	1.000	T
TMEM178B	100507421	genome.wustl.edu	37	7	140912469	140912469	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:140912469C>T	ENST00000565468.1	+	2	540	c.461C>T	c.(460-462)aCg>aTg	p.T154M		NM_001195278.1	NP_001182207.1	H3BS89	T178B_HUMAN	transmembrane protein 178B	154						integral component of membrane (GO:0016021)											TTCAATATCACGAAGACCATC	0.498																																																	0																																										SO:0001583	missense	0				CCDS59086.1	7q34	2012-06-29			ENSG00000261115	ENSG00000261115			44112	protein-coding gene	gene with protein product							Standard	NM_001195278		Approved	DKFZp547G036	uc003vwg.2	H3BS89	OTTHUMG00000172737	ENST00000565468.1:c.461C>T	7.37:g.140912469C>T	ENSP00000456594:p.Thr154Met			Missense_Mutation	SNP	NULL	p.T154M	ENST00000565468.1	37	c.461	CCDS59086.1	7																																																																																			TMEM178B	-	NULL	ENSG00000261115		0.498	TMEM178B-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM178B	HGNC	protein_coding	OTTHUMT00000420337.4	-	0.00	62	0	C			140912469	+1	tier1	-	no_errors	ENST00000565468	ensembl	human	putative	74_37	missense	8.33	66	6	SNP	1.000	T
TNC	3371	genome.wustl.edu	37	9	117825355	117825355	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr9:117825355C>T	ENST00000350763.4	-	13	4285	c.3874G>A	c.(3874-3876)Gag>Aag	p.E1292K	TNC_ENST00000345230.3_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000341037.4_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.E1292K	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1292	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TGGTCAGCCTCCTGGACCTGA	0.552																																																	0													122.0	84.0	97.0					9																	117825355		2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.3874G>A	9.37:g.117825355C>T	ENSP00000265131:p.Glu1292Lys		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.E1292K	ENST00000350763.4	37	c.3874	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523771	0.64747	.	.	ENSG00000041982	ENST00000350763;ENST00000423613	T;T	0.57595	0.39;0.39	5.4	4.48	0.54585	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.211491	0.50627	D	0.000116	T	0.70020	0.3176	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.70490	-0.4857	10	0.42905	T	0.14	.	9.1831	0.37154	0.1651:0.6754:0.1595:0.0	.	1292;1292	E9PC84;P24821	.;TENA_HUMAN	K	1292	ENSP00000265131:E1292K;ENSP00000411406:E1292K	ENSP00000265131:E1292K	E	-	1	0	TNC	116865176	1.000000	0.71417	0.929000	0.37066	0.937000	0.57800	2.596000	0.46205	1.334000	0.45468	0.655000	0.94253	GAG	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.552	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	52	0	C	NM_002160		117825355	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	39.09	67	43	SNP	0.968	T
TNIK	23043	genome.wustl.edu	37	3	170846630	170846630	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:170846630delG	ENST00000436636.2	-	16	1990	c.1646delC	c.(1645-1647)cctfs	p.P549fs	TNIK_ENST00000369326.5_Frame_Shift_Del_p.P520fs|TNIK_ENST00000341852.6_Intron|TNIK_ENST00000460047.1_Intron|TNIK_ENST00000488470.1_Intron|TNIK_ENST00000284483.8_Frame_Shift_Del_p.P549fs|TNIK_ENST00000538048.1_Intron|TNIK_ENST00000475336.1_Intron|TNIK_ENST00000357327.5_Frame_Shift_Del_p.P520fs|TNIK_ENST00000470834.1_Frame_Shift_Del_p.P520fs	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	549	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AGGCATGGCAGGGGAACTTTG	0.483																																																	0													54.0	57.0	56.0					3																	170846630		1947	4147	6094	SO:0001589	frameshift_variant	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1646delC	3.37:g.170846630delG	ENSP00000399511:p.Pro549fs		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.P549fs	ENST00000436636.2	37	c.1646	CCDS46956.1	3																																																																																			TNIK	-	NULL	ENSG00000154310		0.483	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2		0.00	11	0	G	XM_039796		170846630	-1	tier1		no_errors	ENST00000436636	ensembl	human	known	74_37	frame_shift_del	64.71	6	11	DEL	1.000	-
TNIK	23043	genome.wustl.edu	37	3	170846630	170846630	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:170846630delG	ENST00000436636.2	-	16	1990	c.1646delC	c.(1645-1647)cctfs	p.P549fs	TNIK_ENST00000369326.5_Frame_Shift_Del_p.P520fs|TNIK_ENST00000341852.6_Intron|TNIK_ENST00000460047.1_Intron|TNIK_ENST00000488470.1_Intron|TNIK_ENST00000284483.8_Frame_Shift_Del_p.P549fs|TNIK_ENST00000538048.1_Intron|TNIK_ENST00000475336.1_Intron|TNIK_ENST00000357327.5_Frame_Shift_Del_p.P520fs|TNIK_ENST00000470834.1_Frame_Shift_Del_p.P520fs	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	549	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			AGGCATGGCAGGGGAACTTTG	0.483																																																	0													54.0	57.0	56.0					3																	170846630		1947	4147	6094	SO:0001589	frameshift_variant	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1646delC	3.37:g.170846630delG	ENSP00000399511:p.Pro549fs		A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.P549fs	ENST00000436636.2	37	c.1646	CCDS46956.1	3																																																																																			TNIK	-	NULL	ENSG00000154310		0.483	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2		0.00	9	0	G	XM_039796		170846630	-1	tier1		no_errors	ENST00000436636	ensembl	human	known	74_37	frame_shift_del	64.71	6	11	DEL	1.000	-
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	29	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	73.53	9	25	SNP	1.000	T
TPP1	1200	genome.wustl.edu	37	11	6637740	6637743	+	Intron	DEL	TTTT	TTTT	-	rs35039601|rs537576314	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	TTTT	TTTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:6637740_6637743delTTTT	ENST00000299427.6	-	8	947				TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_Intron|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I						embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CCGGCCTGGAtttttttttttttt	0.495																																																	0																																										SO:0001627	intron_variant	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.887-6AAAA>-	11.37:g.6637748_6637751delTTTT			Q71V64	RNA	DEL	-	NULL	ENST00000299427.6	37	NULL	CCDS7770.1	11																																																																																			TPP1	-	-	ENSG00000166340		0.495	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2		0.00	11	0	TTTT			6637743	-1	tier1		no_errors	ENST00000528807	ensembl	human	putative	74_37	rna	14.29	12	2	DEL	0.237:0.105:0.000:0.000	-
TPP1	1200	genome.wustl.edu	37	11	6637740	6637743	+	Intron	DEL	TTTT	TTTT	-	rs35039601|rs537576314	byFrequency	TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	TTTT	TTTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr11:6637740_6637743delTTTT	ENST00000299427.6	-	8	947				TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_Intron|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I						embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CCGGCCTGGAtttttttttttttt	0.495																																																	0																																										SO:0001627	intron_variant	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.887-6AAAA>-	11.37:g.6637748_6637751delTTTT			Q71V64	RNA	DEL	-	NULL	ENST00000299427.6	37	NULL	CCDS7770.1	11																																																																																			TPP1	-	-	ENSG00000166340		0.495	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2		0.00	12	0	TTTT			6637743	-1	tier1		no_errors	ENST00000528807	ensembl	human	putative	74_37	rna	14.29	12	2	DEL	0.237:0.105:0.000:0.000	-
TPR	7175	genome.wustl.edu	37	1	186302444	186302444	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:186302444G>T	ENST00000367478.4	-	37	5561	c.5265C>A	c.(5263-5265)gtC>gtA	p.V1755V		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1755					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TAGAAGGCTGGACATTAGGAC	0.428			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0													146.0	142.0	143.0					1																	186302444		1907	4114	6021	SO:0001819	synonymous_variant	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5265C>A	1.37:g.186302444G>T			Q15655|Q5SWY0|Q99968	Silent	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.V1755	ENST00000367478.4	37	c.5265	CCDS41446.1	1																																																																																			TPR	-	NULL	ENSG00000047410		0.428	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	-	0.00	35	0	G	NM_003292		186302444	-1	tier1	-	no_errors	ENST00000367478	ensembl	human	known	74_37	silent	7.46	62	5	SNP	1.000	T
TPR	7175	genome.wustl.edu	37	1	186302444	186302444	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:186302444G>T	ENST00000367478.4	-	37	5561	c.5265C>A	c.(5263-5265)gtC>gtA	p.V1755V		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1755					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TAGAAGGCTGGACATTAGGAC	0.428			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0													146.0	142.0	143.0					1																	186302444		1907	4114	6021	SO:0001819	synonymous_variant	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5265C>A	1.37:g.186302444G>T			Q15655|Q5SWY0|Q99968	Silent	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.V1755	ENST00000367478.4	37	c.5265	CCDS41446.1	1																																																																																			TPR	-	NULL	ENSG00000047410		0.428	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	-	0.00	43	0	G	NM_003292		186302444	-1	tier1	-	no_errors	ENST00000367478	ensembl	human	known	74_37	silent	7.46	62	5	SNP	1.000	T
TRPC5	7224	genome.wustl.edu	37	X	111195502	111195502	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:111195502C>A	ENST00000262839.2	-	2	1065	c.147G>T	c.(145-147)aaG>aaT	p.K49N		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	49					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GAAGGGCCTGCTTCACAGTGG	0.547																																																	0													112.0	89.0	96.0					X																	111195502		2203	4300	6503	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.147G>T	X.37:g.111195502C>A	ENSP00000262839:p.Lys49Asn		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.K49N	ENST00000262839.2	37	c.147	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415164	0.62511	.	.	ENSG00000072315	ENST00000262839	T	0.69040	-0.37	5.63	2.9	0.33743	Ankyrin repeat-containing domain (3);	0.046199	0.85682	D	0.000000	T	0.69540	0.3122	M	0.67625	2.065	0.50467	D	0.999875	P;P	0.38148	0.62;0.62	P;P	0.47705	0.555;0.513	T	0.68823	-0.5307	10	0.87932	D	0	-13.7977	7.6608	0.28402	0.0:0.574:0.0:0.426	.	50;49	Q59G51;Q9UL62	.;TRPC5_HUMAN	N	49	ENSP00000262839:K49N	ENSP00000262839:K49N	K	-	3	2	TRPC5	111082158	0.995000	0.38212	1.000000	0.80357	0.973000	0.67179	0.427000	0.21379	0.548000	0.28955	0.600000	0.82982	AAG	TRPC5	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000072315		0.547	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	-	0.00	14	0	C	NM_012471		111195502	-1	tier1	-	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	62.96	10	17	SNP	1.000	A
TRPC5	7224	genome.wustl.edu	37	X	111195502	111195502	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:111195502C>A	ENST00000262839.2	-	2	1065	c.147G>T	c.(145-147)aaG>aaT	p.K49N		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	49					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GAAGGGCCTGCTTCACAGTGG	0.547																																																	0													112.0	89.0	96.0					X																	111195502		2203	4300	6503	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.147G>T	X.37:g.111195502C>A	ENSP00000262839:p.Lys49Asn		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.K49N	ENST00000262839.2	37	c.147	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415164	0.62511	.	.	ENSG00000072315	ENST00000262839	T	0.69040	-0.37	5.63	2.9	0.33743	Ankyrin repeat-containing domain (3);	0.046199	0.85682	D	0.000000	T	0.69540	0.3122	M	0.67625	2.065	0.50467	D	0.999875	P;P	0.38148	0.62;0.62	P;P	0.47705	0.555;0.513	T	0.68823	-0.5307	10	0.87932	D	0	-13.7977	7.6608	0.28402	0.0:0.574:0.0:0.426	.	50;49	Q59G51;Q9UL62	.;TRPC5_HUMAN	N	49	ENSP00000262839:K49N	ENSP00000262839:K49N	K	-	3	2	TRPC5	111082158	0.995000	0.38212	1.000000	0.80357	0.973000	0.67179	0.427000	0.21379	0.548000	0.28955	0.600000	0.82982	AAG	TRPC5	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000072315		0.547	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	-	0.00	32	0	C	NM_012471		111195502	-1	tier1	-	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	62.96	10	17	SNP	1.000	A
TRPM7	54822	genome.wustl.edu	37	15	50955214	50955214	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:50955214C>T	ENST00000313478.7	-	2	314	c.33G>A	c.(31-33)ttG>ttA	p.L11L	TRPM7_ENST00000560955.1_Silent_p.L11L	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	11					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CCCTCTTGGTCAAAGTGCTTT	0.338																																																	0													73.0	71.0	71.0					15																	50955214		1811	4067	5878	SO:0001819	synonymous_variant	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.33G>A	15.37:g.50955214C>T			Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.L11	ENST00000313478.7	37	c.33	CCDS42035.1	15																																																																																			TRPM7	-	NULL	ENSG00000092439		0.338	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	-	0.00	25	0	C	NM_017672		50955214	-1	tier1	-	no_errors	ENST00000313478	ensembl	human	known	74_37	silent	15.15	28	5	SNP	1.000	T
TRPM7	54822	genome.wustl.edu	37	15	50955214	50955214	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:50955214C>T	ENST00000313478.7	-	2	314	c.33G>A	c.(31-33)ttG>ttA	p.L11L	TRPM7_ENST00000560955.1_Silent_p.L11L	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	11					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CCCTCTTGGTCAAAGTGCTTT	0.338																																																	0													73.0	71.0	71.0					15																	50955214		1811	4067	5878	SO:0001819	synonymous_variant	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.33G>A	15.37:g.50955214C>T			Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.L11	ENST00000313478.7	37	c.33	CCDS42035.1	15																																																																																			TRPM7	-	NULL	ENSG00000092439		0.338	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	-	0.00	32	0	C	NM_017672		50955214	-1	tier1	-	no_errors	ENST00000313478	ensembl	human	known	74_37	silent	15.15	28	5	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179647637	179647637	+	Missense_Mutation	SNP	C	C	T	rs371757623		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:179647637C>T	ENST00000591111.1	-	18	3220	c.2996G>A	c.(2995-2997)cGt>cAt	p.R999H	TTN_ENST00000589042.1_Missense_Mutation_p.R999H|TTN_ENST00000460472.2_Missense_Mutation_p.R953H|TTN_ENST00000359218.5_Missense_Mutation_p.R953H|TTN_ENST00000342175.6_Missense_Mutation_p.R953H|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R999H|TTN_ENST00000342992.6_Missense_Mutation_p.R999H			Q8WZ42	TITIN_HUMAN	titin	32552	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCATAAGACGAGCAATTCC	0.493																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	102.0	99.0	100.0		2858,2996,2996,2858,2858	6.2	1.0	2		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	953/26927,999/33424,999/5605,953/27052,953/27119	179647637	1,13005	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2996G>A	2.37:g.179647637C>T	ENSP00000465570:p.Arg999His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R999H	ENST00000591111.1	37	c.2996		2	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389979	0.42410	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77329	0.4114	L	0.35644	1.08	0.34124	D	0.664483	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.74023	0.947;0.947;0.947;0.971;0.982	T	0.80863	-0.1192	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	953;953;953;999;999	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	999;953;953;953;953;999	ENSP00000343764:R999H;ENSP00000434586:R953H;ENSP00000340554:R953H;ENSP00000352154:R953H;ENSP00000354117:R999H	ENSP00000340554:R953H	R	-	2	0	TTN	179355882	1.000000	0.71417	0.972000	0.41901	0.368000	0.29767	4.876000	0.63079	2.941000	0.99782	0.655000	0.94253	CGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.493	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	25	0	C	NM_133378		179647637	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179647637	179647637	+	Missense_Mutation	SNP	C	C	T	rs371757623		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr2:179647637C>T	ENST00000591111.1	-	18	3220	c.2996G>A	c.(2995-2997)cGt>cAt	p.R999H	TTN_ENST00000589042.1_Missense_Mutation_p.R999H|TTN_ENST00000460472.2_Missense_Mutation_p.R953H|TTN_ENST00000359218.5_Missense_Mutation_p.R953H|TTN_ENST00000342175.6_Missense_Mutation_p.R953H|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R999H|TTN_ENST00000342992.6_Missense_Mutation_p.R999H			Q8WZ42	TITIN_HUMAN	titin	32552	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCATAAGACGAGCAATTCC	0.493																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	102.0	99.0	100.0		2858,2996,2996,2858,2858	6.2	1.0	2		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	953/26927,999/33424,999/5605,953/27052,953/27119	179647637	1,13005	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2996G>A	2.37:g.179647637C>T	ENSP00000465570:p.Arg999His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R999H	ENST00000591111.1	37	c.2996		2	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389979	0.42410	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77329	0.4114	L	0.35644	1.08	0.34124	D	0.664483	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.74023	0.947;0.947;0.947;0.971;0.982	T	0.80863	-0.1192	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	953;953;953;999;999	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	999;953;953;953;953;999	ENSP00000343764:R999H;ENSP00000434586:R953H;ENSP00000340554:R953H;ENSP00000352154:R953H;ENSP00000354117:R999H	ENSP00000340554:R953H	R	-	2	0	TTN	179355882	1.000000	0.71417	0.972000	0.41901	0.368000	0.29767	4.876000	0.63079	2.941000	0.99782	0.655000	0.94253	CGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.493	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	28	0	C	NM_133378		179647637	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	T
TUBA3C	7278	genome.wustl.edu	37	13	19748204	19748204	+	Silent	SNP	G	G	A	rs1052403		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr13:19748204G>A	ENST00000400113.3	-	5	1256	c.1152C>T	c.(1150-1152)atC>atT	p.I384I		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	384					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		AGGCCTCCGCGATGGCCGTGG	0.637																																																	0													95.0	86.0	89.0					13																	19748204		2203	4300	6503	SO:0001819	synonymous_variant	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1152C>T	13.37:g.19748204G>A			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.I384	ENST00000400113.3	37	c.1152	CCDS9284.1	13																																																																																			TUBA3C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Tubulin,prints_Delta_tubulin	ENSG00000198033		0.637	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	65	0	G	NM_006001		19748204	-1	tier1	rs1052403	no_errors	ENST00000400113	ensembl	human	known	74_37	silent	17.71	79	17	SNP	1.000	A
UBR4	23352	genome.wustl.edu	37	1	19440388	19440388	+	Intron	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:19440388C>G	ENST00000375254.3	-	76	11356				UBR4_ENST00000375217.2_Intron|UBR4_ENST00000375218.3_Missense_Mutation_p.Q208H|UBR4_ENST00000375267.2_Intron|UBR4_ENST00000375226.2_Intron	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGGCAGTCTTCTGATCAAGAC	0.547											OREG0013168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													137.0	138.0	138.0					1																	19440388		2203	4300	6503	SO:0001627	intron_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.11328+50G>C	1.37:g.19440388C>G		733	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	NULL	p.Q208H	ENST00000375254.3	37	c.624	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	4.885	0.164532	0.09287	.	.	ENSG00000127481	ENST00000375218	.	.	.	4.92	3.0	0.34707	.	.	.	.	.	T	0.32675	0.0837	.	.	.	0.09310	N	0.999996	B	0.19200	0.034	B	0.24701	0.055	T	0.29882	-0.9997	7	0.72032	D	0.01	.	6.3313	0.21272	0.0:0.6783:0.1514:0.1702	.	208	Q5T4S7-6	.	H	208	.	ENSP00000364366:Q208H	Q	-	3	2	UBR4	19312975	0.000000	0.05858	0.011000	0.14972	0.122000	0.20287	0.543000	0.23237	1.291000	0.44653	0.655000	0.94253	CAG	UBR4	-	NULL	ENSG00000127481		0.547	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	28	0	C	NM_020765		19440388	-1	tier1	-	no_errors	ENST00000375218	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.001	G
UBR4	23352	genome.wustl.edu	37	1	19440388	19440388	+	Intron	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:19440388C>G	ENST00000375254.3	-	76	11356				UBR4_ENST00000375217.2_Intron|UBR4_ENST00000375218.3_Missense_Mutation_p.Q208H|UBR4_ENST00000375267.2_Intron|UBR4_ENST00000375226.2_Intron	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGGCAGTCTTCTGATCAAGAC	0.547											OREG0013168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													137.0	138.0	138.0					1																	19440388		2203	4300	6503	SO:0001627	intron_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.11328+50G>C	1.37:g.19440388C>G		733	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	NULL	p.Q208H	ENST00000375254.3	37	c.624	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	4.885	0.164532	0.09287	.	.	ENSG00000127481	ENST00000375218	.	.	.	4.92	3.0	0.34707	.	.	.	.	.	T	0.32675	0.0837	.	.	.	0.09310	N	0.999996	B	0.19200	0.034	B	0.24701	0.055	T	0.29882	-0.9997	7	0.72032	D	0.01	.	6.3313	0.21272	0.0:0.6783:0.1514:0.1702	.	208	Q5T4S7-6	.	H	208	.	ENSP00000364366:Q208H	Q	-	3	2	UBR4	19312975	0.000000	0.05858	0.011000	0.14972	0.122000	0.20287	0.543000	0.23237	1.291000	0.44653	0.655000	0.94253	CAG	UBR4	-	NULL	ENSG00000127481		0.547	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	31	0	C	NM_020765		19440388	-1	tier1	-	no_errors	ENST00000375218	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.001	G
UPF3B	65109	genome.wustl.edu	37	X	118975734	118975734	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:118975734C>T	ENST00000276201.2	-	6	657	c.588G>A	c.(586-588)aaG>aaA	p.K196K	UPF3B_ENST00000345865.2_Silent_p.K196K|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	196	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						GTGGGGTTGTCTTTTTAGCTA	0.348																																																	0													134.0	140.0	138.0					X																	118975734		2202	4300	6502	SO:0001819	synonymous_variant	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.588G>A	X.37:g.118975734C>T			D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Silent	SNP	pfam_Nonsense_mediated_decay_UPF3	p.K196	ENST00000276201.2	37	c.588	CCDS14588.1	X																																																																																			UPF3B	-	pfam_Nonsense_mediated_decay_UPF3	ENSG00000125351		0.348	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	-	0.00	39	0	C			118975734	-1	tier1	-	no_errors	ENST00000276201	ensembl	human	known	74_37	silent	8.70	63	6	SNP	1.000	T
UPF3B	65109	genome.wustl.edu	37	X	118975734	118975734	+	Silent	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:118975734C>T	ENST00000276201.2	-	6	657	c.588G>A	c.(586-588)aaG>aaA	p.K196K	UPF3B_ENST00000345865.2_Silent_p.K196K|UPF3B_ENST00000478840.1_5'UTR	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	196	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						GTGGGGTTGTCTTTTTAGCTA	0.348																																																	0													134.0	140.0	138.0					X																	118975734		2202	4300	6502	SO:0001819	synonymous_variant	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.588G>A	X.37:g.118975734C>T			D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Silent	SNP	pfam_Nonsense_mediated_decay_UPF3	p.K196	ENST00000276201.2	37	c.588	CCDS14588.1	X																																																																																			UPF3B	-	pfam_Nonsense_mediated_decay_UPF3	ENSG00000125351		0.348	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	-	0.00	51	0	C			118975734	-1	tier1	-	no_errors	ENST00000276201	ensembl	human	known	74_37	silent	8.70	63	6	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62209684	62209684	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:62209684G>T	ENST00000261517.5	-	60	7984	c.7911C>A	c.(7909-7911)ctC>ctA	p.L2637L	VPS13C_ENST00000249837.3_Silent_p.L2594L|RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395898.3_Silent_p.L2594L|VPS13C_ENST00000395896.4_Silent_p.L2637L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TATTCACTATGAGAGGTAAGA	0.413																																																	0													145.0	133.0	137.0					15																	62209684		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.7911C>A	15.37:g.62209684G>T				Silent	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.L2637	ENST00000261517.5	37	c.7911	CCDS32257.1	15																																																																																			VPS13C	-	NULL	ENSG00000129003		0.413	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	46	0	G	NM_017684		62209684	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.939	T
VPS13C	54832	genome.wustl.edu	37	15	62209684	62209684	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr15:62209684G>T	ENST00000261517.5	-	60	7984	c.7911C>A	c.(7909-7911)ctC>ctA	p.L2637L	VPS13C_ENST00000249837.3_Silent_p.L2594L|RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395898.3_Silent_p.L2594L|VPS13C_ENST00000395896.4_Silent_p.L2637L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TATTCACTATGAGAGGTAAGA	0.413																																																	0													145.0	133.0	137.0					15																	62209684		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.7911C>A	15.37:g.62209684G>T				Silent	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.L2637	ENST00000261517.5	37	c.7911	CCDS32257.1	15																																																																																			VPS13C	-	NULL	ENSG00000129003		0.413	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	52	0	G	NM_017684		62209684	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.939	T
VSTM2B	342865	genome.wustl.edu	37	19	30054821	30054821	+	Missense_Mutation	SNP	C	C	T	rs567862790		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:30054821C>T	ENST00000335523.7	+	5	923	c.838C>T	c.(838-840)Cgc>Tgc	p.R280C		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	280						integral component of membrane (GO:0016021)				breast(2)	2						TAAGTTCCTGCGCCTGCTCTT	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17613	0.0		0.001	False		,,,				2504	0.0																0													172.0	139.0	149.0					19																	30054821		692	1591	2283	SO:0001583	missense	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.838C>T	19.37:g.30054821C>T	ENSP00000335038:p.Arg280Cys			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R280C	ENST00000335523.7	37	c.838	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	C	5.319	0.244116	0.10077	.	.	ENSG00000187135	ENST00000335523	T	0.08720	3.06	5.69	0.87	0.19102	.	.	.	.	.	T	0.03783	0.0107	N	0.14661	0.345	0.09310	N	1	P	0.40931	0.733	B	0.33799	0.17	T	0.37384	-0.9708	9	0.54805	T	0.06	.	3.1934	0.06625	0.1358:0.4741:0.2497:0.1405	.	280	A6NLU5	VTM2B_HUMAN	C	280	ENSP00000335038:R280C	ENSP00000335038:R280C	R	+	1	0	VSTM2B	34746661	0.993000	0.37304	0.001000	0.08648	0.011000	0.07611	1.123000	0.31308	0.013000	0.14918	0.462000	0.41574	CGC	VSTM2B	-	NULL	ENSG00000187135		0.592	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	HGNC	protein_coding	OTTHUMT00000458601.1	-	0.00	38	0	C	NM_001146339		30054821	+1	tier1	-	no_errors	ENST00000335523	ensembl	human	known	74_37	missense	30.19	37	16	SNP	0.087	T
VSTM2B	342865	genome.wustl.edu	37	19	30054821	30054821	+	Missense_Mutation	SNP	C	C	T	rs567862790		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:30054821C>T	ENST00000335523.7	+	5	923	c.838C>T	c.(838-840)Cgc>Tgc	p.R280C		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	280						integral component of membrane (GO:0016021)				breast(2)	2						TAAGTTCCTGCGCCTGCTCTT	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17613	0.0		0.001	False		,,,				2504	0.0																0													172.0	139.0	149.0					19																	30054821		692	1591	2283	SO:0001583	missense	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.838C>T	19.37:g.30054821C>T	ENSP00000335038:p.Arg280Cys			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R280C	ENST00000335523.7	37	c.838	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	C	5.319	0.244116	0.10077	.	.	ENSG00000187135	ENST00000335523	T	0.08720	3.06	5.69	0.87	0.19102	.	.	.	.	.	T	0.03783	0.0107	N	0.14661	0.345	0.09310	N	1	P	0.40931	0.733	B	0.33799	0.17	T	0.37384	-0.9708	9	0.54805	T	0.06	.	3.1934	0.06625	0.1358:0.4741:0.2497:0.1405	.	280	A6NLU5	VTM2B_HUMAN	C	280	ENSP00000335038:R280C	ENSP00000335038:R280C	R	+	1	0	VSTM2B	34746661	0.993000	0.37304	0.001000	0.08648	0.011000	0.07611	1.123000	0.31308	0.013000	0.14918	0.462000	0.41574	CGC	VSTM2B	-	NULL	ENSG00000187135		0.592	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	HGNC	protein_coding	OTTHUMT00000458601.1	-	0.00	46	0	C	NM_001146339		30054821	+1	tier1	-	no_errors	ENST00000335523	ensembl	human	known	74_37	missense	30.19	37	16	SNP	0.087	T
VWDE	221806	genome.wustl.edu	37	7	12409792	12409792	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:12409792G>T	ENST00000275358.3	-	12	2328	c.2140C>A	c.(2140-2142)Cat>Aat	p.H714N		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	714						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TTTCCAGGATGTTTTTGTACA	0.348																																																	0													208.0	160.0	175.0					7																	12409792		692	1591	2283	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2140C>A	7.37:g.12409792G>T	ENSP00000275358:p.His714Asn		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.H714N	ENST00000275358.3	37	c.2140	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	G	1.282	-0.609953	0.03690	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.81579	-1.51	4.93	-1.22	0.09494	.	.	.	.	.	T	0.66025	0.2748	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.47235	-0.9133	9	0.27082	T	0.32	.	4.5091	0.11903	0.3474:0.0:0.4078:0.2448	.	714	Q8N2E2	VWDE_HUMAN	N	714;168	ENSP00000275358:H714N	ENSP00000275358:H714N	H	-	1	0	VWDE	12376317	0.011000	0.17503	0.001000	0.08648	0.011000	0.07611	0.069000	0.14552	-0.465000	0.06953	0.655000	0.94253	CAT	VWDE	-	NULL	ENSG00000146530		0.348	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	51	0	G	XM_371878		12409792	-1	tier1	-	no_errors	ENST00000452576	ensembl	human	known	74_37	missense	44.64	31	25	SNP	0.000	T
VWDE	221806	genome.wustl.edu	37	7	12409792	12409792	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr7:12409792G>T	ENST00000275358.3	-	12	2328	c.2140C>A	c.(2140-2142)Cat>Aat	p.H714N		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	714						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TTTCCAGGATGTTTTTGTACA	0.348																																																	0													208.0	160.0	175.0					7																	12409792		692	1591	2283	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2140C>A	7.37:g.12409792G>T	ENSP00000275358:p.His714Asn		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.H714N	ENST00000275358.3	37	c.2140	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	G	1.282	-0.609953	0.03690	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.81579	-1.51	4.93	-1.22	0.09494	.	.	.	.	.	T	0.66025	0.2748	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.47235	-0.9133	9	0.27082	T	0.32	.	4.5091	0.11903	0.3474:0.0:0.4078:0.2448	.	714	Q8N2E2	VWDE_HUMAN	N	714;168	ENSP00000275358:H714N	ENSP00000275358:H714N	H	-	1	0	VWDE	12376317	0.011000	0.17503	0.001000	0.08648	0.011000	0.07611	0.069000	0.14552	-0.465000	0.06953	0.655000	0.94253	CAT	VWDE	-	NULL	ENSG00000146530		0.348	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	60	0	G	XM_371878		12409792	-1	tier1	-	no_errors	ENST00000452576	ensembl	human	known	74_37	missense	44.64	31	25	SNP	0.000	T
WDR78	79819	genome.wustl.edu	37	1	67313346	67313346	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr1:67313346G>T	ENST00000371026.3	-	8	1167	c.1112C>A	c.(1111-1113)tCt>tAt	p.S371Y	WDR78_ENST00000431318.1_Missense_Mutation_p.S117Y|WDR78_ENST00000371023.3_Missense_Mutation_p.S371Y	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	371					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						GTCCATTAGAGAACTAGTTTC	0.289																																																	0													56.0	58.0	57.0					1																	67313346		2202	4298	6500	SO:0001583	missense	0			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1112C>A	1.37:g.67313346G>T	ENSP00000360065:p.Ser371Tyr		A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S371Y	ENST00000371026.3	37	c.1112	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614541	0.46631	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352;ENST00000371023	T;T;T;T	0.69561	0.27;-0.41;-0.39;2.01	5.16	5.16	0.70880	.	0.239684	0.43747	D	0.000528	T	0.79009	0.4374	M	0.74258	2.255	0.48511	D	0.999662	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.75484	0.986;0.979;0.931	T	0.81398	-0.0951	10	0.87932	D	0	-23.6349	17.7782	0.88516	0.0:0.0:1.0:0.0	.	117;371;371	Q5VTH9-3;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	Y	371;117;137;371	ENSP00000360065:S371Y;ENSP00000393182:S117Y;ENSP00000433682:S137Y;ENSP00000360062:S371Y	ENSP00000360062:S371Y	S	-	2	0	WDR78	67085934	1.000000	0.71417	0.990000	0.47175	0.211000	0.24417	7.188000	0.77739	2.565000	0.86533	0.557000	0.71058	TCT	WDR78	-	NULL	ENSG00000152763		0.289	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1		0.00	28	0	G	NM_024763		67313346	-1			no_errors	ENST00000371026	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.993	T
WISP3	8838	genome.wustl.edu	37	6	112389434	112389434	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:112389434delA	ENST00000368666.2	+	4	902	c.616delA	c.(616-618)aaafs	p.K208fs	WISP3_ENST00000230529.5_Frame_Shift_Del_p.K208fs|WISP3_ENST00000604763.1_Frame_Shift_Del_p.K208fs|WISP3_ENST00000368663.3_Frame_Shift_Del_p.K185fs|WISP3_ENST00000361714.1_Frame_Shift_Del_p.K226fs|WISP3_ENST00000409166.1_5'UTR	NM_198239.1	NP_937882.1	O95389	WISP3_HUMAN	WNT1 inducible signaling pathway protein 3	208	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	13		all_cancers(87;0.000196)|Acute lymphoblastic leukemia(125;1.18e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0283)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0827)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		ACTTATTTGGAAAAAAAAATG	0.333																																																	0									,	45,4219		4,37,2091	45.0	45.0	45.0		,	5.8	1.0	6		46	70,8180		10,50,4065	no	frameshift,frameshift	WISP3	NM_198239.1,NM_003880.3	,	14,87,6156	A1A1,A1R,RR		0.8485,1.0553,0.919	,	,	112389434	115,12399	2203	4298	6501	SO:0001589	frameshift_variant	0			AF100781	CCDS5097.1, CCDS5098.1	6q21	2014-05-06			ENSG00000112761	ENSG00000112761			12771	protein-coding gene	gene with protein product		603400				9843955	Standard	NM_003880		Approved	CCN6	uc003pvo.3	O95389	OTTHUMG00000185101	ENST00000368666.2:c.616delA	6.37:g.112389434delA	ENSP00000357655:p.Lys208fs		Q3KR29|Q5H8W4|Q6UXH6	Frame_Shift_Del	DEL	pfam_IGFBP-like,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt	p.K226fs	ENST00000368666.2	37	c.670	CCDS5098.1	6																																																																																			WISP3	-	superfamily_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt	ENSG00000112761		0.333	WISP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP3	HGNC	protein_coding	OTTHUMT00000041873.2		0.00	15	0	A	NM_003880		112389434	+1	tier1		no_errors	ENST00000361714	ensembl	human	known	74_37	frame_shift_del	12.50	21	3	DEL	1.000	-
WWTR1	25937	genome.wustl.edu	37	3	149290715	149290715	+	Silent	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:149290715G>C	ENST00000465804.1	-	4	760	c.504C>G	c.(502-504)ctC>ctG	p.L168L	WWTR1_ENST00000467467.1_Silent_p.L168L|WWTR1_ENST00000360632.3_Silent_p.L168L	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	168					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CGGCAGGGTGGAGGTTCATAT	0.418			T	CAMTA1	epitheliod hemangioendothelioma																																			Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	0													141.0	130.0	134.0					3																	149290715		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.504C>G	3.37:g.149290715G>C			D3DNH7|Q8N3P2|Q9Y3W6	Silent	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.L168	ENST00000465804.1	37	c.504	CCDS3144.1	3																																																																																			WWTR1	-	NULL	ENSG00000018408		0.418	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	HGNC	protein_coding	OTTHUMT00000356498.1	-	0.00	100	0	G	NM_015472		149290715	-1	tier1	-	no_errors	ENST00000360632	ensembl	human	known	74_37	silent	14.29	138	23	SNP	1.000	C
WWTR1	25937	genome.wustl.edu	37	3	149290715	149290715	+	Silent	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr3:149290715G>C	ENST00000465804.1	-	4	760	c.504C>G	c.(502-504)ctC>ctG	p.L168L	WWTR1_ENST00000467467.1_Silent_p.L168L|WWTR1_ENST00000360632.3_Silent_p.L168L	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	168					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CGGCAGGGTGGAGGTTCATAT	0.418			T	CAMTA1	epitheliod hemangioendothelioma																																			Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	0													141.0	130.0	134.0					3																	149290715		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.504C>G	3.37:g.149290715G>C			D3DNH7|Q8N3P2|Q9Y3W6	Silent	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.L168	ENST00000465804.1	37	c.504	CCDS3144.1	3																																																																																			WWTR1	-	NULL	ENSG00000018408		0.418	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	HGNC	protein_coding	OTTHUMT00000356498.1	-	0.00	114	0	G	NM_015472		149290715	-1	tier1	-	no_errors	ENST00000360632	ensembl	human	known	74_37	silent	14.29	138	23	SNP	1.000	C
ZC3H12B	340554	genome.wustl.edu	37	X	64709206	64709206	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:64709206C>A	ENST00000338957.4	+	1	592	c.525C>A	c.(523-525)agC>agA	p.S175R	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.S164R	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	175							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGATTGCAAGCCCTGAATTGT	0.458																																																	0													69.0	67.0	67.0					X																	64709206		1921	4110	6031	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.525C>A	X.37:g.64709206C>A	ENSP00000340839:p.Ser175Arg		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.S175R	ENST00000338957.4	37	c.525	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	C	6.170	0.399593	0.11696	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.23552	1.9;1.9	5.15	1.28	0.21552	.	0.164574	0.64402	D	0.000003	T	0.11153	0.0272	N	0.16478	0.41	0.49798	D	0.99982	P	0.48503	0.911	B	0.39503	0.301	T	0.24440	-1.0160	10	0.09590	T	0.72	-0.7981	7.9351	0.29925	0.0:0.5204:0.0:0.4796	.	164	Q5HYM0	ZC12B_HUMAN	R	175;164;111	ENSP00000340839:S175R;ENSP00000408077:S164R	ENSP00000218172:S111R	S	+	3	2	ZC3H12B	64625931	0.992000	0.36948	0.217000	0.23759	0.924000	0.55760	0.242000	0.18087	-0.068000	0.12953	-1.167000	0.01749	AGC	ZC3H12B	-	NULL	ENSG00000102053		0.458	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	-	0.00	25	0	C	XM_293334		64709206	+1	tier1	-	no_errors	ENST00000338957	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.980	A
ZC3H12B	340554	genome.wustl.edu	37	X	64709206	64709206	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chrX:64709206C>A	ENST00000338957.4	+	1	592	c.525C>A	c.(523-525)agC>agA	p.S175R	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.S164R	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	175							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGATTGCAAGCCCTGAATTGT	0.458																																																	0													69.0	67.0	67.0					X																	64709206		1921	4110	6031	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.525C>A	X.37:g.64709206C>A	ENSP00000340839:p.Ser175Arg		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.S175R	ENST00000338957.4	37	c.525	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	C	6.170	0.399593	0.11696	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.23552	1.9;1.9	5.15	1.28	0.21552	.	0.164574	0.64402	D	0.000003	T	0.11153	0.0272	N	0.16478	0.41	0.49798	D	0.99982	P	0.48503	0.911	B	0.39503	0.301	T	0.24440	-1.0160	10	0.09590	T	0.72	-0.7981	7.9351	0.29925	0.0:0.5204:0.0:0.4796	.	164	Q5HYM0	ZC12B_HUMAN	R	175;164;111	ENSP00000340839:S175R;ENSP00000408077:S164R	ENSP00000218172:S111R	S	+	3	2	ZC3H12B	64625931	0.992000	0.36948	0.217000	0.23759	0.924000	0.55760	0.242000	0.18087	-0.068000	0.12953	-1.167000	0.01749	AGC	ZC3H12B	-	NULL	ENSG00000102053		0.458	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	-	0.00	27	0	C	XM_293334		64709206	+1	tier1	-	no_errors	ENST00000338957	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.980	A
ZC3H12D	340152	genome.wustl.edu	37	6	149782909	149782909	+	Intron	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:149782909G>C	ENST00000409806.3	-	3	764				ZC3H12D_ENST00000409948.1_Intron|ZC3H12D_ENST00000416573.2_Intron|ZC3H12D_ENST00000542614.1_Intron|ZC3H12D_ENST00000389942.5_Intron			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D						negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		atcgatgttagaagtgcACCA	0.438																																																	0																																										SO:0001627	intron_variant	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.445+57C>G	6.37:g.149782909G>C			A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	RNA	SNP	-	NULL	ENST00000409806.3	37	NULL		6																																																																																			ZC3H12D	-	-	ENSG00000178199		0.438	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	-	0.00	46	0	G	NM_207360		149782909	-1	tier1	-	no_errors	ENST00000462655	ensembl	human	known	74_37	rna	28.99	49	20	SNP	0.000	C
ZC3H12D	340152	genome.wustl.edu	37	6	149782909	149782909	+	Intron	SNP	G	G	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr6:149782909G>C	ENST00000409806.3	-	3	764				ZC3H12D_ENST00000409948.1_Intron|ZC3H12D_ENST00000416573.2_Intron|ZC3H12D_ENST00000542614.1_Intron|ZC3H12D_ENST00000389942.5_Intron			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D						negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		atcgatgttagaagtgcACCA	0.438																																																	0																																										SO:0001627	intron_variant	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.445+57C>G	6.37:g.149782909G>C			A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	RNA	SNP	-	NULL	ENST00000409806.3	37	NULL		6																																																																																			ZC3H12D	-	-	ENSG00000178199		0.438	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	-	0.00	54	0	G	NM_207360		149782909	-1	tier1	-	no_errors	ENST00000462655	ensembl	human	known	74_37	rna	28.99	49	20	SNP	0.000	C
ZFPM2	23414	genome.wustl.edu	37	8	106815021	106815021	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:106815021G>T	ENST00000407775.2	+	8	2961	c.2711G>T	c.(2710-2712)aGc>aTc	p.S904I	RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S635I|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S772I|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S772I|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	904					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S904N(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GAACGAAACAGCCCTGATGTC	0.463																																																	1	Substitution - Missense(1)	endometrium(1)											44.0	43.0	44.0					8																	106815021		1914	4132	6046	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2711G>T	8.37:g.106815021G>T	ENSP00000384179:p.Ser904Ile		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S904I	ENST00000407775.2	37	c.2711	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628599	0.46944	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.22134	1.97;2.41;2.41;3.62	5.57	5.57	0.84162	.	0.080268	0.85682	D	0.000000	T	0.30039	0.0752	N	0.24115	0.695	0.53005	D	0.999961	D	0.67145	0.996	P	0.57548	0.823	T	0.01899	-1.1251	10	0.44086	T	0.13	.	19.5601	0.95368	0.0:0.0:1.0:0.0	.	904	Q8WW38	FOG2_HUMAN	I	904;772;772;635	ENSP00000384179:S904I;ENSP00000430757:S772I;ENSP00000428720:S772I;ENSP00000367733:S635I	ENSP00000367733:S635I	S	+	2	0	ZFPM2	106884197	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.806000	0.55583	2.620000	0.88729	0.650000	0.86243	AGC	ZFPM2	-	NULL	ENSG00000169946		0.463	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1		0.00	14	0	G			106815021	+1			no_errors	ENST00000407775	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
ZC3H3	23144	genome.wustl.edu	37	8	144522386	144522386	+	Silent	SNP	T	T	G	rs35759992		TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr8:144522386T>G	ENST00000262577.5	-	11	2671	c.2640A>C	c.(2638-2640)tcA>tcC	p.S880S		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	880	Poly-Ser.				mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CGggaggggatgaggaggagg	0.647																																																	0													30.0	29.0	30.0					8																	144522386		2202	4299	6501	SO:0001819	synonymous_variant	0			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2640A>C	8.37:g.144522386T>G			Q14163|Q8N4E2|Q9BUS4	Silent	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S880	ENST00000262577.5	37	c.2640	CCDS6402.1	8																																																																																			ZC3H3	-	NULL	ENSG00000014164		0.647	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2		0.00	37	0	T	NM_015117		144522386	-1			no_errors	ENST00000262577	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.000	G
ZMYND11	10771	genome.wustl.edu	37	10	287978	287978	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:287978G>T	ENST00000397962.3	+	10	1277	c.849G>T	c.(847-849)ctG>ctT	p.L283L	ZMYND11_ENST00000381607.4_Silent_p.L189L|ZMYND11_ENST00000309776.4_Silent_p.L243L|ZMYND11_ENST00000509513.2_Silent_p.L282L|ZMYND11_ENST00000381591.1_Silent_p.L283L|ZMYND11_ENST00000381602.4_Silent_p.L243L|ZMYND11_ENST00000381584.1_Silent_p.L266L|ZMYND11_ENST00000402736.1_Silent_p.L252L|ZMYND11_ENST00000381604.4_Silent_p.L243L|ZMYND11_ENST00000403354.1_Silent_p.L203L|ZMYND11_ENST00000535374.1_Silent_p.L78L|ZMYND11_ENST00000602682.1_Silent_p.L198L|ZMYND11_ENST00000545619.1_Silent_p.L163L|ZMYND11_ENST00000558098.2_Silent_p.L283L|ZMYND11_ENST00000397959.3_Silent_p.L198L			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	283	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATCATGAGCTGGTTTGGGCTA	0.363																																																	0													131.0	128.0	129.0					10																	287978		2203	4300	6503	SO:0001819	synonymous_variant	0			X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.849G>T	10.37:g.287978G>T			B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Silent	SNP	pfam_PWWP_dom,pfam_Bromodomain,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.L283	ENST00000397962.3	37	c.849	CCDS7052.2	10																																																																																			ZMYND11	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000015171		0.363	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND11	HGNC	protein_coding	OTTHUMT00000046382.4	-	0.00	39	0	G	NM_006624		287978	+1	tier1	-	no_errors	ENST00000381591	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
ZMYND11	10771	genome.wustl.edu	37	10	287978	287978	+	Silent	SNP	G	G	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr10:287978G>T	ENST00000397962.3	+	10	1277	c.849G>T	c.(847-849)ctG>ctT	p.L283L	ZMYND11_ENST00000381607.4_Silent_p.L189L|ZMYND11_ENST00000309776.4_Silent_p.L243L|ZMYND11_ENST00000509513.2_Silent_p.L282L|ZMYND11_ENST00000381591.1_Silent_p.L283L|ZMYND11_ENST00000381602.4_Silent_p.L243L|ZMYND11_ENST00000381584.1_Silent_p.L266L|ZMYND11_ENST00000402736.1_Silent_p.L252L|ZMYND11_ENST00000381604.4_Silent_p.L243L|ZMYND11_ENST00000403354.1_Silent_p.L203L|ZMYND11_ENST00000535374.1_Silent_p.L78L|ZMYND11_ENST00000602682.1_Silent_p.L198L|ZMYND11_ENST00000545619.1_Silent_p.L163L|ZMYND11_ENST00000558098.2_Silent_p.L283L|ZMYND11_ENST00000397959.3_Silent_p.L198L			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	283	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ATCATGAGCTGGTTTGGGCTA	0.363																																																	0													131.0	128.0	129.0					10																	287978		2203	4300	6503	SO:0001819	synonymous_variant	0			X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.849G>T	10.37:g.287978G>T			B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Silent	SNP	pfam_PWWP_dom,pfam_Bromodomain,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.L283	ENST00000397962.3	37	c.849	CCDS7052.2	10																																																																																			ZMYND11	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000015171		0.363	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND11	HGNC	protein_coding	OTTHUMT00000046382.4	-	0.00	52	0	G	NM_006624		287978	+1	tier1	-	no_errors	ENST00000381591	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
ZNF358	140467	genome.wustl.edu	37	19	7584255	7584255	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:7584255C>T	ENST00000597229.1	+	2	297	c.127C>T	c.(127-129)Cca>Tca	p.P43S	ZNF358_ENST00000394341.2_Missense_Mutation_p.P43S|CTD-2207O23.12_ENST00000599312.1_3'UTR|CTD-2207O23.11_ENST00000602083.1_RNA	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	43					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						TTCTGAAGACCCAGAGCCTGA	0.587																																																	0													50.0	59.0	56.0					19																	7584255		2197	4299	6496	SO:0001583	missense	0			AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.127C>T	19.37:g.7584255C>T	ENSP00000472305:p.Pro43Ser		Q9BTM7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P43S	ENST00000597229.1	37	c.127	CCDS32890.2	19	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924142	0.34002	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.06849	3.25	4.73	1.39	0.22231	.	.	.	.	.	T	0.03651	0.0104	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.16289	0.015	T	0.47394	-0.9121	9	0.14252	T	0.57	-4.8965	6.1336	0.20219	0.0:0.6599:0.1593:0.1808	.	43	Q9NW07	ZN358_HUMAN	S	43	ENSP00000377873:P43S	ENSP00000354703:P43S	P	+	1	0	ZNF358	7490255	0.000000	0.05858	0.008000	0.14137	0.659000	0.38960	0.132000	0.15891	0.667000	0.31107	0.558000	0.71614	CCA	ZNF358	-	NULL	ENSG00000198816		0.587	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF358	HGNC	protein_coding	OTTHUMT00000316747.1		0.00	32	0	C			7584255	+1			no_errors	ENST00000394341	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.036	T
ZNF525	170958	genome.wustl.edu	37	19	53887291	53887291	+	IGR	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:53887291C>G	ENST00000355326.3	+	0	594				ZNF525_ENST00000467003.1_3'UTR|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000474037.1_3'UTR			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TGCAGAATATCAGAAAATTCA	0.378																																																	0																																										SO:0001628	intergenic_variant	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53887291C>G			Q8TF23	RNA	SNP	-	NULL	ENST00000355326.3	37	NULL		19																																																																																			ZNF525	-	-	ENSG00000203326		0.378	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		-	0.00	15	0	C	NR_003699		53887291	+1	tier1	-	no_errors	ENST00000601790	ensembl	human	known	74_37	rna	41.38	17	12	SNP	0.586	G
ZNF525	170958	genome.wustl.edu	37	19	53887291	53887291	+	IGR	SNP	C	C	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:53887291C>G	ENST00000355326.3	+	0	594				ZNF525_ENST00000467003.1_3'UTR|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000474037.1_3'UTR			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						TGCAGAATATCAGAAAATTCA	0.378																																																	0																																										SO:0001628	intergenic_variant	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53887291C>G			Q8TF23	RNA	SNP	-	NULL	ENST00000355326.3	37	NULL		19																																																																																			ZNF525	-	-	ENSG00000203326		0.378	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		-	0.00	19	0	C	NR_003699		53887291	+1	tier1	-	no_errors	ENST00000601790	ensembl	human	known	74_37	rna	41.38	17	12	SNP	0.586	G
ZNF91	7644	genome.wustl.edu	37	19	23542601	23542601	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:23542601T>C	ENST00000300619.7	-	4	3385	c.3180A>G	c.(3178-3180)atA>atG	p.I1060M	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.I1028M	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	1060					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGAGGATGATATAAATGCTT	0.368																																																	0													71.0	76.0	74.0					19																	23542601		2180	4285	6465	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.3180A>G	19.37:g.23542601T>C	ENSP00000300619:p.Ile1060Met		A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I1060M	ENST00000300619.7	37	c.3180	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390723	0.25118	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.10288	2.89;2.89	1.31	-2.61	0.06171	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12433	0.0302	N	0.25094	0.71	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.71656	0.935;0.974	T	0.15925	-1.0420	9	0.30854	T	0.27	.	2.7868	0.05376	0.4901:0.1778:0.0:0.3321	.	1028;1060	Q05481-2;Q05481	.;ZNF91_HUMAN	M	1060;1028	ENSP00000300619:I1060M;ENSP00000380272:I1028M	ENSP00000300619:I1060M	I	-	3	3	ZNF91	23334441	0.000000	0.05858	0.002000	0.10522	0.659000	0.38960	-7.654000	0.00032	-0.674000	0.05253	0.165000	0.16767	ATA	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	-	0.00	32	0	T	NM_003430		23542601	-1	tier1	-	no_errors	ENST00000300619	ensembl	human	known	74_37	missense	46.03	34	29	SNP	0.000	C
ZNF91	7644	genome.wustl.edu	37	19	23542601	23542601	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:23542601T>C	ENST00000300619.7	-	4	3385	c.3180A>G	c.(3178-3180)atA>atG	p.I1060M	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.I1028M	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	1060					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGAGGATGATATAAATGCTT	0.368																																																	0													71.0	76.0	74.0					19																	23542601		2180	4285	6465	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.3180A>G	19.37:g.23542601T>C	ENSP00000300619:p.Ile1060Met		A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I1060M	ENST00000300619.7	37	c.3180	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390723	0.25118	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.10288	2.89;2.89	1.31	-2.61	0.06171	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12433	0.0302	N	0.25094	0.71	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.71656	0.935;0.974	T	0.15925	-1.0420	9	0.30854	T	0.27	.	2.7868	0.05376	0.4901:0.1778:0.0:0.3321	.	1028;1060	Q05481-2;Q05481	.;ZNF91_HUMAN	M	1060;1028	ENSP00000300619:I1060M;ENSP00000380272:I1028M	ENSP00000300619:I1060M	I	-	3	3	ZNF91	23334441	0.000000	0.05858	0.002000	0.10522	0.659000	0.38960	-7.654000	0.00032	-0.674000	0.05253	0.165000	0.16767	ATA	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	-	0.00	45	0	T	NM_003430		23542601	-1	tier1	-	no_errors	ENST00000300619	ensembl	human	known	74_37	missense	46.03	34	29	SNP	0.000	C
ZNF766	90321	genome.wustl.edu	37	19	52793497	52793497	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:52793497A>G	ENST00000439461.1	+	4	496	c.453A>G	c.(451-453)agA>agG	p.R151R	ZNF766_ENST00000593612.1_Silent_p.R166R|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Silent_p.R166R	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		CACTTCAAAGAATTTACTCTG	0.363																																																	0													60.0	60.0	60.0					19																	52793497		1885	4118	6003	SO:0001819	synonymous_variant	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.453A>G	19.37:g.52793497A>G			B2RNE0|Q7Z326	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R166	ENST00000439461.1	37	c.498	CCDS46163.1	19																																																																																			ZNF766	-	NULL	ENSG00000196214		0.363	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	-	0.00	17	0	A	NM_001010851		52793497	+1	tier1	-	no_errors	ENST00000359102	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.000	G
ZNF766	90321	genome.wustl.edu	37	19	52793497	52793497	+	Silent	SNP	A	A	G			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:52793497A>G	ENST00000439461.1	+	4	496	c.453A>G	c.(451-453)agA>agG	p.R151R	ZNF766_ENST00000593612.1_Silent_p.R166R|ZNF766_ENST00000599581.1_3'UTR|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Silent_p.R166R	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		CACTTCAAAGAATTTACTCTG	0.363																																																	0													60.0	60.0	60.0					19																	52793497		1885	4118	6003	SO:0001819	synonymous_variant	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.453A>G	19.37:g.52793497A>G			B2RNE0|Q7Z326	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R166	ENST00000439461.1	37	c.498	CCDS46163.1	19																																																																																			ZNF766	-	NULL	ENSG00000196214		0.363	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	-	0.00	8	0	A	NM_001010851		52793497	+1	tier1	-	no_errors	ENST00000359102	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.000	G
ZNF582	147948	genome.wustl.edu	37	19	56895667	56895667	+	Silent	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:56895667T>C	ENST00000301310.4	-	5	1277	c.1119A>G	c.(1117-1119)ggA>ggG	p.G373G	ZNF582_ENST00000586929.1_Silent_p.G373G	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TAAAGGCCTTTCCACATACTT	0.438																																					Ovarian(183;1887 2032 4349 30507 51343)												0													96.0	94.0	95.0					19																	56895667		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1119A>G	19.37:g.56895667T>C			B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G373	ENST00000301310.4	37	c.1119	CCDS33121.1	19																																																																																			ZNF582	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000018869		0.438	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	-	0.00	26	0	T	NM_144690		56895667	-1	tier1	-	no_errors	ENST00000301310	ensembl	human	known	74_37	silent	30.77	27	12	SNP	0.002	C
ZNF582	147948	genome.wustl.edu	37	19	56895667	56895667	+	Silent	SNP	T	T	C			TCGA-IG-A3I8-01A-11D-A247-09	TCGA-IG-A3I8-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce0db90-1984-4605-9bb4-14e8d0f60458	f4d061b0-d3da-4573-9af1-b6b1e0b582d5	g.chr19:56895667T>C	ENST00000301310.4	-	5	1277	c.1119A>G	c.(1117-1119)ggA>ggG	p.G373G	ZNF582_ENST00000586929.1_Silent_p.G373G	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TAAAGGCCTTTCCACATACTT	0.438																																					Ovarian(183;1887 2032 4349 30507 51343)												0													96.0	94.0	95.0					19																	56895667		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.1119A>G	19.37:g.56895667T>C			B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G373	ENST00000301310.4	37	c.1119	CCDS33121.1	19																																																																																			ZNF582	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000018869		0.438	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	-	0.00	29	0	T	NM_144690		56895667	-1	tier1	-	no_errors	ENST00000301310	ensembl	human	known	74_37	silent	30.77	27	12	SNP	0.002	C
