#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCG5	64240	genome.wustl.edu	37	2	44065707	44065707	+	Silent	SNP	G	G	A	rs375829761		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:44065707G>A	ENST00000260645.1	-	1	251	c.112C>T	c.(112-114)Ctg>Ttg	p.L38L	ABCG5_ENST00000543989.1_5'UTR|ABCG5_ENST00000405322.1_5'UTR|ABCG8_ENST00000272286.2_5'Flank	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	38					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AGGATGCCCAGGCTGTGAGGC	0.677																																																	0													11.0	13.0	12.0					2																	44065707		2199	4284	6483	SO:0001819	synonymous_variant	0			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.112C>T	2.37:g.44065707G>A			Q2T9G2|Q96QZ2|Q96QZ3	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L38	ENST00000260645.1	37	c.112	CCDS1814.1	2																																																																																			ABCG5	-	NULL	ENSG00000138075		0.677	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG5	HGNC	protein_coding	OTTHUMT00000250675.1	-	0.00	60	0	G	NM_022436		44065707	-1	tier1	-	no_errors	ENST00000260645	ensembl	human	known	74_37	silent	11.48	54	7	SNP	0.997	A
ABCB11	8647	genome.wustl.edu	37	2	169870832	169870832	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:169870832C>G	ENST00000263817.6	-	4	255	c.131G>C	c.(130-132)aGa>aCa	p.R44T		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	44					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GAAGCCAACTCTAACGCCATC	0.383																																																	0													280.0	260.0	267.0					2																	169870832		1873	4110	5983	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.131G>C	2.37:g.169870832C>G	ENSP00000263817:p.Arg44Thr		Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R44T	ENST00000263817.6	37	c.131	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	C	0.035	-1.312745	0.01331	.	.	ENSG00000073734	ENST00000263817	D	0.86297	-2.1	4.89	-5.66	0.02451	ABC transporter, transmembrane domain, type 1 (1);	1.685400	0.03424	N	0.206719	T	0.70954	0.3283	N	0.08118	0	0.31335	N	0.684306	B	0.29188	0.236	B	0.26969	0.075	T	0.62153	-0.6914	10	0.11485	T	0.65	-9.749	10.7974	0.46468	0.1122:0.7122:0.0:0.1755	.	44	O95342	ABCBB_HUMAN	T	44	ENSP00000263817:R44T	ENSP00000263817:R44T	R	-	2	0	ABCB11	169579078	0.060000	0.20803	0.014000	0.15608	0.035000	0.12851	-0.253000	0.08794	-1.195000	0.02680	-0.794000	0.03295	AGA	ABCB11	-	superfamily_ABC1_TM_dom	ENSG00000073734		0.383	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	-	0.00	46	0	C	NM_003742		169870832	-1	tier1	-	no_errors	ENST00000263817	ensembl	human	known	74_37	missense	10.53	51	6	SNP	0.163	G
ACAN	176	genome.wustl.edu	37	15	89398787	89398787	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:89398787G>A	ENST00000561243.1	+	11	2971	c.2971G>A	c.(2971-2973)Gac>Aac	p.D991N	ACAN_ENST00000439576.2_Missense_Mutation_p.D991N|ACAN_ENST00000559004.1_Missense_Mutation_p.D991N|ACAN_ENST00000352105.7_Missense_Mutation_p.D991N			P16112	PGCA_HUMAN	aggrecan	990	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGGAGTAGAGGACATCAGCGG	0.547																																																	0													70.0	67.0	68.0					15																	89398787		1542	3666	5208	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2971G>A	15.37:g.89398787G>A	ENSP00000453342:p.Asp991Asn		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.D991N	ENST00000561243.1	37	c.2971	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633902	0.29068	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.95821	-3.82;-3.82	4.08	3.13	0.36017	.	.	.	.	.	D	0.96861	0.8975	M	0.77820	2.39	0.09310	N	1	D;D	0.71674	0.992;0.998	P;D	0.78314	0.908;0.991	D	0.90193	0.4251	9	0.44086	T	0.13	-14.1381	8.0663	0.30663	0.1169:0.0:0.8831:0.0	.	991;991	E7ENV9;E7EX88	.;.	N	991	ENSP00000387356:D991N;ENSP00000341615:D991N	ENSP00000268134:D991N	D	+	1	0	ACAN	87199791	0.006000	0.16342	0.023000	0.16930	0.008000	0.06430	1.689000	0.37700	2.109000	0.64355	0.501000	0.49751	GAC	ACAN	-	NULL	ENSG00000157766		0.547	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	-	0.00	26	0	G	NM_001135		89398787	+1	tier1	-	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.008	A
ACAT2	39	genome.wustl.edu	37	6	160196340	160196340	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:160196340G>A	ENST00000367048.4	+	5	2389	c.629G>A	c.(628-630)aGa>aAa	p.R210K	ACAT2_ENST00000541436.1_Missense_Mutation_p.R239K|ACAT2_ENST00000472052.1_3'UTR	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	210					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GTGTCAACTAGAAAAGGTGAG	0.358																																																	0													97.0	87.0	91.0					6																	160196340		2203	4300	6503	SO:0001583	missense	0			AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.629G>A	6.37:g.160196340G>A	ENSP00000356015:p.Arg210Lys		B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.R239K	ENST00000367048.4	37	c.716	CCDS5268.1	6	.	.	.	.	.	.	.	.	.	.	G	16.69	3.194027	0.58017	.	.	ENSG00000120437	ENST00000367048;ENST00000541436	D;D	0.90197	-2.63;-2.63	5.65	4.73	0.59995	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.085635	0.85682	N	0.000000	T	0.74839	0.3769	N	0.25957	0.775	0.58432	D	0.99999	B;B	0.09022	0.002;0.001	B;B	0.13407	0.009;0.005	T	0.70930	-0.4738	10	0.30854	T	0.27	-9.1635	11.0465	0.47861	0.1689:0.0:0.8311:0.0	.	239;210	B7Z233;Q9BWD1	.;THIC_HUMAN	K	210;239	ENSP00000356015:R210K;ENSP00000437850:R239K	ENSP00000356015:R210K	R	+	2	0	ACAT2	160116330	1.000000	0.71417	0.988000	0.46212	0.982000	0.71751	6.059000	0.71133	1.294000	0.44707	0.563000	0.77884	AGA	ACAT2	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000120437		0.358	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT2	HGNC	protein_coding	OTTHUMT00000042912.1	-	0.00	47	0	G	NM_005891		160196340	+1	tier1	-	no_errors	ENST00000541436	ensembl	human	known	74_37	missense	11.59	61	8	SNP	1.000	A
ACPP	55	genome.wustl.edu	37	3	132086565	132086565	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:132086565G>A	ENST00000351273.7	+	11	1206	c.1156G>A	c.(1156-1158)Gct>Act	p.A386T		NM_001134194.1	NP_001127666.1	P15309	PPAP_HUMAN	acid phosphatase, prostate	0					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						GGTCATCTTTGCTGTTGCCTT	0.408																																																	0													427.0	359.0	380.0					3																	132086565		1568	3582	5150	SO:0001583	missense	0				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000351273.7:c.1156G>A	3.37:g.132086565G>A	ENSP00000323036:p.Ala386Thr		D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.A386T	ENST00000351273.7	37	c.1156	CCDS46916.1	3	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717081	0.48622	.	.	ENSG00000014257	ENST00000351273	T	0.07567	3.18	4.96	4.96	0.65561	.	0.327243	0.26217	N	0.025650	T	0.21881	0.0527	.	.	.	0.22754	N	0.998775	D	0.67145	0.996	P	0.62813	0.907	T	0.02042	-1.1224	9	0.40728	T	0.16	.	14.4466	0.67356	0.0:0.0:1.0:0.0	.	386	P15309-2	.	T	386	ENSP00000323036:A386T	ENSP00000323036:A386T	A	+	1	0	ACPP	133569255	0.902000	0.30710	0.081000	0.20488	0.025000	0.11179	4.145000	0.58065	2.699000	0.92147	0.655000	0.94253	GCT	ACPP	-	NULL	ENSG00000014257		0.408	ACPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ACPP	HGNC	protein_coding	OTTHUMT00000356701.1		0.00	44	0	G	NM_001099		132086565	+1			no_errors	ENST00000351273	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.451	A
ADAMTS15	170689	genome.wustl.edu	37	11	130318901	130318901	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:130318901C>T	ENST00000299164.2	+	1	33	c.33C>T	c.(31-33)ttC>ttT	p.F11F		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	11						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F11F(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CCCTGGCTTTCGCCGGGCGAA	0.711																																																	1	Substitution - coding silent(1)	urinary_tract(1)											17.0	17.0	17.0					11																	130318901		2200	4295	6495	SO:0001819	synonymous_variant	0			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.33C>T	11.37:g.130318901C>T			Q32MI6	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS,prints_Pept_M12B_ADAM-TS8	p.F11	ENST00000299164.2	37	c.33	CCDS8488.1	11																																																																																			ADAMTS15	-	NULL	ENSG00000166106		0.711	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS15	HGNC	protein_coding	OTTHUMT00000385638.1		0.00	20	0	C	NM_139055		130318901	+1			no_errors	ENST00000299164	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.004	T
ADCY7	113	genome.wustl.edu	37	16	50345982	50345982	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:50345982G>A	ENST00000394697.2	+	21	2824	c.2484G>A	c.(2482-2484)aaG>aaA	p.K828K	ADCY7_ENST00000254235.3_Silent_p.K828K			P51828	ADCY7_HUMAN	adenylate cyclase 7	828					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GCCTATGGAAGAAGAAGTTCA	0.552																																																	0													109.0	103.0	105.0					16																	50345982		2198	4300	6498	SO:0001819	synonymous_variant	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2484G>A	16.37:g.50345982G>A			A0AVA6	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K828	ENST00000394697.2	37	c.2484	CCDS10741.1	16																																																																																			ADCY7	-	NULL	ENSG00000121281		0.552	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	-	0.00	38	0	G			50345982	+1	tier1	-	no_errors	ENST00000254235	ensembl	human	known	74_37	silent	6.76	69	5	SNP	1.000	A
ADPGK	83440	genome.wustl.edu	37	15	73048618	73048618	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:73048618C>G	ENST00000311669.8	-	5	907	c.814G>C	c.(814-816)Gag>Cag	p.E272Q	ADPGK_ENST00000567733.1_Intron|ADPGK_ENST00000456471.2_5'Flank	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	272	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CTCTGGAGCTCCTTGCTTTGT	0.507																																																	0													91.0	83.0	86.0					15																	73048618		1868	4110	5978	SO:0001583	missense	0			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.814G>C	15.37:g.73048618C>G	ENSP00000312250:p.Glu272Gln		Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Missense_Mutation	SNP	pfam_ADP_PFK/GK	p.E272Q	ENST00000311669.8	37	c.814	CCDS42057.1	15	.	.	.	.	.	.	.	.	.	.	c	10.94	1.491519	0.26774	.	.	ENSG00000159322	ENST00000311669;ENST00000443764;ENST00000331065	T	0.46451	0.87	5.31	4.38	0.52667	.	0.095842	0.64402	D	0.000001	T	0.39332	0.1074	L	0.45698	1.435	0.80722	D	1	B;B;B	0.27498	0.021;0.052;0.18	B;B;B	0.29176	0.035;0.051;0.099	T	0.21586	-1.0241	10	0.41790	T	0.15	-17.5721	15.2588	0.73606	0.1416:0.8584:0.0:0.0	.	214;272;272	B4DG35;Q9BRR6;Q9BRR6-2	.;ADPGK_HUMAN;.	Q	272;191;150	ENSP00000312250:E272Q	ENSP00000312250:E272Q	E	-	1	0	ADPGK	70835671	1.000000	0.71417	0.952000	0.39060	0.145000	0.21501	3.902000	0.56310	1.215000	0.43411	-0.181000	0.13052	GAG	ADPGK	-	pfam_ADP_PFK/GK	ENSG00000159322		0.507	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK	HGNC	protein_coding	OTTHUMT00000420434.1	-	0.00	53	0	C	NM_031284		73048618	-1	tier1	-	no_errors	ENST00000311669	ensembl	human	known	74_37	missense	18.18	81	18	SNP	1.000	G
AHDC1	27245	genome.wustl.edu	37	1	27877849	27877849	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:27877849C>G	ENST00000247087.5	-	5	1374	c.778G>C	c.(778-780)Gag>Cag	p.E260Q	AHDC1_ENST00000374011.2_Missense_Mutation_p.E260Q			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	260	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCCTGGGCCTCTAGCAGCTGG	0.667																																																	0													24.0	28.0	27.0					1																	27877849		2186	4292	6478	SO:0001583	missense	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.778G>C	1.37:g.27877849C>G	ENSP00000247087:p.Glu260Gln		Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	NULL	p.E260Q	ENST00000247087.5	37	c.778	CCDS30652.1	1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678984	0.47886	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.55413	0.52;0.52	4.57	3.66	0.41972	.	0.000000	0.32624	U	0.005842	T	0.37571	0.1008	N	0.19112	0.55	0.30990	N	0.721561	B	0.18013	0.025	B	0.24848	0.056	T	0.43310	-0.9399	10	0.56958	D	0.05	-8.2839	10.2093	0.43131	0.0:0.9049:0.0:0.0951	.	260	Q5TGY3	AHDC1_HUMAN	Q	260	ENSP00000247087:E260Q;ENSP00000363123:E260Q	ENSP00000247087:E260Q	E	-	1	0	AHDC1	27750436	0.974000	0.33945	0.997000	0.53966	0.989000	0.77384	2.256000	0.43231	1.141000	0.42275	0.467000	0.42956	GAG	AHDC1	-	NULL	ENSG00000126705		0.667	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	-	0.00	51	0	C			27877849	-1	tier1	-	no_errors	ENST00000247087	ensembl	human	known	74_37	missense	10.26	70	8	SNP	0.996	G
AHDC1	27245	genome.wustl.edu	37	1	27878086	27878086	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:27878086C>T	ENST00000247087.5	-	5	1137	c.541G>A	c.(541-543)Gag>Aag	p.E181K	AHDC1_ENST00000374011.2_Missense_Mutation_p.E181K			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	181	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCCCGCTCCTCAGGGCTACGG	0.677																																																	0													65.0	74.0	71.0					1																	27878086		2203	4299	6502	SO:0001583	missense	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.541G>A	1.37:g.27878086C>T	ENSP00000247087:p.Glu181Lys		Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	NULL	p.E181K	ENST00000247087.5	37	c.541	CCDS30652.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945751	0.73672	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.60424	0.19;0.19	4.36	3.44	0.39384	.	.	.	.	.	T	0.40909	0.1136	N	0.19112	0.55	0.42499	D	0.992928	B	0.21606	0.058	B	0.12156	0.007	T	0.43734	-0.9373	9	0.66056	D	0.02	-10.7463	10.5564	0.45121	0.0:0.9012:0.0:0.0988	.	181	Q5TGY3	AHDC1_HUMAN	K	181	ENSP00000247087:E181K;ENSP00000363123:E181K	ENSP00000247087:E181K	E	-	1	0	AHDC1	27750673	0.994000	0.37717	0.998000	0.56505	0.720000	0.41350	3.261000	0.51530	1.966000	0.57179	0.313000	0.20887	GAG	AHDC1	-	NULL	ENSG00000126705		0.677	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3		0.00	41	0	C			27878086	-1			no_errors	ENST00000247087	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.992	T
AIMP1	9255	genome.wustl.edu	37	4	107246215	107246215	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:107246215G>C	ENST00000442366.1	+	2	101	c.49G>C	c.(49-51)Gag>Cag	p.E17Q	AIMP1_ENST00000358008.3_Missense_Mutation_p.E17Q|AIMP1_ENST00000394701.4_Missense_Mutation_p.E41Q	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1	17	Required for fibroblast proliferation.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						GAAGGGTGCAGAGGCAGATCA	0.338																																																	0													61.0	61.0	61.0					4																	107246215		2203	4300	6503	SO:0001583	missense	0			U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.49G>C	4.37:g.107246215G>C	ENSP00000405248:p.Glu17Gln		B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Missense_Mutation	SNP	pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold,superfamily_t-SNARE,pfscan_tRNA-bd_dom	p.E41Q	ENST00000442366.1	37	c.121	CCDS3674.1	4	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044654	0.75732	.	.	ENSG00000164022	ENST00000510207;ENST00000442366;ENST00000432345;ENST00000358008;ENST00000394701	T;T;T;T	0.25579	1.79;1.9;1.9;1.89	5.06	5.06	0.68205	.	0.097964	0.64402	D	0.000002	T	0.46852	0.1414	L	0.59436	1.845	0.80722	D	1	D;P	0.69078	0.997;0.584	D;B	0.75484	0.986;0.113	T	0.22730	-1.0208	10	0.20046	T	0.44	-47.7637	18.4123	0.90555	0.0:0.0:1.0:0.0	.	17;17	B4DNK3;Q12904	.;AIMP1_HUMAN	Q	17;17;17;17;41	ENSP00000423681:E17Q;ENSP00000405248:E17Q;ENSP00000350699:E17Q;ENSP00000378191:E41Q	ENSP00000350699:E17Q	E	+	1	0	AIMP1	107465664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.020000	0.93667	2.373000	0.80994	0.591000	0.81541	GAG	AIMP1	-	superfamily_t-SNARE	ENSG00000164022		0.338	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AIMP1	HGNC	protein_coding	OTTHUMT00000253961.1	-	0.00	30	0	G	NM_004757		107246215	+1	tier1	-	no_errors	ENST00000394701	ensembl	human	known	74_37	missense	19.35	24	6	SNP	1.000	C
AKAP8	10270	genome.wustl.edu	37	19	15483682	15483682	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:15483682G>A	ENST00000269701.2	-	5	901	c.841C>T	c.(841-843)Cgg>Tgg	p.R281W		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	281					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						TCCCGCATCCGAGGCTGCGAG	0.602																																					GBM(190;1671 2163 3274 27186 30476)												0													22.0	24.0	23.0					19																	15483682		2202	4300	6502	SO:0001583	missense	0			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.841C>T	19.37:g.15483682G>A	ENSP00000269701:p.Arg281Trp			Missense_Mutation	SNP	pfam_AKAP95	p.R281W	ENST00000269701.2	37	c.841	CCDS12329.1	19	.	.	.	.	.	.	.	.	.	.	g	16.28	3.077898	0.55753	.	.	ENSG00000105127	ENST00000269701;ENST00000537303	T	0.53423	0.62	4.71	3.6	0.41247	.	0.132668	0.34025	N	0.004335	T	0.62998	0.2474	M	0.62723	1.935	0.28222	N	0.926462	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.55617	-0.8113	10	0.72032	D	0.01	-25.3315	11.8999	0.52678	0.0:0.0:0.8259:0.1741	.	281;281	Q8NE02;O43823	.;AKAP8_HUMAN	W	281;30	ENSP00000269701:R281W	ENSP00000269701:R281W	R	-	1	2	AKAP8	15344682	0.989000	0.36119	0.949000	0.38748	0.351000	0.29236	2.170000	0.42443	2.610000	0.88304	0.645000	0.84053	CGG	AKAP8	-	NULL	ENSG00000105127		0.602	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8	HGNC	protein_coding	OTTHUMT00000461293.3		0.00	30	0	G	NM_005858		15483682	-1			no_errors	ENST00000269701	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.788	A
AMOT	154796	genome.wustl.edu	37	X	112058657	112058657	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:112058657G>A	ENST00000524145.1	-	3	1395	c.1321C>T	c.(1321-1323)Ctc>Ttc	p.L441F	AMOT_ENST00000371959.3_Missense_Mutation_p.L441F|AMOT_ENST00000371958.1_Missense_Mutation_p.L209F|AMOT_ENST00000371962.1_Missense_Mutation_p.L209F|AMOT_ENST00000304758.1_Missense_Mutation_p.L32F			Q4VCS5	AMOT_HUMAN	angiomotin	441					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TCGTCTGAGAGGATCTCAACC	0.522																																																	0													213.0	190.0	198.0					X																	112058657		2203	4300	6503	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1321C>T	X.37:g.112058657G>A	ENSP00000429013:p.Leu441Phe		Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.L441F	ENST00000524145.1	37	c.1321	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668489	0.88348	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.47177	1.0;0.85;0.85;0.85;0.85	5.31	5.31	0.75309	.	0.141884	0.49305	D	0.000146	T	0.71945	0.3400	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.76686	-0.2868	10	0.87932	D	0	-10.123	16.9259	0.86176	0.0:0.0:1.0:0.0	.	441	Q4VCS5	AMOT_HUMAN	F	32;441;209;441;209	ENSP00000305557:L32F;ENSP00000361027:L441F;ENSP00000361030:L209F;ENSP00000429013:L441F;ENSP00000361026:L209F	ENSP00000305557:L32F	L	-	1	0	AMOT	111945313	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.706000	0.84615	2.463000	0.83235	0.600000	0.82982	CTC	AMOT	-	superfamily_Prefoldin	ENSG00000126016		0.522	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	29	0	G	NM_133265		112058657	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	12.68	62	9	SNP	1.000	A
APLP2	334	genome.wustl.edu	37	11	130011951	130011951	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:130011951C>G	ENST00000263574.5	+	17	2244	c.2172C>G	c.(2170-2172)atC>atG	p.I724M	APLP2_ENST00000528499.1_Missense_Mutation_p.I656M|APLP2_ENST00000345598.5_Missense_Mutation_p.I483M|APLP2_ENST00000543137.1_Missense_Mutation_p.I619M|APLP2_ENST00000278756.7_Missense_Mutation_p.I722M|APLP2_ENST00000338167.5_Missense_Mutation_p.I712M|APLP2_ENST00000539648.1_Missense_Mutation_p.I512M	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	724					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		ATGGCACCATCAGCCACGGGA	0.592																																																	0													74.0	57.0	63.0					11																	130011951		2201	4297	6498	SO:0001583	missense	0			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.2172C>G	11.37:g.130011951C>G	ENSP00000263574:p.Ile724Met		B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.I724M	ENST00000263574.5	37	c.2172	CCDS8486.1	11	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156755	0.57259	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	D;D;D;D;D;D;D	0.96168	-3.93;-3.93;-3.93;-3.93;-3.93;-3.93;-3.93	5.75	3.87	0.44632	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96568	0.8880	M	0.63428	1.95	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.997;0.999;0.997;0.999;0.999;0.996;0.998	D	0.95329	0.8428	9	.	.	.	-29.7097	10.7336	0.46111	0.233:0.7012:0.0:0.0657	.	512;724;668;483;650;656;712	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	M	656;512;724;483;712;722;619	ENSP00000435914:I656M;ENSP00000443728:I512M;ENSP00000263574:I724M;ENSP00000263575:I483M;ENSP00000345444:I712M;ENSP00000278756:I722M;ENSP00000444122:I619M	.	I	+	3	3	APLP2	129517161	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.217000	0.42880	0.784000	0.33661	-0.824000	0.03097	ATC	APLP2	-	pfam_APP_amyloid_C	ENSG00000084234		0.592	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	HGNC	protein_coding	OTTHUMT00000386109.1		0.00	21	0	C	NM_001642		130011951	+1			no_errors	ENST00000263574	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160114974	160114974	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:160114974C>G	ENST00000327245.5	-	5	954	c.108G>C	c.(106-108)ggG>ggC	p.G36G	ATP10B_ENST00000518411.1_5'UTR|CTC-529G1.1_ENST00000524198.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	36					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCTCTGTCTCCCTTTCTCTG	0.542																																																	0													152.0	153.0	152.0					5																	160114974		2046	4208	6254	SO:0001819	synonymous_variant	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.108G>C	5.37:g.160114974C>G			Q9H725	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G36	ENST00000327245.5	37	c.108	CCDS43394.1	5																																																																																			ATP10B	-	NULL	ENSG00000118322		0.542	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	-	0.00	37	0	C	NM_025153		160114974	-1	tier1	-	no_errors	ENST00000327245	ensembl	human	known	74_37	silent	6.67	70	5	SNP	0.000	G
ATP6V1D	51382	genome.wustl.edu	37	14	67819642	67819642	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:67819642C>G	ENST00000216442.7	-	2	707	c.157G>C	c.(157-159)Gag>Cag	p.E53Q	ATP6V1D_ENST00000554236.1_Missense_Mutation_p.E53Q|ATP6V1D_ENST00000555474.1_Missense_Mutation_p.E53Q|ATP6V1D_ENST00000555431.1_Intron	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	53					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CATTCTACCTCTATTATCTTC	0.328																																																	0													132.0	141.0	138.0					14																	67819642		2203	4300	6503	SO:0001583	missense	0			AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.157G>C	14.37:g.67819642C>G	ENSP00000216442:p.Glu53Gln		B2RE33|Q9Y688	Missense_Mutation	SNP	pfam_V_ATPase_D,tigrfam_V_ATPase_D	p.E53Q	ENST00000216442.7	37	c.157	CCDS9780.1	14	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004540	0.54254	.	.	ENSG00000100554	ENST00000555474;ENST00000216442;ENST00000554236;ENST00000555723;ENST00000553687;ENST00000555012	.	.	.	5.8	4.88	0.63580	.	0.045452	0.85682	D	0.000000	T	0.52386	0.1731	L	0.27944	0.81	0.80722	D	1	B	0.17667	0.023	B	0.24269	0.052	T	0.48636	-0.9018	9	0.44086	T	0.13	-23.7698	16.9243	0.86172	0.0:0.8725:0.1275:0.0	.	53	Q9Y5K8	VATD_HUMAN	Q	53;53;53;5;35;53	.	ENSP00000216442:E53Q	E	-	1	0	ATP6V1D	66889395	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.740000	0.68629	2.748000	0.94277	0.655000	0.94253	GAG	ATP6V1D	-	pfam_V_ATPase_D,tigrfam_V_ATPase_D	ENSG00000100554		0.328	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1D	HGNC	protein_coding	OTTHUMT00000412511.1	-	0.00	75	0	C	NM_015994		67819642	-1	tier1	-	no_errors	ENST00000216442	ensembl	human	known	74_37	missense	12.41	127	18	SNP	1.000	G
ATR	545	genome.wustl.edu	37	3	142224118	142224118	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:142224118C>G	ENST00000350721.4	-	29	5180	c.5059G>C	c.(5059-5061)Gat>Cat	p.D1687H	ATR_ENST00000383101.3_Missense_Mutation_p.D1623H	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1687	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D1687H(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GCCACTCCATCAGGTTCATGC	0.388								Other conserved DNA damage response genes																																									1	Substitution - Missense(1)	lung(1)											180.0	181.0	181.0					3																	142224118		2203	4300	6503	SO:0001583	missense	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5059G>C	3.37:g.142224118C>G	ENSP00000343741:p.Asp1687His		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.D1687H	ENST00000350721.4	37	c.5059	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813677	0.90790	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.50813	0.73;0.73	5.54	5.54	0.83059	PIK-related kinase (1);Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81221	-0.1031	10	0.87932	D	0	-20.5386	19.4874	0.95035	0.0:1.0:0.0:0.0	.	1687	Q13535	ATR_HUMAN	H	1687;1623	ENSP00000343741:D1687H;ENSP00000372581:D1623H	ENSP00000343741:D1687H	D	-	1	0	ATR	143706808	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.586000	0.87340	0.655000	0.94253	GAT	ATR	-	pfscan_PIK_FAT	ENSG00000175054		0.388	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	-	0.00	30	0	C	NM_001184		142224118	-1	tier1	-	no_errors	ENST00000350721	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	G
B3GALT4	8705	genome.wustl.edu	37	6	33246327	33246327	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:33246327G>C	ENST00000451237.1	+	1	1411	c.1131G>C	c.(1129-1131)caG>caC	p.Q377H		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	377					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						CCTGGCTTCAGAGCTGAGAGT	0.622																																																	0													74.0	86.0	82.0					6																	33246327		2180	4286	6466	SO:0001583	missense	0			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.1131G>C	6.37:g.33246327G>C	ENSP00000390784:p.Gln377His			Missense_Mutation	SNP	pfam_Glyco_trans_31	p.Q377H	ENST00000451237.1	37	c.1131	CCDS34425.1	6	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.315022	0.01331	.	.	ENSG00000235863	ENST00000451237	T	0.42900	0.96	4.78	-2.8	0.05823	.	0.545995	0.17239	N	0.181638	T	0.03434	0.0099	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41752	-0.9491	10	0.13853	T	0.58	.	5.0583	0.14544	0.0:0.25:0.2866:0.4634	.	377	O96024	B3GT4_HUMAN	H	377	ENSP00000390784:Q377H	ENSP00000390784:Q377H	Q	+	3	2	B3GALT4	33354305	0.156000	0.22821	0.028000	0.17463	0.863000	0.49368	-0.502000	0.06390	-0.393000	0.07739	-0.148000	0.13756	CAG	B3GALT4	-	NULL	ENSG00000235863		0.622	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT4	HGNC	protein_coding	OTTHUMT00000076162.2		0.00	41	0	G			33246327	+1			no_errors	ENST00000451237	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.054	C
BARX2	8538	genome.wustl.edu	37	11	129306730	129306730	+	Missense_Mutation	SNP	C	C	G	rs143991757	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:129306730C>G	ENST00000281437.4	+	2	368	c.272C>G	c.(271-273)cCg>cGg	p.P91R	BARX2_ENST00000526127.1_5'UTR	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	91					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CCTGCCACCCCGGGAATCGCC	0.672																																																	0													70.0	74.0	73.0					11																	129306730		2201	4297	6498	SO:0001583	missense	0			AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.272C>G	11.37:g.129306730C>G	ENSP00000281437:p.Pro91Arg		O43518|Q6NT51	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.P91R	ENST00000281437.4	37	c.272	CCDS8481.1	11	.	.	.	.	.	.	.	.	.	.	C	9.960	1.222568	0.22457	.	.	ENSG00000043039	ENST00000281437	D	0.91686	-2.89	5.76	4.84	0.62591	.	0.360824	0.31636	N	0.007319	D	0.86527	0.5954	N	0.24115	0.695	0.23859	N	0.996649	B	0.06786	0.001	B	0.08055	0.003	T	0.75722	-0.3218	10	0.41790	T	0.15	.	15.5588	0.76223	0.0:0.8615:0.1385:0.0	.	91	Q9UMQ3	BARX2_HUMAN	R	91	ENSP00000281437:P91R	ENSP00000281437:P91R	P	+	2	0	BARX2	128811940	0.001000	0.12720	0.007000	0.13788	0.017000	0.09413	1.080000	0.30779	1.413000	0.46997	-0.176000	0.13171	CCG	BARX2	-	NULL	ENSG00000043039		0.672	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARX2	HGNC	protein_coding	OTTHUMT00000386153.1	-	0.00	51	0	C	NM_003658		129306730	+1	tier1	-	no_errors	ENST00000281437	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.050	G
BCAR1	9564	genome.wustl.edu	37	16	75298373	75298373	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:75298373G>C	ENST00000418647.3	-	2	309	c.26C>G	c.(25-27)tCt>tGt	p.S9C	BCAR1_ENST00000546196.1_5'UTR|BCAR1_ENST00000393422.2_Intron|BCAR1_ENST00000420641.3_Intron|BCAR1_ENST00000538440.2_Intron|BCAR1_ENST00000535626.2_Intron	NM_001170714.1	NP_001164185.1	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	0	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GAGCAGAACAGAAGAGAGGAA	0.582																																																	0													16.0	18.0	17.0					16																	75298373		692	1591	2283	SO:0001583	missense	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000418647.3:c.26C>G	16.37:g.75298373G>C	ENSP00000391669:p.Ser9Cys		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.S9C	ENST00000418647.3	37	c.26	CCDS54040.1	16	.	.	.	.	.	.	.	.	.	.	G	7.802	0.713947	0.15306	.	.	ENSG00000050820	ENST00000418647	T	0.34472	1.36	4.08	0.848	0.18966	.	.	.	.	.	T	0.16769	0.0403	N	0.08118	0	0.18873	N	0.999982	B	0.02656	0.0	B	0.01281	0.0	T	0.19943	-1.0290	9	0.72032	D	0.01	.	3.706	0.08401	0.2389:0.2088:0.5523:0.0	.	9	E9PCL5	.	C	9	ENSP00000391669:S9C	ENSP00000391669:S9C	S	-	2	0	BCAR1	73855874	0.029000	0.19370	0.007000	0.13788	0.011000	0.07611	0.715000	0.25822	0.422000	0.26005	0.561000	0.74099	TCT	BCAR1	-	NULL	ENSG00000050820		0.582	BCAR1-005	KNOWN	basic|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000434666.1	-	0.00	25	0	G	NM_014567		75298373	-1	tier1	-	no_errors	ENST00000418647	ensembl	human	known	74_37	missense	13.85	56	9	SNP	0.001	C
BEND2	139105	genome.wustl.edu	37	X	18221839	18221839	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:18221839A>C	ENST00000380033.4	-	5	821	c.689T>G	c.(688-690)tTc>tGc	p.F230C	BEND2_ENST00000380030.3_Missense_Mutation_p.F230C	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	230										NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TGGCATACCGAAACAAGGAAA	0.453																																																	0													169.0	135.0	146.0					X																	18221839		2203	4300	6503	SO:0001583	missense	0			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.689T>G	X.37:g.18221839A>C	ENSP00000369372:p.Phe230Cys		E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	pfam_BEN_domain	p.F230C	ENST00000380033.4	37	c.689	CCDS14184.1	X	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768223	0.31320	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.26223	1.78;1.75	2.69	-0.0333	0.13901	.	1.697700	0.04029	N	0.301048	T	0.29126	0.0724	N	0.19112	0.55	0.09310	N	1	D;D	0.56521	0.976;0.96	D;B	0.63381	0.914;0.429	T	0.13202	-1.0518	10	0.39692	T	0.17	0.2822	2.8761	0.05631	0.5817:0.2597:0.1586:0.0	.	230;230	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	C	230	ENSP00000369372:F230C;ENSP00000369369:F230C	ENSP00000369369:F230C	F	-	2	0	BEND2	18131760	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.146000	0.10250	-0.171000	0.10797	0.242000	0.17961	TTC	BEND2	-	NULL	ENSG00000177324		0.453	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	-	0.00	27	0	A	NM_153346		18221839	-1	tier1	-	no_errors	ENST00000380033	ensembl	human	known	74_37	missense	17.07	68	14	SNP	0.000	C
BEND3	57673	genome.wustl.edu	37	6	107391610	107391610	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:107391610G>C	ENST00000369042.1	-	4	975	c.785C>G	c.(784-786)tCa>tGa	p.S262*	BEND3_ENST00000429433.2_Nonsense_Mutation_p.S262*			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	262	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						GTCCCCCCCTGACAGGCTCTG	0.652																																																	0													23.0	23.0	23.0					6																	107391610		2200	4298	6498	SO:0001587	stop_gained	0			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.785C>G	6.37:g.107391610G>C	ENSP00000358038:p.Ser262*		A2RRH2|Q9HCL9	Nonsense_Mutation	SNP	pfam_BEN_domain	p.S262*	ENST00000369042.1	37	c.785	CCDS34507.1	6	.	.	.	.	.	.	.	.	.	.	G	40	8.164404	0.98686	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.32	5.32	0.75619	.	0.246207	0.34411	N	0.003987	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.2948	14.7543	0.69552	0.0:0.1442:0.8558:0.0	.	.	.	.	X	262	.	ENSP00000358038:S262X	S	-	2	0	BEND3	107498303	1.000000	0.71417	0.965000	0.40720	0.664000	0.39144	7.251000	0.78297	2.774000	0.95407	0.561000	0.74099	TCA	BEND3	-	NULL	ENSG00000178409		0.652	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND3	HGNC	protein_coding	OTTHUMT00000041686.1	-	0.00	47	0	G	NM_020913		107391610	-1	tier1	-	no_errors	ENST00000369042	ensembl	human	known	74_37	nonsense	10.84	74	9	SNP	0.982	C
BPGM	669	genome.wustl.edu	37	7	134346821	134346821	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:134346821C>G	ENST00000393132.2	+	3	1051	c.562C>G	c.(562-564)Cat>Gat	p.H188D	BPGM_ENST00000418040.1_Missense_Mutation_p.H188D|BPGM_ENST00000344924.3_Missense_Mutation_p.H188D	NM_199186.2	NP_954655.1	P07738	PMGE_HUMAN	2,3-bisphosphoglycerate mutase	188	2,3-bisphospho-D-glycerate binding.				carbohydrate metabolic process (GO:0005975)|erythrocyte development (GO:0048821)|glycolytic process (GO:0006096)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			breast(1)|endometrium(1)|lung(2)|stomach(1)	5						GATATCTGCTCATGGAAATAG	0.428																																																	0													74.0	72.0	73.0					7																	134346821		2203	4300	6503	SO:0001583	missense	0			BC017050	CCDS5833.1	7q33	2012-10-02			ENSG00000172331	ENSG00000172331	5.4.2.4		1093	protein-coding gene	gene with protein product		613896					Standard	NM_199186		Approved		uc003vrw.3	P07738	OTTHUMG00000155380	ENST00000393132.2:c.562C>G	7.37:g.134346821C>G	ENSP00000376840:p.His188Asp		A4D1N9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.H188D	ENST00000393132.2	37	c.562	CCDS5833.1	7	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709150	0.89018	.	.	ENSG00000172331	ENST00000344924;ENST00000418040;ENST00000393132	D;D;D	0.98684	-5.07;-5.07;-5.07	6.02	6.02	0.97574	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.99518	0.9828	H	0.99800	4.79	0.80722	D	1	P	0.43412	0.806	P	0.51055	0.657	D	0.97807	1.0248	10	0.87932	D	0	-30.6905	20.5373	0.99239	0.0:1.0:0.0:0.0	.	188	P07738	PMGE_HUMAN	D	188	ENSP00000342032:H188D;ENSP00000399838:H188D;ENSP00000376840:H188D	ENSP00000342032:H188D	H	+	1	0	BPGM	133997361	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.770000	0.85390	2.857000	0.98124	0.650000	0.86243	CAT	BPGM	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	ENSG00000172331		0.428	BPGM-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPGM	HGNC	protein_coding	OTTHUMT00000339763.1	-	0.00	38	0	C	NM_001724		134346821	+1	tier1	-	no_errors	ENST00000344924	ensembl	human	known	74_37	missense	7.25	64	5	SNP	1.000	G
BRCA2	675	genome.wustl.edu	37	13	32954186	32954186	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:32954186C>T	ENST00000380152.3	+	24	9393	c.9160C>T	c.(9160-9162)Ccc>Tcc	p.P3054S	BRCA2_ENST00000544455.1_Missense_Mutation_p.P3054S			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3054					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		GCCACGGGAGCCCCTTCACTT	0.363			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													56.0	56.0	56.0					13																	32954186		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9160C>T	13.37:g.32954186C>T	ENSP00000369497:p.Pro3054Ser		O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.P3054S	ENST00000380152.3	37	c.9160	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	C	9.443	1.088513	0.20390	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.80994	-1.44;-1.44	5.5	-0.815	0.10843	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 3 (1);	0.831124	0.11141	N	0.595229	T	0.65533	0.2700	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.48479	-0.9032	10	0.22706	T	0.39	.	7.0027	0.24820	0.0:0.2484:0.382:0.3696	.	3054	P51587	BRCA2_HUMAN	S	3054	ENSP00000369497:P3054S;ENSP00000439902:P3054S	ENSP00000369497:P3054S	P	+	1	0	BRCA2	31852186	0.000000	0.05858	0.054000	0.19295	0.966000	0.64601	0.289000	0.18957	-0.023000	0.13963	-0.143000	0.13931	CCC	BRCA2	-	pfam_BRCA2_OB_3,superfamily_NA-bd_OB-fold,pirsf_BRCA2	ENSG00000139618		0.363	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	-	0.00	69	0	C	NM_000059		32954186	+1	tier1	-	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	5.88	80	5	SNP	0.000	T
BRD1	23774	genome.wustl.edu	37	22	50217944	50217944	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:50217944G>A	ENST00000216267.8	-	1	508	c.22C>T	c.(22-24)Cat>Tat	p.H8Y	BRD1_ENST00000459821.1_5'Flank|BRD1_ENST00000404760.1_Missense_Mutation_p.H8Y|BRD1_ENST00000342989.5_5'Flank|BRD1_ENST00000457780.2_Missense_Mutation_p.H8Y|BRD1_ENST00000404034.1_Missense_Mutation_p.H8Y|BRD1_ENST00000542442.1_5'Flank	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	8					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GAGCCTCGATGACATCGTCCT	0.473																																																	0													89.0	85.0	86.0					22																	50217944		2203	4300	6503	SO:0001583	missense	0			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.22C>T	22.37:g.50217944G>A	ENSP00000216267:p.His8Tyr		A6ZJA4	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,prints_Bromodomain,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.H8Y	ENST00000216267.8	37	c.22	CCDS14080.1	22	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318853	0.60524	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780	T;T;T;T	0.15603	2.6;2.6;2.58;2.41	4.81	4.81	0.61882	.	0.099373	0.64402	D	0.000002	T	0.35624	0.0938	M	0.61703	1.905	0.53005	D	0.999968	D;P;D	0.59357	0.974;0.949;0.985	P;P;P	0.58520	0.715;0.574;0.84	T	0.03249	-1.1056	9	.	.	.	.	18.0626	0.89382	0.0:0.0:1.0:0.0	.	8;8;8	Q86X06;O95696;O95696-2	.;BRD1_HUMAN;.	Y	8	ENSP00000216267:H8Y;ENSP00000384076:H8Y;ENSP00000385858:H8Y;ENSP00000410042:H8Y	.	H	-	1	0	BRD1	48603948	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	5.918000	0.69996	2.501000	0.84356	0.462000	0.41574	CAT	BRD1	-	NULL	ENSG00000100425		0.473	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BRD1	HGNC	protein_coding	OTTHUMT00000317402.1	-	0.00	11	0	G	NM_014577		50217944	-1	tier1	-	no_errors	ENST00000216267	ensembl	human	known	74_37	missense	33.33	28	14	SNP	1.000	A
BRD9	65980	genome.wustl.edu	37	5	876276	876276	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:876276G>T	ENST00000467963.1	-	12	1489	c.1323C>A	c.(1321-1323)gaC>gaA	p.D441E	BRD9_ENST00000388890.4_Missense_Mutation_p.D325E|BRD9_ENST00000483173.1_Missense_Mutation_p.D388E|BRD9_ENST00000435709.2_3'UTR|BRD9_ENST00000494422.1_5'Flank|BRD9_ENST00000323510.4_Missense_Mutation_p.D345E	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	441					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.D441D(1)|p.D345D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CCAGGAGGTCGTCCACCACTT	0.627																																																	2	Substitution - coding silent(2)	endometrium(2)											112.0	89.0	97.0					5																	876276		2203	4300	6503	SO:0001583	missense	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1323C>A	5.37:g.876276G>T	ENSP00000419765:p.Asp441Glu		A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D441E	ENST00000467963.1	37	c.1323	CCDS34127.2	5	.	.	.	.	.	.	.	.	.	.	g	15.04	2.715230	0.48622	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000323547;ENST00000483173;ENST00000467963	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.0	-9.94	0.00449	.	0.047232	0.85682	D	0.000000	T	0.61578	0.2358	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.996	D;D;D;D;P	0.79784	0.983;0.969;0.993;0.93;0.883	D	0.83710	0.0187	10	0.46703	T	0.11	.	16.3288	0.82997	0.402:0.0:0.598:0.0	.	388;441;119;345;325	B4DMQ2;Q9H8M2;Q8NDF4;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.;.	E	345;325;119;388;441	ENSP00000323557:D345E;ENSP00000373542:D325E;ENSP00000419845:D388E;ENSP00000419765:D441E	ENSP00000323557:D345E	D	-	3	2	BRD9	929276	0.207000	0.23482	0.362000	0.25862	0.372000	0.29890	-0.519000	0.06260	-2.694000	0.00402	-1.936000	0.00505	GAC	BRD9	-	pfam_DUF3512	ENSG00000028310		0.627	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1		0.00	23	0	G	NM_023924		876276	-1			no_errors	ENST00000467963	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.804	T
BRWD3	254065	genome.wustl.edu	37	X	80001094	80001094	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:80001094C>G	ENST00000373275.4	-	7	781	c.565G>C	c.(565-567)Gac>Cac	p.D189H		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	189					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CCGCTTCGGTCAAATGCTACA	0.378																																																	0													38.0	34.0	35.0					X																	80001094		2203	4299	6502	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.565G>C	X.37:g.80001094C>G	ENSP00000362372:p.Asp189His		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D189H	ENST00000373275.4	37	c.565	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588147	0.86851	.	.	ENSG00000165288	ENST00000373275	T	0.59083	0.29	5.06	5.06	0.68205	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	N	0.12663	0.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61608	-0.7028	9	.	.	.	-11.8405	17.6227	0.88086	0.0:1.0:0.0:0.0	.	189	Q6RI45	BRWD3_HUMAN	H	189	ENSP00000362372:D189H	.	D	-	1	0	BRWD3	79887750	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.590000	0.82653	2.348000	0.79779	0.544000	0.68410	GAC	BRWD3	-	pfam_WD40_repeat,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165288		0.378	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	-	0.00	35	0	C	NM_153252		80001094	-1	tier1	-	no_errors	ENST00000373275	ensembl	human	known	74_37	missense	18.37	40	9	SNP	1.000	G
BTBD6	90135	genome.wustl.edu	37	14	105716690	105716690	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:105716690C>A	ENST00000392554.3	+	4	1436	c.1139C>A	c.(1138-1140)tCt>tAt	p.S380Y	BRF1_ENST00000379937.2_Intron|BRF1_ENST00000327359.3_Intron|BTBD6_ENST00000327471.3_Missense_Mutation_p.S305Y|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000463376.2_Missense_Mutation_p.S305Y|BRF1_ENST00000446501.2_5'Flank|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000536364.1_Missense_Mutation_p.S380Y			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	380						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		GGCTCCAGCTCTGGGAAGGCT	0.577																																																	0													65.0	50.0	55.0					14																	105716690		2203	4300	6503	SO:0001583	missense	0			AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.1139C>A	14.37:g.105716690C>A	ENSP00000376337:p.Ser380Tyr		Q8IVQ7|Q9BR94	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S380Y	ENST00000392554.3	37	c.1139	CCDS10002.2	14	.	.	.	.	.	.	.	.	.	.	C	3.378	-0.127081	0.06795	.	.	ENSG00000184887	ENST00000536364;ENST00000537513;ENST00000392554;ENST00000327471	T;T;T;T	0.75260	-0.92;-0.89;-0.92;-0.82	5.16	4.22	0.49857	PHR (1);	0.166261	0.53938	D	0.000052	T	0.61350	0.2340	L	0.37630	1.12	0.31018	N	0.718511	B	0.25272	0.122	B	0.30029	0.11	T	0.53732	-0.8397	10	0.02654	T	1	-20.3304	13.0096	0.58724	0.0:0.7477:0.2523:0.0	.	380	Q96KE9	BTBD6_HUMAN	Y	380;380;380;305	ENSP00000443091:S380Y;ENSP00000446223:S380Y;ENSP00000376337:S380Y;ENSP00000329361:S305Y	ENSP00000329361:S305Y	S	+	2	0	BTBD6	104787735	1.000000	0.71417	0.987000	0.45799	0.970000	0.65996	5.807000	0.69157	2.392000	0.81423	0.655000	0.94253	TCT	BTBD6	-	pfam_PHR	ENSG00000184887		0.577	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD6	HGNC	protein_coding	OTTHUMT00000074556.4	-	0.00	20	0	C			105716690	+1	tier1	-	no_errors	ENST00000392554	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.996	A
C17orf104	284071	genome.wustl.edu	37	17	42743838	42743838	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:42743838G>A	ENST00000409122.2	+	5	701	c.559G>A	c.(559-561)Gat>Aat	p.D187N	C17orf104_ENST00000409464.1_Missense_Mutation_p.D21N|C17orf104_ENST00000359945.3_Missense_Mutation_p.D187N	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	187										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AAGGCCAATAGATACAGTCAT	0.398																																																	0													69.0	70.0	69.0					17																	42743838		1326	2309	3635	SO:0001583	missense	0				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.559G>A	17.37:g.42743838G>A	ENSP00000386452:p.Asp187Asn		B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	NULL	p.D187N	ENST00000409122.2	37	c.559	CCDS45703.2	17	.	.	.	.	.	.	.	.	.	.	G	16.81	3.225668	0.58668	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000432494;ENST00000456912;ENST00000409464	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.93	5.93	0.95920	.	.	.	.	.	T	0.38878	0.1057	N	0.22421	0.69	0.32134	N	0.586358	D;D;D	0.56035	0.974;0.974;0.974	P;P;P	0.56343	0.796;0.796;0.796	T	0.20940	-1.0260	9	0.30854	T	0.27	-21.3029	20.3465	0.98790	0.0:0.0:1.0:0.0	.	187;187;21	A2RUB1-5;A2RUB1;A2RUB1-1	.;CQ104_HUMAN;.	N	187;187;21;21;21	ENSP00000353028:D187N;ENSP00000386452:D187N;ENSP00000399809:D21N;ENSP00000397957:D21N;ENSP00000386586:D21N	ENSP00000353028:D187N	D	+	1	0	C17orf104	40099364	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.093000	0.64517	2.798000	0.96311	0.655000	0.94253	GAT	C17orf104	-	NULL	ENSG00000180336		0.398	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf104	HGNC	protein_coding	OTTHUMT00000329171.2		0.00	23	0	G	NM_001145080		42743838	+1			no_errors	ENST00000409122	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
C17orf78	284099	genome.wustl.edu	37	17	35746184	35746184	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:35746184C>T	ENST00000300618.4	+	6	687	c.637C>T	c.(637-639)Caa>Taa	p.Q213*	RP11-378E13.3_ENST00000592238.1_RNA|ACACA_ENST00000589665.1_Intron|ACACA_ENST00000353139.5_Intron|ACACA_ENST00000416895.1_Intron|C17orf78_ENST00000586700.1_Missense_Mutation_p.S132L	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	213						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				CCTTCAGTATCAATGCCTAGG	0.488																																																	0													39.0	39.0	39.0					17																	35746184		1929	4147	6076	SO:0001587	stop_gained	0			BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.637C>T	17.37:g.35746184C>T	ENSP00000300618:p.Gln213*		Q8N8D2	Nonsense_Mutation	SNP	NULL	p.Q213*	ENST00000300618.4	37	c.637	CCDS45655.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.81|19.81	3.896325|3.896325	0.72639|0.72639	.|.	.|.	ENSG00000167230|ENSG00000167230	ENST00000300618|ENST00000321564	.|.	.|.	.|.	4.64|4.64	2.49|2.49	0.30216|0.30216	.|.	1.232610|.	0.05762|.	N|.	0.605139|.	.|T	.|0.28532	.|0.0706	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.16802	.|0.019	.|B	.|0.17433	.|0.018	.|T	.|0.15492	.|-1.0435	.|7	0.48119|0.41790	T|T	0.1|0.15	0.7909|0.7909	6.0203|6.0203	0.19625|0.19625	0.0:0.7054:0.1919:0.1028|0.0:0.7054:0.1919:0.1028	.|.	.|132	.|Q8N4C9-2	.|.	X|L	213|132	.|.	ENSP00000300618:Q213X|ENSP00000318689:S132L	Q|S	+|+	1|2	0|0	C17orf78|C17orf78	32820297|32820297	0.016000|0.016000	0.18221|0.18221	0.067000|0.067000	0.19924|0.19924	0.568000|0.568000	0.35870|0.35870	0.529000|0.529000	0.23019|0.23019	1.327000|1.327000	0.45338|0.45338	0.555000|0.555000	0.69702|0.69702	CAA|TCA	C17orf78	-	NULL	ENSG00000167230		0.488	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C17orf78	HGNC	protein_coding	OTTHUMT00000451570.2	-	0.00	34	0	C	NM_173625		35746184	+1	tier1	-	no_errors	ENST00000300618	ensembl	human	known	74_37	nonsense	21.82	43	12	SNP	0.076	T
C17orf77	146723	genome.wustl.edu	37	17	72588749	72588749	+	Silent	SNP	T	T	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:72588749T>A	ENST00000392620.1	+	3	926	c.564T>A	c.(562-564)acT>acA	p.T188T	CD300LD_ENST00000375352.1_5'Flank|C17orf77_ENST00000328023.2_Silent_p.T188T	NM_152460.2	NP_689673.2	Q96MU5	CQ077_HUMAN	chromosome 17 open reading frame 77	188						extracellular region (GO:0005576)				breast(2)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11						AGAGGAGCACTTTGGGAAGAC	0.592																																																	0													92.0	84.0	87.0					17																	72588749		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32721.1	17q25.1	2006-01-16			ENSG00000182352	ENSG00000182352			26480	protein-coding gene	gene with protein product							Standard	NM_152460		Approved	FLJ31882	uc002jla.1	Q96MU5	OTTHUMG00000067611	ENST00000392620.1:c.564T>A	17.37:g.72588749T>A				Silent	SNP	NULL	p.T188	ENST00000392620.1	37	c.564	CCDS32721.1	17																																																																																			C17orf77	-	NULL	ENSG00000182352		0.592	C17orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf77	HGNC	protein_coding	OTTHUMT00000145090.2	-	0.00	33	0	T	NM_152460		72588749	+1	tier1	-	no_errors	ENST00000328023	ensembl	human	known	74_37	silent	14.29	42	7	SNP	0.000	A
PQLC2L	152078	genome.wustl.edu	37	3	157289013	157289013	+	Missense_Mutation	SNP	C	C	G	rs192031896		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:157289013C>G	ENST00000449199.2	+	3	272	c.131C>G	c.(130-132)tCt>tGt	p.S44C	C3orf55_ENST00000426338.2_Missense_Mutation_p.S44C|C3orf55_ENST00000461040.1_Intron|C3orf55_ENST00000459838.1_Missense_Mutation_p.S44C|C3orf55_ENST00000312275.5_Missense_Mutation_p.S44C	NM_001130002.2	NP_001123474.1	A1A4F0	CC055_HUMAN		44										breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			GAAGCAGTCTCTCTGGGTTTT	0.428																																																	0													119.0	117.0	118.0					3																	157289013		1980	4170	6150	SO:0001583	missense	0																														ENST00000449199.2:c.131C>G	3.37:g.157289013C>G	ENSP00000413228:p.Ser44Cys		C9JP04|C9JXB5|Q8N6Q6	Missense_Mutation	SNP	NULL	p.S44C	ENST00000449199.2	37	c.131	CCDS46943.1	3	.	.	.	.	.	.	.	.	.	.	c	21.8	4.195240	0.78902	.	.	ENSG00000174899	ENST00000312275;ENST00000459838;ENST00000449199;ENST00000426338	T;T;T;T	0.72505	-0.66;-0.13;-0.54;0.15	3.9	3.9	0.45041	.	.	.	.	.	D	0.86682	0.5991	M	0.90595	3.13	0.09310	N	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.982	T	0.79009	-0.1978	9	0.87932	D	0	.	15.5542	0.76180	0.0:1.0:0.0:0.0	.	44;44;44	C9JXB5;A1A4F0;A1A4F0-2	.;CC055_HUMAN;.	C	44	ENSP00000312323:S44C;ENSP00000420317:S44C;ENSP00000413228:S44C;ENSP00000387918:S44C	ENSP00000312323:S44C	S	+	2	0	C3orf55	158771707	0.943000	0.32029	0.012000	0.15200	0.708000	0.40852	2.361000	0.44160	2.126000	0.65437	0.655000	0.94253	TCT	C3orf55	-	NULL	ENSG00000174899		0.428	C3orf55-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf55	HGNC	protein_coding	OTTHUMT00000352018.1	-	0.00	102	0	C			157289013	+1	tier1	-	no_errors	ENST00000449199	ensembl	human	known	74_37	missense	15.44	115	21	SNP	0.173	G
C7orf72	100130988	genome.wustl.edu	37	7	50198667	50198667	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:50198667G>T	ENST00000297001.6	+	9	1269	c.1219G>T	c.(1219-1221)Gac>Tac	p.D407Y		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	407										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						AATGGCAGTTGACCTCTTCCG	0.458																																																	0													130.0	107.0	114.0					7																	50198667		692	1591	2283	SO:0001583	missense	0				CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.1219G>T	7.37:g.50198667G>T	ENSP00000297001:p.Asp407Tyr		A6NDX9	Missense_Mutation	SNP	NULL	p.D407Y	ENST00000297001.6	37	c.1219	CCDS47585.1	7	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041271	0.35989	.	.	ENSG00000164500	ENST00000297001	.	.	.	4.85	3.03	0.35002	.	0.528772	0.18645	N	0.135176	T	0.41465	0.1160	L	0.43152	1.355	0.09310	N	1	D	0.57899	0.981	P	0.60012	0.867	T	0.13872	-1.0493	9	0.59425	D	0.04	.	4.6539	0.12608	0.1926:0.1819:0.6255:0.0	.	407	A4D263	CG072_HUMAN	Y	407	.	ENSP00000297001:D407Y	D	+	1	0	C7orf72	50169213	0.001000	0.12720	0.070000	0.20053	0.546000	0.35178	0.672000	0.25187	1.398000	0.46701	0.591000	0.81541	GAC	C7orf72	-	NULL	ENSG00000164500		0.458	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf72	HGNC	protein_coding	OTTHUMT00000342124.1	-	0.00	54	0	G	NM_001161834		50198667	+1	tier1	-	no_errors	ENST00000297001	ensembl	human	known	74_37	missense	39.39	60	39	SNP	0.038	T
C8orf34	116328	genome.wustl.edu	37	8	69434053	69434053	+	Missense_Mutation	SNP	C	C	T	rs150489120		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:69434053C>T	ENST00000539993.1	+	6	1076	c.527C>T	c.(526-528)tCt>tTt	p.S176F	C8orf34_ENST00000518698.1_Missense_Mutation_p.S262F|C8orf34_ENST00000348340.2_Missense_Mutation_p.S176F|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000337103.4_Missense_Mutation_p.S151F			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	176										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			ACATTTAATTCTTCTCTTCTG	0.403																																																	0								C	PHE/SER,PHE/SER	0,4406		0,0,2203	72.0	72.0	72.0		785,785	4.6	1.0	8	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	C8orf34	NM_001195639.1,NM_052958.2	155,155	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	262/374,262/539	69434053	1,13005	2203	4300	6503	SO:0001583	missense	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.527C>T	8.37:g.69434053C>T	ENSP00000438159:p.Ser176Phe		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.S262F	ENST00000539993.1	37	c.785		8	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044862	0.75732	0.0	1.16E-4	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.50813	0.73;0.76;0.74	5.45	4.55	0.56014	.	0.211483	0.33854	N	0.004495	T	0.59115	0.2170	L	0.51422	1.61	0.39616	D	0.969952	D;P	0.59767	0.986;0.874	P;P	0.59487	0.858;0.735	T	0.60910	-0.7169	9	.	.	.	-5.7046	16.405	0.83656	0.0:0.8682:0.1318:0.0	.	176;176	Q49A92;Q49A92-3	CH034_HUMAN;.	F	262;176;176;151	ENSP00000427820:S262F;ENSP00000438159:S176F;ENSP00000337174:S151F	.	S	+	2	0	C8orf34	69596607	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.524000	0.60552	1.369000	0.46134	0.655000	0.94253	TCT	C8orf34	-	NULL	ENSG00000165084		0.403	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		-	0.00	37	0	C	NM_052958		69434053	+1	tier1	rs150489120	no_errors	ENST00000518698	ensembl	human	known	74_37	missense	6.76	69	5	SNP	1.000	T
C9	735	genome.wustl.edu	37	5	39341298	39341298	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:39341298G>T	ENST00000263408.4	-	4	521	c.426C>A	c.(424-426)tgC>tgA	p.C142*	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	142	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CTCTGTCTCTGCAGGGGGGAC	0.463																																																	0													112.0	111.0	111.0					5																	39341298		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.426C>A	5.37:g.39341298G>T	ENSP00000263408:p.Cys142*			Nonsense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.C142*	ENST00000263408.4	37	c.426	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396638	0.42512	.	.	ENSG00000113600	ENST00000263408	.	.	.	5.32	3.55	0.40652	.	0.097701	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3615	7.0957	0.25309	0.3401:0.0:0.6599:0.0	.	.	.	.	X	142	.	ENSP00000263408:C142X	C	-	3	2	C9	39377055	1.000000	0.71417	0.940000	0.37924	0.177000	0.22998	2.987000	0.49378	0.638000	0.30545	-0.253000	0.11424	TGC	C9	-	superfamily_LDrepeatLR_classA_rpt	ENSG00000113600		0.463	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	HGNC	protein_coding	OTTHUMT00000211576.3		0.00	17	0	G			39341298	-1			no_errors	ENST00000263408	ensembl	human	known	74_37	nonsense	10.53	34	4	SNP	1.000	T
CACNA1A	773	genome.wustl.edu	37	19	13397432	13397432	+	Silent	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:13397432G>T	ENST00000360228.5	-	20	3437	c.3438C>A	c.(3436-3438)gtC>gtA	p.V1146V	CACNA1A_ENST00000573710.2_Silent_p.V1147V	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1147					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGGTTGGTGACGATAAGGC	0.662																																																	0													39.0	41.0	40.0					19																	13397432		1956	4130	6086	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3438C>A	19.37:g.13397432G>T			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.V1146	ENST00000360228.5	37	c.3438	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.662	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	-	0.00	28	0	G	NM_000068		13397432	-1	tier1	-	no_errors	ENST00000360228	ensembl	human	known	74_37	silent	15.15	28	5	SNP	1.000	T
CAND1	55832	genome.wustl.edu	37	12	67691219	67691219	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:67691219C>T	ENST00000545606.1	+	5	961	c.524C>T	c.(523-525)tCa>tTa	p.S175L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	175					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTCCATCCTTCAATTCTGACC	0.393																																																	0													123.0	126.0	125.0					12																	67691219		2203	4300	6503	SO:0001583	missense	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.524C>T	12.37:g.67691219C>T	ENSP00000442318:p.Ser175Leu		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.S175L	ENST00000545606.1	37	c.524	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263688	0.59431	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.32515	1.45	5.34	5.34	0.76211	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	L	0.46157	1.445	0.80722	D	1	P	0.43885	0.82	P	0.48704	0.587	T	0.04664	-1.0935	9	.	.	.	-9.499	19.057	0.93069	0.0:1.0:0.0:0.0	.	175	Q86VP6	CAND1_HUMAN	L	175;175;17	ENSP00000442318:S175L	.	S	+	2	0	CAND1	65977486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.594000	0.82698	2.508000	0.84585	0.655000	0.94253	TCA	CAND1	-	superfamily_ARM-type_fold	ENSG00000111530		0.393	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	-	0.00	38	0	C	NM_018448		67691219	+1	tier1	-	no_errors	ENST00000545606	ensembl	human	known	74_37	missense	5.56	85	5	SNP	1.000	T
CCDC50	152137	genome.wustl.edu	37	3	191087747	191087747	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:191087747G>C	ENST00000392455.3	+	5	968	c.370G>C	c.(370-372)Gag>Cag	p.E124Q	CCDC50_ENST00000392456.3_Missense_Mutation_p.E124Q	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50	124						cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		GTTACAGGAAGAGAAAAAGAG	0.398																																																	0													123.0	129.0	127.0					3																	191087747		2203	4300	6503	SO:0001583	missense	0			AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.370G>C	3.37:g.191087747G>C	ENSP00000376249:p.Glu124Gln		Q86VH7	Missense_Mutation	SNP	NULL	p.E124Q	ENST00000392455.3	37	c.370	CCDS33913.1	3	.	.	.	.	.	.	.	.	.	.	G	15.51	2.856242	0.51376	.	.	ENSG00000152492	ENST00000392455;ENST00000392456	T;T	0.45276	0.9;0.9	5.15	5.15	0.70609	.	0.122077	0.53938	D	0.000060	T	0.64080	0.2566	M	0.74881	2.28	0.36572	D	0.873062	D;D	0.89917	0.999;1.0	D;D	0.85130	0.951;0.997	T	0.72827	-0.4175	10	0.62326	D	0.03	.	14.1348	0.65279	0.0:0.0:1.0:0.0	.	124;124	Q8IVM0;Q8IVM0-2	CCD50_HUMAN;.	Q	124	ENSP00000376249:E124Q;ENSP00000376250:E124Q	ENSP00000376249:E124Q	E	+	1	0	CCDC50	192570441	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	5.307000	0.65762	2.409000	0.81822	0.650000	0.86243	GAG	CCDC50	-	NULL	ENSG00000152492		0.398	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC50	HGNC	protein_coding	OTTHUMT00000343315.1	-	0.00	57	0	G	NM_174908		191087747	+1	tier1	-	no_errors	ENST00000392456	ensembl	human	known	74_37	missense	5.88	96	6	SNP	1.000	C
CCDC88A	55704	genome.wustl.edu	37	2	55544775	55544775	+	Missense_Mutation	SNP	G	G	C	rs375580003		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:55544775G>C	ENST00000436346.1	-	20	4368	c.3527C>G	c.(3526-3528)tCt>tGt	p.S1176C	CCDC88A_ENST00000263630.8_Missense_Mutation_p.S1176C|CCDC88A_ENST00000413716.2_Missense_Mutation_p.S1175C|AC012358.8_ENST00000366287.4_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.S1175C|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000608103.1_RNA|AC012358.8_ENST00000599475.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1176					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						AGAGATAAGAGATTCATACTC	0.373																																																	0													69.0	74.0	72.0					2																	55544775		2203	4300	6503	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.3527C>G	2.37:g.55544775G>C	ENSP00000410608:p.Ser1176Cys		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.S1176C	ENST00000436346.1	37	c.3527		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.0|23.0	4.356404|4.356404	0.82243|0.82243	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000456975|ENST00000336838;ENST00000263630;ENST00000436346;ENST00000412148;ENST00000413716;ENST00000426576	.|T;T;T;T;T;T	.|0.47177	.|2.43;2.66;2.65;0.85;2.44;1.39	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.143791	.|0.32068	.|U	.|0.006624	T|T	0.63522|0.63522	0.2518|0.2518	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|P;D;P;D;D;D	.|0.61080	.|0.944;0.989;0.943;0.966;0.98;0.989	.|P;D;B;P;P;P	.|0.63877	.|0.662;0.919;0.376;0.662;0.846;0.891	T|T	0.61783|0.61783	-0.6992|-0.6992	5|10	.|0.59425	.|D	.|0.04	-5.5054|-5.5054	20.3172|20.3172	0.98658|0.98658	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1175;1176;1121;1176;1175;1175	.|B7ZM78;Q3V6T2-2;D6W5D1;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.|.;.;.;GRDN_HUMAN;.;.	M|C	156|1175;1176;1176;221;1175;351	.|ENSP00000338728:S1175C;ENSP00000263630:S1176C;ENSP00000410608:S1176C;ENSP00000390012:S221C;ENSP00000404431:S1175C;ENSP00000405080:S351C	.|ENSP00000263630:S1176C	I|S	-|-	3|2	3|0	CCDC88A|CCDC88A	55398279|55398279	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.746000|7.746000	0.85057|0.85057	2.801000|2.801000	0.96364|0.96364	0.650000|0.650000	0.86243|0.86243	ATC|TCT	CCDC88A	-	NULL	ENSG00000115355		0.373	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding			0.00	31	0	G	NM_017571		55544775	-1			no_errors	ENST00000436346	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	C
CCIN	881	genome.wustl.edu	37	9	36169685	36169685	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:36169685G>T	ENST00000335119.2	+	1	297	c.186G>T	c.(184-186)atG>atT	p.M62I		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	62	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GCAATGACATGAAGACCGCTG	0.537																																																	0													111.0	104.0	106.0					9																	36169685		2203	4300	6503	SO:0001583	missense	0			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.186G>T	9.37:g.36169685G>T	ENSP00000334996:p.Met62Ile		Q9BXG7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.M62I	ENST00000335119.2	37	c.186	CCDS6599.1	9	.	.	.	.	.	.	.	.	.	.	G	8.478	0.859187	0.17178	.	.	ENSG00000185972	ENST00000335119	T	0.71341	-0.56	5.69	5.69	0.88448	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.165412	0.42682	D	0.000665	T	0.70710	0.3255	M	0.80616	2.505	0.36571	D	0.873008	B	0.06786	0.001	B	0.14023	0.01	T	0.69273	-0.5188	10	0.13470	T	0.59	.	15.3016	0.73955	0.0:0.0:1.0:0.0	.	62	Q13939	CALI_HUMAN	I	62	ENSP00000334996:M62I	ENSP00000334996:M62I	M	+	3	0	CCIN	36159685	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.843000	0.48238	2.690000	0.91761	0.561000	0.74099	ATG	CCIN	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000185972		0.537	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCIN	HGNC	protein_coding	OTTHUMT00000052418.1	-	0.00	24	0	G	NM_005893		36169685	+1	tier1	-	no_errors	ENST00000335119	ensembl	human	known	74_37	missense	11.63	38	5	SNP	1.000	T
CD55	1604	genome.wustl.edu	37	1	207499005	207499005	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:207499005C>G	ENST00000367064.3	+	4	775	c.517C>G	c.(517-519)Cag>Gag	p.Q173E	CD55_ENST00000391921.4_Missense_Mutation_p.Q109E|CD55_ENST00000367065.5_Missense_Mutation_p.Q173E|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000391920.4_Missense_Mutation_p.Q173E|CD55_ENST00000367067.4_3'UTR|CD55_ENST00000367063.2_Missense_Mutation_p.Q173E|CD55_ENST00000314754.8_Missense_Mutation_p.Q173E|CD55_ENST00000367062.4_Missense_Mutation_p.Q173E	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	173	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	ACGAAATGGTCAGATTGATGT	0.358																																																	0													177.0	171.0	173.0					1																	207499005		2203	4300	6503	SO:0001583	missense	0			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.517C>G	1.37:g.207499005C>G	ENSP00000356031:p.Gln173Glu		B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q173E	ENST00000367064.3	37	c.517	CCDS31006.1	1	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307095	0.23821	.	.	ENSG00000196352	ENST00000367064;ENST00000367063;ENST00000391921;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	T;T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.5	-0.281	0.12882	Complement control module (2);Sushi/SCR/CCP (3);	0.743124	0.12837	N	0.435119	T	0.42381	0.1200	L	0.35723	1.085	0.19300	N	0.999973	P;P;B;P;B	0.49961	0.93;0.704;0.297;0.828;0.42	B;B;B;B;B	0.40825	0.301;0.169;0.12;0.341;0.119	T	0.32079	-0.9920	10	0.18276	T	0.48	.	3.9676	0.09439	0.3865:0.4059:0.1291:0.0785	.	109;173;173;173;173	B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.;.;.;DAF_HUMAN;.	E	173;173;109;109;173;173;173;173	ENSP00000356031:Q173E;ENSP00000356030:Q173E;ENSP00000375788:Q109E;ENSP00000316333:Q173E;ENSP00000356032:Q173E;ENSP00000375787:Q173E;ENSP00000356029:Q173E	ENSP00000316333:Q173E	Q	+	1	0	CD55	205565628	0.000000	0.05858	0.016000	0.15963	0.031000	0.12232	-1.745000	0.01831	-0.021000	0.14009	0.555000	0.69702	CAG	CD55	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000196352		0.358	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD55	HGNC	protein_coding	OTTHUMT00000088208.2	-	0.00	48	0	C	NM_000574		207499005	+1	tier1	-	no_errors	ENST00000314754	ensembl	human	known	74_37	missense	7.69	96	8	SNP	0.043	G
CDC37L1	55664	genome.wustl.edu	37	9	4697838	4697838	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:4697838G>C	ENST00000381854.3	+	5	908	c.706G>C	c.(706-708)Gat>Cat	p.D236H	CDC37L1_ENST00000381858.1_Missense_Mutation_p.D236H	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	236	Self-association and interaction with Hsp90.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		CTGTAATGTGGATCCAAGAGG	0.353																																																	0													95.0	99.0	98.0					9																	4697838		2203	4300	6503	SO:0001583	missense	0			AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.706G>C	9.37:g.4697838G>C	ENSP00000371278:p.Asp236His		B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	pfam_Cdc37_Hsp90-bd	p.D236H	ENST00000381854.3	37	c.706	CCDS6454.1	9	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561323	0.86335	.	.	ENSG00000106993	ENST00000381858;ENST00000381854	T;T	0.50813	0.73;0.73	5.31	5.31	0.75309	Cdc37, Hsp90 binding (1);	0.000000	0.85682	D	0.000000	T	0.73156	0.3551	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74266	-0.3721	10	0.42905	T	0.14	-16.1596	19.3311	0.94288	0.0:0.0:1.0:0.0	.	236	Q7L3B6	CD37L_HUMAN	H	236	ENSP00000371282:D236H;ENSP00000371278:D236H	ENSP00000371278:D236H	D	+	1	0	CDC37L1	4687838	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.348000	0.97062	2.642000	0.89623	0.655000	0.94253	GAT	CDC37L1	-	pfam_Cdc37_Hsp90-bd	ENSG00000106993		0.353	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37L1	HGNC	protein_coding	OTTHUMT00000051564.1	-	0.00	70	0	G	NM_017913		4697838	+1	tier1	-	no_errors	ENST00000381854	ensembl	human	known	74_37	missense	12.75	88	13	SNP	1.000	C
CDH18	1016	genome.wustl.edu	37	5	19473394	19473394	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:19473394G>T	ENST00000507958.1	-	15	3304	c.2314C>A	c.(2314-2316)Ccc>Acc	p.P772T	CDH18_ENST00000382275.1_Missense_Mutation_p.P772T|CDH18_ENST00000274170.4_Missense_Mutation_p.P772T|CDH18_ENST00000510297.1_5'UTR			Q13634	CAD18_HUMAN	cadherin 18, type 2	772					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTAAACTCGGGTCCCCAGTCT	0.458																																																	0													83.0	87.0	86.0					5																	19473394		2203	4300	6503	SO:0001583	missense	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.2314C>A	5.37:g.19473394G>T	ENSP00000425093:p.Pro772Thr		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P772T	ENST00000507958.1	37	c.2314	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353609	0.82243	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	D;D;D	0.83837	-1.77;-1.77;-1.77	5.21	5.21	0.72293	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.92492	0.7616	M	0.89214	3.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.93288	0.6666	9	.	.	.	.	17.6979	0.88286	0.0:0.0:1.0:0.0	.	772	Q13634	CAD18_HUMAN	T	772	ENSP00000371710:P772T;ENSP00000425093:P772T;ENSP00000274170:P772T	.	P	-	1	0	CDH18	19509151	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	9.807000	0.99171	2.600000	0.87896	0.655000	0.94253	CCC	CDH18	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000145526		0.458	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	-	0.00	50	0	G	NM_004934		19473394	-1	tier1	-	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	26.58	58	21	SNP	1.000	T
C10orf105	414152	genome.wustl.edu	37	10	73499506	73499506	+	5'Flank	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:73499506G>C	ENST00000398786.2	-	0	0				CDH23_ENST00000224721.6_Missense_Mutation_p.E1494Q	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											GGACAGAGAAGAGCTGGATCA	0.592																																																	0													33.0	36.0	35.0					10																	73499506		1943	4128	6071	SO:0001631	upstream_gene_variant	0			AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427		10.37:g.73499506G>C	Exception_encountered			Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E1494Q	ENST00000398786.2	37	c.4480	CCDS44430.1	10	.	.	.	.	.	.	.	.	.	.	G	13.10	2.136398	0.37728	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398792	.	.	.	5.67	3.8	0.43715	Cadherin (4);Cadherin-like (1);	0.627868	0.16125	N	0.228444	T	0.46151	0.1378	L	0.31752	0.955	0.80722	D	1	B;B	0.33318	0.06;0.408	B;B	0.39771	0.048;0.309	T	0.19095	-1.0316	9	0.13853	T	0.58	.	10.2273	0.43233	0.0752:0.3243:0.6004:0.0	.	309;1489	E7ERT0;Q9H251	.;CAD23_HUMAN	Q	1494;1489;1492;309	.	ENSP00000224721:E1494Q	E	+	1	0	CDH23	73169512	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.296000	0.43584	1.388000	0.46506	0.655000	0.94253	GAG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.592	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000048551.2	-	0.00	44	0	G	NM_001164375		73499506	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	14.29	54	9	SNP	0.990	C
CDK10	8558	genome.wustl.edu	37	16	89755673	89755673	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:89755673G>A	ENST00000353379.7	+	2	144	c.101G>A	c.(100-102)cGg>cAg	p.R34Q	CDK10_ENST00000505473.1_5'UTR|CDK10_ENST00000514965.1_3'UTR|CDK10_ENST00000331006.8_Intron|RP11-368I7.4_ENST00000567544.1_5'Flank	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	34					negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		GGACGATGCCGGAGTGTGAAG	0.527																																																	0													185.0	138.0	154.0					16																	89755673		2198	4300	6498	SO:0001583	missense	0			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.101G>A	16.37:g.89755673G>A	ENSP00000338673:p.Arg34Gln		A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R34Q	ENST00000353379.7	37	c.101	CCDS10984.2	16	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207232	0.39003	.	.	ENSG00000185324	ENST00000393082;ENST00000353379	T	0.44083	0.93	4.77	4.77	0.60923	Protein kinase-like domain (1);	0.053953	0.64402	D	0.000001	T	0.50017	0.1591	N	0.19112	0.55	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.999	D;D;P	0.67725	0.953;0.935;0.904	T	0.58284	-0.7663	10	0.87932	D	0	-24.3639	17.8045	0.88598	0.0:0.0:1.0:0.0	.	34;34;34	B7Z319;Q15131;B3KQJ3	.;CDK10_HUMAN;.	Q	5;34	ENSP00000338673:R34Q	ENSP00000338673:R34Q	R	+	2	0	CDK10	88283174	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	8.677000	0.91203	2.202000	0.70862	0.561000	0.74099	CGG	CDK10	-	superfamily_Kinase-like_dom	ENSG00000185324		0.527	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	HGNC	protein_coding	OTTHUMT00000269925.2	-	0.00	63	0	G			89755673	+1	tier1	-	no_errors	ENST00000353379	ensembl	human	known	74_37	missense	5.93	111	7	SNP	1.000	A
CDKN1A	1026	genome.wustl.edu	37	6	36652282	36652282	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:36652282G>C	ENST00000405375.1	+	2	639	c.404G>C	c.(403-405)gGa>gCa	p.G135A	CDKN1A_ENST00000448526.2_Missense_Mutation_p.G169A|CDKN1A_ENST00000244741.5_Missense_Mutation_p.G135A|CDKN1A_ENST00000373711.2_Missense_Mutation_p.G135A	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	135					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						GGTGGACCTGGAGACTCTCAG	0.587																																																	0													52.0	55.0	54.0					6																	36652282		2203	4300	6503	SO:0001583	missense	0			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.404G>C	6.37:g.36652282G>C	ENSP00000384849:p.Gly135Ala		Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	pfam_CDI	p.G169A	ENST00000405375.1	37	c.506	CCDS4824.1	6	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343773	0.24339	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.08	4.18	0.49190	.	0.512099	0.18261	N	0.146619	T	0.32971	0.0847	L	0.46157	1.445	0.18873	N	0.999987	P;P;P	0.48834	0.916;0.673;0.793	B;B;B	0.41202	0.35;0.268;0.35	T	0.20773	-1.0265	10	0.10377	T	0.69	-14.0636	10.8778	0.46921	0.0:0.0:0.8134:0.1866	.	169;135;135	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	A	169;135;135;135	ENSP00000409259:G169A;ENSP00000244741:G135A;ENSP00000384849:G135A;ENSP00000362815:G135A	ENSP00000244741:G135A	G	+	2	0	CDKN1A	36760260	0.270000	0.24152	0.042000	0.18584	0.323000	0.28346	3.387000	0.52501	2.644000	0.89710	0.561000	0.74099	GGA	CDKN1A	-	NULL	ENSG00000124762		0.587	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1A	HGNC	protein_coding	OTTHUMT00000040354.1		0.00	26	0	G	NM_078467		36652282	+1			no_errors	ENST00000448526	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.197	C
CEP290	80184	genome.wustl.edu	37	12	88481593	88481593	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:88481593G>C	ENST00000552810.1	-	32	4501	c.4158C>G	c.(4156-4158)atC>atG	p.I1386M	CEP290_ENST00000547691.2_Missense_Mutation_p.I446M|CEP290_ENST00000397838.3_Missense_Mutation_p.I446M|CEP290_ENST00000309041.7_Missense_Mutation_p.I1388M	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1386					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CAAGACTGCTGATTGTACGTT	0.244																																																	0													36.0	33.0	34.0					12																	88481593		1542	3498	5040	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4158C>G	12.37:g.88481593G>C	ENSP00000448012:p.Ile1386Met		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.I1388M	ENST00000552810.1	37	c.4164	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	G	15.52	2.859036	0.51376	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.71461	0.01;-0.57;-0.57;0.01	5.48	2.64	0.31445	.	0.046212	0.85682	D	0.000000	T	0.79793	0.4507	M	0.70275	2.135	0.46654	D	0.999144	D	0.89917	1.0	D	0.91635	0.999	T	0.77469	-0.2576	10	0.48119	T	0.1	.	8.4058	0.32614	0.1346:0.0:0.74:0.1254	.	1386	O15078	CE290_HUMAN	M	446;1386;1388;446	ENSP00000446905:I446M;ENSP00000448012:I1386M;ENSP00000308021:I1388M;ENSP00000380938:I446M	ENSP00000308021:I1388M	I	-	3	3	CEP290	87005724	1.000000	0.71417	0.998000	0.56505	0.633000	0.38033	1.454000	0.35178	0.695000	0.31675	-0.140000	0.14226	ATC	CEP290	-	NULL	ENSG00000198707		0.244	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	-	0.00	48	0	G	NM_025114		88481593	-1	tier1	-	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	C
CFHR2	3080	genome.wustl.edu	37	1	196876605	196876605	+	Intron	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:196876605G>T	ENST00000367421.3	+	2	135				CFHR4_ENST00000367416.2_Missense_Mutation_p.W258L|CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367418.2_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						AATGGAGACTGGTCAGAACCA	0.353																																																	0																																										SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-41980G>T	1.37:g.196876605G>T			Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.W258L	ENST00000367421.3	37	c.773		1	.	.	.	.	.	.	.	.	.	.	.	14.05	2.418265	0.42918	.	.	ENSG00000134365	ENST00000367416	D	0.91011	-2.77	3.49	3.49	0.39957	.	.	.	.	.	D	0.97129	0.9062	H	0.99940	5	0.22081	N	0.999375	D;D	0.64830	0.987;0.994	P;P	0.56823	0.514;0.807	D	0.91079	0.4898	9	0.87932	D	0	.	10.8049	0.46512	0.0:0.0:1.0:0.0	.	258;259	C9J7J7;Q5DVJ7	.;.	L	258	ENSP00000356386:W258L	ENSP00000356386:W258L	W	+	2	0	CFHR4	195143228	1.000000	0.71417	0.890000	0.34922	0.029000	0.11900	2.434000	0.44802	1.684000	0.51022	0.404000	0.27445	TGG	CFHR4	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000134365		0.353	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding			0.00	22	0	G	NM_005666		196876605	+1			no_errors	ENST00000367416	ensembl	human	known	74_37	missense	10.00	45	5	SNP	0.984	T
CHAF1B	8208	genome.wustl.edu	37	21	37775142	37775142	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr21:37775142C>T	ENST00000314103.5	+	8	901	c.750C>T	c.(748-750)ctC>ctT	p.L250L		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	250					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						CTTTGCTTCTCACGCCAGGTG	0.502																																																	0													185.0	166.0	173.0					21																	37775142		2203	4300	6503	SO:0001819	synonymous_variant	0			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.750C>T	21.37:g.37775142C>T			Q99548	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	p.L250	ENST00000314103.5	37	c.750	CCDS13644.1	21																																																																																			CHAF1B	-	superfamily_WD40_repeat_dom	ENSG00000159259		0.502	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	HGNC	protein_coding	OTTHUMT00000194616.2	-	0.00	53	0	C	NM_005441		37775142	+1	tier1	-	no_errors	ENST00000314103	ensembl	human	known	74_37	silent	10.84	74	9	SNP	0.978	T
CHGB	1114	genome.wustl.edu	37	20	5904375	5904375	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:5904375C>G	ENST00000378961.4	+	4	1789	c.1585C>G	c.(1585-1587)Ctc>Gtc	p.L529V		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	529						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						CTACGACCCTCTCCAGTGGAA	0.438																																																	0													67.0	68.0	68.0					20																	5904375		2203	4300	6503	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1585C>G	20.37:g.5904375C>G	ENSP00000368244:p.Leu529Val		A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.L529V	ENST00000378961.4	37	c.1585	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540539	0.27563	.	.	ENSG00000089199	ENST00000378961	T	0.01613	4.73	5.93	-0.852	0.10713	.	0.664367	0.14482	N	0.316886	T	0.01627	0.0052	L	0.43923	1.385	0.09310	N	1	B	0.30068	0.267	B	0.30495	0.116	T	0.44817	-0.9303	10	0.41790	T	0.15	0.4249	1.7706	0.03011	0.1227:0.4192:0.2052:0.2529	.	529	P05060	SCG1_HUMAN	V	529	ENSP00000368244:L529V	ENSP00000368244:L529V	L	+	1	0	CHGB	5852375	0.000000	0.05858	0.015000	0.15790	0.990000	0.78478	-0.391000	0.07323	-0.387000	0.07809	-0.176000	0.13171	CTC	CHGB	-	pfam_Granin	ENSG00000089199		0.438	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	-	0.00	14	0	C	NM_001819		5904375	+1	tier1	-	no_errors	ENST00000378961	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.000	G
CHML	1122	genome.wustl.edu	37	1	241798714	241798714	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:241798714G>C	ENST00000366553.1	-	1	518	c.355C>G	c.(355-357)Ctg>Gtg	p.L119V	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	119					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TTTTTCTGCAGAGCACCAATC	0.428																																																	0													149.0	154.0	152.0					1																	241798714		2203	4298	6501	SO:0001583	missense	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.355C>G	1.37:g.241798714G>C	ENSP00000355511:p.Leu119Val		B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.L119V	ENST00000366553.1	37	c.355	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	G	3.574	-0.087075	0.07097	.	.	ENSG00000203668	ENST00000366553	T	0.60424	0.19	4.53	-0.268	0.12934	.	0.290828	0.27754	U	0.017985	T	0.33352	0.0860	.	.	.	0.21386	N	0.999709	B	0.10296	0.003	B	0.15870	0.014	T	0.08868	-1.0701	9	0.23302	T	0.38	-0.8071	3.8675	0.09022	0.3923:0.1795:0.4282:0.0	.	119	P26374	RAE2_HUMAN	V	119	ENSP00000355511:L119V	ENSP00000355511:L119V	L	-	1	2	CHML	239865337	0.697000	0.27767	0.042000	0.18584	0.857000	0.48899	-0.194000	0.09559	-0.127000	0.11661	0.650000	0.86243	CTG	CHML	-	pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort	ENSG00000203668		0.428	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	-	0.00	19	0	G	NM_001821		241798714	-1	tier1	-	no_errors	ENST00000366553	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.093	C
CHST12	55501	genome.wustl.edu	37	7	2472467	2472467	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:2472467G>A	ENST00000258711.6	+	2	328	c.193G>A	c.(193-195)Gat>Aat	p.D65N		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	65					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		GGCCGACTCCGATGTCGACGA	0.662																																																	0													43.0	50.0	48.0					7																	2472467		2203	4300	6503	SO:0001583	missense	0			AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.193G>A	7.37:g.2472467G>A	ENSP00000258711:p.Asp65Asn		A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.D65N	ENST00000258711.6	37	c.193	CCDS5333.1	7	.	.	.	.	.	.	.	.	.	.	G	7.763	0.705783	0.15172	.	.	ENSG00000136213	ENST00000258711;ENST00000432336	T;T	0.63744	-0.06;0.69	4.94	2.08	0.27032	.	0.723385	0.13637	N	0.373258	T	0.46034	0.1372	M	0.62723	1.935	0.09310	N	1	P	0.48640	0.913	B	0.25614	0.062	T	0.30966	-0.9960	10	0.19590	T	0.45	-9.985	9.0809	0.36552	0.2439:0.0:0.7561:0.0	.	65	Q9NRB3	CHSTC_HUMAN	N	65	ENSP00000258711:D65N;ENSP00000411207:D65N	ENSP00000258711:D65N	D	+	1	0	CHST12	2438993	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.781000	0.26774	0.130000	0.18549	0.555000	0.69702	GAT	CHST12	-	NULL	ENSG00000136213		0.662	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST12	HGNC	protein_coding	OTTHUMT00000060170.3	-	0.00	65	0	G	NM_018641		2472467	+1	tier1	-	no_errors	ENST00000258711	ensembl	human	known	74_37	missense	8.45	130	12	SNP	0.001	A
CLPTM1	1209	genome.wustl.edu	37	19	45476365	45476365	+	Silent	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:45476365C>A	ENST00000337392.5	+	3	357	c.207C>A	c.(205-207)atC>atA	p.I69I	CLPTM1_ENST00000546079.1_5'UTR|CLPTM1_ENST00000541297.2_Silent_p.I55I	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	69					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TCTGGGCCATCAGCAGTTGGT	0.622																																																	0													61.0	66.0	64.0					19																	45476365		2203	4300	6503	SO:0001819	synonymous_variant	0			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.207C>A	19.37:g.45476365C>A			B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	pfam_CLPTM1	p.I69	ENST00000337392.5	37	c.207	CCDS12651.1	19																																																																																			CLPTM1	-	pfam_CLPTM1	ENSG00000104853		0.622	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	HGNC	protein_coding	OTTHUMT00000453267.1	-	0.00	36	0	C	NM_001294		45476365	+1	tier1	-	no_errors	ENST00000337392	ensembl	human	known	74_37	silent	19.61	41	10	SNP	1.000	A
CLTCL1	8218	genome.wustl.edu	37	22	19241719	19241719	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:19241719C>G	ENST00000263200.10	-	3	354	c.282G>C	c.(280-282)gaG>gaC	p.E94D	CLTCL1_ENST00000427926.1_Missense_Mutation_p.E94D|CLTCL1_ENST00000353891.5_Missense_Mutation_p.E94D	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	94	Globular terminal domain.|WD40-like repeat 2.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TACTCTTCATCTCAATATTAA	0.363			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													67.0	64.0	65.0					22																	19241719		1847	4107	5954	SO:0001583	missense	0				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.282G>C	22.37:g.19241719C>G	ENSP00000445677:p.Glu94Asp		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.E94D	ENST00000263200.10	37	c.282	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129419	0.37630	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926;ENST00000449918	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	3.9	1.71	0.24356	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.077823	0.50627	N	0.000116	T	0.52500	0.1738	L	0.48642	1.525	0.52099	D	0.999946	B;D	0.62365	0.058;0.991	B;D	0.80764	0.166;0.994	T	0.45498	-0.9257	10	0.27082	T	0.32	-8.6801	5.3904	0.16242	0.0:0.6507:0.1675:0.1818	.	94;94	P53675-2;P53675	.;CLH2_HUMAN	D	94;94;94;115	ENSP00000439662:E94D;ENSP00000445677:E94D;ENSP00000441158:E94D;ENSP00000443264:E115D	ENSP00000445677:E94D	E	-	3	2	CLTCL1	17621719	1.000000	0.71417	0.937000	0.37676	0.997000	0.91878	1.228000	0.32588	0.280000	0.22209	0.563000	0.77884	GAG	CLTCL1	-	superfamily_Clathrin_H-chain_propeller_N,pirsf_Clathrin_heavy_chain	ENSG00000070371		0.363	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	-	0.00	39	0	C	NM_007098		19241719	-1	tier1	-	no_errors	ENST00000263200	ensembl	human	known	74_37	missense	15.49	60	11	SNP	1.000	G
COBLL1	22837	genome.wustl.edu	37	2	165561596	165561596	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:165561596C>G	ENST00000392717.2	-	8	1134	c.1130G>C	c.(1129-1131)aGa>aCa	p.R377T	COBLL1_ENST00000491126.2_5'UTR|COBLL1_ENST00000194871.6_Missense_Mutation_p.R405T|COBLL1_ENST00000409184.3_Missense_Mutation_p.R377T|COBLL1_ENST00000342193.4_Missense_Mutation_p.R339T|COBLL1_ENST00000375458.2_Missense_Mutation_p.R339T			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	377						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TGCCCTCACTCTTCCTGCTTC	0.443																																																	0													78.0	73.0	75.0					2																	165561596		2203	4300	6503	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1130G>C	2.37:g.165561596C>G	ENSP00000376478:p.Arg377Thr		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfscan_WH2_dom	p.R405T	ENST00000392717.2	37	c.1214		2	.	.	.	.	.	.	.	.	.	.	C	1.984	-0.433464	0.04669	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.31	0.108	0.14548	Cordon-bleu domain (1);	1.083790	0.06915	N	0.808399	T	0.33411	0.0862	L	0.36672	1.1	0.09310	N	1	P;P;P	0.36282	0.546;0.546;0.491	B;B;B	0.39027	0.288;0.288;0.19	T	0.24083	-1.0170	9	0.12766	T	0.61	0.0163	9.9821	0.41819	0.3863:0.5442:0.0695:0.0	.	377;405;377	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	T	339;339;377;377;405	.	ENSP00000194871:R405T	R	-	2	0	COBLL1	165269842	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.987000	0.29603	-0.136000	0.11475	-1.216000	0.01612	AGA	COBLL1	-	pfam_Cordon-bleu_ubiquitin_domain	ENSG00000082438		0.443	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		-	0.00	24	0	C	NM_014900		165561596	-1	tier1	-	no_errors	ENST00000194871	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.001	G
COL4A4	1286	genome.wustl.edu	37	2	227896937	227896937	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:227896937C>G	ENST00000396625.3	-	39	3840	c.3633G>C	c.(3631-3633)gaG>gaC	p.E1211D	COL4A4_ENST00000329662.7_Missense_Mutation_p.E1211D	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1211	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GGTCTCCTCTCTCCCCTTTTA	0.517																																																	0													48.0	50.0	50.0					2																	227896937		1847	4093	5940	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3633G>C	2.37:g.227896937C>G	ENSP00000379866:p.Glu1211Asp		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.E1211D	ENST00000396625.3	37	c.3633	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852859	0.32699	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.94232	-3.38;-3.24	5.41	3.58	0.41010	.	.	.	.	.	D	0.85788	0.5778	N	0.25647	0.755	0.32745	N	0.507187	B	0.12630	0.006	B	0.15484	0.013	T	0.80466	-0.1370	9	0.20046	T	0.44	.	6.1813	0.20472	0.1854:0.7209:0.0:0.0936	.	1211	P53420	CO4A4_HUMAN	D	1211	ENSP00000379866:E1211D;ENSP00000328553:E1211D	ENSP00000328553:E1211D	E	-	3	2	COL4A4	227605181	0.064000	0.20934	0.780000	0.31762	0.963000	0.63663	0.232000	0.17891	1.267000	0.44247	0.650000	0.86243	GAG	COL4A4	-	pfam_Collagen	ENSG00000081052		0.517	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1		0.00	22	0	C	NM_000092		227896937	-1			no_errors	ENST00000396625	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.734	G
COL4A6	1288	genome.wustl.edu	37	X	107400267	107400267	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:107400267C>T	ENST00000372216.4	-	45	5139	c.5039G>A	c.(5038-5040)cGa>cAa	p.R1680Q	COL4A6_ENST00000545689.1_Missense_Mutation_p.R1655Q|COL4A6_ENST00000334504.7_Missense_Mutation_p.R1679Q|COL4A6_ENST00000394872.2_Missense_Mutation_p.R1680Q|COL4A6_ENST00000418180.1_Missense_Mutation_p.R214Q|COL4A6_ENST00000538570.1_Missense_Mutation_p.R1622Q	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1680	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GCGACTGACTCGAGTGTGGAG	0.572									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0													80.0	76.0	78.0					X																	107400267		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.5039G>A	X.37:g.107400267C>T	ENSP00000361290:p.Arg1680Gln		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.R1680Q	ENST00000372216.4	37	c.5039	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945584	0.53079	.	.	ENSG00000197565	ENST00000418180;ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	4.99	4.99	0.66335	C-type lectin fold (1);	0.000000	0.34853	N	0.003630	D	0.92708	0.7682	M	0.83774	2.66	0.37392	D	0.912485	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.75020	0.975;0.953;0.975;0.985;0.975	D	0.94492	0.7702	10	0.54805	T	0.06	.	18.0603	0.89374	0.0:1.0:0.0:0.0	.	1655;214;1622;1680;1679	F5H851;B4DZ39;F5H3Q5;Q14031;Q14031-2	.;.;.;CO4A6_HUMAN;.	Q	214;1680;1679;1680;1667;1655;1622	ENSP00000406002:R214Q;ENSP00000361290:R1680Q;ENSP00000334733:R1679Q;ENSP00000378340:R1680Q;ENSP00000443707:R1655Q;ENSP00000445236:R1622Q	ENSP00000334733:R1679Q	R	-	2	0	COL4A6	107286923	0.990000	0.36364	0.989000	0.46669	0.632000	0.37999	3.233000	0.51311	2.396000	0.81511	0.513000	0.50165	CGA	COL4A6	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	ENSG00000197565		0.572	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	-	0.00	19	0	C			107400267	-1	tier1	-	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.967	T
COPA	1314	genome.wustl.edu	37	1	160268910	160268910	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:160268910G>C	ENST00000241704.7	-	18	2041	c.1812C>G	c.(1810-1812)atC>atG	p.I604M	COPA_ENST00000368069.3_Missense_Mutation_p.I613M	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	604					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATTTTCTGTTGATCAGGGCCA	0.438																																																	0													128.0	127.0	127.0					1																	160268910		2203	4300	6503	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1812C>G	1.37:g.160268910G>C	ENSP00000241704:p.Ile604Met		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I613M	ENST00000241704.7	37	c.1839	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320173	0.41096	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.61040	0.19;0.14	4.98	4.06	0.47325	Coatomer, WD associated region (1);	0.107166	0.64402	D	0.000004	T	0.57946	0.2088	M	0.81802	2.56	0.50171	D	0.999853	B;P	0.39748	0.374;0.686	P;P	0.51355	0.467;0.667	T	0.64820	-0.6317	10	0.66056	D	0.02	-10.2436	7.3267	0.26560	0.0848:0.0:0.7452:0.17	.	604;613	P53621;P53621-2	COPA_HUMAN;.	M	613;604	ENSP00000357048:I613M;ENSP00000241704:I604M	ENSP00000241704:I604M	I	-	3	3	COPA	158535534	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.366000	0.59492	1.309000	0.44985	-0.291000	0.09656	ATC	COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.438	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	-	0.00	45	0	G	NM_004371		160268910	-1	tier1	-	no_errors	ENST00000368069	ensembl	human	known	74_37	missense	5.62	84	5	SNP	1.000	C
COPA	1314	genome.wustl.edu	37	1	160276271	160276271	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:160276271T>A	ENST00000241704.7	-	15	1544	c.1315A>T	c.(1315-1317)Aat>Tat	p.N439Y	COPA_ENST00000368069.3_Missense_Mutation_p.N439Y	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	439					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTCTTCAGATTCTTGATCAGA	0.413																																																	0													162.0	150.0	154.0					1																	160276271		2203	4300	6503	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1315A>T	1.37:g.160276271T>A	ENSP00000241704:p.Asn439Tyr		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N439Y	ENST00000241704.7	37	c.1315	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211884	0.79240	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.66460	-0.16;-0.21	5.79	4.66	0.58398	Coatomer, WD associated region (1);	0.082406	0.85682	D	0.000000	T	0.78400	0.4277	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.978	T	0.82481	-0.0436	10	0.87932	D	0	-23.2771	10.6614	0.45704	0.0:0.0754:0.0:0.9246	.	439;439	P53621;P53621-2	COPA_HUMAN;.	Y	439	ENSP00000357048:N439Y;ENSP00000241704:N439Y	ENSP00000241704:N439Y	N	-	1	0	COPA	158542895	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.954000	0.87848	1.009000	0.39289	0.533000	0.62120	AAT	COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.413	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	28	0	T	NM_004371		160276271	-1			no_errors	ENST00000368069	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	A
CRCP	27297	genome.wustl.edu	37	7	65617257	65617257	+	Silent	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:65617257C>A	ENST00000395326.3	+	6	718	c.360C>A	c.(358-360)gtC>gtA	p.V120V	RP5-1132H15.1_ENST00000435524.2_RNA|CRCP_ENST00000398684.2_Silent_p.V43V|CRCP_ENST00000338592.5_Silent_p.V87V|CRCP_ENST00000431089.2_Silent_p.V113V|CRCP_ENST00000492264.1_3'UTR|CRCP_ENST00000415001.2_Silent_p.V87V	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component	120					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)			cervix(1)|kidney(1)|lung(4)	6						TCCACACCGTCACCAGCATTC	0.512																																																	0													84.0	74.0	77.0					7																	65617257		2203	4300	6503	SO:0001819	synonymous_variant	0			AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.360C>A	7.37:g.65617257C>A			A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Silent	SNP	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	p.V120	ENST00000395326.3	37	c.360	CCDS5532.1	7																																																																																			CRCP	-	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	ENSG00000241258		0.512	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRCP	HGNC	protein_coding	OTTHUMT00000251697.2		0.00	23	0	C	NM_014478		65617257	+1			no_errors	ENST00000395326	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.998	A
CRCP	27297	genome.wustl.edu	37	7	65617267	65617267	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:65617267C>T	ENST00000395326.3	+	6	728	c.370C>T	c.(370-372)Ctg>Ttg	p.L124L	RP5-1132H15.1_ENST00000435524.2_RNA|CRCP_ENST00000398684.2_Silent_p.L47L|CRCP_ENST00000338592.5_Silent_p.L91L|CRCP_ENST00000431089.2_Silent_p.L117L|CRCP_ENST00000492264.1_3'UTR|CRCP_ENST00000415001.2_Silent_p.L91L	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component	124					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)			cervix(1)|kidney(1)|lung(4)	6						CACCAGCATTCTGCCTGCAGA	0.547																																																	0													82.0	72.0	76.0					7																	65617267		2203	4300	6503	SO:0001819	synonymous_variant	0			AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.370C>T	7.37:g.65617267C>T			A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Silent	SNP	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	p.L124	ENST00000395326.3	37	c.370	CCDS5532.1	7																																																																																			CRCP	-	superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	ENSG00000241258		0.547	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRCP	HGNC	protein_coding	OTTHUMT00000251697.2		0.00	22	0	C	NM_014478		65617267	+1			no_errors	ENST00000395326	ensembl	human	known	74_37	silent	8.57	32	3	SNP	1.000	T
CSF2RB	1439	genome.wustl.edu	37	22	37326490	37326490	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:37326490G>A	ENST00000403662.3	+	7	1014	c.792G>A	c.(790-792)gtG>gtA	p.V264V	CSF2RB_ENST00000406230.1_Silent_p.V264V|CSF2RB_ENST00000262825.5_Silent_p.V264V|CSF2RB_ENST00000536485.1_Silent_p.V205V			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	264					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCTGGGAGGTGAGGAAGGAGG	0.607																																																	0													106.0	102.0	103.0					22																	37326490		2203	4300	6503	SO:0001819	synonymous_variant	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.792G>A	22.37:g.37326490G>A			Q5JZI1|Q6ICE0	Silent	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.V264	ENST00000403662.3	37	c.792	CCDS13936.1	22																																																																																			CSF2RB	-	pirsf_IL3_rcpt_beta,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	ENSG00000100368		0.607	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	-	0.00	51	0	G	NM_000395		37326490	+1	tier1	-	no_errors	ENST00000262825	ensembl	human	known	74_37	silent	22.78	61	18	SNP	0.994	A
CSMD1	64478	genome.wustl.edu	37	8	3889611	3889611	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:3889611G>T	ENST00000520002.1	-	4	981	c.426C>A	c.(424-426)agC>agA	p.S142R	CSMD1_ENST00000537824.1_Missense_Mutation_p.S142R|CSMD1_ENST00000400186.3_Missense_Mutation_p.S142R|CSMD1_ENST00000542608.1_Missense_Mutation_p.S142R|CSMD1_ENST00000539096.1_Missense_Mutation_p.S142R|CSMD1_ENST00000602723.1_Missense_Mutation_p.S142R|CSMD1_ENST00000602557.1_Missense_Mutation_p.S142R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	142						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CACAAGTGTGGCTAGGTAAAA	0.388																																																	0													68.0	69.0	69.0					8																	3889611		1914	4130	6044	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.426C>A	8.37:g.3889611G>T	ENSP00000430733:p.Ser142Arg		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S142R	ENST00000520002.1	37	c.426		8	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413741	0.25465	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.26660	1.72;1.83;1.86;1.72;2.2	5.52	0.596	0.17496	.	0.000000	0.56097	U	0.000030	T	0.30008	0.0751	L	0.45137	1.4	0.35242	D	0.777915	D	0.67145	0.996	P	0.56216	0.794	T	0.29088	-1.0023	10	0.33940	T	0.23	.	9.7239	0.40320	0.5622:0.0:0.4378:0.0	.	142	E5RIG2	.	R	142;142;4;142;142;142	ENSP00000383047:S142R;ENSP00000430733:S142R;ENSP00000441462:S142R;ENSP00000446243:S142R;ENSP00000441675:S142R	ENSP00000320445:S4R	S	-	3	2	CSMD1	3877019	0.991000	0.36638	0.991000	0.47740	0.501000	0.33797	0.327000	0.19663	0.046000	0.15833	-0.794000	0.03295	AGC	CSMD1	-	NULL	ENSG00000183117		0.388	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2		0.00	21	0	G	NM_033225		3889611	-1			no_errors	ENST00000520002	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.979	T
CXCL1	2919	genome.wustl.edu	37	4	74735691	74735691	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:74735691A>G	ENST00000395761.3	+	3	360	c.293A>G	c.(292-294)gAa>gGa	p.E98G	CXCL1_ENST00000509101.1_3'UTR	NM_001511.3	NP_001502.1	P09341	GROA_HUMAN	chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)	98					actin cytoskeleton organization (GO:0030036)|cell chemotaxis (GO:0060326)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|enzyme activator activity (GO:0008047)|receptor binding (GO:0005102)			lung(2)	2	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AAAATCATCGAAAAGATGCTG	0.483																																																	0													62.0	64.0	63.0					4																	74735691		2197	4300	6497	SO:0001583	missense	0			J03561	CCDS47074.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000163739		"""Endogenous ligands"""	4602	protein-coding gene	gene with protein product		155730	"""GRO1 oncogene (melanoma growth stimulating activity, alpha)"", ""fibroblast secretory protein"""	MGSA, GRO1, FSP		2217207	Standard	NM_001511		Approved	SCYB1, GROa, MGSA-a, NAP-3	uc003hhh.3	P09341		ENST00000395761.3:c.293A>G	4.37:g.74735691A>G	ENSP00000379110:p.Glu98Gly		Q9UCR7	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.E98G	ENST00000395761.3	37	c.293	CCDS47074.1	4	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875333	0.33162	.	.	ENSG00000163739	ENST00000395761	T	0.05199	3.48	5.48	4.29	0.51040	Chemokine interleukin-8-like domain (3);	0.978397	0.08416	N	0.949092	T	0.10895	0.0266	M	0.66560	2.04	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.25467	-1.0131	10	0.56958	D	0.05	.	9.6002	0.39598	0.8237:0.1763:0.0:0.0	.	98	P09341	GROA_HUMAN	G	98	ENSP00000379110:E98G	ENSP00000379110:E98G	E	+	2	0	CXCL1	74954555	0.004000	0.15560	0.001000	0.08648	0.004000	0.04260	2.040000	0.41203	0.906000	0.36621	-0.313000	0.08912	GAA	CXCL1	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000163739		0.483	CXCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL1	HGNC	protein_coding	OTTHUMT00000362734.1		0.00	28	0	A			74735691	+1			no_errors	ENST00000395761	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.003	G
CYB5R2	51700	genome.wustl.edu	37	11	7690913	7690913	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:7690913C>T	ENST00000533558.1	-	4	757	c.201G>A	c.(199-201)agG>agA	p.R67R	CYB5R2_ENST00000528585.1_5'Flank|CYB5R2_ENST00000299498.6_Silent_p.R67R|CYB5R2_ENST00000299497.9_Silent_p.R67R|CYB5R2_ENST00000524790.1_Silent_p.R67R			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	67	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGGTGTAAGCCCTGACCACCA	0.428																																																	0													112.0	94.0	100.0					11																	7690913		2201	4296	6497	SO:0001819	synonymous_variant	0			AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.201G>A	11.37:g.7690913C>T			Q9BVA3|Q9UF68|Q9UHJ0	Silent	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.R67	ENST00000533558.1	37	c.201	CCDS7780.1	11																																																																																			CYB5R2	-	pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000166394		0.428	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R2	HGNC	protein_coding	OTTHUMT00000385679.1	-	0.00	49	0	C	NM_016229		7690913	-1	tier1	-	no_errors	ENST00000299498	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.981	T
DBX2	440097	genome.wustl.edu	37	12	45410229	45410229	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:45410229G>C	ENST00000332700.6	-	4	1031	c.860C>G	c.(859-861)tCa>tGa	p.S287*		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	287					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		TCTTGGACTTGAGTGCTGTTG	0.517																																																	0													107.0	112.0	110.0					12																	45410229		2203	4300	6503	SO:0001587	stop_gained	0				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.860C>G	12.37:g.45410229G>C	ENSP00000331470:p.Ser287*			Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.S287*	ENST00000332700.6	37	c.860	CCDS31781.1	12	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403690	0.83230	.	.	ENSG00000185610	ENST00000332700	.	.	.	5.76	3.89	0.44902	.	0.564083	0.16405	N	0.215878	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-1.3937	9.7436	0.40433	0.0737:0.1408:0.7855:0.0	.	.	.	.	X	287	.	ENSP00000331470:S287X	S	-	2	0	DBX2	43696496	0.635000	0.27199	0.191000	0.23289	0.426000	0.31534	2.383000	0.44354	0.746000	0.32786	0.650000	0.86243	TCA	DBX2	-	NULL	ENSG00000185610		0.517	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBX2	HGNC	protein_coding	OTTHUMT00000404810.1	-	0.00	60	0	G	NM_001004329		45410229	-1	tier1	-	no_errors	ENST00000332700	ensembl	human	known	74_37	nonsense	14.63	70	12	SNP	0.672	C
DCC	1630	genome.wustl.edu	37	18	50976874	50976874	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr18:50976874G>A	ENST00000442544.2	+	23	3850	c.3234G>A	c.(3232-3234)ccG>ccA	p.P1078P	DCC_ENST00000581580.1_Silent_p.P713P	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1078					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCCCAGAGCCGCCAATTGGAC	0.483																																																	0													83.0	75.0	77.0					18																	50976874		2203	4300	6503	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3234G>A	18.37:g.50976874G>A				Silent	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P1078	ENST00000442544.2	37	c.3234	CCDS11952.1	18																																																																																			DCC	-	pfam_Neogenin_C	ENSG00000187323		0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	65	0	G	NM_005215		50976874	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	silent	17.12	92	19	SNP	0.974	A
DCLK1	9201	genome.wustl.edu	37	13	36362275	36362275	+	Intron	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:36362275G>A	ENST00000360631.3	-	16	2270				DCLK1_ENST00000379893.1_Intron|DCLK1_ENST00000255448.4_Intron			O15075	DCLK1_HUMAN	doublecortin-like kinase 1						axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TTTATCCACCGAAGGAACTGG	0.428																																																	0																																										SO:0001627	intron_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.2058+5227C>T	13.37:g.36362275G>A			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	RNA	SNP	-	NULL	ENST00000360631.3	37	NULL		13																																																																																			DCLK1	-	-	ENSG00000133083		0.428	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	63	0	G	NM_004734		36362275	-1	tier1	-	no_errors	ENST00000477664	ensembl	human	known	74_37	rna	10.31	87	10	SNP	1.000	A
DDX19A	55308	genome.wustl.edu	37	16	70390094	70390094	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:70390094G>A	ENST00000302243.7	+	4	400	c.237G>A	c.(235-237)ctG>ctA	p.L79L	DDX19A_ENST00000417604.2_Silent_p.L79L|RP11-529K1.3_ENST00000567706.1_Intron|DDX19A_ENST00000562509.1_3'UTR|DDX19A_ENST00000443119.2_5'Flank	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	79	N-terminal lobe. {ECO:0000250}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				TGGAAGTCCTGCAACGGGATC	0.498																																																	0													245.0	224.0	231.0					16																	70390094		2198	4300	6498	SO:0001819	synonymous_variant	0			AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.237G>A	16.37:g.70390094G>A			B2RPL0|B4DRZ7|Q53FM0	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L79	ENST00000302243.7	37	c.237	CCDS10889.1	16																																																																																			DDX19A	-	NULL	ENSG00000168872		0.498	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX19A	HGNC	protein_coding	OTTHUMT00000268967.2	-	0.00	47	0	G	NM_018332		70390094	+1	tier1	-	no_errors	ENST00000302243	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	A
DDX39A	10212	genome.wustl.edu	37	19	14522410	14522410	+	Splice_Site	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:14522410C>A	ENST00000242776.4	-	4	438	c.337G>T	c.(337-339)Gtg>Ttg	p.V113L	CTC-548K16.5_ENST00000590626.1_RNA|DDX39A_ENST00000592927.1_5'UTR|DDX39A_ENST00000454233.2_Splice_Site_p.V113L	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	113	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						AGGACCGTCACCTGGGAAGTG	0.572																																																	0													106.0	90.0	95.0					19																	14522410		2203	4300	6503	SO:0001630	splice_region_variant	0			U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.337-1G>T	19.37:g.14522410C>A			Q8N5M0|Q9BVP6|Q9H5W0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.V113L	ENST00000242776.4	37	c.337	CCDS12308.1	19	.	.	.	.	.	.	.	.	.	.	c	16.78	3.217954	0.58560	.	.	ENSG00000123136	ENST00000451994;ENST00000242776;ENST00000324340;ENST00000454233	T;T;T	0.14766	2.48;2.48;2.48	3.85	2.79	0.32731	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.075053	0.52532	D	0.000061	T	0.12987	0.0315	L	0.48986	1.54	0.58432	D	0.99999	P;B	0.43909	0.821;0.198	B;B	0.41813	0.367;0.102	T	0.01863	-1.1258	10	0.66056	D	0.02	-25.3773	6.6622	0.23020	0.0:0.8668:0.0:0.1332	.	113;113	B1Q2N1;O00148	.;DX39A_HUMAN	L	156;113;113;113	ENSP00000242776:V113L;ENSP00000322749:V113L;ENSP00000392929:V113L	ENSP00000242776:V113L	V	-	1	0	DDX39A	14383410	1.000000	0.71417	0.842000	0.33263	0.135000	0.20990	4.877000	0.63086	1.874000	0.54306	0.558000	0.71614	GTG	DDX39A	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000123136		0.572	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39A	HGNC	protein_coding	OTTHUMT00000459880.1	-	0.00	76	0	C	NM_138998	Missense_Mutation	14522410	-1	tier1	-	no_errors	ENST00000242776	ensembl	human	known	74_37	missense	8.08	91	8	SNP	1.000	A
DDX3X	1654	genome.wustl.edu	37	X	41206955	41206955	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:41206955G>C	ENST00000399959.2	+	17	2827	c.1972G>C	c.(1972-1974)Gac>Cac	p.D658H	DDX3X_ENST00000441189.2_Missense_Mutation_p.D135H|DDX3X_ENST00000457138.2_Missense_Mutation_p.D642H|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	658	Gly/Ser-rich.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CCAGGGGGTTGACTGGTGGGG	0.428										HNSCC(61;0.18)																																							0													76.0	81.0	79.0					X																	41206955		2203	4298	6501	SO:0001583	missense	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1972G>C	X.37:g.41206955G>C	ENSP00000382840:p.Asp658His		A8K538|B4E3E8|O15536	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D658H	ENST00000399959.2	37	c.1972	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	g	19.60	3.857238	0.71834	.	.	ENSG00000215301	ENST00000399959;ENST00000457138;ENST00000441189	T;T	0.24151	1.94;1.87	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.50411	0.1614	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.99;0.99;0.99;0.99	T	0.50355	-0.8838	10	0.87932	D	0	-10.1125	18.8603	0.92268	0.0:0.0:1.0:0.0	.	135;528;642;670;658	B4DLA0;B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;.;DDX3X_HUMAN	H	658;642;135	ENSP00000382840:D658H;ENSP00000392494:D642H	ENSP00000382840:D658H	D	+	1	0	DDX3X	41091899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.470000	0.97683	2.400000	0.81607	0.586000	0.80456	GAC	DDX3X	-	NULL	ENSG00000215301		0.428	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	-	0.00	16	0	G	NM_024005		41206955	+1	tier1	-	no_errors	ENST00000399959	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	C
DEFB129	140881	genome.wustl.edu	37	20	210168	210168	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:210168C>A	ENST00000246105.4	+	2	339	c.308C>A	c.(307-309)cCc>cAc	p.P103H		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	103					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TCTGTTCTCCCCCAAATCAAA	0.403																																																	0													92.0	93.0	93.0					20																	210168		2203	4300	6503	SO:0001583	missense	0			AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.308C>A	20.37:g.210168C>A	ENSP00000246105:p.Pro103His		Q8NES7	Missense_Mutation	SNP	NULL	p.P103H	ENST00000246105.4	37	c.308	CCDS12992.1	20	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033871	0.35893	.	.	ENSG00000125903	ENST00000246105	T	0.42513	0.97	3.96	0.505	0.16953	.	0.696409	0.12681	N	0.448000	T	0.37919	0.1021	L	0.27053	0.805	0.09310	N	1	D	0.64830	0.994	P	0.56865	0.808	T	0.17137	-1.0379	10	0.62326	D	0.03	-0.5154	3.5117	0.07710	0.2341:0.5559:0.0:0.21	.	103	Q9H1M3	DB129_HUMAN	H	103	ENSP00000246105:P103H	ENSP00000246105:P103H	P	+	2	0	DEFB129	158168	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.215000	0.09279	0.091000	0.17302	0.563000	0.77884	CCC	DEFB129	-	NULL	ENSG00000125903		0.403	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB129	HGNC	protein_coding	OTTHUMT00000077430.2		0.00	22	0	C	NM_080831		210168	+1			no_errors	ENST00000246105	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	A
DHTKD1	55526	genome.wustl.edu	37	10	12126748	12126748	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:12126748C>G	ENST00000263035.4	+	3	582	c.520C>G	c.(520-522)Cag>Gag	p.Q174E	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	174					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GCTGGAATCTCAGGTAAAAAG	0.527																																																	0													89.0	92.0	91.0					10																	12126748		2203	4300	6503	SO:0001583	missense	0			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.520C>G	10.37:g.12126748C>G	ENSP00000263035:p.Gln174Glu		Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.Q174E	ENST00000263035.4	37	c.520	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	C	8.981	0.975250	0.18736	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.13307	2.67;2.6	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.08223	0.0205	N	0.11427	0.14	0.80722	D	1	B	0.30146	0.27	B	0.31101	0.124	T	0.08576	-1.0715	10	0.02654	T	1	-13.5526	19.5499	0.95312	0.0:1.0:0.0:0.0	.	174	Q96HY7	DHTK1_HUMAN	E	174	ENSP00000263035:Q174E;ENSP00000388163:Q174E	ENSP00000263035:Q174E	Q	+	1	0	DHTKD1	12166754	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.387000	0.79785	2.692000	0.91855	0.609000	0.83330	CAG	DHTKD1	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000181192		0.527	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	-	0.00	38	0	C	NM_018706		12126748	+1	tier1	-	no_errors	ENST00000263035	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	G
DIAPH2	1730	genome.wustl.edu	37	X	96502803	96502803	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:96502803G>C	ENST00000324765.8	+	23	3156	c.2809G>C	c.(2809-2811)Gaa>Caa	p.E937Q	DIAPH2_ENST00000373054.4_Missense_Mutation_p.E933Q|DIAPH2_ENST00000373049.4_Missense_Mutation_p.E937Q|DIAPH2_ENST00000373061.3_Missense_Mutation_p.E937Q|DIAPH2_ENST00000355827.4_Missense_Mutation_p.E937Q			O60879	DIAP2_HUMAN	diaphanous-related formin 2	937	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CCCCCAAGCAGAAAATCAACA	0.348																																																	0													153.0	129.0	137.0					X																	96502803		2203	4300	6503	SO:0001583	missense	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2809G>C	X.37:g.96502803G>C	ENSP00000321348:p.Glu937Gln		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.E937Q	ENST00000324765.8	37	c.2809	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	G	7.442	0.640933	0.14386	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.66	4.79	0.61399	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.073797	0.56097	D	0.000025	T	0.09642	0.0237	N	0.17838	0.53	0.37933	D	0.932067	B;B	0.16603	0.018;0.015	B;B	0.18871	0.023;0.013	T	0.13098	-1.0522	10	0.07644	T	0.81	.	10.5793	0.45246	0.0754:0.1312:0.7935:0.0	.	937;937	O60879;O60879-2	DIAP2_HUMAN;.	Q	937;933;937;937;937;944	ENSP00000362152:E937Q;ENSP00000362145:E933Q;ENSP00000348082:E937Q;ENSP00000362140:E937Q;ENSP00000321348:E937Q	ENSP00000321348:E937Q	E	+	1	0	DIAPH2	96389459	1.000000	0.71417	0.533000	0.28001	0.284000	0.27059	4.862000	0.62976	2.523000	0.85059	0.594000	0.82650	GAA	DIAPH2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000147202		0.348	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	-	0.00	53	0	G	NM_006729, NM_007309		96502803	+1	tier1	-	no_errors	ENST00000324765	ensembl	human	known	74_37	missense	18.07	68	15	SNP	0.957	C
DIDO1	11083	genome.wustl.edu	37	20	61510742	61510742	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:61510742C>T	ENST00000266070.4	-	16	6891	c.6566G>A	c.(6565-6567)cGg>cAg	p.R2189Q	DIDO1_ENST00000395343.1_Missense_Mutation_p.R2189Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	2189	Arg-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ggaccggtcccggtcgcgcct	0.731																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													10.0	9.0	9.0					20																	61510742		2030	3944	5974	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.6566G>A	20.37:g.61510742C>T	ENSP00000266070:p.Arg2189Gln		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.R2189Q	ENST00000266070.4	37	c.6566	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297343	0.60086	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.63913	-0.07;-0.07	5.29	4.35	0.52113	.	.	.	.	.	T	0.71160	0.3307	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	P	0.55345	0.774	T	0.74925	-0.3498	9	0.66056	D	0.02	-23.8449	13.6782	0.62467	0.0:0.9243:0.0:0.0757	.	2189	Q9BTC0	DIDO1_HUMAN	Q	2189	ENSP00000266070:R2189Q;ENSP00000378752:R2189Q	ENSP00000266070:R2189Q	R	-	2	0	DIDO1	60981187	0.942000	0.31987	0.008000	0.14137	0.553000	0.35397	4.354000	0.59417	1.231000	0.43661	0.609000	0.83330	CGG	DIDO1	-	NULL	ENSG00000101191		0.731	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	70	0	C	NM_080796		61510742	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	missense	9.00	91	9	SNP	0.781	T
DNAAF1	123872	genome.wustl.edu	37	16	84199429	84199429	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:84199429G>A	ENST00000378553.5	+	7	1028	c.904G>A	c.(904-906)Gaa>Aaa	p.E302K	DNAAF1_ENST00000334315.5_Missense_Mutation_p.E302K|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	302					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GTACGCAGCTGAAAAGGAGGA	0.517																																																	0													155.0	152.0	153.0					16																	84199429		2200	4300	6500	SO:0001583	missense	0			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.904G>A	16.37:g.84199429G>A	ENSP00000367815:p.Glu302Lys		B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	NULL	p.E302K	ENST00000378553.5	37	c.904	CCDS10943.2	16	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993182	0.74703	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.43294	0.95;1.47	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.68063	0.2960	M	0.80508	2.5	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.67868	-0.5559	10	0.42905	T	0.14	-22.4163	19.113	0.93326	0.0:0.0:1.0:0.0	.	50;302	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	K	302	ENSP00000334593:E302K;ENSP00000367815:E302K	ENSP00000334593:E302K	E	+	1	0	DNAAF1	82756930	1.000000	0.71417	0.991000	0.47740	0.015000	0.08874	7.819000	0.86621	2.615000	0.88500	0.650000	0.86243	GAA	DNAAF1	-	NULL	ENSG00000154099		0.517	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	HGNC	protein_coding	OTTHUMT00000250328.3	-	0.00	48	0	G	NM_178452		84199429	+1	tier1	-	no_errors	ENST00000378553	ensembl	human	known	74_37	missense	18.52	44	10	SNP	1.000	A
DNAH12	201625	genome.wustl.edu	37	3	57399535	57399535	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:57399535C>T	ENST00000351747.2	-	39	6081	c.5901G>A	c.(5899-5901)ttG>ttA	p.L1967L		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1967	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						CATACTTCTCCAATGCAGGCA	0.348																																																	0													123.0	106.0	111.0					3																	57399535		692	1590	2282	SO:0001819	synonymous_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.5901G>A	3.37:g.57399535C>T			A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1967	ENST00000351747.2	37	c.5901		3																																																																																			DNAH12	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000174844		0.348	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding			0.00	24	0	C	NM_178504		57399535	-1			no_errors	ENST00000351747	ensembl	human	known	74_37	silent	11.54	23	3	SNP	1.000	T
DNAH14	127602	genome.wustl.edu	37	1	225576110	225576110	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:225576110G>A	ENST00000445597.2	+	57	9777	c.9777G>A	c.(9775-9777)ctG>ctA	p.L3259L	DNAH14_ENST00000430092.1_Silent_p.L4267L|DNAH14_ENST00000439375.2_Silent_p.L4267L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3259					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GTAAGCCACTGAGTTCCTGGA	0.408																																																	0													162.0	128.0	138.0					1																	225576110		692	1591	2283	SO:0001819	synonymous_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9777G>A	1.37:g.225576110G>A			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.L4267	ENST00000445597.2	37	c.12801		1																																																																																			DNAH14	-	pfam_Dynein_heavy_dom	ENSG00000185842		0.408	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	38	0	G	XM_059166		225576110	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	silent	11.63	74	10	SNP	0.199	A
PGS1	9489	genome.wustl.edu	37	17	76423160	76423160	+	IGR	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:76423160C>G	ENST00000262764.6	+	0	2201				DNAH17_ENST00000585328.1_Missense_Mutation_p.E4201D|DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.E4229D	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CCGGAATCTTCTCCAGGATGT	0.567																																					Esophageal Squamous(45;182 1126 10685 43198)												0													42.0	33.0	36.0					17																	76423160		2202	4297	6499	SO:0001628	intergenic_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76423160C>G			B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.E4229D	ENST00000262764.6	37	c.12687	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	C	11.61	1.688966	0.29962	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.09630	2.96	4.99	4.99	0.66335	.	0.000000	0.56097	D	0.000037	T	0.09069	0.0224	L	0.42487	1.325	0.43122	D	0.994845	B	0.20459	0.045	B	0.26969	0.075	T	0.16158	-1.0412	10	0.10636	T	0.68	.	7.7802	0.29060	0.1627:0.7558:0.0:0.0816	.	4201	E7EUM8	.	D	4201;4229	ENSP00000374490:E4229D	ENSP00000300671:E4201D	E	-	3	2	DNAH17	73934755	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	1.126000	0.31344	2.319000	0.78375	0.655000	0.94253	GAG	DNAH17	-	pfam_Dynein_heavy_dom	ENSG00000187775		0.567	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000437301.1	-	0.00	29	0	C	NM_024419		76423160	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	17.65	42	9	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196912149	196912149	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:196912149T>C	ENST00000312428.6	-	5	425	c.325A>G	c.(325-327)Act>Gct	p.T109A	DNAH7_ENST00000410072.1_Missense_Mutation_p.T109A	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	109	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GATTTGGAAGTAGATGGTCCA	0.333																																																	0													190.0	188.0	188.0					2																	196912149		1845	4083	5928	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.325A>G	2.37:g.196912149T>C	ENSP00000311273:p.Thr109Ala		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.T109A	ENST00000312428.6	37	c.325	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	11.22	1.575558	0.28092	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446;ENST00000427816	T;T	0.21031	2.03;2.85	4.35	1.89	0.25635	.	0.379213	0.23217	N	0.050618	T	0.11537	0.0281	L	0.36672	1.1	0.23076	N	0.998333	B	0.06786	0.001	B	0.04013	0.001	T	0.34950	-0.9808	10	0.08179	T	0.78	.	4.3708	0.11246	0.0:0.1042:0.2019:0.6939	.	109	Q8WXX0	DYH7_HUMAN	A	109;109;109;84	ENSP00000311273:T109A;ENSP00000386260:T109A	ENSP00000311273:T109A	T	-	1	0	DNAH7	196620394	0.997000	0.39634	0.775000	0.31657	0.238000	0.25445	2.026000	0.41069	0.407000	0.25591	0.482000	0.46254	ACT	DNAH7	-	NULL	ENSG00000118997		0.333	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	52	0	T	NM_018897		196912149	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	15.29	72	13	SNP	0.846	C
DOCK9	23348	genome.wustl.edu	37	13	99538803	99538803	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:99538803G>C	ENST00000376460.1	-	19	2199	c.2119C>G	c.(2119-2121)Cca>Gca	p.P707A	DOCK9_ENST00000448493.2_Missense_Mutation_p.P719A|DOCK9_ENST00000339416.2_Missense_Mutation_p.P708A|DOCK9_ENST00000442173.1_Missense_Mutation_p.P707A	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	708	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TAAAATTCTGGGTTTTGGTGA	0.383																																																	0													75.0	72.0	73.0					13																	99538803		1826	4086	5912	SO:0001583	missense	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2119C>G	13.37:g.99538803G>C	ENSP00000365643:p.Pro707Ala		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P708A	ENST00000376460.1	37	c.2122	CCDS45062.1	13	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822639	0.90873	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	M	0.83603	2.65	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	T	0.43572	-0.9383	9	.	.	.	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	708;707;707;707;708	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	A	707;708;708;708;707;708;719;707	ENSP00000365643:P707A;ENSP00000341086:P708A;ENSP00000401958:P719A;ENSP00000406883:P707A	.	P	-	1	0	DOCK9	98336804	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.473000	0.97714	2.797000	0.96272	0.655000	0.94253	CCA	DOCK9	-	NULL	ENSG00000088387		0.383	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	-	0.00	26	0	G	NM_015296		99538803	-1	tier1	-	no_errors	ENST00000339416	ensembl	human	known	74_37	missense	17.24	24	5	SNP	1.000	C
DSCAML1	57453	genome.wustl.edu	37	11	117302357	117302357	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:117302357G>C	ENST00000321322.6	-	31	5448	c.5447C>G	c.(5446-5448)tCc>tGc	p.S1816C	DSCAML1_ENST00000527706.1_Missense_Mutation_p.S1546C	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1756					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGCAGGTGTGGAGGCCTGGCA	0.622																																																	0													150.0	144.0	146.0					11																	117302357		2201	4296	6497	SO:0001583	missense	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5447C>G	11.37:g.117302357G>C	ENSP00000315465:p.Ser1816Cys		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1816C	ENST00000321322.6	37	c.5447	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904598	0.92035	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.62105	0.08;0.05	4.82	4.82	0.62117	.	.	.	.	.	T	0.55609	0.1931	N	0.08118	0	0.80722	D	1	P	0.47253	0.892	P	0.51866	0.682	T	0.64702	-0.6345	9	0.56958	D	0.05	.	17.6813	0.88243	0.0:0.0:1.0:0.0	.	1756	Q8TD84	DSCL1_HUMAN	C	1546;1816;1523	ENSP00000434335:S1546C;ENSP00000315465:S1816C	ENSP00000315465:S1816C	S	-	2	0	DSCAML1	116807567	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.346000	0.97056	2.499000	0.84300	0.561000	0.74099	TCC	DSCAML1	-	NULL	ENSG00000177103		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	58	0	G	NM_020693		117302357	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	missense	11.43	61	8	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56324949	56324949	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:56324949C>G	ENST00000361203.3	-	97	22110	c.22103G>C	c.(22102-22104)aGa>aCa	p.R7368T	DST_ENST00000421834.2_Missense_Mutation_p.R5364T|DST_ENST00000244364.6_Missense_Mutation_p.R5078T|DST_ENST00000370754.5_Missense_Mutation_p.R7657T|DST_ENST00000370769.4_Missense_Mutation_p.R7479T|DST_ENST00000370788.2_Missense_Mutation_p.R5282T|DST_ENST00000446842.2_Missense_Mutation_p.R7153T|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	7477					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGTTCGGACTCTGGCAGCTGC	0.478																																																	0													73.0	79.0	77.0					6																	56324949		1972	4142	6114	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.22103G>C	6.37:g.56324949C>G	ENSP00000354508:p.Arg7368Thr		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R7657T	ENST00000361203.3	37	c.22970		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.05|17.05	3.289979|3.289979	0.59976|0.59976	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000523292|ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.|T;T;T;T;T;T;T	.|0.64085	.|1.01;-0.07;-0.08;-0.04;0.87;-0.04;-0.03	6.17|6.17	5.31|5.31	0.75309|0.75309	.|.	.|0.000000	.|0.64402	.|D	.|0.000017	T|T	0.59770|0.59770	0.2218|0.2218	L|L	0.57536|0.57536	1.79|1.79	.|.	.|.	.|.	.|P;D;D;P;B;P;B;B	.|0.65815	.|0.651;0.99;0.995;0.651;0.23;0.514;0.415;0.0	.|B;P;P;B;B;B;B;B	.|0.59115	.|0.15;0.795;0.852;0.15;0.098;0.197;0.2;0.002	T|T	0.62525|0.62525	-0.6836|-0.6836	4|9	.|0.29301	.|T	.|0.29	.|.	11.5429|11.5429	0.50677|0.50677	0.0:0.8646:0.0:0.1354|0.0:0.8646:0.0:0.1354	.|.	.|5364;7479;7657;7477;5078;165;165;5282	.|Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8;Q9BSP9;Q86T18;E7ERU0	.|.;.;.;DYST_HUMAN;.;.;.;.	Q|T	166|5078;7657;7479;5364;7153;5282;7368	.|ENSP00000244364:R5078T;ENSP00000359790:R7657T;ENSP00000359805:R7479T;ENSP00000400883:R5364T;ENSP00000393645:R7153T;ENSP00000359824:R5282T;ENSP00000354508:R7368T	.|ENSP00000244364:R5078T	E|R	-|-	1|2	0|0	DST|DST	56432908|56432908	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.992000|0.992000	0.81027|0.81027	3.658000|3.658000	0.54482|0.54482	1.635000|1.635000	0.50512|0.50512	0.655000|0.655000	0.94253|0.94253	GAG|AGA	DST	-	NULL	ENSG00000151914		0.478	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	40	0	C	NM_001723		56324949	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	13.33	39	6	SNP	0.995	G
DYNC1H1	1778	genome.wustl.edu	37	14	102499768	102499768	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:102499768C>T	ENST00000360184.4	+	54	10524	c.10360C>T	c.(10360-10362)Ctg>Ttg	p.L3454L	RP11-1017G21.4_ENST00000557551.1_RNA|DYNC1H1_ENST00000556791.1_3'UTR	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3454	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ATACGCCGTCCTGATCTCAGA	0.557																																																	0													97.0	88.0	91.0					14																	102499768		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10360C>T	14.37:g.102499768C>T			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L3454	ENST00000360184.4	37	c.10360	CCDS9966.1	14																																																																																			DYNC1H1	-	NULL	ENSG00000197102		0.557	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	-	0.00	27	0	C	NM_001376		102499768	+1	tier1	-	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	18.18	27	6	SNP	1.000	T
ELFN2	114794	genome.wustl.edu	37	22	37770925	37770925	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:37770925G>A	ENST00000402918.2	-	3	1435	c.650C>T	c.(649-651)tCg>tTg	p.S217L	RP1-63G5.8_ENST00000609322.1_RNA|RP1-63G5.5_ENST00000430883.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	217	LRRCT.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CTCCCGCGGCGACTCACACTG	0.632																																																	0													24.0	33.0	30.0					22																	37770925		2202	4298	6500	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.650C>T	22.37:g.37770925G>A	ENSP00000385277:p.Ser217Leu		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.S217L	ENST00000402918.2	37	c.650	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215511	0.58452	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.55234	0.53;0.53	4.96	4.96	0.65561	.	0.182670	0.46442	D	0.000300	T	0.44138	0.1279	L	0.39245	1.2	0.47183	D	0.999349	P	0.43750	0.816	B	0.34242	0.178	T	0.53143	-0.8480	10	0.59425	D	0.04	-9.2694	18.5971	0.91232	0.0:0.0:1.0:0.0	.	217	Q5R3F8	PPR29_HUMAN	L	217	ENSP00000300147:S217L;ENSP00000385277:S217L	ENSP00000300147:S217L	S	-	2	0	ELFN2	36100871	1.000000	0.71417	0.964000	0.40570	0.992000	0.81027	6.282000	0.72639	2.468000	0.83385	0.609000	0.83330	TCG	ELFN2	-	NULL	ENSG00000166897		0.632	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	-	0.00	126	0	G	NM_052906		37770925	-1	tier1	-	no_errors	ENST00000402918	ensembl	human	known	74_37	missense	15.08	169	30	SNP	1.000	A
EME1	146956	genome.wustl.edu	37	17	48452978	48452978	+	Missense_Mutation	SNP	A	A	C	rs76993288|rs36080231|rs558756129|rs3060668	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:48452978A>C	ENST00000338165.4	+	2	491	c.409A>C	c.(409-411)Aag>Cag	p.K137Q	MRPL27_ENST00000507088.1_5'Flank|EME1_ENST00000511648.2_Missense_Mutation_p.K137Q|MRPL27_ENST00000225969.4_5'Flank|MRPL27_ENST00000503633.1_5'Flank|EME1_ENST00000393271.2_Missense_Mutation_p.K137Q|MRPL27_ENST00000442592.3_5'Flank	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	137					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TGACTGGAAAAAGCCCTTTCC	0.473								Direct reversal of damage;Homologous recombination																																									0													77.0	81.0	80.0					17																	48452978		2203	4300	6503	SO:0001583	missense	0			BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.409A>C	17.37:g.48452978A>C	ENSP00000339897:p.Lys137Gln		Q96N62	Missense_Mutation	SNP	pfam_ERCC4_domain,smart_ERCC4_domain	p.K137Q	ENST00000338165.4	37	c.409	CCDS11565.1	17	.	.	.	.	.	.	.	.	.	.	A	10.79	1.448556	0.26074	.	.	ENSG00000154920	ENST00000338165;ENST00000393271;ENST00000511648	T;T;T	0.10573	2.87;2.86;2.86	4.58	1.04	0.20106	.	0.639993	0.14457	N	0.318426	T	0.05914	0.0154	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.28850	0.225;0.144	B;B	0.20955	0.032;0.014	T	0.37314	-0.9711	10	0.21540	T	0.41	-21.2574	4.6392	0.12540	0.6446:0.1673:0.1881:0.0	.	137;137	Q96AY2-2;Q96AY2	.;EME1_HUMAN	Q	137	ENSP00000339897:K137Q;ENSP00000376952:K137Q;ENSP00000421700:K137Q	ENSP00000339897:K137Q	K	+	1	0	EME1	45807977	0.000000	0.05858	0.932000	0.37286	0.879000	0.50718	0.151000	0.16283	0.788000	0.33755	0.533000	0.62120	AAG	EME1	-	NULL	ENSG00000154920		0.473	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EME1	HGNC	protein_coding	OTTHUMT00000367118.3		0.00	36	0	A	NM_152463		48452978	+1			no_errors	ENST00000393271	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.140	C
AC008132.13	0	genome.wustl.edu	37	22	18839191	18839191	+	3'UTR	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:18839191C>T	ENST00000342005.4	+	0	1558				AC008132.13_ENST00000412938.1_3'UTR																							CAGGGCAGCTCCCCTGTAAGC	0.602																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000342005.4:c.*48C>T	22.37:g.18839191C>T				RNA	SNP	-	NULL	ENST00000342005.4	37	NULL		22																																																																																			AC008132.13	-	-	ENSG00000161103		0.602	AC008132.13-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000316711.1	-	0.00	9	0	C			18839191	+1	tier1	-	no_errors	ENST00000412938	ensembl	human	known	74_37	rna	50.00	7	7	SNP	0.057	T
LOC105377213	105377213	genome.wustl.edu	37	X	150684403	150684403	+	lincRNA	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:150684403G>C	ENST00000454307.1	+	0	168																											GAGAGTCTTTGAGGGAGTTCC	0.552																																																	0																																												0																															X.37:g.150684403G>C				RNA	SNP	-	NULL	ENST00000454307.1	37	NULL		X																																																																																			XX-FW80269A6.1	-	-	ENSG00000214915		0.552	XX-FW80269A6.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000214915	Clone_based_vega_gene	lincRNA	OTTHUMT00000078422.1	-	0.00	50	0	G			150684403	+1	tier1	-	no_errors	ENST00000454307	ensembl	human	known	74_37	rna	8.43	76	7	SNP	0.000	C
RP11-51O6.1	0	genome.wustl.edu	37	16	61089574	61089574	+	RNA	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:61089574C>T	ENST00000591758.1	-	0	294																											TGTAAGACTTCTTCTTCCTTT	0.408																																																	0																																												0																															16.37:g.61089574C>T				RNA	SNP	-	NULL	ENST00000591758.1	37	NULL		16																																																																																			RP11-51O6.1	-	-	ENSG00000224631		0.408	RP11-51O6.1-002	KNOWN	basic	processed_transcript	ENSG00000224631	Clone_based_vega_gene	pseudogene	OTTHUMT00000460612.1	-	0.00	22	0	C			61089574	-1	tier1	-	no_errors	ENST00000591758	ensembl	human	known	74_37	rna	17.78	37	8	SNP	1.000	T
PDPR	55066	genome.wustl.edu	37	16	70190311	70190311	+	Intron	SNP	C	C	T	rs544773983		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:70190311C>T	ENST00000288050.4	+	19	3192				PDPR_ENST00000568530.1_Intron|PDPR_ENST00000542659.1_Intron|PDPR_ENST00000398122.3_Intron|RP11-296I10.3_ENST00000566989.1_RNA|RP11-296I10.3_ENST00000502126.1_RNA|PDPR_ENST00000567046.1_Intron|PDPR_ENST00000562100.1_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit						cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ACCCTTCCCACGGTGCTGCTC	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24676	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2236-67C>T	16.37:g.70190311C>T			A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	RNA	SNP	-	NULL	ENST00000288050.4	37	NULL	CCDS45520.1	16																																																																																			RP11-296I10.3	-	-	ENSG00000247228		0.572	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000247228	Clone_based_vega_gene	protein_coding	OTTHUMT00000434502.1	-	0.00	56	0	C	NM_017990		70190311	-1	tier1	-	no_errors	ENST00000566989	ensembl	human	known	74_37	rna	7.69	72	6	SNP	0.000	T
LGR5	8549	genome.wustl.edu	37	12	71976149	71976149	+	Intron	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:71976149C>T	ENST00000266674.5	+	17	1863				LGR5_ENST00000536515.1_Intron|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Intron			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TTCATGTCTCCAGAATAACCC	0.418																																																	0																																										SO:0001627	intron_variant	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1553-87C>T	12.37:g.71976149C>T			D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	RNA	SNP	-	NULL	ENST00000266674.5	37	NULL	CCDS9000.1	12																																																																																			RP11-186F10.2	-	-	ENSG00000257761		0.418	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257761	Clone_based_vega_gene	protein_coding	OTTHUMT00000404744.1	-	0.00	18	0	C	NM_003667		71976149	-1	tier1	-	no_errors	ENST00000546601	ensembl	human	known	74_37	rna	15.62	27	5	SNP	0.000	T
NFAT5	10725	genome.wustl.edu	37	16	69737362	69737362	+	3'UTR	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:69737362G>T	ENST00000354436.2	+	0	12022				NFAT5_ENST00000393742.2_3'UTR|NFAT5_ENST00000349945.1_3'UTR|NFAT5_ENST00000432919.1_3'UTR|RP11-311C24.1_ENST00000561622.1_RNA	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive						cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTAACCACAAGATAGGTAGAT	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.*7108G>T	16.37:g.69737362G>T			A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	RNA	SNP	-	NULL	ENST00000354436.2	37	NULL	CCDS10881.1	16																																																																																			RP11-311C24.1	-	-	ENSG00000260772		0.284	NFAT5-001	KNOWN	basic|CCDS	protein_coding	ENSG00000260772	Clone_based_vega_gene	protein_coding	OTTHUMT00000268952.2	-	0.00	75	0	G	NM_138714		69737362	+1	tier1	-	no_errors	ENST00000561622	ensembl	human	known	74_37	rna	31.82	75	35	SNP	0.072	T
TRMT112P6	391358	genome.wustl.edu	37	2	26251217	26251217	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:26251217C>G	ENST00000599234.1	-	1	264	c.265G>C	c.(265-267)Gag>Cag	p.E89Q																								CTCAGAAACTCTTCATTCTCC	0.582																																																	0																																										SO:0001583	missense	0																														ENST00000599234.1:c.265G>C	2.37:g.26251217C>G	ENSP00000472299:p.Glu89Gln			Missense_Mutation	SNP	pfam_UPF0434/Trm112	p.E89Q	ENST00000599234.1	37	c.265		2																																																																																			AC013449.1	-	pfam_UPF0434/Trm112	ENSG00000268412		0.582	AC013449.1-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000268412	Clone_based_ensembl_gene	protein_coding		-	0.00	53	0	C			26251217	-1	tier1	-	no_errors	ENST00000599234	ensembl	human	novel	74_37	missense	13.16	33	5	SNP	0.003	G
WDR92	116143	genome.wustl.edu	37	2	68384711	68384711	+	5'Flank	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:68384711G>C	ENST00000295121.6	-	0	0				PNO1_ENST00000263657.2_5'Flank|RP11-474G23.1_ENST00000406334.3_Missense_Mutation_p.A293G|WDR92_ENST00000492039.2_5'Flank|WDR92_ENST00000409164.1_5'Flank|WDR92_ENST00000406245.2_5'Flank	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92						apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						TGGCATGTTGGCTGTAGTTAT	0.522																																																	0													70.0	65.0	67.0					2																	68384711		876	1991	2867	SO:0001631	upstream_gene_variant	0			AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561		2.37:g.68384711G>C	Exception_encountered		Q96CR6	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.A293G	ENST00000295121.6	37	c.878	CCDS1884.1	2																																																																																			RP11-474G23.1	-	NULL	ENSG00000273398		0.522	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273398	Clone_based_vega_gene	protein_coding	OTTHUMT00000251754.2	-	0.00	61	0	G	NM_138458		68384711	-1	tier1	-	no_errors	ENST00000406334	ensembl	human	known	74_37	missense	6.17	76	5	SNP	0.000	C
EPM2AIP1	9852	genome.wustl.edu	37	3	37033360	37033360	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:37033360G>C	ENST00000322716.5	-	1	1435	c.1209C>G	c.(1207-1209)gtC>gtG	p.V403V	MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000435176.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	403					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						CAGCAGCAAAGACTTTACTAA	0.388																																																	0													103.0	105.0	105.0					3																	37033360		1906	4107	6013	SO:0001819	synonymous_variant	0			AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.1209C>G	3.37:g.37033360G>C			O94866|Q9H3L3	Silent	SNP	NULL	p.V403	ENST00000322716.5	37	c.1209	CCDS46790.1	3																																																																																			EPM2AIP1	-	NULL	ENSG00000178567		0.388	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2AIP1	HGNC	protein_coding	OTTHUMT00000470593.1		0.00	23	0	G	NM_014805		37033360	-1			no_errors	ENST00000322716	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.109	C
EPHA3	2042	genome.wustl.edu	37	3	89445061	89445061	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:89445061G>A	ENST00000336596.2	+	6	1606	c.1381G>A	c.(1381-1383)Gaa>Aaa	p.E461K	EPHA3_ENST00000452448.2_Missense_Mutation_p.E461K|EPHA3_ENST00000494014.1_Missense_Mutation_p.E461K	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	461	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.E461*(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCAAGAACCTGAACATCCTAA	0.458										TSP Lung(6;0.00050)																																							2	Substitution - Nonsense(2)	haematopoietic_and_lymphoid_tissue(2)											193.0	181.0	185.0					3																	89445061		2203	4300	6503	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1381G>A	3.37:g.89445061G>A	ENSP00000337451:p.Glu461Lys		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E461K	ENST00000336596.2	37	c.1381	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018660	0.93404	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.56611	0.45;0.45;0.45	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63780	0.2540	L	0.31120	0.905	0.80722	D	1	D;P	0.76494	0.999;0.57	D;B	0.81914	0.995;0.202	T	0.57957	-0.7721	9	.	.	.	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	461;461	P29320;P29320-2	EPHA3_HUMAN;.	K	461	ENSP00000337451:E461K;ENSP00000399926:E461K;ENSP00000419190:E461K	.	E	+	1	0	EPHA3	89527751	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.019000	0.88732	2.826000	0.97356	0.655000	0.94253	GAA	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000044524		0.458	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1		0.00	26	0	G	NM_005233		89445061	+1			no_errors	ENST00000336596	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	A
EVA1C	59271	genome.wustl.edu	37	21	33887364	33887364	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr21:33887364C>T	ENST00000300255.2	+	8	1663	c.1190C>T	c.(1189-1191)tCa>tTa	p.S397L	EVA1C_ENST00000485488.1_3'UTR|EVA1C_ENST00000401402.3_Missense_Mutation_p.S349L|EVA1C_ENST00000382699.3_Missense_Mutation_p.S394L	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	397						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										TGTAGGACTTCATATCCTATA	0.502																																																	0													104.0	116.0	112.0					21																	33887364		2203	4300	6503	SO:0001583	missense	0			AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.1190C>T	21.37:g.33887364C>T	ENSP00000300255:p.Ser397Leu		A6ND58|Q8IXZ0	Missense_Mutation	SNP	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom	p.S397L	ENST00000300255.2	37	c.1190	CCDS13614.1	21	.	.	.	.	.	.	.	.	.	.	C	18.16	3.562565	0.65538	.	.	ENSG00000166979	ENST00000300255;ENST00000401402;ENST00000382699	T;T;T	0.51574	0.7;0.7;0.7	5.67	5.67	0.87782	.	0.403240	0.28527	N	0.015024	T	0.54679	0.1873	M	0.80183	2.485	0.42742	D	0.993747	B;B	0.33964	0.232;0.434	B;B	0.31614	0.133;0.133	T	0.60167	-0.7316	10	0.56958	D	0.05	-6.2994	19.7635	0.96333	0.0:1.0:0.0:0.0	.	394;397	A6ND58;P58658	.;CU063_HUMAN	L	397;349;394	ENSP00000300255:S397L;ENSP00000384594:S349L;ENSP00000372146:S394L	ENSP00000300255:S397L	S	+	2	0	C21orf63	32809235	0.335000	0.24748	0.980000	0.43619	0.954000	0.61252	2.740000	0.47418	2.669000	0.90835	0.655000	0.94253	TCA	EVA1C	-	NULL	ENSG00000166979		0.502	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVA1C	HGNC	protein_coding	OTTHUMT00000139403.1		0.00	22	0	C	NM_058187		33887364	+1			no_errors	ENST00000300255	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.982	T
FAM208B	54906	genome.wustl.edu	37	10	5784127	5784127	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:5784127C>G	ENST00000328090.5	+	14	3020	c.2395C>G	c.(2395-2397)Ctg>Gtg	p.L799V	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	799																	GTGGGTAGCTCTGTTTTACAG	0.378																																																	0													133.0	121.0	124.0					10																	5784127		1856	4097	5953	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2395C>G	10.37:g.5784127C>G	ENSP00000328426:p.Leu799Val		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.L799V	ENST00000328090.5	37	c.2395	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464769	0.84425	.	.	ENSG00000108021	ENST00000328090	T	0.19394	2.15	5.57	5.57	0.84162	.	0.000000	0.47852	D	0.000212	T	0.50069	0.1594	M	0.77616	2.38	0.38970	D	0.958735	D	0.89917	1.0	D	0.87578	0.998	T	0.49254	-0.8959	10	0.41790	T	0.15	.	19.1459	0.93467	0.0:1.0:0.0:0.0	.	799	Q5VWN6	F208B_HUMAN	V	799	ENSP00000328426:L799V	ENSP00000328426:L799V	L	+	1	2	C10orf18	5824133	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.714000	0.47202	2.607000	0.88179	0.655000	0.94253	CTG	FAM208B	-	NULL	ENSG00000108021		0.378	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	-	0.00	41	0	C	NM_017782		5784127	+1	tier1	-	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	G
FAM71A	149647	genome.wustl.edu	37	1	212798703	212798703	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:212798703G>A	ENST00000294829.3	+	1	915	c.484G>A	c.(484-486)Gac>Aac	p.D162N	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	162						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CACACGGGATGACCTCTTTGC	0.493																																																	0													116.0	121.0	119.0					1																	212798703		2203	4300	6503	SO:0001583	missense	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.484G>A	1.37:g.212798703G>A	ENSP00000294829:p.Asp162Asn		Q5VTZ1	Missense_Mutation	SNP	pfam_DUF3699	p.D162N	ENST00000294829.3	37	c.484	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968559	0.53614	.	.	ENSG00000162771	ENST00000294829	T	0.18338	2.22	4.54	4.54	0.55810	.	0.407497	0.22564	N	0.058434	T	0.43523	0.1251	M	0.82323	2.585	0.37169	D	0.902951	D	0.76494	0.999	D	0.72338	0.977	T	0.53585	-0.8418	10	0.62326	D	0.03	-29.2238	13.0262	0.58817	0.0:0.0:1.0:0.0	.	162	Q8IYT1	FA71A_HUMAN	N	162	ENSP00000294829:D162N	ENSP00000294829:D162N	D	+	1	0	FAM71A	210865326	0.032000	0.19561	0.947000	0.38551	0.015000	0.08874	1.339000	0.33885	2.526000	0.85167	0.563000	0.77884	GAC	FAM71A	-	pfam_DUF3699	ENSG00000162771		0.493	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	-	0.00	28	0	G	NM_153606		212798703	+1	tier1	-	no_errors	ENST00000294829	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.965	A
FAM71C	196472	genome.wustl.edu	37	12	100043170	100043170	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:100043170G>A	ENST00000324341.1	+	2	1142	c.720G>A	c.(718-720)gaG>gaA	p.E240E	ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	240										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		ATACAATAGAGATATGAATCC	0.413																																																	0													131.0	132.0	131.0					12																	100043170		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.720G>A	12.37:g.100043170G>A			B2R6Y6	Silent	SNP	pfam_DUF3699	p.E240	ENST00000324341.1	37	c.720	CCDS9072.1	12																																																																																			FAM71C	-	NULL	ENSG00000180219		0.413	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71C	HGNC	protein_coding	OTTHUMT00000408458.1	-	0.00	30	0	G	NM_153364		100043170	+1	tier1	-	no_errors	ENST00000324341	ensembl	human	known	74_37	silent	12.07	51	7	SNP	0.006	A
FAM71D	161142	genome.wustl.edu	37	14	67669818	67669818	+	3'UTR	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:67669818G>C	ENST00000556046.1	+	0	708							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		CAGGTCAACAGAAGAGGTGAA	0.463																																																	0													98.0	84.0	89.0					14																	67669818		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*223G>C	14.37:g.67669818G>C			Q86VN4	Missense_Mutation	SNP	pfam_DUF3699	p.R56T	ENST00000556046.1	37	c.167		14	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900045	0.72754	.	.	ENSG00000172717	ENST00000524532;ENST00000530728	T;T	0.55930	0.49;1.31	5.32	4.42	0.53409	.	0.460995	0.21226	N	0.078075	T	0.65575	0.2704	M	0.71581	2.175	.	.	.	D	0.76494	0.999	D	0.66084	0.941	T	0.75139	-0.3423	9	0.87932	D	0	-17.6654	7.2301	0.26038	0.1738:0.0:0.8262:0.0	.	56	Q8N9W8	FA71D_HUMAN	T	56	ENSP00000436280:R56T;ENSP00000433183:R56T	ENSP00000431905:R56T	R	+	2	0	FAM71D	66739571	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	2.563000	0.45922	2.485000	0.83878	0.643000	0.83706	AGA	FAM71D	-	NULL	ENSG00000172717		0.463	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	FAM71D	HGNC	protein_coding	OTTHUMT00000412390.1	-	0.00	55	0	G	NM_173526		67669818	+1	tier1	-	no_errors	ENST00000311864	ensembl	human	known	74_37	missense	12.12	58	8	SNP	0.999	C
FAM9B	171483	genome.wustl.edu	37	X	8997386	8997386	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:8997386C>G	ENST00000327220.5	-	6	719	c.355G>C	c.(355-357)Gag>Cag	p.E119Q	FAM9B_ENST00000428477.1_Missense_Mutation_p.E119Q|FAM9B_ENST00000362066.3_Missense_Mutation_p.E159Q			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	119						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				tcttcttcctcttTCTGCTCG	0.373																																																	0													226.0	165.0	186.0					X																	8997386		2203	4300	6503	SO:0001583	missense	0				CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.355G>C	X.37:g.8997386C>G	ENSP00000318716:p.Glu119Gln		Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.E119Q	ENST00000327220.5	37	c.355	CCDS14132.1	X	.	.	.	.	.	.	.	.	.	.	C	5.957	0.360479	0.11296	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	0.43	-0.86	0.10680	.	.	.	.	.	T	0.37758	0.1015	L	0.36672	1.1	0.09310	N	1	D;D	0.56287	0.975;0.975	D;D	0.63283	0.913;0.913	T	0.29243	-1.0018	7	0.19590	T	0.45	.	.	.	.	.	119;159	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	Q	159;119;119	.	ENSP00000318716:E119Q	E	-	1	0	FAM9B	8957386	0.007000	0.16637	0.002000	0.10522	0.002000	0.02628	-0.358000	0.07641	-0.539000	0.06273	-0.545000	0.04230	GAG	FAM9B	-	pfam_Cor1/Xlr/Xmr	ENSG00000177138		0.373	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	HGNC	protein_coding	OTTHUMT00000055702.2	-	0.00	43	0	C	NM_205849		8997386	-1	tier1	-	no_errors	ENST00000327220	ensembl	human	known	74_37	missense	13.33	65	10	SNP	0.002	G
FOXI3	344167	genome.wustl.edu	37	2	88748296	88748296	+	RNA	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:88748296A>G	ENST00000398142.3	-	0	769							A8MTJ6	FOXI3_HUMAN	forkhead box I3						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)	2						GGAAGTTCCCATTGTCAAACA	0.498																																					Pancreas(81;472 1448 16397 17495 22123)												0													54.0	46.0	48.0					2																	88748296		692	1591	2283			0			BN001221, BN001222		2p11.2	2008-12-18				ENSG00000214336			35123	protein-coding gene	gene with protein product		612351				18787161	Standard	NM_001135649		Approved		uc010ytq.1	A8MTJ6			2.37:g.88748296A>G			B5RI09	RNA	SNP	-	NULL	ENST00000398142.3	37	NULL		2																																																																																			FOXI3	-	-	ENSG00000214336		0.498	FOXI3-001	KNOWN	sequence_error|basic	processed_transcript	FOXI3	HGNC	processed_transcript	OTTHUMT00000338241.2	-	0.00	26	0	A	NM_001135649		88748296	-1	tier1	-	no_errors	ENST00000398142	ensembl	human	known	74_37	rna	13.16	33	5	SNP	0.392	G
FPGT	8790	genome.wustl.edu	37	1	74670407	74670407	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:74670407C>T	ENST00000609362.1	+	4	713	c.676C>T	c.(676-678)Cgt>Tgt	p.R226C	FPGT-TNNI3K_ENST00000533006.1_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT_ENST00000534056.1_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT_ENST00000370894.5_Intron|FPGT_ENST00000524915.1_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT_ENST00000370898.3_Missense_Mutation_p.R239C	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	226					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)			breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						GTCTTGCCATCGTTTCCTTCA	0.398																																																	0													78.0	78.0	78.0					1																	74670407		2203	4300	6503	SO:0001583	missense	0			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.676C>T	1.37:g.74670407C>T	ENSP00000476680:p.Arg226Cys		A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	pfam_Fucokinase,superfamily_Trimer_LpxA-like,pirsf_Fucose-1-phosphate_GuaTrfase	p.R239C	ENST00000609362.1	37	c.715	CCDS663.1	1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465613	0.43839	.	.	ENSG00000254685	ENST00000370898	T	0.33216	1.42	5.57	4.66	0.58398	L-fucokinase (1);	.	.	.	.	T	0.13030	0.0316	L	0.52759	1.655	0.80722	D	1	B	0.26512	0.151	B	0.22601	0.04	T	0.04128	-1.0975	8	.	.	.	.	10.6234	0.45493	0.0:0.8537:0.0:0.1463	.	226	O14772	FPGT_HUMAN	C	226	ENSP00000359935:R226C	.	R	+	1	0	TNNI3K	74442995	0.995000	0.38212	1.000000	0.80357	0.977000	0.68977	2.535000	0.45685	1.361000	0.45981	0.591000	0.81541	CGT	FPGT	-	pfam_Fucokinase,pirsf_Fucose-1-phosphate_GuaTrfase	ENSG00000254685		0.398	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGT	HGNC	protein_coding			0.00	19	0	C			74670407	+1			no_errors	ENST00000370898	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
FRMD6	122786	genome.wustl.edu	37	14	52187044	52187044	+	Silent	SNP	C	C	T	rs75861020		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:52187044C>T	ENST00000344768.5	+	11	1492	c.1296C>T	c.(1294-1296)agC>agT	p.S432S	FRMD6_ENST00000395718.2_Silent_p.S424S|FRMD6_ENST00000553556.1_Silent_p.S74S|FRMD6_ENST00000356218.4_Silent_p.S424S|FRMD6_ENST00000554167.1_Silent_p.S355S			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	432					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GTCATGGCAGCTCCCACACCT	0.587																																																	0													43.0	44.0	44.0					14																	52187044		2203	4300	6503	SO:0001819	synonymous_variant	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1296C>T	14.37:g.52187044C>T			D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.S432	ENST00000344768.5	37	c.1296	CCDS58318.1	14																																																																																			FRMD6	-	NULL	ENSG00000139926		0.587	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	-	0.00	30	0	C	NM_152330		52187044	+1	tier1	-	no_errors	ENST00000344768	ensembl	human	known	74_37	silent	16.67	40	8	SNP	1.000	T
FUCA2	2519	genome.wustl.edu	37	6	143825347	143825347	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:143825347G>T	ENST00000002165.6	-	3	510	c.455C>A	c.(454-456)gCc>gAc	p.A152D	RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000610068.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|FUCA2_ENST00000438118.2_Intron|RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|FUCA2_ENST00000367585.1_Intron	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	152					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		CTCATCTATGGCATTCCAGTT	0.408																																																	0													106.0	110.0	109.0					6																	143825347		2203	4300	6503	SO:0001583	missense	0			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.455C>A	6.37:g.143825347G>T	ENSP00000002165:p.Ala152Asp		E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	p.A152D	ENST00000002165.6	37	c.455	CCDS5200.1	6	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860760	0.91433	.	.	ENSG00000001036	ENST00000002165	T	0.57907	0.37	5.61	5.61	0.85477	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.100870	0.64402	D	0.000002	T	0.79587	0.4471	H	0.95884	3.735	0.80722	D	1	D	0.60575	0.988	D	0.67548	0.952	D	0.85876	0.1419	10	0.87932	D	0	-17.892	19.6306	0.95700	0.0:0.0:1.0:0.0	.	152	Q9BTY2	FUCO2_HUMAN	D	152	ENSP00000002165:A152D	ENSP00000002165:A152D	A	-	2	0	FUCA2	143867040	1.000000	0.71417	0.483000	0.27378	0.735000	0.41995	9.471000	0.97696	2.623000	0.88846	0.650000	0.86243	GCC	FUCA2	-	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub	ENSG00000001036		0.408	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUCA2	HGNC	protein_coding	OTTHUMT00000042521.2		0.00	18	0	G	NM_032020		143825347	-1			no_errors	ENST00000002165	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.966	T
FUK	197258	genome.wustl.edu	37	16	70513177	70513177	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:70513177G>C	ENST00000288078.6	+	23	3256	c.3024G>C	c.(3022-3024)atG>atC	p.M1008I	FUK_ENST00000571514.1_Missense_Mutation_p.M499I|FUK_ENST00000378912.2_Missense_Mutation_p.M1014I	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	1008						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TGCGGCGTATGATGGATGTCC	0.627																																																	0													45.0	49.0	48.0					16																	70513177		2065	4212	6277	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.3024G>C	16.37:g.70513177G>C	ENSP00000288078:p.Met1008Ile		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.M1014I	ENST00000288078.6	37	c.3042	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433420	0.43224	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	D;D	0.92446	-3.04;-3.04	4.54	4.54	0.55810	GHMP kinase, C-terminal (1);	0.163732	0.64402	D	0.000003	D	0.82806	0.5117	N	0.25201	0.72	0.80722	D	1	B;B;B	0.17038	0.02;0.016;0.016	B;B;B	0.18871	0.023;0.016;0.016	T	0.74731	-0.3566	10	0.02654	T	1	-17.0181	11.0511	0.47889	0.0847:0.0:0.9153:0.0	.	1014;914;1008	Q8N0W3-2;B2RDL5;Q8N0W3	.;.;FUK_HUMAN	I	1008;1014	ENSP00000288078:M1008I;ENSP00000368192:M1014I	ENSP00000288078:M1008I	M	+	3	0	FUK	69070678	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.821000	0.69257	2.356000	0.79943	0.655000	0.94253	ATG	FUK	-	pfam_GHMP_kinase_C_dom	ENSG00000157353		0.627	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2		0.00	47	0	G	NM_145059		70513177	+1			no_errors	ENST00000378912	ensembl	human	known	74_37	missense	7.89	70	6	SNP	1.000	C
GCN1L1	10985	genome.wustl.edu	37	12	120591024	120591024	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:120591024G>C	ENST00000300648.6	-	33	4067	c.4055C>G	c.(4054-4056)tCc>tGc	p.S1352C	MIR4498_ENST00000577599.1_RNA	NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1352					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TACCTGCTGGGAGGGGGTGGA	0.602																																																	0													53.0	57.0	55.0					12																	120591024		1985	4154	6139	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4055C>G	12.37:g.120591024G>C	ENSP00000300648:p.Ser1352Cys		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S1352C	ENST00000300648.6	37	c.4055	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731937	0.89390	.	.	ENSG00000089154	ENST00000300648	T	0.68479	-0.33	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.88119	0.6351	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90981	0.4827	10	0.87932	D	0	-17.125	19.8377	0.96663	0.0:0.0:1.0:0.0	.	1352	Q92616	GCN1L_HUMAN	C	1352	ENSP00000300648:S1352C	ENSP00000300648:S1352C	S	-	2	0	GCN1L1	119075407	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.505000	0.97989	2.711000	0.92665	0.561000	0.74099	TCC	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1		0.00	28	0	G			120591024	-1			no_errors	ENST00000300648	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	C
GDAP1L1	78997	genome.wustl.edu	37	20	42908227	42908227	+	3'UTR	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:42908227C>G	ENST00000342560.5	+	0	1479					NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1											endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TTCAAGGTCTCAAGATGGAAC	0.502																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.*287C>G	20.37:g.42908227C>G			B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Nonsense_Mutation	SNP	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	p.S97*	ENST00000342560.5	37	c.290	CCDS13328.1	20	.	.	.	.	.	.	.	.	.	.	C	8.289	0.817213	0.16607	.	.	ENSG00000124194	ENST00000262604;ENST00000447658	.	.	.	5.44	3.15	0.36227	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1539	0.42812	0.0:0.8104:0.0:0.1896	.	.	.	.	X	101;97	.	ENSP00000262604:S101X	S	+	2	0	GDAP1L1	42341641	0.464000	0.25807	0.996000	0.52242	0.365000	0.29674	0.646000	0.24797	1.289000	0.44618	0.591000	0.81541	TCA	GDAP1L1	-	superfamily_Glutathione-S-Trfase_C-like	ENSG00000124194		0.502	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1L1	HGNC	protein_coding	OTTHUMT00000079356.1	-	0.00	47	0	C	NM_024034		42908227	+1	tier1	-	no_errors	ENST00000447658	ensembl	human	known	74_37	nonsense	16.07	47	9	SNP	0.879	G
GINS2	51659	genome.wustl.edu	37	16	85711917	85711917	+	Silent	SNP	G	G	A	rs199530196		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:85711917G>A	ENST00000253462.3	-	5	559	c.459C>T	c.(457-459)atC>atT	p.I153I		NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	153					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(2)|lung(2)	6						CGCTGGTGTTGATCTCCATCA	0.448																																																	0													95.0	89.0	91.0					16																	85711917		2198	4300	6498	SO:0001819	synonymous_variant	0			BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.459C>T	16.37:g.85711917G>A			D3DUM5|Q6IAG9	Silent	SNP	pfam_GINS_complex,pirsf_GINS_Psf2_subgr	p.I153	ENST00000253462.3	37	c.459	CCDS10953.1	16																																																																																			GINS2	-	pfam_GINS_complex,pirsf_GINS_Psf2_subgr	ENSG00000131153		0.448	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS2	HGNC	protein_coding	OTTHUMT00000269098.1	-	0.00	45	0	G	NM_016095		85711917	-1	tier1	-	no_errors	ENST00000253462	ensembl	human	known	74_37	silent	11.43	62	8	SNP	1.000	A
GJA9	81025	genome.wustl.edu	37	1	39340430	39340430	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:39340430G>A	ENST00000360786.3	-	1	1593	c.1341C>T	c.(1339-1341)ttC>ttT	p.F447F	GJA9_ENST00000357771.3_Silent_p.F447F|RP5-864K19.4_ENST00000443161.1_RNA|MYCBP_ENST00000397572.2_5'Flank|RP5-864K19.4_ENST00000433671.2_RNA|RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000454994.2_Intron|MYCBP_ENST00000489803.1_5'UTR			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	447					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			TGCCCTTTCTGAACTGGCCCT	0.507																																																	0													123.0	120.0	121.0					1																	39340430		2203	4300	6503	SO:0001819	synonymous_variant	0			AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1341C>T	1.37:g.39340430G>A			B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.F447	ENST00000360786.3	37	c.1341	CCDS432.1	1																																																																																			GJA9	-	NULL	ENSG00000131233		0.507	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA9	HGNC	protein_coding	OTTHUMT00000001205.1	-	0.00	36	0	G	NM_030772		39340430	-1	tier1	-	no_errors	ENST00000357771	ensembl	human	known	74_37	silent	12.50	56	8	SNP	0.004	A
GLIPR1L1	256710	genome.wustl.edu	37	12	75728517	75728517	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:75728517G>A	ENST00000378695.4	+	1	99	c.9G>A	c.(7-9)ctG>ctA	p.L3L	CAPS2_ENST00000442339.2_Intron|GLIPR1L1_ENST00000312442.2_Silent_p.L3L			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	3					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						CCATGGCTCTGAAGAATAAAT	0.527											OREG0021998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													128.0	126.0	127.0					12																	75728517		2203	4300	6503	SO:0001819	synonymous_variant	0			BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.9G>A	12.37:g.75728517G>A		1162	Q96L06	Silent	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.L3	ENST00000378695.4	37	c.9		12																																																																																			GLIPR1L1	-	NULL	ENSG00000173401		0.527	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	GLIPR1L1	HGNC	protein_coding	OTTHUMT00000405714.1	-	0.00	58	0	G	NM_152779		75728517	+1	tier1	-	no_errors	ENST00000378695	ensembl	human	known	74_37	silent	13.46	90	14	SNP	0.000	A
GPBP1L1	60313	genome.wustl.edu	37	1	46099807	46099807	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:46099807C>G	ENST00000290795.3	-	8	2067	c.846G>C	c.(844-846)gtG>gtC	p.V282V	GPBP1L1_ENST00000479235.1_5'UTR|GPBP1L1_ENST00000355105.3_Silent_p.V282V			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	282					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					TAGCCAGTACCACTGGTTTGG	0.478																																																	0													107.0	97.0	100.0					1																	46099807		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.846G>C	1.37:g.46099807C>G			D3DQ10|Q9H751	Silent	SNP	NULL	p.V282	ENST00000290795.3	37	c.846	CCDS528.1	1																																																																																			GPBP1L1	-	NULL	ENSG00000159592		0.478	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1		0.00	53	0	C	NM_021639		46099807	-1			no_errors	ENST00000290795	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.998	G
GPR26	2849	genome.wustl.edu	37	10	125447475	125447475	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:125447475C>G	ENST00000284674.1	+	3	866	c.813C>G	c.(811-813)atC>atG	p.I271M		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	271					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CGGTGCCCATCGGCTCCCACT	0.597																																																	0													63.0	59.0	60.0					10																	125447475		2203	4300	6503	SO:0001583	missense	0				CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.813C>G	10.37:g.125447475C>G	ENSP00000284674:p.Ile271Met		Q2M2E2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.I271M	ENST00000284674.1	37	c.813	CCDS7636.1	10	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223148	0.58668	.	.	ENSG00000154478	ENST00000284674	T	0.73363	-0.74	5.59	-0.146	0.13432	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83372	0.5240	M	0.83312	2.635	0.41898	D	0.990407	D	0.71674	0.998	D	0.71414	0.973	T	0.82307	-0.0522	10	0.72032	D	0.01	-24.8999	9.6137	0.39679	0.0:0.5519:0.0:0.4481	.	271	Q8NDV2	GPR26_HUMAN	M	271	ENSP00000284674:I271M	ENSP00000284674:I271M	I	+	3	3	GPR26	125437465	0.940000	0.31905	0.995000	0.50966	0.835000	0.47333	0.129000	0.15830	-0.082000	0.12640	-0.237000	0.12165	ATC	GPR26	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM	ENSG00000154478		0.597	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR26	HGNC	protein_coding	OTTHUMT00000050850.1	-	0.00	34	0	C			125447475	+1	tier1	-	no_errors	ENST00000284674	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.991	G
GREB1L	80000	genome.wustl.edu	37	18	19029503	19029503	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr18:19029503G>C	ENST00000580732.2	+	12	1807	c.1426G>C	c.(1426-1428)Gag>Cag	p.E476Q	RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000400483.4_Missense_Mutation_p.E476Q|GREB1L_ENST00000424526.1_Missense_Mutation_p.E476Q|GREB1L_ENST00000431264.1_Missense_Mutation_p.E476Q|SNORD23_ENST00000408212.1_RNA|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000269218.6_Intron			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	476						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GGAAGAATTTGAGCAAATTAT	0.453																																																	0													73.0	64.0	67.0					18																	19029503		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1426G>C	18.37:g.19029503G>C	ENSP00000464162:p.Glu476Gln		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.E476Q	ENST00000580732.2	37	c.1426	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007742	0.93287	.	.	ENSG00000141449	ENST00000424526;ENST00000400483;ENST00000431264	T;T;T	0.23950	2.66;1.88;1.88	5.83	5.83	0.93111	.	.	.	.	.	T	0.46814	0.1412	M	0.74881	2.28	0.58432	D	0.999994	D;P	0.55800	0.973;0.787	P;P	0.52823	0.71;0.479	T	0.45071	-0.9286	9	0.72032	D	0.01	.	20.1197	0.97955	0.0:0.0:1.0:0.0	.	476;476	Q9C091;Q9C091-2	GRB1L_HUMAN;.	Q	476	ENSP00000412060:E476Q;ENSP00000383331:E476Q;ENSP00000393125:E476Q	ENSP00000383331:E476Q	E	+	1	0	GREB1L	17283501	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.770000	0.95276	0.650000	0.86243	GAG	GREB1L	-	NULL	ENSG00000141449		0.453	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2		0.00	34	0	G	NM_024935		19029503	+1			no_errors	ENST00000424526	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	C
HAS2	3037	genome.wustl.edu	37	8	122626975	122626975	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:122626975G>T	ENST00000303924.4	-	4	1570	c.1033C>A	c.(1033-1035)Ctc>Atc	p.L345I		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	345					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AGCCATCTGAGATATTCTATA	0.473																																																	0													142.0	129.0	134.0					8																	122626975		2203	4300	6503	SO:0001583	missense	0			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1033C>A	8.37:g.122626975G>T	ENSP00000306991:p.Leu345Ile		Q32MM3	Missense_Mutation	SNP	pfam_Chitin_synth_fng	p.L345I	ENST00000303924.4	37	c.1033	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591540	0.66219	.	.	ENSG00000170961	ENST00000303924	T	0.59364	0.27	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.76385	0.3980	M	0.76002	2.32	0.80722	D	1	D	0.65815	0.995	D	0.70227	0.968	T	0.70350	-0.4896	10	0.27785	T	0.31	-14.7402	20.5385	0.99246	0.0:0.0:1.0:0.0	.	345	Q92819	HAS2_HUMAN	I	345	ENSP00000306991:L345I	ENSP00000306991:L345I	L	-	1	0	HAS2	122696156	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.617000	0.83032	2.863000	0.98299	0.549000	0.68633	CTC	HAS2	-	pfam_Chitin_synth_fng	ENSG00000170961		0.473	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	HGNC	protein_coding	OTTHUMT00000381150.2	-	0.00	67	0	G	NM_005328		122626975	-1	tier1	-	no_errors	ENST00000303924	ensembl	human	known	74_37	missense	5.80	130	8	SNP	1.000	T
HERC2P3	283755	genome.wustl.edu	37	15	20644361	20644361	+	RNA	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:20644361C>T	ENST00000428453.1	-	0	3202							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CACCCTGCGCCGCCTCAGCGT	0.657																																																	0													5.0	4.0	4.0					15																	20644361		1957	3722	5679			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644361C>T				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.657	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2		0.00	74	0	C	NG_008269		20644361	-1			no_errors	ENST00000426501	ensembl	human	known	74_37	rna	6.12	92	6	SNP	1.000	T
HIST1H2BK	85236	genome.wustl.edu	37	6	27114569	27114569	+	Silent	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:27114569T>C	ENST00000356950.1	-	1	8	c.9A>G	c.(7-9)gaA>gaG	p.E3E	HIST1H2BK_ENST00000396891.4_Silent_p.E3E|HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						ACTTCGCTGGTTCCGGCATGT	0.562																																																	0													51.0	51.0	51.0					6																	27114569		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.9A>G	6.37:g.27114569T>C			A8K7P7|Q2VPI7	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E3	ENST00000356950.1	37	c.9	CCDS4621.1	6																																																																																			HIST1H2BK	-	NULL	ENSG00000197903		0.562	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BK	HGNC	protein_coding	OTTHUMT00000040141.1		0.00	56	0	T	NM_080593		27114569	-1			no_errors	ENST00000356950	ensembl	human	known	74_37	silent	7.77	95	8	SNP	0.083	C
HMCN1	83872	genome.wustl.edu	37	1	185902877	185902877	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:185902877C>G	ENST00000271588.4	+	11	1978	c.1749C>G	c.(1747-1749)ttC>ttG	p.F583L	HMCN1_ENST00000367492.2_Missense_Mutation_p.F583L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	583	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTGTGAAATTCAACGATGCTG	0.458																																																	0													152.0	146.0	148.0					1																	185902877		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1749C>G	1.37:g.185902877C>G	ENSP00000271588:p.Phe583Leu		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.F583L	ENST00000271588.4	37	c.1749	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	7.007	0.555928	0.13436	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.25085	1.82;1.82	5.67	3.74	0.42951	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.508790	0.23083	N	0.052131	T	0.11495	0.0280	N	0.12611	0.24	0.09310	N	1	B	0.17268	0.021	B	0.18263	0.021	T	0.22347	-1.0219	10	0.25106	T	0.35	.	3.0074	0.06033	0.1472:0.5553:0.1425:0.1551	.	583	Q96RW7	HMCN1_HUMAN	L	583	ENSP00000271588:F583L;ENSP00000356462:F583L	ENSP00000271588:F583L	F	+	3	2	HMCN1	184169500	0.000000	0.05858	0.004000	0.12327	0.602000	0.36980	0.108000	0.15396	0.702000	0.31825	0.655000	0.94253	TTC	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.458	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	77	0	C	NM_031935		185902877	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	10.90	139	17	SNP	0.002	G
HMCN1	83872	genome.wustl.edu	37	1	185902924	185902924	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:185902924C>G	ENST00000271588.4	+	11	2025	c.1796C>G	c.(1795-1797)tCa>tGa	p.S599*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.S599*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	599	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAAGGTGGATCATCAGCCGCT	0.403																																																	0													152.0	149.0	150.0					1																	185902924		2203	4300	6503	SO:0001587	stop_gained	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1796C>G	1.37:g.185902924C>G	ENSP00000271588:p.Ser599*		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.S599*	ENST00000271588.4	37	c.1796	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.720584	0.96839	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.67	3.78	0.43462	.	0.519042	0.20560	N	0.089936	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	11.5408	0.50665	0.0:0.8066:0.1251:0.0683	.	.	.	.	X	599	.	ENSP00000271588:S599X	S	+	2	0	HMCN1	184169547	0.073000	0.21202	0.106000	0.21319	0.088000	0.18126	1.510000	0.35790	0.741000	0.32674	0.655000	0.94253	TCA	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000143341		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	75	0	C	NM_031935		185902924	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	nonsense	6.71	153	11	SNP	0.006	G
HSD11B2	3291	genome.wustl.edu	37	16	67469707	67469707	+	Missense_Mutation	SNP	G	G	A	rs1139495		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:67469707G>A	ENST00000326152.5	+	2	574	c.442G>A	c.(442-444)Gtg>Atg	p.V148M	ATP6V0D1_ENST00000567694.1_5'Flank|HSD11B2_ENST00000567684.2_3'UTR	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2	148				V -> F (in Ref. 2; AAB48544). {ECO:0000305}.|V -> L (in Ref. 1; AAA91969). {ECO:0000305}.	female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		CATTAGCCGCGTGCTAGAGTT	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		20400	0.0		0.001	False		,,,				2504	0.0																0													56.0	45.0	49.0					16																	67469707		2198	4300	6498	SO:0001583	missense	0			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.442G>A	16.37:g.67469707G>A	ENSP00000316786:p.Val148Met		A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	p.V148M	ENST00000326152.5	37	c.442	CCDS10837.1	16	.	.	.	.	.	.	.	.	.	.	G	10.02	1.237213	0.22711	.	.	ENSG00000176387	ENST00000326152	D	0.88354	-2.37	5.28	4.33	0.51752	NAD(P)-binding domain (1);	0.421932	0.26665	N	0.023128	D	0.89969	0.6869	L	0.44542	1.39	0.09310	N	0.999998	D	0.54772	0.968	P	0.56823	0.807	D	0.83894	0.0286	10	0.87932	D	0	.	13.0219	0.58794	0.079:0.0:0.921:0.0	.	148	P80365	DHI2_HUMAN	M	148	ENSP00000316786:V148M	ENSP00000316786:V148M	V	+	1	0	HSD11B2	66027208	0.942000	0.31987	0.008000	0.14137	0.615000	0.37417	5.124000	0.64709	1.382000	0.46385	0.591000	0.81541	GTG	HSD11B2	-	pfam_DH_sc/Rdtase_SDR	ENSG00000176387		0.632	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD11B2	HGNC	protein_coding	OTTHUMT00000268826.3	-	0.00	17	0	G	NM_000196		67469707	+1	tier1	-	no_errors	ENST00000326152	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.208	A
HSPA2	3306	genome.wustl.edu	37	14	65009364	65009364	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:65009364G>A	ENST00000394709.1	+	2	1873	c.1797G>A	c.(1795-1797)caG>caA	p.Q599Q	HSPA2_ENST00000247207.6_Silent_p.Q599Q|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	599					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		AACACAAGCAGAAAGAGCTCG	0.557																																					Pancreas(136;1211 1835 24894 31984 38227)												0													110.0	110.0	110.0					14																	65009364		2203	4300	6503	SO:0001819	synonymous_variant	0			L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1797G>A	14.37:g.65009364G>A			Q15508|Q53XM3|Q9UE78	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.Q599	ENST00000394709.1	37	c.1797	CCDS9766.1	14																																																																																			HSPA2	-	pfam_Hsp_70_fam	ENSG00000126803		0.557	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	HGNC	protein_coding	OTTHUMT00000280651.1		0.00	15	0	G			65009364	+1			no_errors	ENST00000247207	ensembl	human	known	74_37	silent	11.43	31	4	SNP	1.000	A
HTR3A	3359	genome.wustl.edu	37	11	113856798	113856798	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:113856798C>T	ENST00000504030.2	+	6	1051	c.606C>T	c.(604-606)gtC>gtT	p.V202V	HTR3A_ENST00000535865.1_Intron|HTR3A_ENST00000506841.2_Silent_p.V202V|HTR3A_ENST00000299961.5_Silent_p.V187V|HTR3A_ENST00000355556.2_Silent_p.V208V|HTR3A_ENST00000375498.2_Silent_p.V208V			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	202					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	ACAGGAGTGTCTTCATGAACC	0.478																																																	0													192.0	199.0	197.0					11																	113856798		2201	4296	6497	SO:0001819	synonymous_variant	0			D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.606C>T	11.37:g.113856798C>T			B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_A,prints_5HT3_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V208	ENST00000504030.2	37	c.624		11																																																																																			HTR3A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000166736		0.478	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	HTR3A	HGNC	protein_coding	OTTHUMT00000360822.2	-	0.00	56	0	C	NM_000869		113856798	+1	tier1	-	no_errors	ENST00000355556	ensembl	human	known	74_37	silent	10.47	77	9	SNP	1.000	T
ICAM5	7087	genome.wustl.edu	37	19	10401883	10401883	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:10401883G>A	ENST00000221980.4	+	2	281	c.218G>A	c.(217-219)cGa>cAa	p.R73Q	CTD-2369P2.8_ENST00000589379.1_RNA|ICAM5_ENST00000586004.1_3'UTR	NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	73	Ig-like C2-type 1.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TCGCTGCGCCGAAACGGGACC	0.706																																																	0													30.0	31.0	31.0					19																	10401883		2203	4298	6501	SO:0001583	missense	0			U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.218G>A	19.37:g.10401883G>A	ENSP00000221980:p.Arg73Gln		Q9Y6F3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_ICAM_N,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom,prints_ICAM_VCAM_N,prints_ICAM	p.R73Q	ENST00000221980.4	37	c.218	CCDS12233.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.072051	0.93950	.	.	ENSG00000105376	ENST00000221980	T	0.14144	2.53	4.96	4.96	0.65561	Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	0.421612	0.23764	N	0.044798	T	0.15132	0.0365	N	0.17723	0.515	0.33587	D	0.600666	D	0.69078	0.997	P	0.51415	0.669	T	0.07443	-1.0772	10	0.54805	T	0.06	-16.0222	13.5764	0.61877	0.0:0.0:1.0:0.0	.	73	Q9UMF0	ICAM5_HUMAN	Q	73	ENSP00000221980:R73Q	ENSP00000221980:R73Q	R	+	2	0	ICAM5	10262883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.277000	0.43417	2.577000	0.86979	0.549000	0.68633	CGA	ICAM5	-	pfam_ICAM_N	ENSG00000105376		0.706	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM5	HGNC	protein_coding	OTTHUMT00000451217.1		0.00	24	0	G	NM_003259		10401883	+1			no_errors	ENST00000221980	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.994	A
IFI27L2	83982	genome.wustl.edu	37	14	94594153	94594153	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:94594153C>G	ENST00000238609.3	-	4	475	c.376G>C	c.(376-378)Gag>Cag	p.E126Q	IFI27L2_ENST00000556727.1_Missense_Mutation_p.E101Q	NM_032036.2	NP_114425.1	Q9H2X8	I27L2_HUMAN	interferon, alpha-inducible protein 27-like 2	126						integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	8						TCATGTTTCTCTGACTTGAGT	0.488																																																	0													219.0	206.0	210.0					14																	94594153		2203	4300	6503	SO:0001583	missense	0			AF208232	CCDS9920.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000119632			19753	protein-coding gene	gene with protein product		611319	"""family with sequence similarity 14, member A"""	FAM14A			Standard	NM_032036		Approved	TLH29	uc001ycq.3	Q9H2X8		ENST00000238609.3:c.376G>C	14.37:g.94594153C>G	ENSP00000238609:p.Glu126Gln		Q8TBD7|Q9NYL0	Missense_Mutation	SNP	pfam_IFI6/IFI27	p.E126Q	ENST00000238609.3	37	c.376	CCDS9920.1	14	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324862	0.60634	.	.	ENSG00000119632	ENST00000238609;ENST00000556727	T;T	0.38077	1.16;1.18	4.1	4.1	0.47936	.	.	.	.	.	T	0.36054	0.0953	L	0.29908	0.895	0.21184	N	0.999767	P	0.52316	0.952	P	0.49140	0.601	T	0.17715	-1.0360	9	0.87932	D	0	.	12.5672	0.56316	0.0:1.0:0.0:0.0	.	126	Q9H2X8	I27L2_HUMAN	Q	126;101	ENSP00000238609:E126Q;ENSP00000451717:E101Q	ENSP00000238609:E126Q	E	-	1	0	IFI27L2	93663906	0.077000	0.21312	0.266000	0.24541	0.028000	0.11728	-0.456000	0.06754	2.211000	0.71520	0.563000	0.77884	GAG	IFI27L2	-	NULL	ENSG00000119632		0.488	IFI27L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI27L2	HGNC	protein_coding	OTTHUMT00000412935.1	-	0.00	121	0	C	NM_032036		94594153	-1	tier1	-	no_errors	ENST00000238609	ensembl	human	known	74_37	missense	7.83	200	17	SNP	0.726	G
INTS2	57508	genome.wustl.edu	37	17	59949628	59949628	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:59949628G>C	ENST00000444766.3	-	20	2875	c.2800C>G	c.(2800-2802)Cag>Gag	p.Q934E	Y_RNA_ENST00000365491.1_RNA|INTS2_ENST00000251334.6_Missense_Mutation_p.Q926E	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	934					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						AAATTTACCTGAGCGGCCAGT	0.393																																																	0													65.0	57.0	60.0					17																	59949628		1816	4076	5892	SO:0001583	missense	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2800C>G	17.37:g.59949628G>C	ENSP00000414237:p.Gln934Glu		Q9ULD3	Missense_Mutation	SNP	NULL	p.Q934E	ENST00000444766.3	37	c.2800	CCDS45750.1	17	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541214	0.85917	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.62105	0.05	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	M	0.76170	2.325	0.80722	D	1	P	0.43578	0.811	P	0.57960	0.83	T	0.76364	-0.2986	9	.	.	.	-7.3251	18.077	0.89430	0.0:0.0:1.0:0.0	.	934	Q9H0H0	INT2_HUMAN	E	934;933	ENSP00000414237:Q934E	.	Q	-	1	0	INTS2	57304410	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.887000	0.92456	2.575000	0.86900	0.552000	0.68991	CAG	INTS2	-	NULL	ENSG00000108506		0.393	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1		0.00	46	0	G	NM_020748		59949628	-1			no_errors	ENST00000444766	ensembl	human	known	74_37	missense	14.29	60	10	SNP	1.000	C
IPP	3652	genome.wustl.edu	37	1	46193360	46193360	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:46193360G>A	ENST00000396478.3	-	5	1093	c.991C>T	c.(991-993)Cag>Tag	p.Q331*		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	331						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					CTTCGAGCCTGATGAAGTGAA	0.478																																																	0													173.0	162.0	166.0					1																	46193360		2203	4300	6503	SO:0001587	stop_gained	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.991C>T	1.37:g.46193360G>A	ENSP00000379739:p.Gln331*		A2A6V4|D3DQ11|Q8N5C3	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Q331*	ENST00000396478.3	37	c.991	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.709248	0.97780	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	.	.	.	X	331	.	ENSP00000353024:Q331X	Q	-	1	0	IPP	45965947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.484000	0.97940	2.937000	0.99478	0.650000	0.86243	CAG	IPP	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.478	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	-	0.00	58	0	G	NM_005897		46193360	-1	tier1	-	no_errors	ENST00000396478	ensembl	human	known	74_37	nonsense	12.50	63	9	SNP	1.000	A
IPPK	64768	genome.wustl.edu	37	9	95414874	95414874	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:95414874C>G	ENST00000287996.3	-	4	549	c.273G>C	c.(271-273)aaG>aaC	p.K91N		NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	91					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAGATTGTATCTTTAAACAAA	0.323																																																	0													96.0	95.0	95.0					9																	95414874		2203	4300	6503	SO:0001583	missense	0			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.273G>C	9.37:g.95414874C>G	ENSP00000287996:p.Lys91Asn		Q5T9F7|Q9H7V8	Missense_Mutation	SNP	pfam_Ins_P5_2-kin	p.K91N	ENST00000287996.3	37	c.273	CCDS6699.1	9	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604722	0.46423	.	.	ENSG00000127080	ENST00000287996	T	0.33216	1.42	4.65	3.74	0.42951	.	0.050628	0.85682	D	0.000000	T	0.26195	0.0639	L	0.27053	0.805	0.80722	D	1	P	0.47604	0.898	P	0.48089	0.566	T	0.01757	-1.1280	10	0.18710	T	0.47	-9.4787	11.8585	0.52453	0.0:0.9109:0.0:0.0891	.	91	Q9H8X2	IPPK_HUMAN	N	91	ENSP00000287996:K91N	ENSP00000287996:K91N	K	-	3	2	IPPK	94454695	1.000000	0.71417	0.995000	0.50966	0.789000	0.44602	1.197000	0.32211	1.078000	0.41014	0.195000	0.17529	AAG	IPPK	-	pfam_Ins_P5_2-kin	ENSG00000127080		0.323	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1		0.00	53	0	C	NM_022755		95414874	-1			no_errors	ENST00000287996	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	G
ITGA8	8516	genome.wustl.edu	37	10	15688954	15688954	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:15688954C>T	ENST00000378076.3	-	12	1451	c.1098G>A	c.(1096-1098)gtG>gtA	p.V366V		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	366					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GGAGAGAGCTCACTTGCAAAT	0.507																																																	0													133.0	117.0	122.0					10																	15688954		2203	4300	6503	SO:0001819	synonymous_variant	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1098G>A	10.37:g.15688954C>T			B0YJ31|Q5VX94	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V366	ENST00000378076.3	37	c.1098	CCDS31155.1	10																																																																																			ITGA8	-	smart_Int_alpha_beta-p	ENSG00000077943		0.507	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	61	0	C	NM_003638		15688954	-1	tier1	-	no_errors	ENST00000378076	ensembl	human	known	74_37	silent	13.79	75	12	SNP	0.001	T
KALRN	8997	genome.wustl.edu	37	3	124132352	124132352	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:124132352G>C	ENST00000240874.3	+	14	2533	c.2376G>C	c.(2374-2376)ttG>ttC	p.L792F	KALRN_ENST00000460856.1_Missense_Mutation_p.L792F|KALRN_ENST00000360013.3_Missense_Mutation_p.L792F	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	792					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						ATGAAGACTTGCTTCGGCAGA	0.537																																																	0													88.0	73.0	78.0					3																	124132352		2203	4300	6503	SO:0001583	missense	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.2376G>C	3.37:g.124132352G>C	ENSP00000240874:p.Leu792Phe		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.L792F	ENST00000240874.3	37	c.2376	CCDS3027.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.507269|4.507269	0.85282|0.85282	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000460856;ENST00000240874;ENST00000360013	.|T;T;T	.|0.55052	.|0.54;0.54;0.54	5.65|5.65	4.77|4.77	0.60923|0.60923	.|.	.|0.000000	.|0.64402	.|D	.|0.000006	T|T	0.68091|0.68091	0.2963|0.2963	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;1.0	.|D;D;D;D	.|0.83275	.|0.991;0.98;0.994;0.996	T|T	0.69239|0.69239	-0.5197|-0.5197	5|10	.|0.46703	.|T	.|0.11	.|.	16.1299|16.1299	0.81422|0.81422	0.0:0.0:0.8655:0.1345|0.0:0.0:0.8655:0.1345	.|.	.|792;138;792;792	.|C9IZQ6;F2Z3Q6;O60229;O60229-2	.|.;.;KALRN_HUMAN;.	S|F	770|792	.|ENSP00000418611:L792F;ENSP00000240874:L792F;ENSP00000353109:L792F	.|ENSP00000240874:L792F	C|L	+|+	2|3	0|2	KALRN|KALRN	125615042|125615042	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	3.180000|3.180000	0.50895|0.50895	1.606000|1.606000	0.50161|0.50161	-0.182000|-0.182000	0.12963|0.12963	TGC|TTG	KALRN	-	NULL	ENSG00000160145		0.537	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	-	0.00	31	0	G	NM_003947		124132352	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	C
KANSL2	54934	genome.wustl.edu	37	12	49065687	49065687	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:49065687G>C	ENST00000420613.2	-	5	651	c.604C>G	c.(604-606)Cgt>Ggt	p.R202G	KANSL2_ENST00000550347.1_Missense_Mutation_p.R385G|KANSL2_ENST00000553086.1_Missense_Mutation_p.R202G|KANSL2_ENST00000357861.3_Missense_Mutation_p.R7G	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	202					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											GACTGCAAACGAATTAGCTTT	0.403																																																	0													124.0	120.0	121.0					12																	49065687		1883	4108	5991	SO:0001583	missense	0			AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.604C>G	12.37:g.49065687G>C	ENSP00000415436:p.Arg202Gly		Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	NULL	p.R202G	ENST00000420613.2	37	c.604	CCDS44869.1	12	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848141	0.91277	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000553086;ENST00000357861	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.87892	0.6292	M	0.71036	2.16	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.987;0.999	D;P;D	0.70487	0.957;0.763;0.969	D	0.87916	0.2700	10	0.87932	D	0	-18.3429	19.3727	0.94495	0.0:0.0:1.0:0.0	.	385;202;7	F8VX10;Q9H9L4;Q9H9L4-2	.;CL041_HUMAN;.	G	385;202;202;7	ENSP00000449747:R385G;ENSP00000415436:R202G;ENSP00000448833:R202G;ENSP00000350527:R7G	ENSP00000350527:R7G	R	-	1	0	C12orf41	47351954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.201000	0.58439	2.878000	0.98634	0.650000	0.86243	CGT	KANSL2	-	NULL	ENSG00000139620		0.403	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL2	HGNC	protein_coding	OTTHUMT00000408841.1	-	0.00	54	0	G	NM_017822		49065687	-1	tier1	-	no_errors	ENST00000420613	ensembl	human	known	74_37	missense	7.14	65	5	SNP	1.000	C
KCTD16	57528	genome.wustl.edu	37	5	143586365	143586365	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:143586365A>C	ENST00000507359.3	+	2	1179	c.88A>C	c.(88-90)Aat>Cat	p.N30H	KCTD16_ENST00000512467.1_Missense_Mutation_p.N30H	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	30	BTB.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GGTAGAGCTGAATGTCGGGGG	0.478																																																	0													86.0	84.0	85.0					5																	143586365		2203	4300	6503	SO:0001583	missense	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.88A>C	5.37:g.143586365A>C	ENSP00000426548:p.Asn30His		Q9P2M9	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.N30H	ENST00000507359.3	37	c.88	CCDS34260.1	5	.	.	.	.	.	.	.	.	.	.	A	18.64	3.666606	0.67814	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	D;D	0.85556	-2.0;-2.0	5.67	5.67	0.87782	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.96097	0.8728	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98122	1.0426	10	0.87932	D	0	.	15.909	0.79456	1.0:0.0:0.0:0.0	.	30	Q68DU8	KCD16_HUMAN	H	30	ENSP00000424151:N30H;ENSP00000426548:N30H	ENSP00000426548:N30H	N	+	1	0	KCTD16	143566558	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.281000	0.95811	2.155000	0.67459	0.459000	0.35465	AAT	KCTD16	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000183775		0.478	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3		0.00	13	0	A	XM_098368		143586365	+1			no_errors	ENST00000507359	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	C
KCTD4	386618	genome.wustl.edu	37	13	45768277	45768277	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:45768277G>A	ENST00000379108.1	-	1	575	c.426C>T	c.(424-426)ttC>ttT	p.F142F	GTF2F2_ENST00000340473.6_Intron|KCTD4_ENST00000405872.1_Silent_p.F142F			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	142					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		TTATTTCCAAGAAAGTAGTCT	0.408																																																	0													112.0	106.0	108.0					13																	45768277		2203	4300	6503	SO:0001819	synonymous_variant	0			BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.426C>T	13.37:g.45768277G>A			Q5W0P9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.F142	ENST00000379108.1	37	c.426	CCDS9396.1	13																																																																																			KCTD4	-	NULL	ENSG00000180332		0.408	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD4	HGNC	protein_coding	OTTHUMT00000044757.1	-	0.00	33	0	G			45768277	-1	tier1	-	no_errors	ENST00000379108	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	A
KERA	11081	genome.wustl.edu	37	12	91449383	91449383	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:91449383C>T	ENST00000266719.3	-	2	923	c.676G>A	c.(676-678)Gaa>Aaa	p.E226K		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	226					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						GGTATTCCTTCAATGGAATTG	0.388																																																	0													116.0	115.0	116.0					12																	91449383		2203	4299	6502	SO:0001583	missense	0			AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.676G>A	12.37:g.91449383C>T	ENSP00000266719:p.Glu226Lys			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.E226K	ENST00000266719.3	37	c.676	CCDS9037.1	12	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016191	0.93404	.	.	ENSG00000139330	ENST00000266719	T	0.18810	2.19	6.08	6.08	0.98989	.	0.041699	0.85682	D	0.000000	T	0.32912	0.0845	L	0.31926	0.97	0.80722	D	1	D	0.59357	0.985	P	0.57620	0.824	T	0.00326	-1.1815	10	0.26408	T	0.33	-24.1169	20.6634	0.99662	0.0:1.0:0.0:0.0	.	226	O60938	KERA_HUMAN	K	226	ENSP00000266719:E226K	ENSP00000266719:E226K	E	-	1	0	KERA	89973514	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.717000	0.68446	2.894000	0.99253	0.655000	0.94253	GAA	KERA	-	NULL	ENSG00000139330		0.388	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KERA	HGNC	protein_coding	OTTHUMT00000407149.2	-	0.00	48	0	C	NM_007035		91449383	-1	tier1	-	no_errors	ENST00000266719	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	T
KHDRBS2	202559	genome.wustl.edu	37	6	62688035	62688035	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:62688035G>T	ENST00000281156.4	-	4	697	c.419C>A	c.(418-420)cCa>cAa	p.P140Q		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTCCCCAGGTGGAGCAAACAC	0.373																																																	0													122.0	111.0	115.0					6																	62688035		2203	4300	6503	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.419C>A	6.37:g.62688035G>T	ENSP00000281156:p.Pro140Gln		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P140Q	ENST00000281156.4	37	c.419	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977582	0.92982	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.16457	2.34	5.46	5.46	0.80206	K Homology (1);	0.000000	0.85682	D	0.000000	T	0.31199	0.0789	M	0.66439	2.03	0.80722	D	1	P	0.50943	0.94	P	0.60117	0.869	T	0.01688	-1.1295	10	0.56958	D	0.05	-2.2923	19.3174	0.94220	0.0:0.0:1.0:0.0	.	140	Q5VWX1	KHDR2_HUMAN	Q	140	ENSP00000281156:P140Q	ENSP00000281156:P140Q	P	-	2	0	KHDRBS2	62745994	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.569000	0.86673	0.650000	0.86243	CCA	KHDRBS2	-	smart_KH_dom	ENSG00000112232		0.373	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2		0.00	32	0	G	NM_152688		62688035	-1			no_errors	ENST00000281156	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
KLHL20	27252	genome.wustl.edu	37	1	173744844	173744844	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:173744844G>C	ENST00000209884.4	+	10	1637	c.1501G>C	c.(1501-1503)Ggc>Cgc	p.G501R	KLHL20_ENST00000546011.1_Missense_Mutation_p.G312R	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	501					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GAAACACCTAGGCTGTGCAGT	0.483																																					GBM(159;862 2695 6559 23041)												0													107.0	100.0	102.0					1																	173744844		2203	4300	6503	SO:0001583	missense	0			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1501G>C	1.37:g.173744844G>C	ENSP00000209884:p.Gly501Arg		B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.G501R	ENST00000209884.4	37	c.1501	CCDS1310.1	1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995188	0.54147	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	D;D	0.82711	-1.64;-1.64	5.32	3.46	0.39613	Galactose oxidase, beta-propeller (1);	0.048129	0.85682	D	0.000000	D	0.87908	0.6296	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88685	0.3205	10	0.87932	D	0	.	10.5839	0.45271	0.1579:0.0:0.8421:0.0	.	312;501	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	R	312;501	ENSP00000443121:G312R;ENSP00000209884:G501R	ENSP00000209884:G501R	G	+	1	0	KLHL20	172011467	1.000000	0.71417	0.977000	0.42913	0.312000	0.27988	7.436000	0.80404	0.643000	0.30638	-0.136000	0.14681	GGC	KLHL20	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000076321		0.483	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL20	HGNC	protein_coding	OTTHUMT00000097582.1	-	0.00	38	0	G	NM_014458		173744844	+1	tier1	-	no_errors	ENST00000209884	ensembl	human	known	74_37	missense	9.64	75	8	SNP	0.992	C
KMT2A	4297	genome.wustl.edu	37	11	118375063	118375063	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:118375063C>G	ENST00000389506.5	+	27	8447	c.8447C>G	c.(8446-8448)tCc>tGc	p.S2816C	KMT2A_ENST00000534358.1_Missense_Mutation_p.S2819C|KMT2A_ENST00000354520.4_Missense_Mutation_p.S2778C			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2816					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGTACCCCCTCCGACAAAAAT	0.448																																																	0													85.0	89.0	88.0					11																	118375063		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8447C>G	11.37:g.118375063C>G	ENSP00000374157:p.Ser2816Cys		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.S2816C	ENST00000389506.5	37	c.8447	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114222	0.37339	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83163	-1.69;-1.69;-1.65	6.17	6.17	0.99709	.	0.099934	0.45126	D	0.000394	D	0.85969	0.5821	L	0.40543	1.245	0.58432	D	0.999994	D;D	0.62365	0.991;0.991	P;P	0.54401	0.751;0.751	D	0.86037	0.1517	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2819;2816	E9PQG7;Q03164	.;MLL1_HUMAN	C	2819;2816;2778;1726	ENSP00000436786:S2819C;ENSP00000374157:S2816C;ENSP00000346516:S2778C	ENSP00000346516:S2778C	S	+	2	0	MLL	117880273	0.993000	0.37304	0.467000	0.27180	0.607000	0.37147	4.799000	0.62517	2.941000	0.99782	0.655000	0.94253	TCC	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.448	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	36	0	C	NM_005933		118375063	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.979	G
KMT2C	58508	genome.wustl.edu	37	7	151859780	151859780	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:151859780C>T	ENST00000262189.6	-	43	11100	c.10882G>A	c.(10882-10884)Gat>Aat	p.D3628N	KMT2C_ENST00000355193.2_Missense_Mutation_p.D3628N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3628					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCAGTTATATCTGAATGGGGA	0.468																																																	0													92.0	85.0	87.0					7																	151859780		2203	4300	6503	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.10882G>A	7.37:g.151859780C>T	ENSP00000262189:p.Asp3628Asn		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D3628N	ENST00000262189.6	37	c.10882	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.92|19.92	3.915997|3.915997	0.73098|0.73098	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.91011|.	-1.98;-1.9;-2.77|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.47852|.	D|.	0.000217|.	T|T	0.75250|0.75250	0.3824|0.3824	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.996;0.998;0.998|.	T|T	0.73135|0.73135	-0.4078|-0.4078	10|5	0.48119|.	T|.	0.1|.	.|.	19.4545|19.4545	0.94882|0.94882	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3628;2689;3628|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	N|K	3628;3628;214|1133	ENSP00000262189:D3628N;ENSP00000347325:D3628N;ENSP00000410411:D214N|.	ENSP00000262189:D3628N|.	D|R	-|-	1|2	0|0	MLL3|MLL3	151490713|151490713	1.000000|1.000000	0.71417|0.71417	0.668000|0.668000	0.29813|0.29813	0.993000|0.993000	0.82548|0.82548	7.480000|7.480000	0.81109|0.81109	2.590000|2.590000	0.87494|0.87494	0.650000|0.650000	0.86243|0.86243	GAT|AGA	KMT2C	-	NULL	ENSG00000055609		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	37	0	C			151859780	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	20.00	56	14	SNP	1.000	T
KRT28	162605	genome.wustl.edu	37	17	38948703	38948703	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:38948703C>G	ENST00000306658.7	-	8	1436	c.1371G>C	c.(1369-1371)aaG>aaC	p.K457N		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				TTTGTTCTGTCTTGCCGTTGG	0.358																																					Melanoma(19;789 869 15380 26882 39836)												0													129.0	117.0	121.0					17																	38948703		2202	4300	6502	SO:0001583	missense	0			AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.1371G>C	17.37:g.38948703C>G	ENSP00000305263:p.Lys457Asn			Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K457N	ENST00000306658.7	37	c.1371	CCDS11376.1	17	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275792	0.59649	.	.	ENSG00000173908	ENST00000306658	D	0.82803	-1.65	6.06	1.77	0.24775	.	0.191054	0.36665	N	0.002472	T	0.74291	0.3697	L	0.47716	1.5	0.31809	N	0.627428	P	0.42078	0.77	B	0.41440	0.357	T	0.74665	-0.3589	10	0.54805	T	0.06	.	4.3758	0.11270	0.1641:0.5943:0.0:0.2417	.	457	Q7Z3Y7	K1C28_HUMAN	N	457	ENSP00000305263:K457N	ENSP00000305263:K457N	K	-	3	2	KRT28	36202229	0.015000	0.18098	0.982000	0.44146	0.936000	0.57629	-0.113000	0.10774	0.837000	0.34925	0.644000	0.83932	AAG	KRT28	-	NULL	ENSG00000173908		0.358	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT28	HGNC	protein_coding	OTTHUMT00000257201.2	-	0.00	48	0	C	NM_181535		38948703	-1	tier1	-	no_errors	ENST00000306658	ensembl	human	known	74_37	missense	7.14	65	5	SNP	0.962	G
KRT9	3857	genome.wustl.edu	37	17	39723652	39723652	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:39723652C>T	ENST00000246662.4	-	7	1810	c.1745G>A	c.(1744-1746)aGt>aAt	p.S582N	KRT9_ENST00000588431.1_Missense_Mutation_p.S349N	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	582	Tail.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				gctgcctccacttcctcccct	0.602																																																	0													199.0	154.0	169.0					17																	39723652		2203	4298	6501	SO:0001583	missense	0				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1745G>A	17.37:g.39723652C>T	ENSP00000246662:p.Ser582Asn		O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.S582N	ENST00000246662.4	37	c.1745	CCDS32654.1	17	.	.	.	.	.	.	.	.	.	.	C	9.970	1.225312	0.22457	.	.	ENSG00000171403	ENST00000246662	T	0.81247	-1.47	2.99	2.99	0.34606	.	0.687661	0.11962	N	0.512678	D	0.82825	0.5121	L	0.32530	0.975	0.26208	N	0.979349	D	0.57571	0.98	D	0.70227	0.968	T	0.71347	-0.4620	10	0.87932	D	0	.	9.5554	0.39334	0.0:1.0:0.0:0.0	.	582	P35527	K1C9_HUMAN	N	582	ENSP00000246662:S582N	ENSP00000246662:S582N	S	-	2	0	KRT9	36977178	1.000000	0.71417	0.984000	0.44739	0.841000	0.47740	2.421000	0.44688	1.668000	0.50843	0.542000	0.68232	AGT	KRT9	-	NULL	ENSG00000171403		0.602	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT9	HGNC	protein_coding	OTTHUMT00000257707.1	-	0.00	101	0	C	NM_000226		39723652	-1	tier1	-	no_errors	ENST00000246662	ensembl	human	known	74_37	missense	12.44	176	25	SNP	0.996	T
LAMA4	3910	genome.wustl.edu	37	6	112443245	112443245	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:112443245C>G	ENST00000230538.7	-	32	4844	c.4447G>C	c.(4447-4449)Gaa>Caa	p.E1483Q	LAMA4_ENST00000389463.4_Missense_Mutation_p.E1476Q|LAMA4_ENST00000424408.2_Missense_Mutation_p.E1476Q|LAMA4_ENST00000522006.1_Missense_Mutation_p.E1476Q	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1483	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TTTAAGTGTTCAAACTCTTGG	0.443																																																	0													212.0	197.0	202.0					6																	112443245		2203	4300	6503	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.4447G>C	6.37:g.112443245C>G	ENSP00000230538:p.Glu1483Gln		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.E1483Q	ENST00000230538.7	37	c.4447	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590174	0.46214	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.269972	0.41500	D	0.000876	T	0.05273	0.0140	L	0.29908	0.895	0.80722	D	1	B;B	0.20052	0.024;0.041	B;B	0.14578	0.005;0.011	T	0.24621	-1.0155	10	0.14252	T	0.57	.	12.6206	0.56601	0.0:0.9238:0.0:0.0762	.	1483;1476	Q16363;Q16363-2	LAMA4_HUMAN;.	Q	1483;1476;1476;1476	ENSP00000230538:E1483Q;ENSP00000429488:E1476Q;ENSP00000374114:E1476Q;ENSP00000416470:E1476Q	ENSP00000230538:E1483Q	E	-	1	0	LAMA4	112549938	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.148000	0.42235	2.644000	0.89710	0.561000	0.74099	GAA	LAMA4	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000112769		0.443	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	51	0	C	NM_001105206		112443245	-1	tier1	-	no_errors	ENST00000230538	ensembl	human	known	74_37	missense	11.63	76	10	SNP	1.000	G
LHFPL5	222662	genome.wustl.edu	37	6	35782462	35782462	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:35782462C>G	ENST00000373853.1	+	2	930	c.552C>G	c.(550-552)ctC>ctG	p.L184L	LHFPL5_ENST00000360215.1_Silent_p.L184L|LHFPL5_ENST00000496656.1_3'UTR			Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	184					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transport (GO:0006811)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)				endometrium(4)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|urinary_tract(1)	20						TGGCCATCCTCAGCATTGGCG	0.622																																																	0													174.0	102.0	126.0					6																	35782462		2203	4300	6503	SO:0001819	synonymous_variant	0			BC028630	CCDS4812.1	6p21.31	2014-01-28				ENSG00000197753			21253	protein-coding gene	gene with protein product		609427	"""deafness, autosomal recessive 67"""	DFNB67		16459341	Standard	NM_182548		Approved	MGC33835, dJ510O8.8, Tmhs	uc003olg.1	Q8TAF8		ENST00000373853.1:c.552C>G	6.37:g.35782462C>G			B3KX66	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.L184	ENST00000373853.1	37	c.552	CCDS4812.1	6																																																																																			LHFPL5	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000197753		0.622	LHFPL5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL5	HGNC	protein_coding	OTTHUMT00000040323.1	-	0.00	68	0	C	NM_182548		35782462	+1	tier1	-	no_errors	ENST00000360215	ensembl	human	known	74_37	silent	6.58	71	5	SNP	1.000	G
LAMA4	3910	genome.wustl.edu	37	6	112496650	112496650	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:112496650C>T	ENST00000230538.7	-	11	1619	c.1222G>A	c.(1222-1224)Gag>Aag	p.E408K	LAMA4_ENST00000389463.4_Missense_Mutation_p.E401K|LAMA4_ENST00000424408.2_Missense_Mutation_p.E401K|LAMA4_ENST00000522006.1_Missense_Mutation_p.E401K	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	408	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGTTCATGCTCTTCCCCATAA	0.473																																																	0													141.0	142.0	142.0					6																	112496650		2203	4300	6503	SO:0001583	missense	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1222G>A	6.37:g.112496650C>T	ENSP00000230538:p.Glu408Lys		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.E408K	ENST00000230538.7	37	c.1222	CCDS43491.1	6	.	.	.	.	.	.	.	.	.	.	C	5.969	0.362761	0.11296	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	5.71	-1.57	0.08506	Laminin I (1);	0.719496	0.14444	N	0.319198	T	0.01320	0.0043	N	0.12182	0.205	0.48696	D	0.999691	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.42413	-0.9453	10	0.09084	T	0.74	.	7.577	0.27942	0.0:0.3341:0.4186:0.2473	.	408;401	Q16363;Q16363-2	LAMA4_HUMAN;.	K	408;401;401;401	ENSP00000230538:E408K;ENSP00000429488:E401K;ENSP00000374114:E401K;ENSP00000416470:E401K	ENSP00000230538:E408K	E	-	1	0	LAMA4	112603343	0.031000	0.19500	0.087000	0.20705	0.675000	0.39556	0.100000	0.15231	-0.050000	0.13356	0.655000	0.94253	GAG	LAMA4	-	pfam_Laminin_I	ENSG00000112769		0.473	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2		0.00	23	0	C	NM_001105206		112496650	-1			no_errors	ENST00000230538	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.008	T
TUNAR	100507043	genome.wustl.edu	37	14	96389122	96389122	+	lincRNA	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:96389122G>T	ENST00000503525.2	+	0	411					NR_038861.1																						TTACAGGTTAGCCTGGCAAGG	0.423																																																	0																																												0																															14.37:g.96389122G>T				RNA	SNP	-	NULL	ENST00000503525.2	37	NULL		14																																																																																			LINC00617	-	-	ENSG00000250366		0.423	LINC00617-002	KNOWN	basic	lincRNA	LINC00617	HGNC	lincRNA	OTTHUMT00000413257.1		0.00	54	0	G			96389122	+1			no_errors	ENST00000503525	ensembl	human	known	74_37	rna	5.06	75	4	SNP	1.000	T
LINC00905	148231	genome.wustl.edu	37	19	16146762	16146762	+	RNA	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:16146762G>C	ENST00000588117.2	+	0	1025					NR_024335.1|NR_024336.1				long intergenic non-protein coding RNA 905																		AGTAGCGGTTGAGGTTGCGGC	0.617																																																	0																																												0			BC031284, BC069223, DB461577		19p13.12	2013-05-21			ENSG00000167459	ENSG00000167459		"""Long non-coding RNAs"""	26334	non-coding RNA	RNA, long non-coding							Standard	NR_110321		Approved	FLJ25328			OTTHUMG00000182270		19.37:g.16146762G>C				RNA	SNP	-	NULL	ENST00000588117.2	37	NULL		19																																																																																			LINC00905	-	-	ENSG00000167459		0.617	LINC00905-001	KNOWN	basic	lincRNA	LINC00905	HGNC	processed_transcript	OTTHUMT00000460313.2	-	0.00	26	0	G	NR_024335		16146762	+1	tier1	-	no_errors	ENST00000588117	ensembl	human	known	74_37	rna	14.63	35	6	SNP	1.000	C
MAZ	4150	genome.wustl.edu	37	16	29821856	29821856	+	3'UTR	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:29821856C>T	ENST00000322945.6	+	0	1903				PRRT2_ENST00000567659.1_5'Flank|MAZ_ENST00000545521.1_3'UTR|MAZ_ENST00000566906.2_3'UTR|MAZ_ENST00000219782.6_3'UTR|PRRT2_ENST00000300797.6_5'Flank|PRRT2_ENST00000358758.7_5'Flank|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000563402.1_3'UTR|MAZ_ENST00000562337.1_3'UTR|AC009133.20_ENST00000569039.1_RNA|AC009133.15_ENST00000566537.1_RNA|AC009133.14_ENST00000569981.1_RNA|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_3'UTR	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CCTCTCCTCTCTGTAAGCCCA	0.627																																					Colon(72;875 1167 15364 30899 37091)												0																																										SO:0001624	3_prime_UTR_variant	0			M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.*304C>T	16.37:g.29821856C>T			A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	RNA	SNP	-	NULL	ENST00000322945.6	37	NULL	CCDS42143.1	16																																																																																			AC009133.14	-	-	ENSG00000238045		0.627	MAZ-001	KNOWN	basic|CCDS	protein_coding	LOC100289283	Clone_based_vega_gene	protein_coding	OTTHUMT00000435536.1	-	0.00	58	0	C	NM_002383		29821856	-1	tier1	-	no_errors	ENST00000569981	ensembl	human	known	74_37	rna	14.77	75	13	SNP	0.996	T
SMG1P7	100506060	genome.wustl.edu	37	16	70267382	70267382	+	RNA	SNP	T	T	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:70267382T>A	ENST00000459379.1	-	0	0																											GCTTGTCGAATACGAGTTCCA	0.368																																																	0																																												0																															16.37:g.70267382T>A				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.368	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	134	0	T			70267382	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	23.81	176	55	SNP	1.000	A
TIMP2	7077	genome.wustl.edu	37	17	76888114	76888114	+	Intron	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:76888114G>A	ENST00000262768.7	-	2	429				TIMP2_ENST00000536189.2_Intron|DDC8_ENST00000322630.2_Nonsense_Mutation_p.R158*	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			GCTGATCTTCGCTGGATGGGC	0.637																																																	0																																										SO:0001627	intron_variant	0				CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-18113C>T	17.37:g.76888114G>A			Q16121|Q93006|Q9UDF7	Nonsense_Mutation	SNP	NULL	p.R158*	ENST00000262768.7	37	c.472	CCDS11758.1	17	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619341	0.66787	.	.	ENSG00000178404	ENST00000322630	.	.	.	3.98	0.434	0.16539	.	0.313023	0.22586	N	0.058153	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.2885	5.0019	0.14268	0.1055:0.0:0.4179:0.4767	.	.	.	.	X	158	.	ENSP00000312767:R158X	R	-	1	2	AC100788.1	74399709	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.383000	0.20651	0.117000	0.18138	-0.224000	0.12420	CGA	DDC8	-	NULL	ENSG00000178404		0.637	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100653515	Uniprot_gn	protein_coding	OTTHUMT00000335662.1	-	0.00	26	0	G	NM_003255		76888114	-1	tier1	-	no_errors	ENST00000322630	ensembl	human	putative	74_37	nonsense	15.79	32	6	SNP	0.000	A
LOC202181	202181	genome.wustl.edu	37	5	177099140	177099140	+	RNA	SNP	T	T	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:177099140T>A	ENST00000515045.1	-	0	70					NR_026921.1																						GATCACGATGTAATCCTCCAT	0.756																																																	0																																												0																															5.37:g.177099140T>A				RNA	SNP	-	NULL	ENST00000515045.1	37	NULL		5																																																																																			RP11-1277A3.2	-	-	ENSG00000246596		0.756	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	LOC202181	Clone_based_vega_gene	pseudogene	OTTHUMT00000373167.1	-	0.00	8	0	T			177099140	-1	tier1	-	no_errors	ENST00000515045	ensembl	human	known	74_37	rna	60.00	4	6	SNP	0.986	A
LOC285556	285556	genome.wustl.edu	37	4	100574460	100574460	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:100574460C>T	ENST00000511828.1	-	1	1345	c.1346G>A	c.(1345-1347)aGc>aAc	p.S449N																								CAGGTCGCTGCTTGTAGGGCT	0.677																																																	0																																										SO:0001583	missense	0																														ENST00000511828.1:c.1346G>A	4.37:g.100574460C>T	ENSP00000427555:p.Ser449Asn			Missense_Mutation	SNP	NULL	p.S449N	ENST00000511828.1	37	c.1346		4	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300829	0.40694	.	.	ENSG00000248713	ENST00000511828	T	0.22134	1.97	5.01	4.17	0.49024	.	.	.	.	.	T	0.15652	0.0377	N	0.14661	0.345	.	.	.	.	.	.	.	.	.	T	0.16778	-1.0391	6	0.87932	D	0	.	7.7473	0.28877	0.0:0.8166:0.0:0.1834	.	.	.	.	N	449	ENSP00000427555:S449N	ENSP00000427555:S449N	S	-	2	0	RP11-766F14.2	100793483	0.050000	0.20438	1.000000	0.80357	0.590000	0.36582	0.000000	0.12993	1.345000	0.45676	0.655000	0.94253	AGC	RP11-766F14.2	-	NULL	ENSG00000248713		0.677	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	-	0.00	47	0	C			100574460	-1	tier1	-	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	11.86	52	7	SNP	0.385	T
LOC441666	441666	genome.wustl.edu	37	10	42832735	42832735	+	RNA	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:42832735C>G	ENST00000609841.1	-	0	1168					NR_024380.1																						TCTAGGGTTTCTCTCCACTAT	0.353																																																	0																																												0																															10.37:g.42832735C>G				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.353	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	37	0	C			42832735	-1	tier1	-	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	20.00	32	8	SNP	0.999	G
LRRTM4	80059	genome.wustl.edu	37	2	77746526	77746526	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:77746526G>A	ENST00000409093.1	-	3	805	c.469C>T	c.(469-471)Cgg>Tgg	p.R157W	LRRTM4_ENST00000409884.1_Missense_Mutation_p.R157W|LRRTM4_ENST00000409911.1_Missense_Mutation_p.R158W|LRRTM4_ENST00000409088.3_Missense_Mutation_p.R157W|LRRTM4_ENST00000409282.1_Missense_Mutation_p.R158W			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	157					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		ATGAGTTTCCGAAGGCCTTTA	0.393																																																	0													70.0	65.0	67.0					2																	77746526		1845	4081	5926	SO:0001583	missense	0			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.469C>T	2.37:g.77746526G>A	ENSP00000386357:p.Arg157Trp		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R158W	ENST00000409093.1	37	c.472	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800335	0.70567	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.04706	3.57;3.57;3.57;3.57;3.57	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.17492	0.0420	L	0.46819	1.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.00079	-1.2111	10	0.48119	T	0.1	.	18.5348	0.91006	0.0:0.0:1.0:0.0	.	158;157;157	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	W	158;157;157;157;158	ENSP00000387228:R158W;ENSP00000387297:R157W;ENSP00000386357:R157W;ENSP00000386236:R157W;ENSP00000386286:R158W	ENSP00000386236:R157W	R	-	1	2	LRRTM4	77600034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.723000	0.93209	0.563000	0.77884	CGG	LRRTM4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000176204		0.393	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	-	0.00	44	0	G	NM_024993		77746526	-1	tier1	-	no_errors	ENST00000409911	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141143523	141143523	+	Silent	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:141143523G>T	ENST00000389484.3	-	67	11441	c.10470C>A	c.(10468-10470)ccC>ccA	p.P3490P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3490	LDL-receptor class A 25. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.P3490P(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCCAGTGATCGGGAATACAGT	0.378										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - coding silent(1)	endometrium(1)											147.0	138.0	141.0					2																	141143523		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10470C>A	2.37:g.141143523G>T			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.P3490	ENST00000389484.3	37	c.10470	CCDS2182.1	2																																																																																			LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	36	0	G	NM_018557		141143523	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	26.09	34	12	SNP	0.994	T
KIAA2012	100652824	genome.wustl.edu	37	2	202979699	202979699	+	Intron	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:202979699G>C	ENST00000409515.3	+	11	2098				AC079354.3_ENST00000409819.1_RNA|AC079354.1_ENST00000541917.1_Intron|AC079354.1_ENST00000295844.3_Intron|AC079354.3_ENST00000584624.1_RNA																							CTTCAGTCTTGATGGTGACAG	0.408																																																	0																																										SO:0001627	intron_variant	0																														ENST00000409515.3:c.2098+1530G>C	2.37:g.202979699G>C				RNA	SNP	-	NULL	ENST00000409515.3	37	NULL		2																																																																																			AC079354.3	-	-	ENSG00000222035		0.408	AC079354.1-001	KNOWN	basic	processed_transcript	LOC729224	Clone_based_vega_gene	protein_coding	OTTHUMT00000336161.2	-	0.00	54	0	G			202979699	-1	tier1	-	no_errors	ENST00000409819	ensembl	human	known	74_37	rna	8.86	72	7	SNP	0.035	C
LRTM2	654429	genome.wustl.edu	37	12	1936680	1936680	+	5'UTR	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:1936680G>C	ENST00000543818.1	+	0	653				CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000535041.1_5'UTR|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000299194.1_5'UTR|LRTM2_ENST00000543730.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGTGCAGGGGGAAGCAGCAGG	0.657																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.-190G>C	12.37:g.1936680G>C			A7E2U6	RNA	SNP	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			LRTM2	-	-	ENSG00000166159		0.657	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	-	0.00	50	0	G			1936680	+1	tier1	-	no_errors	ENST00000544489	ensembl	human	known	74_37	rna	11.32	46	6	SNP	0.001	C
LSM14B	149986	genome.wustl.edu	37	20	60701373	60701373	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:60701373C>T	ENST00000279068.6	+	3	465	c.305C>T	c.(304-306)tCt>tTt	p.S102F	LSM14B_ENST00000253001.4_Missense_Mutation_p.S102F|LSM14B_ENST00000370915.1_Missense_Mutation_p.S102F	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	102					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			TCCCTGGGTTCTGCCTCCGCC	0.657																																																	0													71.0	76.0	74.0					20																	60701373		2147	4241	6388	SO:0001583	missense	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.305C>T	20.37:g.60701373C>T	ENSP00000279068:p.Ser102Phe		Q6PFW8|Q96LH8	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.S102F	ENST00000279068.6	37	c.305	CCDS46626.1	20	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996808	0.74818	.	.	ENSG00000149657	ENST00000370915;ENST00000279068;ENST00000253001;ENST00000400318;ENST00000279069	T;T;T	0.49720	0.8;0.77;0.81	5.42	4.47	0.54385	.	0.203473	0.42682	D	0.000663	T	0.66346	0.2780	M	0.64997	1.995	0.44627	D	0.997606	B;D;D	0.71674	0.437;0.998;0.997	B;D;D	0.79784	0.22;0.993;0.915	T	0.70908	-0.4744	10	0.87932	D	0	.	16.2584	0.82528	0.0:0.8672:0.1328:0.0	.	102;128;102	Q9BX40;Q5TBQ0;Q9BX40-2	LS14B_HUMAN;.;.	F	102;102;102;128;102	ENSP00000279068:S102F;ENSP00000253001:S102F;ENSP00000383172:S128F	ENSP00000253001:S102F	S	+	2	0	LSM14B	60134768	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.420000	0.44679	1.266000	0.44231	0.511000	0.50034	TCT	LSM14B	-	NULL	ENSG00000149657		0.657	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	-	0.00	49	0	C	NM_144703		60701373	+1	tier1	-	no_errors	ENST00000253001	ensembl	human	known	74_37	missense	12.31	57	8	SNP	1.000	T
LZTS2	84445	genome.wustl.edu	37	10	102762382	102762382	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:102762382G>C	ENST00000370220.1	+	1	3150	c.87G>C	c.(85-87)gtG>gtC	p.V29V	LZTS2_ENST00000370223.3_Silent_p.V29V					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGGGTAGTGTGAGCAGCCTTA	0.672																																					Esophageal Squamous(8;38 437 13604 19902 37640)												0													49.0	55.0	53.0					10																	102762382		2203	4299	6502	SO:0001819	synonymous_variant	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.87G>C	10.37:g.102762382G>C				Silent	SNP	NULL	p.V29	ENST00000370220.1	37	c.87	CCDS7507.1	10																																																																																			LZTS2	-	NULL	ENSG00000107816		0.672	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1	-	0.00	65	0	G	XM_046743		102762382	+1	tier1	-	no_errors	ENST00000370220	ensembl	human	known	74_37	silent	22.50	61	18	SNP	1.000	C
MAD2L2	10459	genome.wustl.edu	37	1	11735184	11735184	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:11735184G>A	ENST00000235310.3	-	10	1477	c.549C>T	c.(547-549)gaC>gaT	p.D183D	MAD2L2_ENST00000376672.1_Silent_p.D196D|MAD2L2_ENST00000376667.3_Silent_p.D183D|MAD2L2_ENST00000376692.4_Silent_p.D183D|MAD2L2_ENST00000376669.5_Silent_p.D196D			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	183	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with ipaB.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGCCGGGGGTCATGCATGT	0.577								DNA polymerases (catalytic subunits)																																									0													73.0	79.0	77.0					1																	11735184		2203	4300	6503	SO:0001819	synonymous_variant	0			AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.549C>T	1.37:g.11735184G>A			B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Silent	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.D196	ENST00000235310.3	37	c.588	CCDS134.1	1																																																																																			MAD2L2	-	superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	ENSG00000116670		0.577	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAD2L2	HGNC	protein_coding	OTTHUMT00000006344.2		0.00	37	0	G	NM_006341		11735184	-1			no_errors	ENST00000376669	ensembl	human	known	74_37	silent	8.57	32	3	SNP	1.000	A
MAP3K11	4296	genome.wustl.edu	37	11	65373507	65373507	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:65373507C>T	ENST00000530153.1	-	7	1399	c.878G>A	c.(877-879)cGa>cAa	p.R293Q	MAP3K11_ENST00000534432.1_5'UTR|MAP3K11_ENST00000309100.3_Missense_Mutation_p.R550Q|MAP3K11_ENST00000532507.1_5'UTR					mitogen-activated protein kinase kinase kinase 11											breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(14)|skin(1)	24						CTCCAGACGTCGGGGGGACTG	0.607																																																	0													18.0	21.0	20.0					11																	65373507		2201	4296	6497	SO:0001583	missense	0				CCDS8107.1	11q13.1-q13.3	2011-06-09			ENSG00000173327	ENSG00000173327	2.7.10.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6850	protein-coding gene	gene with protein product		600050		MLK3, PTK1		9267807, 8183572	Standard	NM_002419		Approved	SPRK, MEKK11	uc001oew.3	Q16584	OTTHUMG00000166529	ENST00000530153.1:c.878G>A	11.37:g.65373507C>T	ENSP00000433886:p.Arg293Gln			Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.R550Q	ENST00000530153.1	37	c.1649		11	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249927	0.39797	.	.	ENSG00000173327	ENST00000309100;ENST00000530153	T;T	0.74106	-0.7;-0.81	5.14	5.14	0.70334	.	0.335214	0.25391	N	0.031001	T	0.69842	0.3156	N	0.19112	0.55	0.09310	N	1	D;B	0.67145	0.996;0.162	P;B	0.56612	0.802;0.056	T	0.61292	-0.7092	10	0.29301	T	0.29	.	11.219	0.48844	0.1832:0.8168:0.0:0.0	.	57;550	B3KQY4;Q16584	.;M3K11_HUMAN	Q	550;293	ENSP00000309597:R550Q;ENSP00000433886:R293Q	ENSP00000309597:R550Q	R	-	2	0	MAP3K11	65130083	0.026000	0.19158	0.353000	0.25747	0.923000	0.55619	1.942000	0.40243	2.407000	0.81776	0.491000	0.48974	CGA	MAP3K11	-	pirsf_MAPKKK9/10/11	ENSG00000173327		0.607	MAP3K11-004	PUTATIVE	basic|exp_conf	protein_coding	MAP3K11	HGNC	protein_coding	OTTHUMT00000390233.2	-	0.00	38	0	C			65373507	-1	tier1	-	no_errors	ENST00000309100	ensembl	human	known	74_37	missense	15.87	53	10	SNP	0.014	T
MAP3K6	9064	genome.wustl.edu	37	1	27685071	27685071	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:27685071G>A	ENST00000493901.1	-	21	2854	c.2615C>T	c.(2614-2616)cCc>cTc	p.P872L	MAP3K6_ENST00000357582.2_Missense_Mutation_p.P872L|MAP3K6_ENST00000374040.3_Missense_Mutation_p.P864L	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	872	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CAGAGAGCTGGGCATTGGCGG	0.632																																																	0													35.0	39.0	37.0					1																	27685071		2202	4299	6501	SO:0001583	missense	0			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2615C>T	1.37:g.27685071G>A	ENSP00000419591:p.Pro872Leu		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P872L	ENST00000493901.1	37	c.2615	CCDS299.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.164103|5.164103	0.94727|0.94727	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582|ENST00000472410	T;T;T|T	0.27104|0.28255	1.69;1.69;1.69|1.62	5.23|5.23	5.23|5.23	0.72850|0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.60599|0.60599	0.2281|0.2281	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.68633|0.68633	-0.5357|-0.5357	9|7	0.87932|0.87932	D|D	0|0	.|.	17.5658|17.5658	0.87919|0.87919	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	864;872|.	O95382-3;O95382|.	.;M3K6_HUMAN|.	L|S	864;872;595;872|596	ENSP00000363152:P864L;ENSP00000419591:P872L;ENSP00000350195:P872L|ENSP00000418731:P596S	ENSP00000350195:P872L|ENSP00000418731:P596S	P|P	-|-	2|1	0|0	MAP3K6|MAP3K6	27557658|27557658	1.000000|1.000000	0.71417|0.71417	0.971000|0.971000	0.41717|0.41717	0.980000|0.980000	0.70556|0.70556	9.448000|9.448000	0.97600|0.97600	2.464000|2.464000	0.83262|0.83262	0.561000|0.561000	0.74099|0.74099	CCC|CCA	MAP3K6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000142733		0.632	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2		0.00	69	0	G	NM_004672		27685071	-1			no_errors	ENST00000357582	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
MEA1	4201	genome.wustl.edu	37	6	42980987	42980987	+	Missense_Mutation	SNP	C	C	G	rs201793021		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:42980987C>G	ENST00000244711.3	-	2	323	c.169G>C	c.(169-171)Gag>Cag	p.E57Q	KLHDC3_ENST00000244670.8_5'Flank|KLHDC3_ENST00000326974.4_5'Flank	NM_014623.2	NP_055438.1	Q16626	MEA1_HUMAN	male-enhanced antigen 1	57					cell differentiation (GO:0030154)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				central_nervous_system(1)|large_intestine(3)|lung(1)|skin(1)	6			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TCCTCCTGCTCTTCCTCAGGC	0.602																																																	0													108.0	110.0	109.0					6																	42980987		2203	4300	6503	SO:0001583	missense	0				CCDS4879.1	6p21.3-p21.1	2008-08-15	2005-06-02	2005-06-02	ENSG00000124733	ENSG00000124733			6986	protein-coding gene	gene with protein product		143170	"""male-enhanced antigen"""	MEA		2813404, 12444059	Standard	NM_014623		Approved		uc003otk.3	Q16626	OTTHUMG00000014717	ENST00000244711.3:c.169G>C	6.37:g.42980987C>G	ENSP00000244711:p.Glu57Gln		Q5TC36|Q9BV01	Missense_Mutation	SNP	pfam_MEA1	p.E57Q	ENST00000244711.3	37	c.169	CCDS4879.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.147687	0.94603	.	.	ENSG00000124733	ENST00000244711	T	0.55413	0.52	6.07	6.07	0.98685	.	0.109197	0.64402	D	0.000007	T	0.50871	0.1641	L	0.27053	0.805	0.58432	D	0.999997	D	0.56968	0.978	P	0.57057	0.812	T	0.52624	-0.8551	10	0.62326	D	0.03	-4.0737	20.2629	0.98456	0.0:1.0:0.0:0.0	.	57	Q16626	MEA1_HUMAN	Q	57	ENSP00000244711:E57Q	ENSP00000244711:E57Q	E	-	1	0	MEA1	43088965	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	6.360000	0.73064	2.890000	0.99128	0.585000	0.79938	GAG	MEA1	-	pfam_MEA1	ENSG00000124733		0.602	MEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEA1	HGNC	protein_coding	OTTHUMT00000040574.2	-	0.00	66	0	C			42980987	-1	tier1	-	no_errors	ENST00000244711	ensembl	human	known	74_37	missense	13.64	76	12	SNP	1.000	G
ME1	4199	genome.wustl.edu	37	6	83947511	83947511	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:83947511C>G	ENST00000369705.3	-	9	1067	c.951G>C	c.(949-951)ttG>ttC	p.L317F	ME1_ENST00000541327.1_Missense_Mutation_p.L151F|ME1_ENST00000543031.1_Missense_Mutation_p.L242F	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	317					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		CTTCTTTTTCCAAGGCCATCA	0.343																																																	0													89.0	81.0	84.0					6																	83947511		2203	4300	6503	SO:0001583	missense	0			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.951G>C	6.37:g.83947511C>G	ENSP00000358719:p.Leu317Phe		B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.L317F	ENST00000369705.3	37	c.951	CCDS34492.1	6	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548198	0.45383	.	.	ENSG00000065833	ENST00000369705;ENST00000541327;ENST00000543031	T;T;T	0.32515	1.45;1.45;1.45	5.64	4.78	0.61160	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.070244	0.85682	D	0.000000	T	0.26593	0.0650	L	0.54323	1.7	0.35300	D	0.782914	P	0.41393	0.748	P	0.47528	0.549	T	0.14755	-1.0461	10	0.87932	D	0	-15.9445	13.4813	0.61336	0.0:0.9234:0.0:0.0766	.	317	P48163	MAOX_HUMAN	F	317;151;242	ENSP00000358719:L317F;ENSP00000439912:L151F;ENSP00000446114:L242F	ENSP00000358719:L317F	L	-	3	2	ME1	84004230	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	7.149000	0.77396	1.395000	0.46643	-0.136000	0.14681	TTG	ME1	-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd	ENSG00000065833		0.343	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME1	HGNC	protein_coding	OTTHUMT00000041350.1	-	0.00	37	0	C			83947511	-1	tier1	-	no_errors	ENST00000369705	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	G
MDN1	23195	genome.wustl.edu	37	6	90402667	90402667	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:90402667G>C	ENST00000369393.3	-	63	10197	c.10082C>G	c.(10081-10083)tCt>tGt	p.S3361C	MDN1_ENST00000428876.1_Missense_Mutation_p.S3361C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3361					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TACTTGGGCAGACCGTGGCCC	0.592																																																	0													60.0	51.0	54.0					6																	90402667		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10082C>G	6.37:g.90402667G>C	ENSP00000358400:p.Ser3361Cys		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.S3361C	ENST00000369393.3	37	c.10082	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989783	0.54041	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03607	3.87;3.87	5.19	5.19	0.71726	.	0.132235	0.52532	D	0.000067	T	0.05640	0.0148	M	0.62723	1.935	0.58432	D	0.999995	D	0.55172	0.97	P	0.47673	0.554	T	0.23976	-1.0173	10	0.66056	D	0.02	.	19.0637	0.93101	0.0:0.0:1.0:0.0	.	3361	Q9NU22	MDN1_HUMAN	C	3361	ENSP00000358400:S3361C;ENSP00000413970:S3361C	ENSP00000358400:S3361C	S	-	2	0	MDN1	90459388	1.000000	0.71417	0.955000	0.39395	0.484000	0.33280	8.759000	0.91667	2.578000	0.87016	0.491000	0.48974	TCT	MDN1	-	pirsf_Midasin	ENSG00000112159		0.592	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	41	0	G			90402667	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	16.13	26	5	SNP	0.921	C
MED13L	23389	genome.wustl.edu	37	12	116434866	116434866	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:116434866G>C	ENST00000281928.3	-	15	2945	c.2739C>G	c.(2737-2739)ttC>ttG	p.F913L		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	913						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTTCCATTTTGAATTCTGTGA	0.423																																																	0													240.0	223.0	229.0					12																	116434866		2203	4300	6503	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.2739C>G	12.37:g.116434866G>C	ENSP00000281928:p.Phe913Leu		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.F913L	ENST00000281928.3	37	c.2739	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816489	0.50527	.	.	ENSG00000123066	ENST00000281928	T	0.73575	-0.76	5.87	0.917	0.19380	.	0.095419	0.85682	D	0.000000	T	0.61502	0.2352	L	0.40543	1.245	0.39278	D	0.964508	P	0.43788	0.817	B	0.39339	0.297	T	0.56323	-0.7998	10	0.25751	T	0.34	-15.9654	11.4648	0.50232	0.4274:0.0:0.5726:0.0	.	913	Q71F56	MD13L_HUMAN	L	913	ENSP00000281928:F913L	ENSP00000281928:F913L	F	-	3	2	MED13L	114919249	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	1.330000	0.33781	-0.090000	0.12462	-0.229000	0.12294	TTC	MED13L	-	NULL	ENSG00000123066		0.423	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	-	0.00	39	0	G			116434866	-1	tier1	-	no_errors	ENST00000281928	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.969	C
MIA3	375056	genome.wustl.edu	37	1	222826624	222826624	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:222826624G>C	ENST00000344922.5	+	15	4289	c.4264G>C	c.(4264-4266)Gag>Cag	p.E1422Q	MIA3_ENST00000340535.7_Missense_Mutation_p.E300Q|MIA3_ENST00000344441.6_Missense_Mutation_p.E1422Q|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1422					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		ATCTGAATCTGAGGGTCAAAA	0.398																																																	0													140.0	130.0	133.0					1																	222826624		1862	4098	5960	SO:0001583	missense	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.4264G>C	1.37:g.222826624G>C	ENSP00000340900:p.Glu1422Gln		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E1422Q	ENST00000344922.5	37	c.4264	CCDS41470.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.01|18.01	3.528866|3.528866	0.64860|0.64860	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471|ENST00000354906	T;T;T|.	0.72167|.	-0.63;-0.63;1.56|.	5.66|5.66	4.75|4.75	0.60458|0.60458	.|.	.|.	.|.	.|.	.|.	T|.	0.58481|.	0.2125|.	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	1|1	P;P;P|.	0.49862|.	0.78;0.798;0.929|.	B;B;B|.	0.40702|.	0.306;0.319;0.338|.	T|.	0.52968|.	-0.8504|.	9|.	0.38643|.	T|.	0.18|.	.|.	16.7488|16.7488	0.85480|0.85480	0.0:0.1291:0.8709:0.0|0.0:0.1291:0.8709:0.0	.|.	1363;300;1422|.	Q5JRA6-2;Q5JRA6-4;Q5JRA6|.	.;.;MIA3_HUMAN|.	Q|S	1422;1422;1363;300;300|945	ENSP00000340900:E1422Q;ENSP00000340587:E1422Q;ENSP00000345866:E300Q|.	ENSP00000284471:E300Q|.	E|X	+|+	1|2	0|2	MIA3|MIA3	220893247|220893247	1.000000|1.000000	0.71417|0.71417	0.011000|0.011000	0.14972|0.14972	0.976000|0.976000	0.68499|0.68499	5.606000|5.606000	0.67641|0.67641	1.386000|1.386000	0.46466|0.46466	0.557000|0.557000	0.71058|0.71058	GAG|TGA	MIA3	-	NULL	ENSG00000154305		0.398	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4		0.00	41	0	G	NM_198551		222826624	+1			no_errors	ENST00000344441	ensembl	human	known	74_37	missense	7.69	72	6	SNP	0.155	C
MRAS	22808	genome.wustl.edu	37	3	138121105	138121105	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:138121105C>T	ENST00000289104.4	+	6	1268	c.621C>T	c.(619-621)atC>atT	p.I207I	MRAS_ENST00000474559.1_Silent_p.I207I|MRAS_ENST00000423968.2_Silent_p.I207I|MRAS_ENST00000464896.1_Silent_p.I131I	NM_001085049.2|NM_001252090.1|NM_001252091.1|NM_012219.4	NP_001078518.1|NP_001239019.1|NP_001239020.1|NP_036351.3	O14807	RASM_HUMAN	muscle RAS oncogene homolog	207					actin cytoskeleton organization (GO:0030036)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|Ras protein signal transduction (GO:0007265)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	14						AATGTGTGATCTTGTGACAGG	0.557																																																	0													57.0	61.0	60.0					3																	138121105		2203	4300	6503	SO:0001819	synonymous_variant	0			AF022080	CCDS3100.1, CCDS58855.1	3q22.3	2014-05-09			ENSG00000158186	ENSG00000158186			7227	protein-coding gene	gene with protein product		608435				9400994, 10446149	Standard	NM_012219		Approved	M-RAs, R-RAS3, RRAS3	uc003esi.4	O14807	OTTHUMG00000159888	ENST00000289104.4:c.621C>T	3.37:g.138121105C>T			B4DIK0|Q86WX8	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_EF_GTP-bd_dom,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I207	ENST00000289104.4	37	c.621	CCDS3100.1	3																																																																																			MRAS	-	smart_Ran_GTPase	ENSG00000158186		0.557	MRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRAS	HGNC	protein_coding	OTTHUMT00000357990.1	-	0.00	41	0	C			138121105	+1	tier1	-	no_errors	ENST00000289104	ensembl	human	known	74_37	silent	20.59	54	14	SNP	0.741	T
MROH9	80133	genome.wustl.edu	37	1	170959080	170959080	+	Silent	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:170959080T>C	ENST00000367758.3	+	11	1063	c.964T>C	c.(964-966)Ttg>Ctg	p.L322L	MROH9_ENST00000367759.4_Silent_p.L322L	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	322																	TATCACTTTGTTGACATGCAC	0.458																																																	0													150.0	143.0	145.0					1																	170959080		1934	4145	6079	SO:0001819	synonymous_variant	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.964T>C	1.37:g.170959080T>C			A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	superfamily_ARM-type_fold	p.L322	ENST00000367758.3	37	c.964	CCDS41436.1	1																																																																																			MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.458	MROH9-001	KNOWN	basic|CCDS	protein_coding	MROH9	HGNC	protein_coding	OTTHUMT00000099327.1	-	0.00	55	0	T	NM_025063		170959080	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	silent	6.73	97	7	SNP	0.006	C
MSH3	4437	genome.wustl.edu	37	5	79950579	79950579	+	Silent	SNP	C	C	G	rs564921007	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:79950579C>G	ENST00000265081.6	+	1	113	c.33C>G	c.(31-33)ctC>ctG	p.L11L	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	11					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CGGGCGGCCTCGCTGCCTCCA	0.697								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0													23.0	22.0	22.0					5																	79950579		2196	4293	6489	SO:0001819	synonymous_variant	0			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.33C>G	5.37:g.79950579C>G			A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.L11	ENST00000265081.6	37	c.33	CCDS34195.1	5																																																																																			MSH3	-	NULL	ENSG00000113318		0.697	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1		0.00	30	0	C	NM_002439		79950579	+1			no_errors	ENST00000265081	ensembl	human	known	74_37	silent	10.34	26	3	SNP	0.000	G
ASB12	142689	genome.wustl.edu	37	X	63445264	63445264	+	Missense_Mutation	SNP	C	C	A	rs34689841	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:63445264C>A	ENST00000396130.2	-	1	239	c.240G>T	c.(238-240)ttG>ttT	p.L80F	ASB12_ENST00000362002.2_Missense_Mutation_p.L89F|MTMR8_ENST00000453546.1_Missense_Mutation_p.L464F			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	80					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						AGAGGACTTGCAAACAGCTCA	0.537																																																	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)											73.0	48.0	57.0					X																	63445264		2203	4300	6503	SO:0001583	missense	0			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.240G>T	X.37:g.63445264C>A	ENSP00000379435:p.Leu80Phe		J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L464F	ENST00000396130.2	37	c.1392		X	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014284	0.35511	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.66638	-0.22;-0.22;-0.22	3.56	2.7	0.31948	Ankyrin repeat-containing domain (4);	0.077595	0.53938	D	0.000059	T	0.76652	0.4017	M	0.74467	2.265	0.25154	N	0.990401	D;P	0.76494	0.999;0.873	D;P	0.72982	0.979;0.741	T	0.65768	-0.6088	10	0.87932	D	0	-16.2753	6.4162	0.21717	0.0:0.759:0.0:0.241	.	464;80	B4DQL0;Q8WXK4	.;ASB12_HUMAN	F	89;80;89;464	ENSP00000355195:L89F;ENSP00000379435:L80F;ENSP00000394003:L464F	ENSP00000354626:L89F	L	-	3	2	ASB12;MTMR8	63361989	0.578000	0.26717	0.125000	0.21846	0.381000	0.30169	0.220000	0.17660	0.677000	0.31305	0.529000	0.55759	TTG	MTMR8	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000102043		0.537	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	MTMR8	HGNC	protein_coding		-	0.00	16	0	C			63445264	-1	tier1	-	no_errors	ENST00000453546	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.957	A
MUC16	94025	genome.wustl.edu	37	19	9084625	9084625	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:9084625G>C	ENST00000397910.4	-	1	7393	c.7190C>G	c.(7189-7191)tCa>tGa	p.S2397*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2397	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTCATTCCTGAGATGCTAGT	0.468																																																	0													114.0	113.0	113.0					19																	9084625		1977	4170	6147	SO:0001587	stop_gained	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7190C>G	19.37:g.9084625G>C	ENSP00000381008:p.Ser2397*		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S2397*	ENST00000397910.4	37	c.7190	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	46	12.890786	0.99704	.	.	ENSG00000181143	ENST00000397910	.	.	.	0.225	-0.451	0.12214	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	2397	.	ENSP00000381008:S2397X	S	-	2	0	MUC16	8945625	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	-0.238000	0.08977	-0.839000	0.04212	-0.834000	0.03071	TCA	MUC16	-	NULL	ENSG00000181143		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	54	0	G	NM_024690		9084625	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	nonsense	12.50	84	12	SNP	0.007	C
MYBL1	4603	genome.wustl.edu	37	8	67485683	67485683	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:67485683G>T	ENST00000522677.3	-	11	1939	c.1529C>A	c.(1528-1530)tCa>tAa	p.S510*	MYBL1_ENST00000524176.2_Nonsense_Mutation_p.S510*|MYBL1_ENST00000517885.1_Nonsense_Mutation_p.S168*	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	510	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			AATAGGGGTTGATGTAAATGA	0.353																																																	0													141.0	132.0	135.0					8																	67485683		1819	4089	5908	SO:0001587	stop_gained	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1529C>A	8.37:g.67485683G>T	ENSP00000429633:p.Ser510*		E7EW29|Q495F9	Nonsense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S510*	ENST00000522677.3	37	c.1529	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	G	41	8.845519	0.98976	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1166	19.6002	0.95559	0.0:0.0:1.0:0.0	.	.	.	.	X	510;168;510	.	ENSP00000428265:S168X	S	-	2	0	MYBL1	67648237	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.611000	0.90905	2.691000	0.91804	0.655000	0.94253	TCA	MYBL1	-	pfam_C-myb_C	ENSG00000185697		0.353	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	-	0.00	61	0	G	XM_034274		67485683	-1	tier1	-	no_errors	ENST00000522677	ensembl	human	known	74_37	nonsense	5.43	87	5	SNP	1.000	T
MYH13	8735	genome.wustl.edu	37	17	10206759	10206759	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:10206759C>G	ENST00000418404.3	-	37	5686	c.5523G>C	c.(5521-5523)ctG>ctC	p.L1841L	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.L1841L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1841					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GGGCTCCCTTCAGGGCTTCAG	0.512																																																	0													155.0	152.0	153.0					17																	10206759		1922	4145	6067	SO:0001819	synonymous_variant	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5523G>C	17.37:g.10206759C>G			O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1841	ENST00000418404.3	37	c.5523	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.512	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	65	0	C	NM_003802		10206759	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	silent	9.26	98	10	SNP	0.819	G
MYH14	79784	genome.wustl.edu	37	19	50720965	50720965	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:50720965C>T	ENST00000596571.1	+	2	499	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C	MYH14_ENST00000262269.8_Missense_Mutation_p.R167C|MYH14_ENST00000440075.2_Missense_Mutation_p.R167C|MYH14_ENST00000425460.1_Missense_Mutation_p.R167C|MYH14_ENST00000598205.1_Missense_Mutation_p.R167C|MYH14_ENST00000601313.1_Missense_Mutation_p.R167C|MYH14_ENST00000376970.2_Missense_Mutation_p.R167C			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	167	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGGCAAGAAGCGCCACGAGGT	0.617																																																	0													77.0	85.0	82.0					19																	50720965		2170	4270	6440	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.499C>T	19.37:g.50720965C>T	ENSP00000472819:p.Arg167Cys		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R167C	ENST00000596571.1	37	c.499	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745449	0.69418	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	4.63	4.63	0.57726	Myosin head, motor domain (2);	.	.	.	.	D	0.96839	0.8968	H	0.99042	4.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98093	1.0410	9	0.87932	D	0	.	15.3635	0.74499	0.0:1.0:0.0:0.0	.	167;167;167	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	C	167	ENSP00000406273:R167C;ENSP00000366169:R167C;ENSP00000407879:R167C;ENSP00000262269:R167C	ENSP00000262269:R167C	R	+	1	0	MYH14	55412777	0.985000	0.35326	1.000000	0.80357	0.883000	0.51084	0.286000	0.18902	2.579000	0.87056	0.655000	0.94253	CGC	MYH14	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000105357		0.617	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	-	0.00	35	0	C	NM_024729		50720965	+1	tier1	-	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
MYH4	4622	genome.wustl.edu	37	17	10354724	10354724	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:10354724C>T	ENST00000255381.2	-	28	3894	c.3784G>A	c.(3784-3786)Gaa>Aaa	p.E1262K	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1262					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GTTTTTATTTCACTAAGCTGG	0.408																																																	0													225.0	193.0	204.0					17																	10354724		2203	4300	6503	SO:0001583	missense	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3784G>A	17.37:g.10354724C>T	ENSP00000255381:p.Glu1262Lys			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1262K	ENST00000255381.2	37	c.3784	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862270	0.91511	.	.	ENSG00000141048	ENST00000255381	D	0.82526	-1.62	5.62	5.62	0.85841	Myosin tail (1);	0.000000	0.38005	U	0.001849	D	0.91751	0.7391	H	0.95679	3.705	0.80722	D	1	B	0.25007	0.116	B	0.39771	0.309	D	0.90831	0.4716	10	0.87932	D	0	.	20.0359	0.97557	0.0:1.0:0.0:0.0	.	1262	Q9Y623	MYH4_HUMAN	K	1262	ENSP00000255381:E1262K	ENSP00000255381:E1262K	E	-	1	0	MYH4	10295449	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.815000	0.86186	2.805000	0.96524	0.655000	0.94253	GAA	MYH4	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000264424		0.408	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	-	0.00	58	0	C	NM_017533		10354724	-1	tier1	-	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	11.63	75	10	SNP	1.000	T
MYO9A	4649	genome.wustl.edu	37	15	72244100	72244100	+	Intron	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:72244100C>G	ENST00000356056.5	-	15	2775				MYO9A_ENST00000564571.1_Intron|MYO9A_ENST00000563542.1_Intron|MYO9A_ENST00000566885.1_Missense_Mutation_p.D369H|MYO9A_ENST00000424560.1_Intron|MYO9A_ENST00000444904.1_Intron	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AACAGTTTATCAGGATTTGTA	0.438																																																	0													171.0	159.0	163.0					15																	72244100		2199	4297	6496	SO:0001627	intron_variant	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2302+17G>C	15.37:g.72244100C>G			B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D369H	ENST00000356056.5	37	c.1105	CCDS10239.1	15																																																																																			MYO9A	-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000066933		0.438	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	-	0.00	61	0	C	NM_006901		72244100	-1	tier1	-	no_errors	ENST00000566885	ensembl	human	putative	74_37	missense	10.10	89	10	SNP	0.009	G
MYT1L	23040	genome.wustl.edu	37	2	1795777	1795777	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:1795777A>T	ENST00000399161.2	-	25	4170	c.3423T>A	c.(3421-3423)gaT>gaA	p.D1141E	MYT1L_ENST00000428368.2_Missense_Mutation_p.D1139E|MYT1L_ENST00000407844.1_Missense_Mutation_p.D139E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1141					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CATTGATTGGATCCTACGAGA	0.313																																																	0													71.0	60.0	64.0					2																	1795777		1821	4080	5901	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3423T>A	2.37:g.1795777A>T	ENSP00000382114:p.Asp1141Glu		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D1141E	ENST00000399161.2	37	c.3423		2	.	.	.	.	.	.	.	.	.	.	A	0.369	-0.935060	0.02340	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000428368	T;T	0.37411	1.2;1.2	5.87	4.67	0.58626	.	0.086329	0.85682	D	0.000000	T	0.08846	0.0219	N	0.00621	-1.32	0.39047	D	0.960253	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.20605	-1.0270	10	0.02654	T	1	-34.8935	6.1956	0.20548	0.7425:0.0:0.0856:0.1719	.	139;1141;1139	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	E	1141;1087;139;1139	ENSP00000382114:D1141E;ENSP00000396103:D1139E	ENSP00000295067:D1087E	D	-	3	2	MYT1L	1774784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.653000	0.37323	1.007000	0.39238	0.529000	0.55759	GAT	MYT1L	-	NULL	ENSG00000186487		0.313	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	23	0	A	NM_015025		1795777	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	T
NAV3	89795	genome.wustl.edu	37	12	78569186	78569186	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:78569186G>C	ENST00000397909.2	+	25	5255	c.5082G>C	c.(5080-5082)aaG>aaC	p.K1694N	NAV3_ENST00000536525.2_Missense_Mutation_p.K1694N|NAV3_ENST00000266692.7_Missense_Mutation_p.K1517N|NAV3_ENST00000228327.6_Missense_Mutation_p.K1694N			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1694	Poly-Lys.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CCGACTCCAAGAAGAAGAAAA	0.398										HNSCC(70;0.22)																																							0													91.0	87.0	88.0					12																	78569186		1863	4100	5963	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5082G>C	12.37:g.78569186G>C	ENSP00000381007:p.Lys1694Asn		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.K1694N	ENST00000397909.2	37	c.5082		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.73|17.73	3.461108|3.461108	0.63513|0.63513	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|D;D;D;D;D	.|0.93811	.|-3.29;-3.29;-3.29;-3.29;-3.29	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.37906	.|U	.|0.001897	D|D	0.95774|0.95774	0.8625|0.8625	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.988;0.999;1.0;1.0	.|P;D;D;D	.|0.85130	.|0.864;0.994;0.948;0.997	D|D	0.95264|0.95264	0.8371|0.8371	5|10	.|0.52906	.|T	.|0.07	-18.5398|-18.5398	13.3168|13.3168	0.60411|0.60411	0.0822:0.0:0.9178:0.0|0.0822:0.0:0.9178:0.0	.|.	.|1694;1517;1694;1694	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	Q|N	589|1694;1694;1694;1517;315;323	.|ENSP00000446132:K1694N;ENSP00000381007:K1694N;ENSP00000228327:K1694N;ENSP00000266692:K1517N;ENSP00000448303:K323N	.|ENSP00000228327:K1694N	E|K	+|+	1|3	0|2	NAV3|NAV3	77093317|77093317	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.775000|0.775000	0.43874|0.43874	3.406000|3.406000	0.52637|0.52637	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GAA|AAG	NAV3	-	NULL	ENSG00000067798		0.398	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	96	0	G	NM_001024383		78569186	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	8.55	107	10	SNP	1.000	C
NDUFB7	4713	genome.wustl.edu	37	19	14677011	14677011	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:14677011C>T	ENST00000215565.2	-	3	409	c.348G>A	c.(346-348)gaG>gaA	p.E116E		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	116					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCGCCTTCTTCTCCCGCCGCT	0.637																																																	0													26.0	31.0	30.0					19																	14677011		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.348G>A	19.37:g.14677011C>T			Q6ICN9|Q9UI16	Silent	SNP	pfam_NADH_UbQ_OxRdtase_B18_su	p.E116	ENST00000215565.2	37	c.348	CCDS12314.1	19																																																																																			NDUFB7	-	NULL	ENSG00000099795		0.637	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB7	HGNC	protein_coding	OTTHUMT00000466025.1	-	0.00	53	0	C	NM_004146		14677011	-1	tier1	-	no_errors	ENST00000215565	ensembl	human	known	74_37	silent	7.89	70	6	SNP	0.002	T
NIPBL	25836	genome.wustl.edu	37	5	36975895	36975895	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:36975895A>G	ENST00000282516.8	+	9	1385	c.886A>G	c.(886-888)Atc>Gtc	p.I296V	NIPBL_ENST00000448238.2_Missense_Mutation_p.I296V|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	296					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			ACCACCTTTAATCCTACAATC	0.348																																																	0													109.0	112.0	111.0					5																	36975895		2203	4300	6503	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.886A>G	5.37:g.36975895A>G	ENSP00000282516:p.Ile296Val		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I296V	ENST00000282516.8	37	c.886	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	A	14.93	2.683352	0.47991	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.96168	-3.91;-3.93	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.94876	0.8344	N	0.24115	0.695	0.43824	D	0.996392	P;P	0.46327	0.803;0.876	P;P	0.61800	0.785;0.894	D	0.94055	0.7321	10	0.30078	T	0.28	.	14.9485	0.71050	1.0:0.0:0.0:0.0	.	296;296	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	296	ENSP00000282516:I296V;ENSP00000406266:I296V	ENSP00000282516:I296V	I	+	1	0	NIPBL	37011652	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	8.912000	0.92726	1.935000	0.56089	0.383000	0.25322	ATC	NIPBL	-	NULL	ENSG00000164190		0.348	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	-	0.00	28	0	A	NM_015384		36975895	+1	tier1	-	no_errors	ENST00000282516	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	G
NOL10	79954	genome.wustl.edu	37	2	10799328	10799328	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:10799328C>G	ENST00000381685.5	-	10	831	c.726G>C	c.(724-726)ttG>ttC	p.L242F	NOL10_ENST00000538384.1_Missense_Mutation_p.L216F|NOL10_ENST00000542668.1_Missense_Mutation_p.L192F|NOL10_ENST00000345985.3_Missense_Mutation_p.L242F	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	242						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)					Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		CTGCCATGGTCAAGGCACCAT	0.383																																																	0													86.0	79.0	81.0					2																	10799328		2203	4300	6503	SO:0001583	missense	0			AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.726G>C	2.37:g.10799328C>G	ENSP00000371101:p.Leu242Phe		A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Missense_Mutation	SNP	pfam_NUC153,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.L242F	ENST00000381685.5	37	c.726	CCDS1673.2	2	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532158	0.64972	.	.	ENSG00000115761	ENST00000345985;ENST00000381685;ENST00000542668;ENST00000538384;ENST00000431319	T;T;T;T;T	0.65916	2.29;2.77;-0.18;2.77;1.73	5.58	2.78	0.32641	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.995;0.996;0.999	T	0.70539	-0.4844	10	0.34782	T	0.22	-0.9738	6.2001	0.20571	0.0:0.6518:0.1338:0.2144	.	216;92;242;242	B4DLV0;Q9BSC4-3;Q9BSC4;Q9BSC4-2	.;.;NOL10_HUMAN;.	F	242;242;192;216;133	ENSP00000263837:L242F;ENSP00000371101:L242F;ENSP00000437625:L192F;ENSP00000439663:L216F;ENSP00000403170:L133F	ENSP00000263837:L242F	L	-	3	2	NOL10	10716779	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.396000	0.34531	0.298000	0.22638	0.563000	0.77884	TTG	NOL10	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000115761		0.383	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL10	HGNC	protein_coding	OTTHUMT00000239227.1	-	0.00	41	0	C	NM_024894		10799328	-1	tier1	-	no_errors	ENST00000381685	ensembl	human	known	74_37	missense	11.76	60	8	SNP	1.000	G
NOTCH1	4851	genome.wustl.edu	37	9	139404376	139404377	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:139404376_139404377insA	ENST00000277541.6	-	18	2852_2853	c.2777_2778insT	c.(2776-2778)atcfs	p.I926fs		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	926	EGF-like 24. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGGCCGTGTTGATGCCGTCTGT	0.658			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0																																										SO:0001589	frameshift_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2778dupT	9.37:g.139404377_139404377dupA	ENSP00000277541:p.Ile926fs		Q59ED8|Q5SXM3	Frame_Shift_Ins	INS	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.N927fs	ENST00000277541.6	37	c.2778_2777	CCDS43905.1	9																																																																																			NOTCH1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.658	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1		0.00	58	0	-	NM_017617		139404377	-1	tier1		no_errors	ENST00000277541	ensembl	human	known	74_37	frame_shift_ins	23.19	53	16	INS	0.907:0.900	A
NOTCH2	4853	genome.wustl.edu	37	1	120484162	120484162	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:120484162C>T	ENST00000256646.2	-	18	3187	c.2968G>A	c.(2968-2970)Gag>Aag	p.E990K		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	990	EGF-like 26; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAGTGCACTCATTGATGTTG	0.483			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													116.0	91.0	99.0					1																	120484162		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2968G>A	1.37:g.120484162C>T	ENSP00000256646:p.Glu990Lys		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.E990K	ENST00000256646.2	37	c.2968	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.679636	0.96774	.	.	ENSG00000134250	ENST00000256646	D	0.91996	-2.95	6.08	6.08	0.98989	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.37906	U	0.001891	D	0.96364	0.8814	M	0.84773	2.715	0.80722	D	1	D;D	0.69078	0.997;0.988	D;P	0.81914	0.995;0.696	D	0.95618	0.8678	10	0.56958	D	0.05	.	19.6603	0.95864	0.0:1.0:0.0:0.0	.	990;990	Q6IQ50;Q04721	.;NOTC2_HUMAN	K	990	ENSP00000256646:E990K	ENSP00000256646:E990K	E	-	1	0	NOTCH2	120285685	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	7.382000	0.79729	2.894000	0.99253	0.591000	0.81541	GAG	NOTCH2	-	pirsf_Notch,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000134250		0.483	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	-	0.00	68	0	C	NM_024408		120484162	-1	tier1	-	no_errors	ENST00000256646	ensembl	human	known	74_37	missense	8.26	111	10	SNP	1.000	T
NPAS3	64067	genome.wustl.edu	37	14	34029384	34029384	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:34029384G>A	ENST00000356141.4	+	5	526	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K	NPAS3_ENST00000551008.1_Missense_Mutation_p.E74K|NPAS3_ENST00000551492.1_Missense_Mutation_p.E181K|NPAS3_ENST00000346562.2_Missense_Mutation_p.E144K|NPAS3_ENST00000357798.5_Missense_Mutation_p.E163K|NPAS3_ENST00000341321.4_Missense_Mutation_p.E176K|NPAS3_ENST00000548645.1_Missense_Mutation_p.E146K|NPAS3_ENST00000547068.1_Missense_Mutation_p.E72K			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	176	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GTACATTTCCGAAACAGTCTC	0.348																																																	0													80.0	81.0	81.0					14																	34029384		2203	4300	6503	SO:0001583	missense	0			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.526G>A	14.37:g.34029384G>A	ENSP00000348460:p.Glu176Lys		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.E176K	ENST00000356141.4	37	c.526	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.681221	0.96774	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008;ENST00000546849	T;T;T;T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.82	5.82	0.92795	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.53302	0.1788	M	0.83692	2.655	0.80722	D	1	D;D;D;D;D	0.89917	0.994;1.0;1.0;1.0;1.0	P;D;D;D;D	0.80764	0.66;0.985;0.991;0.985;0.994	T	0.56025	-0.8047	10	0.72032	D	0.01	.	20.0966	0.97849	0.0:0.0:1.0:0.0	.	74;146;176;144;163	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	K	153;181;144;176;146;176;163;72;74;86	ENSP00000448373:E153K;ENSP00000450392:E181K;ENSP00000319610:E144K;ENSP00000344158:E176K;ENSP00000448916:E146K;ENSP00000348460:E176K;ENSP00000350446:E163K;ENSP00000449542:E72K;ENSP00000447213:E74K;ENSP00000446700:E86K	ENSP00000344158:E176K	E	+	1	0	NPAS3	33099135	1.000000	0.71417	0.992000	0.48379	0.957000	0.61999	9.807000	0.99171	2.753000	0.94483	0.557000	0.71058	GAA	NPAS3	-	pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	ENSG00000151322		0.348	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	-	0.00	50	0	G			34029384	+1	tier1	-	no_errors	ENST00000356141	ensembl	human	known	74_37	missense	13.98	80	13	SNP	1.000	A
NRCAM	4897	genome.wustl.edu	37	7	107789071	107789071	+	3'UTR	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:107789071C>G	ENST00000379028.3	-	0	5669				NRCAM_ENST00000522550.2_5'UTR|NRCAM_ENST00000413765.2_3'UTR|NRCAM_ENST00000379024.4_3'UTR|NRCAM_ENST00000351718.4_3'UTR			Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTCTTAGATTCTGAAATGTAT	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000379028.3:c.*1284G>C	7.37:g.107789071C>G			A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	RNA	SNP	-	NULL	ENST00000379028.3	37	NULL	CCDS47686.1	7																																																																																			NRCAM	-	-	ENSG00000091129		0.323	NRCAM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding		-	0.00	46	0	C	NM_001037132		107789071	-1	tier1	-	no_errors	ENST00000522550	ensembl	human	known	74_37	rna	15.79	48	9	SNP	0.641	G
NTRK3	4916	genome.wustl.edu	37	15	88474392	88474392	+	Intron	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:88474392C>G	ENST00000360948.2	-	16	2051				NTRK3_ENST00000355254.2_Intron|NTRK3_ENST00000542733.2_Intron|NTRK3_ENST00000357724.2_Intron|NTRK3_ENST00000394480.2_Intron|NTRK3_ENST00000558676.1_Intron|NTRK3_ENST00000557856.1_Intron	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			tcccttttATCATGTATGACA	0.433			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													26.0	24.0	25.0					15																	88474392		876	1991	2867	SO:0001627	intron_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1890-1727G>C	15.37:g.88474392C>G			B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	RNA	SNP	-	NULL	ENST00000360948.2	37	NULL	CCDS32322.1	15																																																																																			NTRK3	-	-	ENSG00000140538		0.433	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	86	0	C			88474392	-1	tier1	-	no_errors	ENST00000559680	ensembl	human	putative	74_37	rna	7.64	133	11	SNP	0.000	G
OR4C5	79346	genome.wustl.edu	37	11	48387907	48387907	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:48387907G>A	ENST00000319813.3	-	1	110	c.111C>T	c.(109-111)ggC>ggT	p.G37G				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TCTGTGTCAGGCCAAGCAAGA	0.398																																																	0																																										SO:0001819	synonymous_variant	0					11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.111C>T	11.37:g.48387907G>A			Q6IFB2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G37	ENST00000319813.3	37	c.111		11																																																																																			OR4C5	-	NULL	ENSG00000176540		0.398	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	HGNC	protein_coding	OTTHUMT00000404174.1	-	0.00	40	0	G	NG_002247		48387907	-1	tier1	-	no_errors	ENST00000319813	ensembl	human	known	74_37	silent	9.09	70	7	SNP	0.989	A
OR4C15	81309	genome.wustl.edu	37	11	55321806	55321807	+	Missense_Mutation	DNP	AC	AC	GA			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:55321806_55321807AC>GA	ENST00000314644.2	+	1	24_25	c.24_25AC>GA	c.(22-27)gcACtc>gcGAtc	p.L9I		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CAACAGAAGCACTCAATAATTT	0.302										HNSCC(20;0.049)																																							0																																										SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	Exception_encountered	11.37:g.55321806_55321807delinsGA	ENSP00000324958:p.Leu9Ile		Q6IFE2	Silent|Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A8|p.L9I	ENST00000314644.2	37	c.24|c.25	CCDS31501.1	11																																																																																			OR4C15	-	NULL	ENSG00000181939		0.302	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	-	0.00	36|37	0	A|C	NM_001001920		55321806|55321807	+1	tier1	-	no_errors	ENST00000314644	ensembl	human	known	74_37	silent|missense	13.04	60	9	SNP	0.001|0.000	G|A
OR5AK2	390181	genome.wustl.edu	37	11	56756448	56756448	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:56756448G>A	ENST00000326855.2	+	1	102	c.60G>A	c.(58-60)caG>caA	p.Q20Q		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q20H(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TTGGTGCCCAGCATGAGTTTT	0.408																																																	1	Substitution - Missense(1)	breast(1)											150.0	143.0	145.0					11																	56756448		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.60G>A	11.37:g.56756448G>A			B2RNZ9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q20	ENST00000326855.2	37	c.60	CCDS31538.1	11																																																																																			OR5AK2	-	NULL	ENSG00000181273		0.408	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	HGNC	protein_coding	OTTHUMT00000392446.1	-	0.00	100	0	G	NM_001005323		56756448	+1	tier1	-	no_errors	ENST00000326855	ensembl	human	known	74_37	silent	8.70	147	14	SNP	0.000	A
OSBPL6	114880	genome.wustl.edu	37	2	179197727	179197727	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:179197727G>C	ENST00000190611.4	+	8	992	c.616G>C	c.(616-618)Gaa>Caa	p.E206Q	OSBPL6_ENST00000315022.2_Missense_Mutation_p.E185Q|OSBPL6_ENST00000409045.3_Missense_Mutation_p.E206Q|OSBPL6_ENST00000392505.2_Missense_Mutation_p.E206Q|OSBPL6_ENST00000357080.4_Missense_Mutation_p.E206Q|OSBPL6_ENST00000409631.1_Missense_Mutation_p.E206Q|OSBPL6_ENST00000359685.3_Missense_Mutation_p.E206Q	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	206					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GTCCACAGCTGAATCCTCACC	0.383																																																	0													96.0	84.0	88.0					2																	179197727		2203	4300	6503	SO:0001583	missense	0			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.616G>C	2.37:g.179197727G>C	ENSP00000190611:p.Glu206Gln		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E185Q	ENST00000190611.4	37	c.553	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612807	0.87258	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.12569	2.7;2.7;2.67;2.69;2.68;2.7;2.7	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.29158	0.0725	L	0.38531	1.155	0.80722	D	1	B;D;D;D;P;D	0.61080	0.024;0.975;0.989;0.975;0.935;0.986	B;P;D;P;P;P	0.70487	0.022;0.87;0.969;0.87;0.575;0.844	T	0.00391	-1.1769	10	0.30854	T	0.27	-20.9883	19.9215	0.97087	0.0:0.0:1.0:0.0	.	206;185;206;206;206;206	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	Q	206;206;206;206;206;206;185	ENSP00000376293:E206Q;ENSP00000352713:E206Q;ENSP00000349591:E206Q;ENSP00000387248:E206Q;ENSP00000190611:E206Q;ENSP00000386885:E206Q;ENSP00000318723:E185Q	ENSP00000190611:E206Q	E	+	1	0	OSBPL6	178905973	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.216000	0.77974	2.785000	0.95823	0.655000	0.94253	GAA	OSBPL6	-	NULL	ENSG00000079156		0.383	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2		0.00	36	0	G	NM_032523		179197727	+1			no_errors	ENST00000315022	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	C
OTP	23440	genome.wustl.edu	37	5	76932724	76932724	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:76932724G>A	ENST00000306422.3	-	2	1507	c.369C>T	c.(367-369)ttC>ttT	p.F123F	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	123					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		GAGTCTTGGCGAAGCTCCTCT	0.637																																																	0													114.0	112.0	112.0					5																	76932724		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.369C>T	5.37:g.76932724G>A				Silent	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,pfscan_OAR_dom,pfscan_Homeobox_dom	p.F123	ENST00000306422.3	37	c.369	CCDS4039.1	5																																																																																			OTP	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000171540		0.637	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTP	HGNC	protein_coding	OTTHUMT00000220016.2	-	0.00	98	0	G			76932724	-1	tier1	-	no_errors	ENST00000306422	ensembl	human	known	74_37	silent	6.48	101	7	SNP	1.000	A
OTUD1	220213	genome.wustl.edu	37	10	23729743	23729743	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:23729743C>G	ENST00000376495.3	+	1	1546	c.1357C>G	c.(1357-1359)Caa>Gaa	p.Q453E		NM_001145373.2	NP_001138845.1	Q5VV17	OTUD1_HUMAN	OTU deubiquitinase 1	453					protein K63-linked deubiquitination (GO:0070536)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						CAAACAAACTCAAGTGCAAAG	0.413																																																	0													94.0	81.0	85.0					10																	23729743		692	1591	2283	SO:0001583	missense	0			AK096389	CCDS44366.1	10p12.31	2014-02-24	2014-02-24		ENSG00000165312	ENSG00000165312		"""OTU domain containing"""	27346	protein-coding gene	gene with protein product		612022	"""OTU domain containing 1"""	OTDC1		23827681	Standard	NM_001145373		Approved	DUBA7	uc001irr.2	Q5VV17	OTTHUMG00000017819	ENST00000376495.3:c.1357C>G	10.37:g.23729743C>G	ENSP00000365678:p.Gln453Glu			Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.Q453E	ENST00000376495.3	37	c.1357	CCDS44366.1	10	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594377	0.66219	.	.	ENSG00000165312	ENST00000376495	.	.	.	5.7	4.8	0.61643	.	0.000000	0.64402	U	0.000004	T	0.51958	0.1705	N	0.24115	0.695	0.45390	D	0.998371	D	0.67145	0.996	P	0.54499	0.754	T	0.55848	-0.8076	9	0.52906	T	0.07	-0.7084	14.8766	0.70498	0.0:0.931:0.0:0.069	.	453	Q5VV17	OTUD1_HUMAN	E	453	.	ENSP00000365678:Q453E	Q	+	1	0	OTUD1	23769749	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.897000	0.69831	1.397000	0.46682	0.655000	0.94253	CAA	OTUD1	-	NULL	ENSG00000165312		0.413	OTUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD1	HGNC	protein_coding	OTTHUMT00000047215.1		0.00	30	0	C	XM_166659		23729743	+1			no_errors	ENST00000376495	ensembl	human	known	74_37	missense	7.50	36	3	SNP	1.000	G
OXA1L	5018	genome.wustl.edu	37	14	23235862	23235862	+	Silent	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:23235862T>C	ENST00000285848.5	+	1	132	c.132T>C	c.(130-132)ggT>ggC	p.G44G	OXA1L_ENST00000358043.5_5'Flank|OXA1L_ENST00000412791.1_5'Flank|OXA1L_ENST00000604262.1_5'Flank|CTD-2555K7.2_ENST00000554730.1_RNA|CTD-2555K7.2_ENST00000553792.1_RNA|CTD-2555K7.2_ENST00000554857.1_RNA	NM_005015.3	NP_005006.3	Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	0			V -> A (in dbSNP:rs8572). {ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex I biogenesis (GO:0097031)|negative regulation of ATPase activity (GO:0032780)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|protein complex assembly (GO:0006461)|protein insertion into membrane (GO:0051205)|protein tetramerization (GO:0051262)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	mitochondrial ribosome binding (GO:0097177)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|skin(2)	19	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		TCTCGAGGGGTTGTGGTTCTT	0.557																																																	0													106.0	117.0	113.0					14																	23235862		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9573.1	14q11.2	2009-05-26			ENSG00000155463	ENSG00000155463			8526	protein-coding gene	gene with protein product		601066				8586451, 19349278	Standard	NM_005015		Approved	MGC133129, OXA1	uc001wgn.2	Q15070	OTTHUMG00000028691	ENST00000285848.5:c.132T>C	14.37:g.23235862T>C			B4DPA2	Silent	SNP	pfam_Membrane_insert_OXA1/ALB3/YidC,tigrfam_Membr_insert_YidC/Oxa1_C	p.G44	ENST00000285848.5	37	c.132	CCDS9573.1	14																																																																																			OXA1L	-	NULL	ENSG00000155463		0.557	OXA1L-001	KNOWN	basic|CCDS	protein_coding	OXA1L	HGNC	protein_coding	OTTHUMT00000071630.2	-	0.00	35	0	T	NM_005015		23235862	+1	tier1	-	no_errors	ENST00000285848	ensembl	human	known	74_37	silent	12.90	54	8	SNP	0.000	C
P2RY4	5030	genome.wustl.edu	37	X	69478523	69478523	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:69478523G>A	ENST00000374519.2	-	1	1131	c.952C>T	c.(952-954)Cgt>Tgt	p.R318C		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	318					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)	p.R318C(1)		cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						CAGAGCTGACGGAGCTGACGT	0.622																																																	1	Substitution - Missense(1)	large_intestine(1)											47.0	40.0	42.0					X																	69478523		2203	4300	6503	SO:0001583	missense	0			X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.952C>T	X.37:g.69478523G>A	ENSP00000363643:p.Arg318Cys		Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y4_rcpt,prints_GPCR_Rhodpsn,prints_P2Y2_rcpt	p.R318C	ENST00000374519.2	37	c.952	CCDS14398.1	X	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568998	0.28003	.	.	ENSG00000186912	ENST00000374519	T	0.25085	1.82	4.7	1.78	0.24846	.	1.012330	0.07916	U	0.975151	T	0.16128	0.0388	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	P	0.46452	0.517	T	0.20042	-1.0287	10	0.33141	T	0.24	.	7.738	0.28825	0.2628:0.0:0.7372:0.0	.	318	P51582	P2RY4_HUMAN	C	318	ENSP00000363643:R318C	ENSP00000363643:R318C	R	-	1	0	P2RY4	69395248	0.951000	0.32395	0.019000	0.16419	0.334000	0.28698	2.378000	0.44309	0.042000	0.15717	0.589000	0.80489	CGT	P2RY4	-	prints_P2Y4_rcpt	ENSG00000186912		0.622	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	HGNC	protein_coding	OTTHUMT00000057058.2	-	0.00	40	0	G	NM_002565		69478523	-1	tier1	-	no_errors	ENST00000374519	ensembl	human	known	74_37	missense	33.33	44	22	SNP	0.023	A
PAPD5	64282	genome.wustl.edu	37	16	50261847	50261847	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:50261847C>T	ENST00000561678.1	+	10	1597	c.1523C>T	c.(1522-1524)tCt>tTt	p.S508F	PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000436909.3_Missense_Mutation_p.S618F|PAPD5_ENST00000357464.3_Missense_Mutation_p.S539F			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5	492	Ser-rich.				histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TTGGAGTCCTCTCAGGCAGTT	0.488																																																	0													99.0	96.0	97.0					16																	50261847		1940	4147	6087	SO:0001583	missense	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.1523C>T	16.37:g.50261847C>T	ENSP00000455837:p.Ser508Phe		B4DV38|Q9NW67|Q9Y6C0	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.S618F	ENST00000561678.1	37	c.1853		16	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647970	0.67358	.	.	ENSG00000121274	ENST00000436909;ENST00000357464	T;T	0.48836	0.8;0.82	6.17	6.17	0.99709	.	0.452000	0.26453	N	0.024286	T	0.29945	0.0749	N	0.08118	0	0.36852	D	0.887926	P;B	0.45902	0.868;0.435	B;B	0.39805	0.31;0.06	T	0.40346	-0.9568	10	0.62326	D	0.03	.	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	618;492	B4DV38;Q8NDF8	.;PAPD5_HUMAN	F	618;539	ENSP00000396995:S618F;ENSP00000350054:S539F	ENSP00000350054:S539F	S	+	2	0	PAPD5	48819348	0.908000	0.30866	0.936000	0.37596	0.992000	0.81027	2.851000	0.48302	2.941000	0.99782	0.655000	0.94253	TCT	PAPD5	-	NULL	ENSG00000121274		0.488	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	-	0.00	54	0	C	NM_022447		50261847	+1	tier1	-	no_errors	ENST00000436909	ensembl	human	known	74_37	missense	23.68	87	27	SNP	1.000	T
PCCA	5095	genome.wustl.edu	37	13	100861714	100861714	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:100861714C>G	ENST00000376285.1	+	7	635	c.597C>G	c.(595-597)gtC>gtG	p.V199V	PCCA_ENST00000376279.3_Silent_p.V199V|PCCA_ENST00000376286.4_Silent_p.V173V	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	199	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ATGGAGTAGTCAAGGTGAGAA	0.333																																																	0													127.0	112.0	117.0					13																	100861714		2203	4300	6503	SO:0001819	synonymous_variant	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.597C>G	13.37:g.100861714C>G			B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Silent	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.V199	ENST00000376285.1	37	c.597	CCDS9496.2	13																																																																																			PCCA	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom	ENSG00000175198		0.333	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	-	0.00	28	0	C			100861714	+1	tier1	-	no_errors	ENST00000376285	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	G
PCDHA2	56146	genome.wustl.edu	37	5	140174599	140174599	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:140174599C>G	ENST00000526136.1	+	1	50	c.50C>G	c.(49-51)tCg>tGg	p.S17W	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.S17W|PCDHA2_ENST00000520672.2_Missense_Mutation_p.S17W|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	17					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCTGCTCTCGCTTCTGCTC	0.587																																																	0													34.0	41.0	38.0					5																	140174599		2203	4300	6503	SO:0001583	missense	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.50C>G	5.37:g.140174599C>G	ENSP00000431748:p.Ser17Trp		O75287|Q9BTV3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S17W	ENST00000526136.1	37	c.50	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	c	1.229	-0.624670	0.03636	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.52526	0.73;0.66;0.7	4.01	-2.51	0.06365	.	1.179440	0.06668	U	0.765657	T	0.33089	0.0851	L	0.34521	1.04	0.31980	N	0.606002	B;B;B	0.12013	0.005;0.003;0.005	B;B;B	0.18561	0.001;0.01;0.022	T	0.34576	-0.9823	10	0.37606	T	0.19	.	5.7536	0.18160	0.0:0.2897:0.2483:0.462	.	17;17;17	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	W	17	ENSP00000430584:S17W;ENSP00000367372:S17W;ENSP00000431748:S17W	ENSP00000367372:S17W	S	+	2	0	PCDHA2	140154783	0.000000	0.05858	0.020000	0.16555	0.079000	0.17450	-2.127000	0.01315	-0.425000	0.07371	-1.205000	0.01647	TCG	PCDHA2	-	NULL	ENSG00000204969		0.587	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	-	0.00	39	0	C	NM_018905		140174599	+1	tier1	-	no_errors	ENST00000526136	ensembl	human	known	74_37	missense	12.90	54	8	SNP	0.968	G
PCDHB1	29930	genome.wustl.edu	37	5	140431453	140431453	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:140431453T>C	ENST00000306549.3	+	1	475	c.398T>C	c.(397-399)tTc>tCc	p.F133S		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	133	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCCAGTTTTCCTAAACAAG	0.537																																																	0													36.0	39.0	38.0					5																	140431453		2203	4300	6503	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.398T>C	5.37:g.140431453T>C	ENSP00000307234:p.Phe133Ser		Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F133S	ENST00000306549.3	37	c.398	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	T	19.88	3.908489	0.72868	.	.	ENSG00000171815	ENST00000306549	T	0.32023	1.47	5.81	5.81	0.92471	Cadherin (2);Cadherin-like (1);	0.000000	0.49305	D	0.000143	T	0.76162	0.3949	H	0.99777	4.77	0.53688	D	0.999972	D	0.89917	1.0	D	0.87578	0.998	D	0.87891	0.2684	10	0.87932	D	0	.	16.162	0.81727	0.0:0.0:0.0:1.0	.	133	Q9Y5F3	PCDB1_HUMAN	S	133	ENSP00000307234:F133S	ENSP00000307234:F133S	F	+	2	0	PCDHB1	140411637	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.907000	0.87430	2.224000	0.72417	0.533000	0.62120	TTC	PCDHB1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000171815		0.537	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	-	0.00	32	0	T	NM_013340		140431453	+1	tier1	-	no_errors	ENST00000306549	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.998	C
PCDHB6	56130	genome.wustl.edu	37	5	140530592	140530592	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:140530592G>A	ENST00000231136.1	+	1	754	c.754G>A	c.(754-756)Gag>Aag	p.E252K	PCDHB6_ENST00000543635.1_Missense_Mutation_p.E116K	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	252	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAAGTCCCTGAGAACAACCC	0.522																																																	0													50.0	53.0	52.0					5																	140530592		2203	4300	6503	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.754G>A	5.37:g.140530592G>A	ENSP00000231136:p.Glu252Lys		B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E252K	ENST00000231136.1	37	c.754	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739199	0.69304	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.76316	-1.01;-1.01	4.85	4.85	0.62838	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93099	0.7803	H	0.98276	4.19	0.51482	D	0.999921	D	0.89917	1.0	D	0.97110	1.0	D	0.95931	0.8938	9	0.87932	D	0	.	18.3285	0.90261	0.0:0.0:1.0:0.0	.	252	Q9Y5E3	PCDB6_HUMAN	K	116;252;37	ENSP00000438466:E116K;ENSP00000231136:E252K	ENSP00000231136:E252K	E	+	1	0	PCDHB6	140510776	1.000000	0.71417	0.565000	0.28409	0.238000	0.25445	7.964000	0.87933	2.394000	0.81467	0.561000	0.74099	GAG	PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113211		0.522	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	-	0.00	34	0	G	NM_018939		140530592	+1	tier1	-	no_errors	ENST00000231136	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	A
PCED1A	64773	genome.wustl.edu	37	20	2818908	2818908	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:2818908C>A	ENST00000360652.2	-	6	1313	c.811G>T	c.(811-813)Gtg>Ttg	p.V271L	VPS16_ENST00000380445.3_5'Flank|PCED1A_ENST00000356872.3_Missense_Mutation_p.V220L|VPS16_ENST00000380469.3_5'Flank	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	271																	GGCAGCTCCACGCCCCAGGCG	0.622																																																	0													97.0	87.0	90.0					20																	2818908		2203	4300	6503	SO:0001583	missense	0			AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.811G>T	20.37:g.2818908C>A	ENSP00000353868:p.Val271Leu		Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	NULL	p.V271L	ENST00000360652.2	37	c.811	CCDS13035.1	20	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007239	0.54361	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.50001	0.76;0.82;0.95;0.96	4.29	3.34	0.38264	Esterase, SGNH hydrolase-type (1);	0.071226	0.53938	D	0.000041	T	0.58395	0.2119	L	0.48877	1.53	0.47214	D	0.999354	D;D;D;D	0.89917	1.0;0.98;0.997;0.997	D;P;D;D	0.91635	0.999;0.793;0.984;0.925	T	0.59852	-0.7376	10	0.72032	D	0.01	-8.5999	9.9578	0.41678	0.0:0.8992:0.0:0.1008	.	220;267;118;271	Q9H1Q7-2;D3DVX4;B4DEI2;Q9H1Q7	.;.;.;F113A_HUMAN	L	220;271;220;271	ENSP00000349334:V220L;ENSP00000353868:V271L;ENSP00000388935:V220L;ENSP00000401711:V271L	ENSP00000349334:V220L	V	-	1	0	FAM113A	2766908	1.000000	0.71417	0.844000	0.33320	0.721000	0.41392	4.754000	0.62191	1.159000	0.42565	0.563000	0.77884	GTG	PCED1A	-	NULL	ENSG00000132635		0.622	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1A	HGNC	protein_coding	OTTHUMT00000077676.2	-	0.00	44	0	C	NM_022760		2818908	-1	tier1	-	no_errors	ENST00000360652	ensembl	human	known	74_37	missense	9.76	74	8	SNP	0.991	A
PCIF1	63935	genome.wustl.edu	37	20	44567713	44567713	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:44567713G>C	ENST00000372409.3	+	3	439	c.75G>C	c.(73-75)caG>caC	p.Q25H		NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	25					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						CCTCCAATCAGAGCCAGCCCT	0.632																																																	0													77.0	75.0	76.0					20																	44567713		2203	4300	6503	SO:0001583	missense	0			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.75G>C	20.37:g.44567713G>C	ENSP00000361486:p.Gln25His		E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	pfam_PCIF1_WW,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.Q25H	ENST00000372409.3	37	c.75	CCDS13388.1	20	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319468	0.60524	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.49	3.13	0.36017	.	0.294993	0.33419	N	0.004938	T	0.30759	0.0775	N	0.19112	0.55	0.42982	D	0.994467	P	0.49253	0.921	B	0.42163	0.378	T	0.05616	-1.0874	9	0.35671	T	0.21	-20.1786	9.4576	0.38764	0.089:0.1486:0.7624:0.0	.	25	Q9H4Z3	PCIF1_HUMAN	H	25	.	ENSP00000361486:Q25H	Q	+	3	2	PCIF1	44001120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.945000	0.63568	1.269000	0.44280	0.655000	0.94253	CAG	PCIF1	-	NULL	ENSG00000100982		0.632	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCIF1	HGNC	protein_coding	OTTHUMT00000079550.1	-	0.00	48	0	G	NM_022104		44567713	+1	tier1	-	no_errors	ENST00000372409	ensembl	human	known	74_37	missense	10.67	67	8	SNP	1.000	C
PDLIM3	27295	genome.wustl.edu	37	4	186456520	186456520	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:186456520G>A	ENST00000284770.5	-	1	142	c.69C>T	c.(67-69)ttC>ttT	p.F23F	PDLIM3_ENST00000284771.6_Silent_p.F23F|PDLIM3_ENST00000284767.5_Silent_p.F23F	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	23	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		AAGGCTGGTTGAAGTCTATGC	0.672																																																	0													46.0	49.0	48.0					4																	186456520		2203	4300	6503	SO:0001819	synonymous_variant	0			AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.69C>T	4.37:g.186456520G>A			B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Silent	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.F23	ENST00000284770.5	37	c.69	CCDS3844.1	4																																																																																			PDLIM3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000154553		0.672	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	PDLIM3	HGNC	protein_coding	OTTHUMT00000360499.2	-	0.00	46	0	G	NM_014476		186456520	-1	tier1	-	no_errors	ENST00000284770	ensembl	human	known	74_37	silent	12.28	50	7	SNP	0.999	A
PDS5B	23047	genome.wustl.edu	37	13	33330027	33330027	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:33330027C>G	ENST00000315596.10	+	26	3175	c.2989C>G	c.(2989-2991)Cac>Gac	p.H997D		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	997					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ATATACAATTCACCTTTTGGC	0.289																																																	0													128.0	117.0	121.0					13																	33330027		1818	4067	5885	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2989C>G	13.37:g.33330027C>G	ENSP00000313851:p.His997Asp		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H997D	ENST00000315596.10	37	c.2989	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935822	0.73442	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.66280	-0.2	5.65	5.65	0.86999	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77651	0.4162	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.76315	-0.3004	10	0.48119	T	0.1	-17.6613	19.7111	0.96096	0.0:1.0:0.0:0.0	.	997	Q9NTI5	PDS5B_HUMAN	D	997	ENSP00000313851:H997D	ENSP00000313851:H997D	H	+	1	0	PDS5B	32228027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.731000	0.84895	2.664000	0.90586	0.491000	0.48974	CAC	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.289	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	-	0.00	36	0	C	NM_015032		33330027	+1	tier1	-	no_errors	ENST00000315596	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	G
PDXK	8566	genome.wustl.edu	37	21	45152385	45152385	+	Intron	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr21:45152385G>C	ENST00000291565.4	+	2	270				PDXK_ENST00000327574.4_Missense_Mutation_p.E43Q|PDXK_ENST00000476313.1_Intron|PDXK_ENST00000398081.1_Intron|PDXK_ENST00000468090.1_Intron	NM_003681.4	NP_003672.1	O00764	PDXK_HUMAN	pyridoxal (pyridoxine, vitamin B6) kinase						cell proliferation (GO:0008283)|pyridoxal 5'-phosphate salvage (GO:0009443)|pyridoxal phosphate biosynthetic process (GO:0042823)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|protein homodimerization activity (GO:0042803)|pyridoxal kinase activity (GO:0008478)|pyridoxal phosphate binding (GO:0030170)|sodium ion binding (GO:0031402)|zinc ion binding (GO:0008270)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	TTTAAAAGCAGAAAATAGCGA	0.468																																																	0													164.0	160.0	161.0					21																	45152385		876	1991	2867	SO:0001627	intron_variant	0			U89606	CCDS13699.1	21q22.3	2007-05-10			ENSG00000160209	ENSG00000160209	2.7.1.35		8819	protein-coding gene	gene with protein product		179020	"""chromosome 21 open reading frame 97"", ""chromosome 21 open reading frame 124"""	C21orf97, C21orf124		9099727	Standard	NM_003681		Approved	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873	uc002zdm.4	O00764	OTTHUMG00000086870	ENST00000291565.4:c.88-1565G>C	21.37:g.45152385G>C			Q7Z2Y0|Q9BS02	Missense_Mutation	SNP	NULL	p.E43Q	ENST00000291565.4	37	c.127	CCDS13699.1	21	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322520	0.23994	.	.	ENSG00000160209	ENST00000327574	.	.	.	2.74	0.875	0.19130	.	.	.	.	.	T	0.40839	0.1133	.	.	.	0.09310	N	0.999999	D	0.69078	0.997	P	0.55713	0.782	T	0.19418	-1.0306	6	.	.	.	.	3.9662	0.09433	0.1441:0.2494:0.6065:0.0	.	43	A8MT14	.	Q	43	.	.	E	+	1	0	PDXK	43976813	0.002000	0.14202	0.032000	0.17829	0.640000	0.38277	0.127000	0.15790	0.221000	0.20879	0.655000	0.94253	GAA	PDXK	-	NULL	ENSG00000160209		0.468	PDXK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXK	HGNC	protein_coding	OTTHUMT00000195636.1	-	0.00	67	0	G	NM_003681		45152385	+1	tier1	-	no_errors	ENST00000327574	ensembl	human	putative	74_37	missense	17.19	53	11	SNP	0.060	C
PEAK1	79834	genome.wustl.edu	37	15	77407012	77407012	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:77407012C>T	ENST00000560626.2	-	7	5202	c.4727G>A	c.(4726-4728)cGc>cAc	p.R1576H	PEAK1_ENST00000312493.4_Missense_Mutation_p.R1576H			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1576	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TGGGGCAAGGCGAGACTGGTC	0.522																																																	0													119.0	117.0	117.0					15																	77407012		1905	4108	6013	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4727G>A	15.37:g.77407012C>T	ENSP00000452796:p.Arg1576His		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.R1576H	ENST00000560626.2	37	c.4727	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944554	0.92593	.	.	ENSG00000173517	ENST00000312493	T	0.73258	-0.73	5.47	5.47	0.80525	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.81861	0.4912	L	0.49513	1.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83086	-0.0135	10	0.87932	D	0	-7.1694	19.3317	0.94293	0.0:1.0:0.0:0.0	.	1576	Q9H792	PEAK1_HUMAN	H	1576	ENSP00000309230:R1576H	ENSP00000309230:R1576H	R	-	2	0	AC087465.1	75194067	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.582000	0.87167	0.561000	0.74099	CGC	PEAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000173517		0.522	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	HGNC	protein_coding	OTTHUMT00000419483.3	-	0.00	39	0	C			77407012	-1	tier1	-	no_errors	ENST00000312493	ensembl	human	known	74_37	missense	16.92	54	11	SNP	1.000	T
PHLDB3	653583	genome.wustl.edu	37	19	43983562	43983562	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:43983562C>G	ENST00000292140.5	-	14	2029	c.1669G>C	c.(1669-1671)Gac>Cac	p.D557H		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	557	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				GCTTGGCGGTCAAAGCAGAAC	0.632																																																	0													12.0	15.0	14.0					19																	43983562		2021	4132	6153	SO:0001583	missense	0				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1669G>C	19.37:g.43983562C>G	ENSP00000292140:p.Asp557His		Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D557H	ENST00000292140.5	37	c.1669	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	C	19.62	3.860869	0.71834	.	.	ENSG00000176531	ENST00000292140	T	0.75367	-0.93	4.59	4.59	0.56863	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000002	D	0.85026	0.5603	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86836	0.2014	10	0.87932	D	0	.	15.7522	0.77994	0.0:1.0:0.0:0.0	.	227;557	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	H	557	ENSP00000292140:D557H	ENSP00000292140:D557H	D	-	1	0	PHLDB3	48675402	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	6.996000	0.76263	2.501000	0.84356	0.585000	0.79938	GAC	PHLDB3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000176531		0.632	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	-	0.00	59	0	C			43983562	-1	tier1	-	no_errors	ENST00000292140	ensembl	human	known	74_37	missense	11.49	77	10	SNP	1.000	G
PIKFYVE	200576	genome.wustl.edu	37	2	209182630	209182630	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:209182630G>T	ENST00000264380.4	+	16	2205	c.2047G>T	c.(2047-2049)Ggc>Tgc	p.G683C		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	683					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GGTTGTCAATGGCTTTGTTTG	0.358																																																	0													202.0	191.0	195.0					2																	209182630		2203	4300	6503	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2047G>T	2.37:g.209182630G>T	ENSP00000264380:p.Gly683Cys		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.G683C	ENST00000264380.4	37	c.2047	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971737	0.92919	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	D;D	0.94793	-3.52;-3.52	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.98015	0.9346	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98323	1.0529	10	0.87932	D	0	-17.091	20.2617	0.98447	0.0:0.0:1.0:0.0	.	683;627	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	C	683;259;627	ENSP00000264380:G683C;ENSP00000405736:G627C	ENSP00000264380:G683C	G	+	1	0	PIKFYVE	208890875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.793000	0.96121	0.655000	0.94253	GGC	PIKFYVE	-	pfam_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000115020		0.358	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2		0.00	60	0	G	NM_015040		209182630	+1			no_errors	ENST00000264380	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
PLBD1	79887	genome.wustl.edu	37	12	14664608	14664608	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:14664608G>A	ENST00000240617.5	-	7	1534	c.882C>T	c.(880-882)agC>agT	p.S294S		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	294					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						TCAATCCACTGCTAAGAATGT	0.403																																																	0													56.0	56.0	56.0					12																	14664608		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.882C>T	12.37:g.14664608G>A			A8K4E9|Q9BVV3|Q9H625	Silent	SNP	pfam_PLipase_B-like	p.S294	ENST00000240617.5	37	c.882	CCDS31751.1	12																																																																																			PLBD1	-	pfam_PLipase_B-like	ENSG00000121316		0.403	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	-	0.00	35	0	G	NM_024829		14664608	-1	tier1	-	no_errors	ENST00000240617	ensembl	human	known	74_37	silent	11.59	61	8	SNP	1.000	A
PLCG1	5335	genome.wustl.edu	37	20	39788339	39788339	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:39788339C>T	ENST00000373271.1	+	2	716	c.311C>T	c.(310-312)tCa>tTa	p.S104L	PLCG1_ENST00000373272.2_Missense_Mutation_p.S104L|PLCG1_ENST00000244007.3_Missense_Mutation_p.S104L	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	104	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CCGGACCAGTCACATTGCTTT	0.507																																																	0													100.0	103.0	102.0					20																	39788339		2203	4300	6503	SO:0001583	missense	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.311C>T	20.37:g.39788339C>T	ENSP00000362368:p.Ser104Leu		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.S104L	ENST00000373271.1	37	c.311	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377364	0.61735	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.65178	-0.14;-0.14;-0.14	5.07	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.061513	0.64402	D	0.000003	T	0.46502	0.1396	N	0.11698	0.16	0.47037	D	0.999292	B;B	0.09022	0.002;0.002	B;B	0.09377	0.002;0.004	T	0.32534	-0.9903	10	0.28530	T	0.3	.	18.4505	0.90702	0.0:1.0:0.0:0.0	.	104;104	P19174;A2A284	PLCG1_HUMAN;.	L	104	ENSP00000244007:S104L;ENSP00000362368:S104L;ENSP00000362369:S104L	ENSP00000244007:S104L	S	+	2	0	PLCG1	39221753	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.442000	0.80503	2.360000	0.80028	0.650000	0.86243	TCA	PLCG1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pirsf_PLC-gamma,pfscan_Pleckstrin_homology	ENSG00000124181		0.507	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	-	0.00	43	0	C	NM_182811		39788339	+1	tier1	-	no_errors	ENST00000244007	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
PLEC	5339	genome.wustl.edu	37	8	144996792	144996792	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:144996792C>T	ENST00000322810.4	-	31	7885	c.7716G>A	c.(7714-7716)gaG>gaA	p.E2572E	PLEC_ENST00000436759.2_Silent_p.E2462E|PLEC_ENST00000354589.3_Silent_p.E2435E|PLEC_ENST00000356346.3_Silent_p.E2421E|PLEC_ENST00000345136.3_Silent_p.E2435E|PLEC_ENST00000357649.2_Silent_p.E2439E|PLEC_ENST00000354958.2_Silent_p.E2413E|PLEC_ENST00000398774.2_Silent_p.E2403E|PLEC_ENST00000527096.1_Silent_p.E2458E	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2572	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTCGCTGGATCTCCAGTGTCT	0.642																																																	0													45.0	48.0	47.0					8																	144996792		2175	4279	6454	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7716G>A	8.37:g.144996792C>T			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2572	ENST00000322810.4	37	c.7716	CCDS43772.1	8																																																																																			PLEC	-	NULL	ENSG00000178209		0.642	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	21	0	C	NM_000445		144996792	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	silent	20.31	51	13	SNP	1.000	T
PLEKHM2	23207	genome.wustl.edu	37	1	16043265	16043265	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:16043265C>G	ENST00000375799.3	+	3	458	c.231C>G	c.(229-231)atC>atG	p.I77M	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.I77M	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	77	Interaction with KIF5B.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GAGAGGCCATCAAGCAGATCG	0.592																																																	0													43.0	44.0	44.0					1																	16043265		2077	4221	6298	SO:0001583	missense	0			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.231C>G	1.37:g.16043265C>G	ENSP00000364956:p.Ile77Met		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.I77M	ENST00000375799.3	37	c.231	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761734	0.69763	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.33654	1.4;1.4	5.72	4.8	0.61643	RUN (2);	0.290828	0.38058	N	0.001828	T	0.53610	0.1807	M	0.73598	2.24	0.43724	D	0.996207	P	0.45011	0.848	P	0.57371	0.819	T	0.56044	-0.8044	10	0.87932	D	0	-11.1307	10.5475	0.45068	0.0:0.7931:0.1349:0.072	.	77	Q8IWE5	PKHM2_HUMAN	M	77	ENSP00000364956:I77M;ENSP00000364950:I77M	ENSP00000364950:I77M	I	+	3	3	PLEKHM2	15915852	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	2.005000	0.40864	2.696000	0.92011	0.650000	0.86243	ATC	PLEKHM2	-	pfam_Run,pfscan_Run	ENSG00000116786		0.592	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	-	0.00	32	0	C	NM_015164		16043265	+1	tier1	-	no_errors	ENST00000375799	ensembl	human	known	74_37	missense	8.70	41	4	SNP	0.995	G
PLEKHA6	22874	genome.wustl.edu	37	1	204228389	204228389	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:204228389C>T	ENST00000272203.3	-	8	1320	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.R355Q|PLEKHA6_ENST00000485632.1_5'Flank	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	335	Pro-rich.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GCCTCACCTCCGAAGGTCTTC	0.617																																																	0													30.0	34.0	33.0					1																	204228389		2203	4300	6503	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1004G>A	1.37:g.204228389C>T	ENSP00000272203:p.Arg335Gln		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R335Q	ENST00000272203.3	37	c.1004	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583653	0.46006	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.11169	2.8;3.23	5.45	5.45	0.79879	.	0.472357	0.24443	N	0.038499	T	0.08891	0.0220	L	0.52364	1.645	0.39426	D	0.966994	P	0.45768	0.866	B	0.31442	0.13	T	0.07195	-1.0785	10	0.54805	T	0.06	.	9.6187	0.39708	0.0:0.8434:0.0:0.1566	.	335	Q9Y2H5	PKHA6_HUMAN	Q	335;355	ENSP00000272203:R335Q;ENSP00000402046:R355Q	ENSP00000272203:R335Q	R	-	2	0	PLEKHA6	202495012	0.980000	0.34600	0.996000	0.52242	0.637000	0.38172	1.993000	0.40747	2.560000	0.86352	0.561000	0.74099	CGG	PLEKHA6	-	NULL	ENSG00000143850		0.617	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	-	0.00	25	0	C	NM_014935		204228389	-1	tier1	-	no_errors	ENST00000272203	ensembl	human	known	74_37	missense	13.16	33	5	SNP	0.863	T
PLXNA2	5362	genome.wustl.edu	37	1	208390941	208390941	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:208390941G>A	ENST00000367033.3	-	2	1084	c.327C>T	c.(325-327)ctC>ctT	p.L109L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	109	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CATTGTTGGTGAGGGTGAGCA	0.582																																																	0													110.0	107.0	108.0					1																	208390941		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.327C>T	1.37:g.208390941G>A			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L109	ENST00000367033.3	37	c.327	CCDS31013.1	1																																																																																			PLXNA2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000076356		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	57	0	G	NM_025179		208390941	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	10.19	97	11	SNP	0.965	A
PLXND1	23129	genome.wustl.edu	37	3	129324787	129324787	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:129324787G>T	ENST00000324093.4	-	1	874	c.696C>A	c.(694-696)ttC>ttA	p.F232L	PLXND1_ENST00000393239.1_Missense_Mutation_p.F232L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	232	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GCGTGTTCTCGAAGCGGTGGT	0.692																																					Ovarian(97;366 1484 3738 22084 39045)												0													36.0	36.0	36.0					3																	129324787		2202	4299	6501	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.696C>A	3.37:g.129324787G>T	ENSP00000317128:p.Phe232Leu		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.F232L	ENST00000324093.4	37	c.696	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	g	16.46	3.130685	0.56828	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.33438	1.47;1.41	3.52	0.575	0.17374	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (3);	1.825470	0.03253	U	0.182122	T	0.48370	0.1496	M	0.63428	1.95	0.43588	D	0.995938	D	0.76494	0.999	D	0.74674	0.984	T	0.59495	-0.7444	10	0.09338	T	0.73	.	8.3462	0.32275	0.2812:0.0:0.7188:0.0	.	232	Q9Y4D7	PLXD1_HUMAN	L	232	ENSP00000317128:F232L;ENSP00000376931:F232L	ENSP00000317128:F232L	F	-	3	2	PLXND1	130807477	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	1.781000	0.38644	0.215000	0.20761	-0.703000	0.03666	TTC	PLXND1	-	superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000004399		0.692	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4		0.00	22	0	G	NM_015103		129324787	-1			no_errors	ENST00000324093	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
MCOLN1	57192	genome.wustl.edu	37	19	7600729	7600729	+	IGR	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:7600729G>C	ENST00000264079.6	+	0	2082				PNPLA6_ENST00000414982.3_Missense_Mutation_p.E28Q|PNPLA6_ENST00000221249.6_Intron|PNPLA6_ENST00000600737.1_Missense_Mutation_p.E19Q|PNPLA6_ENST00000545201.2_Intron|CTD-2207O23.10_ENST00000601870.1_Intron|PNPLA6_ENST00000450331.3_Intron	NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GAAGGTGGCGGAGAGGGATGG	0.687																																																	0													56.0	60.0	59.0					19																	7600729		692	1591	2283	SO:0001628	intergenic_variant	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1			19.37:g.7600729G>C			D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E28Q	ENST00000264079.6	37	c.82	CCDS12180.1	19	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386175	0.25031	.	.	ENSG00000032444	ENST00000414982	T	0.44482	0.92	3.34	-4.3	0.03710	.	.	.	.	.	T	0.22820	0.0551	N	0.19112	0.55	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26985	-1.0087	9	0.56958	D	0.05	.	5.787	0.18338	0.2299:0.5146:0.2555:0.0	.	19;19	Q8IY17;Q8IY17-3	PLPL6_HUMAN;.	Q	28	ENSP00000407509:E28Q	ENSP00000407509:E28Q	E	+	1	0	PNPLA6	7506729	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.215000	0.09279	-0.386000	0.07821	-0.291000	0.09656	GAG	PNPLA6	-	NULL	ENSG00000032444		0.687	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000458974.2		0.00	56	0	G	NM_020533		7600729	+1			no_errors	ENST00000414982	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	C
PODN	127435	genome.wustl.edu	37	1	53544495	53544495	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:53544495C>T	ENST00000312553.5	+	8	1464	c.1457C>T	c.(1456-1458)tCg>tTg	p.S486L	PODN_ENST00000371500.3_Missense_Mutation_p.S467L|PODN_ENST00000395871.2_Missense_Mutation_p.S344L|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	438					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTGGACCTGTCGGGCAACCGG	0.657																																																	0													64.0	52.0	56.0					1																	53544495		2203	4298	6501	SO:0001583	missense	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1457C>T	1.37:g.53544495C>T	ENSP00000308315:p.Ser486Leu		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.S486L	ENST00000312553.5	37	c.1457	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035432	0.93630	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.62364	0.03;0.03;0.03	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.81264	0.4786	M	0.82517	2.595	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.981;0.997;0.951	D	0.84509	0.0621	10	0.87932	D	0	.	18.0614	0.89378	0.0:1.0:0.0:0.0	.	344;467;486	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	L	467;344;486	ENSP00000360555:S467L;ENSP00000379212:S344L;ENSP00000308315:S486L	ENSP00000308315:S486L	S	+	2	0	PODN	53317083	1.000000	0.71417	0.978000	0.43139	0.972000	0.66771	5.756000	0.68757	2.492000	0.84095	0.555000	0.69702	TCG	PODN	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000174348		0.657	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	-	0.00	54	0	C	NM_153703		53544495	+1	tier1	-	no_errors	ENST00000312553	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	T
POLG	5428	genome.wustl.edu	37	15	89876828	89876830	+	In_Frame_Del	DEL	TGC	TGC	-	rs527965158|rs587781117|rs573261648|rs369920352	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:89876828_89876830delTGC	ENST00000268124.5	-	2	489_491	c.156_158delGCA	c.(154-159)cagcaa>caa	p.52_53QQ>Q	POLG_ENST00000525806.1_5'Flank|RP11-217B1.2_ENST00000562356.1_RNA|POLG_ENST00000442287.2_In_Frame_Del_p.52_53QQ>Q|RP11-217B1.2_ENST00000569473.1_RNA	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	52	Poly-Gln.				aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			aggctgctgttgctgctgctgct	0.69								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)												0																																										SO:0001651	inframe_deletion	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.156_158delGCA	15.37:g.89876837_89876839delTGC	ENSP00000268124:p.Gln55del		Q8NFM2|Q92515	In_Frame_Del	DEL	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.Q55in_frame_del	ENST00000268124.5	37	c.158_156	CCDS10350.1	15																																																																																			POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub	ENSG00000140521		0.690	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2		0.00	23	0	TGC	NM_002693		89876830	-1	tier1		no_errors	ENST00000268124	ensembl	human	known	74_37	in_frame_del	11.43	31	4	DEL	0.005:0.011:0.014	-
POLR3A	11128	genome.wustl.edu	37	10	79784318	79784318	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:79784318C>T	ENST00000372371.3	-	5	771	c.634G>A	c.(634-636)Gga>Aga	p.G212R		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	212					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TGTGCCCTTCCCAGCAGAGGC	0.522																																																	0													105.0	96.0	99.0					10																	79784318		2203	4300	6503	SO:0001583	missense	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.634G>A	10.37:g.79784318C>T	ENSP00000361446:p.Gly212Arg		Q8IW34|Q8TCW5	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.G212R	ENST00000372371.3	37	c.634	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	C	11.63	1.694763	0.30052	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.20738	2.05	5.52	4.62	0.57501	RNA polymerase Rpb1, domain 1 (1);	1.413740	0.04151	N	0.321344	T	0.23014	0.0556	L	0.37561	1.115	0.44366	D	0.997269	B	0.02656	0.0	B	0.12156	0.007	T	0.03473	-1.1033	9	.	.	.	-12.0865	14.2508	0.66019	0.0:0.9285:0.0:0.0715	.	212	O14802	RPC1_HUMAN	R	212	ENSP00000361446:G212R	.	G	-	1	0	POLR3A	79454324	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	2.681000	0.46926	1.334000	0.45468	0.555000	0.69702	GGA	POLR3A	-	pfam_RNA_pol_Rpb1_1	ENSG00000148606		0.522	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1	-	0.00	37	0	C	NM_007055		79784318	-1	tier1	-	no_errors	ENST00000372371	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	T
PPIP5K2	23262	genome.wustl.edu	37	5	102488444	102488444	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:102488444C>A	ENST00000358359.3	+	10	1630	c.1121C>A	c.(1120-1122)tCt>tAt	p.S374Y	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.S374Y|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.S374Y|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	374	Polyphosphoinositide-binding domain.				inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCAACTACATCTGGAACTATG	0.323																																																	0													80.0	81.0	81.0					5																	102488444		2203	4295	6498	SO:0001583	missense	0			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1121C>A	5.37:g.102488444C>A	ENSP00000351126:p.Ser374Tyr		A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.S374Y	ENST00000358359.3	37	c.1121		5	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709018	0.68615	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.16073	2.37;2.37;2.37	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.19208	0.0461	L	0.35723	1.085	0.80722	D	1	B;B;B	0.31174	0.01;0.311;0.207	B;B;B	0.40565	0.02;0.333;0.179	T	0.01436	-1.1355	10	0.02654	T	1	.	20.0016	0.97412	0.0:1.0:0.0:0.0	.	296;374;374	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	Y	374;296;374;374;374	ENSP00000313070:S374Y;ENSP00000351126:S374Y;ENSP00000416016:S374Y	ENSP00000313070:S374Y	S	+	2	0	PPIP5K2	102516343	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.970000	0.70431	2.802000	0.96397	0.655000	0.94253	TCT	PPIP5K2	-	NULL	ENSG00000145725		0.323	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	-	0.00	51	0	C	NM_015216		102488444	+1	tier1	-	no_errors	ENST00000358359	ensembl	human	known	74_37	missense	16.67	50	10	SNP	1.000	A
PRDM15	63977	genome.wustl.edu	37	21	43221625	43221625	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr21:43221625C>T	ENST00000269844.3	-	31	4409	c.4299G>A	c.(4297-4299)ccG>ccA	p.P1433P	PRDM15_ENST00000398548.1_Silent_p.P1104P|PRDM15_ENST00000422911.1_Silent_p.P1124P|PRDM15_ENST00000538201.1_Silent_p.P1087P|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000447207.2_Silent_p.P1067P	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TCGAGGCTTCCGGCTGGGGGT	0.587																																																	0													97.0	83.0	88.0					21																	43221625		2203	4300	6503	SO:0001819	synonymous_variant	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4299G>A	21.37:g.43221625C>T			E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.P1433	ENST00000269844.3	37	c.4299	CCDS13676.1	21																																																																																			PRDM15	-	NULL	ENSG00000141956		0.587	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding			0.00	67	0	C	NM_022115		43221625	-1			no_errors	ENST00000269844	ensembl	human	known	74_37	silent	6.94	67	5	SNP	0.006	T
PROSER1	80209	genome.wustl.edu	37	13	39591640	39591640	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr13:39591640G>C	ENST00000352251.3	-	10	1605	c.772C>G	c.(772-774)Caa>Gaa	p.Q258E	PROSER1_ENST00000350125.3_Missense_Mutation_p.Q236E|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	258	Pro-rich.																TACTTACTTTGATTCTGTATA	0.289																																																	0													85.0	73.0	77.0					13																	39591640		2197	4293	6490	SO:0001583	missense	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.772C>G	13.37:g.39591640G>C	ENSP00000332034:p.Gln258Glu		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.Q258E	ENST00000352251.3	37	c.772	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110192	0.37242	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.32272	1.46;1.46	5.95	5.95	0.96441	.	.	.	.	.	T	0.36331	0.0963	L	0.59436	1.845	0.46279	D	0.998968	P;P	0.41131	0.739;0.739	B;B	0.41510	0.359;0.359	T	0.03673	-1.1014	8	.	.	.	.	17.5371	0.87835	0.0:0.0:1.0:0.0	.	236;258	A6NJ97;Q86XN7	.;PRSR1_HUMAN	E	258;236	ENSP00000332034:Q258E;ENSP00000339123:Q236E	.	Q	-	1	0	PROSER1	38489640	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	6.037000	0.70956	2.821000	0.97095	0.650000	0.86243	CAA	PROSER1	-	NULL	ENSG00000120685		0.289	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	-	0.00	42	0	G	NM_025138		39591640	-1	tier1	-	no_errors	ENST00000352251	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	C
PRR26	414235	genome.wustl.edu	37	10	697123	697123	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:697123G>A	ENST00000441152.2	+	3	779	c.616G>A	c.(616-618)Gtc>Atc	p.V206I	PRR26_ENST00000381489.5_Intron|DIP2C_ENST00000280886.6_Intron			Q8N8Z3	PRR26_HUMAN	proline rich 26	206																	TGGGACCACCGTCCTCCACGC	0.627																																																	0																																										SO:0001583	missense	0			AK096000		10p15.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000180525	ENSG00000180525			30724	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 108"""	C10orf108			Standard	NR_027151		Approved	FLJ38681	uc001ifr.3	Q8N8Z3	OTTHUMG00000017529	ENST00000441152.2:c.616G>A	10.37:g.697123G>A	ENSP00000414034:p.Val206Ile			Missense_Mutation	SNP	NULL	p.V206I	ENST00000441152.2	37	c.616		10	.	.	.	.	.	.	.	.	.	.	g	5.515	0.279954	0.10458	.	.	ENSG00000180525	ENST00000441152	.	.	.	1.76	-1.58	0.08479	.	.	.	.	.	T	0.11367	0.0277	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31943	-0.9925	5	0.05351	T	0.99	.	5.2314	0.15424	0.5794:0.0:0.4206:0.0	.	.	.	.	I	206	.	ENSP00000414034:V206I	V	+	1	0	C10orf108	687123	0.000000	0.05858	0.001000	0.08648	0.387000	0.30353	-0.358000	0.07641	-0.457000	0.07033	-0.734000	0.03567	GTC	PRR26	-	NULL	ENSG00000180525		0.627	PRR26-002	KNOWN	basic|appris_principal	protein_coding	PRR26	HGNC	protein_coding	OTTHUMT00000046386.1		0.00	22	0	G			697123	+1			no_errors	ENST00000441152	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.001	A
PSMD11	5717	genome.wustl.edu	37	17	30806325	30806325	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:30806325G>T	ENST00000261712.3	+	10	1232	c.969G>T	c.(967-969)ttG>ttT	p.L323F	PSMD11_ENST00000457654.2_Missense_Mutation_p.L323F	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	323	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			GCACACACTTGGCCAAGTTGT	0.493																																					Ovarian(130;1038 1716 9294 11987 19279)												0													156.0	148.0	150.0					17																	30806325		2203	4300	6503	SO:0001583	missense	0			AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.969G>T	17.37:g.30806325G>T	ENSP00000261712:p.Leu323Phe		A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.L323F	ENST00000261712.3	37	c.969	CCDS11272.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.52|15.52	2.858168|2.858168	0.51376|0.51376	.|.	.|.	ENSG00000108671|ENSG00000108671	ENST00000457654|ENST00000261712	T|T	0.42513|0.81247	0.97|-1.47	5.31|5.31	5.31|5.31	0.75309|0.75309	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.81178|0.81178	0.4768|0.4768	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	.|B	.|0.32160	.|0.358	.|B	.|0.42798	.|0.398	T|T	0.76594|0.76594	-0.2902|-0.2902	6|10	.|0.26408	.|T	.|0.33	-2.7484|-2.7484	16.511|16.511	0.84284|0.84284	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|323	.|O00231	.|PSD11_HUMAN	C|F	61|323	ENSP00000393185:G61C|ENSP00000261712:L323F	.|ENSP00000261712:L323F	G|L	+|+	1|3	0|2	PSMD11|PSMD11	27830438|27830438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.681000|7.681000	0.84073|0.84073	2.768000|2.768000	0.95171|0.95171	0.561000|0.561000	0.74099|0.74099	GGC|TTG	PSMD11	-	pfam_PCI_dom,smart_PCI_dom	ENSG00000108671		0.493	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD11	HGNC	protein_coding	OTTHUMT00000256252.2	-	0.00	44	0	G	NM_002815		30806325	+1	tier1	-	no_errors	ENST00000261712	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
PSMG3	84262	genome.wustl.edu	37	7	1608892	1608892	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:1608892G>A	ENST00000288607.2	-	1	737	c.84C>T	c.(82-84)ttC>ttT	p.F28F	PSMG3_ENST00000404674.3_Silent_p.F28F|PSMG3_ENST00000252329.3_Silent_p.F28F|PSMG3-AS1_ENST00000437621.2_lincRNA	NM_032302.3	NP_115678.1	Q9BT73	PSMG3_HUMAN	proteasome (prosome, macropain) assembly chaperone 3	28										lung(2)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.63e-15)		TGTGACTGCTGAAGGCCGTAC	0.632																																																	0													47.0	42.0	43.0					7																	1608892		2203	4300	6503	SO:0001819	synonymous_variant	0			BC027171	CCDS5327.1	7p22.3	2010-07-07	2007-08-16	2007-08-16	ENSG00000157778	ENSG00000157778			22420	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 48"""	C7orf48		17189198	Standard	NM_032302		Approved	MGC10911, PAC3	uc011jvx.1	Q9BT73	OTTHUMG00000119043	ENST00000288607.2:c.84C>T	7.37:g.1608892G>A			A4D216|A8MPW2	Silent	SNP	pfam_Proteasome_assmbl_chp_3	p.F28	ENST00000288607.2	37	c.84	CCDS5327.1	7																																																																																			PSMG3	-	NULL	ENSG00000157778		0.632	PSMG3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PSMG3	HGNC	protein_coding	OTTHUMT00000239254.2		0.00	19	0	G	NM_032302		1608892	-1			no_errors	ENST00000252329	ensembl	human	known	74_37	silent	12.70	55	8	SNP	1.000	A
PTBP1	5725	genome.wustl.edu	37	19	806462	806462	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:806462C>T	ENST00000349038.4	+	9	1020	c.947C>T	c.(946-948)gCg>gTg	p.A316V	PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000356948.6_Missense_Mutation_p.A342V|MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000394601.4_Missense_Mutation_p.A335V	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	316	Poly-Ala.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCCCCTCGGCGGCGGCGGCA	0.692																																																	0													14.0	16.0	15.0					19																	806462		2187	4262	6449	SO:0001583	missense	0			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.947C>T	19.37:g.806462C>T	ENSP00000014112:p.Ala316Val		Q9BUQ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.A342V	ENST00000349038.4	37	c.1025	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	C	7.291	0.611140	0.14066	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.48522	0.81;0.81;1.12	4.29	2.14	0.27477	.	0.270660	0.34200	N	0.004179	T	0.42245	0.1194	M	0.62016	1.91	0.80722	D	1	B;P;P	0.47350	0.174;0.775;0.894	B;B;B	0.41946	0.007;0.221;0.371	T	0.20840	-1.0263	10	0.32370	T	0.25	-20.9565	9.3662	0.38226	0.0:0.8234:0.0:0.1766	.	316;335;342	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	V	342;335;316	ENSP00000349428:A342V;ENSP00000408096:A335V;ENSP00000014112:A316V	ENSP00000014112:A316V	A	+	2	0	PTBP1	757462	1.000000	0.71417	0.005000	0.12908	0.023000	0.10783	5.033000	0.64146	0.293000	0.22520	-0.251000	0.11542	GCG	PTBP1	-	tigrfam_HnRNP-L_PTB	ENSG00000011304		0.692	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	HGNC	protein_coding	OTTHUMT00000457605.1	-	0.00	52	0	C			806462	+1	tier1	-	no_errors	ENST00000356948	ensembl	human	known	74_37	missense	10.61	59	7	SNP	0.382	T
PTCD3	55037	genome.wustl.edu	37	2	86361473	86361473	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:86361473C>T	ENST00000254630.7	+	20	1668	c.1602C>T	c.(1600-1602)ctC>ctT	p.L534L	SNORD94_ENST00000386037.1_RNA	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	534					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)	p.L534L(1)		NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TCCTGATGCTCATGGCAAGGG	0.448																																																	1	Substitution - coding silent(1)	lung(1)											105.0	88.0	94.0					2																	86361473		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.1602C>T	2.37:g.86361473C>T			A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Silent	SNP	NULL	p.L534	ENST00000254630.7	37	c.1602	CCDS33235.1	2																																																																																			PTCD3	-	NULL	ENSG00000132300		0.448	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD3	HGNC	protein_coding	OTTHUMT00000329854.1	-	0.00	52	0	C	NM_017952		86361473	+1	tier1	-	no_errors	ENST00000254630	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.999	T
PTPRT	11122	genome.wustl.edu	37	20	41306583	41306583	+	Missense_Mutation	SNP	C	C	G	rs571224137		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:41306583C>G	ENST00000373187.1	-	7	1075	c.1076G>C	c.(1075-1077)cGa>cCa	p.R359P	PTPRT_ENST00000356100.2_Missense_Mutation_p.R359P|PTPRT_ENST00000373201.1_Missense_Mutation_p.R359P|PTPRT_ENST00000373198.4_Missense_Mutation_p.R359P|PTPRT_ENST00000373193.3_Missense_Mutation_p.R359P|PTPRT_ENST00000373190.1_Missense_Mutation_p.R359P|PTPRT_ENST00000373184.1_Missense_Mutation_p.R359P			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	359	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R359L(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GAGGAGCACTCGGATCTCATA	0.567																																																	1	Substitution - Missense(1)	lung(1)											114.0	115.0	115.0					20																	41306583		1969	4171	6140	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1076G>C	20.37:g.41306583C>G	ENSP00000362283:p.Arg359Pro		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.R359P	ENST00000373187.1	37	c.1076	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141816	0.57044	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.42	5.42	0.78866	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.066160	0.64402	D	0.000019	T	0.62171	0.2406	L	0.48642	1.525	0.49389	D	0.999787	P;P	0.45672	0.864;0.648	P;P	0.48227	0.571;0.482	T	0.63060	-0.6721	10	0.52906	T	0.07	.	19.1814	0.93625	0.0:1.0:0.0:0.0	.	359;359	O14522-1;O14522	.;PTPRT_HUMAN	P	359	ENSP00000362286:R359P;ENSP00000362283:R359P;ENSP00000362289:R359P;ENSP00000348408:R359P;ENSP00000362294:R359P;ENSP00000362280:R359P;ENSP00000362297:R359P	ENSP00000348408:R359P	R	-	2	0	PTPRT	40739997	1.000000	0.71417	0.995000	0.50966	0.870000	0.49936	4.484000	0.60271	2.705000	0.92388	0.655000	0.94253	CGA	PTPRT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196090		0.567	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	45	0	C			41306583	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	6.74	83	6	SNP	0.998	G
RECK	8434	genome.wustl.edu	37	9	36112352	36112352	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:36112352G>A	ENST00000377966.3	+	16	2505	c.1939G>A	c.(1939-1941)Ggg>Agg	p.G647R		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	647	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TGGGCAGAATGGGCGCACTTA	0.493																																																	0													149.0	117.0	128.0					9																	36112352		2203	4300	6503	SO:0001583	missense	0			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.1939G>A	9.37:g.36112352G>A	ENSP00000367202:p.Gly647Arg		B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal_dom,superfamily_Prot_inh_PMP,smart_Kazal_dom	p.G647R	ENST00000377966.3	37	c.1939	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.106747	0.94292	.	.	ENSG00000122707	ENST00000377966	T	0.12255	2.7	5.71	5.71	0.89125	Proteinase inhibitor I1, Kazal (2);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.59768	-0.7392	10	0.87932	D	0	-14.5155	17.3431	0.87303	0.0:0.0:1.0:0.0	.	647;647	A8K9D8;O95980	.;RECK_HUMAN	R	647	ENSP00000367202:G647R	ENSP00000367202:G647R	G	+	1	0	RECK	36102352	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.502000	0.97981	2.701000	0.92244	0.563000	0.77884	GGG	RECK	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000122707		0.493	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	-	0.00	65	0	G			36112352	+1	tier1	-	no_errors	ENST00000377966	ensembl	human	known	74_37	missense	27.91	62	24	SNP	1.000	A
REG1A	5967	genome.wustl.edu	37	2	79349978	79349978	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:79349978G>A	ENST00000233735.1	+	5	436	c.333G>A	c.(331-333)tgG>tgA	p.W111*		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	111	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						ACCGCCGCTGGCACTGGAGCA	0.552																																																	0													110.0	110.0	110.0					2																	79349978		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.333G>A	2.37:g.79349978G>A	ENSP00000233735:p.Trp111*		P11379|Q4ZG28	Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.W111*	ENST00000233735.1	37	c.333	CCDS1964.1	2	.	.	.	.	.	.	.	.	.	.	g	21.0	4.085068	0.76642	.	.	ENSG00000115386	ENST00000233735	.	.	.	2.92	2.92	0.33932	.	0.000000	0.36740	N	0.002434	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4067	0.38466	0.0:0.0:1.0:0.0	.	.	.	.	X	111	.	ENSP00000233735:W111X	W	+	3	0	REG1A	79203486	0.611000	0.26992	0.993000	0.49108	0.871000	0.50021	1.536000	0.36072	1.637000	0.50538	0.557000	0.71058	TGG	REG1A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000115386		0.552	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG1A	HGNC	protein_coding	OTTHUMT00000252289.1	-	0.00	31	0	G	NM_002909		79349978	+1	tier1	-	no_errors	ENST00000233735	ensembl	human	known	74_37	nonsense	10.87	41	5	SNP	0.962	A
RFPL2	10739	genome.wustl.edu	37	22	32587193	32587193	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:32587193G>C	ENST00000400237.1	-	5	1638	c.703C>G	c.(703-705)Cgc>Ggc	p.R235G	RFPL2_ENST00000248983.4_Missense_Mutation_p.R145G|RFPL2_ENST00000248980.4_Missense_Mutation_p.R174G|RFPL2_ENST00000400236.3_Missense_Mutation_p.R145G|RFPL2_ENST00000489846.1_5'UTR			O75678	RFPL2_HUMAN	ret finger protein-like 2	235	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						CAGGTAAAGCGAGGGGAGCCC	0.582																																																	0													93.0	89.0	91.0					22																	32587193		2203	4300	6503	SO:0001583	missense	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.703C>G	22.37:g.32587193G>C	ENSP00000383096:p.Arg235Gly			Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.R235G	ENST00000400237.1	37	c.703	CCDS43009.2	22	.	.	.	.	.	.	.	.	.	.	G	0.090	-1.169144	0.01660	.	.	ENSG00000128253	ENST00000248980;ENST00000248983;ENST00000400236;ENST00000400237	T;T;T;T	0.05319	3.46;3.46;3.46;3.46	0.311	-0.622	0.11560	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.02267	0.0070	N	0.03281	-0.365	0.09310	N	1	B;B	0.16396	0.017;0.004	B;B	0.20384	0.029;0.025	T	0.47086	-0.9144	9	0.19590	T	0.45	.	2.176	0.03862	0.3173:0.3405:0.3422:0.0	.	235;174	O75678;O75678-3	RFPL2_HUMAN;.	G	174;145;145;235	ENSP00000248980:R174G;ENSP00000248983:R145G;ENSP00000383095:R145G;ENSP00000383096:R235G	ENSP00000248980:R174G	R	-	1	0	RFPL2	30917193	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	-0.002000	0.12924	-0.520000	0.06435	-0.507000	0.04495	CGC	RFPL2	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000128253		0.582	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	-	0.00	109	0	G	NM_006605		32587193	-1	tier1	-	no_errors	ENST00000400237	ensembl	human	known	74_37	missense	6.45	174	12	SNP	0.059	C
ACSBG2	81616	genome.wustl.edu	37	19	6190810	6190811	+	Intron	DEL	AT	AT	-	rs72157010|rs34836033|rs111435067	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:6190810_6190811delAT	ENST00000586696.1	+	14	2312				RFX2_ENST00000587700.1_5'UTR|ACSBG2_ENST00000588485.1_Intron|ACSBG2_ENST00000591741.1_Intron|ACSBG2_ENST00000591403.1_Intron|ACSBG2_ENST00000588304.1_Intron|ACSBG2_ENST00000252669.5_Intron			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2						cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAacacacacatacacacatac	0.485														1326	0.264776	0.1528	0.33	5008	,	,		17087	0.3502		0.2545	False		,,,				2504	0.2924																0																																										SO:0001627	intron_variant	0				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1998+107AT>-	19.37:g.6190810_6190811delAT			B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	RNA	DEL	-	NULL	ENST00000586696.1	37	NULL	CCDS12159.1	19																																																																																			RFX2	-	-	ENSG00000087903		0.485	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452898.1		0.00	8	0	AT	NM_030924		6190811	-1	tier1		no_errors	ENST00000587700	ensembl	human	known	74_37	rna	46.67	8	7	DEL	0.000:0.000	-
RGL3	57139	genome.wustl.edu	37	19	11510589	11510589	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:11510589C>G	ENST00000380456.3	-	16	1751	c.1688G>C	c.(1687-1689)aGa>aCa	p.R563T	RGL3_ENST00000393423.3_Missense_Mutation_p.R569T|RGL3_ENST00000568628.1_5'Flank	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	563	Pro-rich.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						AGGAGCATCTCTGCTTCTAGG	0.662																																					GBM(174;751 2067 17998 27979 33959)												0													29.0	35.0	33.0					19																	11510589		2200	4298	6498	SO:0001583	missense	0			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1688G>C	19.37:g.11510589C>G	ENSP00000369823:p.Arg563Thr		B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R569T	ENST00000380456.3	37	c.1706	CCDS32910.1	19	.	.	.	.	.	.	.	.	.	.	C	5.743	0.321602	0.10845	.	.	ENSG00000205517	ENST00000342684;ENST00000393423;ENST00000380456	T;T	0.40225	1.18;1.04	4.92	-5.66	0.02451	.	1.894700	0.01908	N	0.039617	T	0.24624	0.0597	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.22276	0.067;0.067;0.067;0.067	B;B;B;B	0.16722	0.016;0.016;0.01;0.01	T	0.11421	-1.0588	10	0.14656	T	0.56	.	7.0773	0.25211	0.0:0.4104:0.1207:0.4689	.	563;569;569;360	Q3MIN7;B5ME84;B7ZL22;Q8TEP0	RGL3_HUMAN;.;.;.	T	360;569;563	ENSP00000377075:R569T;ENSP00000369823:R563T	ENSP00000344665:R360T	R	-	2	0	RGL3	11371589	0.000000	0.05858	0.000000	0.03702	0.222000	0.24845	-0.993000	0.03720	-0.926000	0.03770	0.313000	0.20887	AGA	RGL3	-	NULL	ENSG00000205517		0.662	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	-	0.00	27	0	C	XM_290867		11510589	-1	tier1	-	no_errors	ENST00000393423	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.000	G
SCARF1	8578	genome.wustl.edu	37	17	1551189	1551189	+	5'Flank	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:1551189C>T	ENST00000263071.4	-	0	0				SCARF1_ENST00000348987.3_5'Flank|RILP_ENST00000301336.6_Missense_Mutation_p.R295Q|SCARF1_ENST00000571272.1_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCGCTGCTTCCGGACAGCCAC	0.612																																																	0													168.0	117.0	134.0					17																	1551189		2203	4300	6503	SO:0001631	upstream_gene_variant	0			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1551189C>T	Exception_encountered		A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	pfam_RILP,pfam_JNK/Rab-associated_protein-1_N	p.R295Q	ENST00000263071.4	37	c.884	CCDS11007.1	17	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043022	0.75732	.	.	ENSG00000167705	ENST00000301336	T	0.43688	0.94	5.6	-2.44	0.06502	.	0.419796	0.21720	N	0.070136	T	0.19846	0.0477	N	0.08118	0	0.20975	N	0.999811	D	0.53151	0.958	B	0.41917	0.37	T	0.37009	-0.9724	10	0.41790	T	0.15	-24.8997	11.2381	0.48953	0.0:0.313:0.0:0.687	.	295	Q96NA2	RILP_HUMAN	Q	295	ENSP00000301336:R295Q	ENSP00000301336:R295Q	R	-	2	0	RILP	1497939	0.026000	0.19158	0.973000	0.42090	0.899000	0.52679	-0.835000	0.04386	-0.245000	0.09625	0.655000	0.94253	CGG	RILP	-	pfam_RILP	ENSG00000167705		0.612	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RILP	HGNC	protein_coding	OTTHUMT00000207081.4	-	0.00	31	0	C	NM_003693		1551189	-1	tier1	-	no_errors	ENST00000301336	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.966	T
RNF41	10193	genome.wustl.edu	37	12	56600447	56600447	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:56600447C>T	ENST00000345093.4	-	7	1107	c.738G>A	c.(736-738)ctG>ctA	p.L246L	RNF41_ENST00000552656.1_Silent_p.L246L|RNF41_ENST00000394013.2_Silent_p.L175L	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	246					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						CATTTTCAATCAGCTCGTTGA	0.562											OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													92.0	78.0	83.0					12																	56600447		2203	4300	6503	SO:0001819	synonymous_variant	0			AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.738G>A	12.37:g.56600447C>T		1016	A6NFW0|B2RBT8|O75598	Silent	SNP	pfam_USP8_interacting,pfam_Znf_C3HC4_RING-type,pfam_Ubox_domain,superfamily_TRAF-like,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_SIAH	p.L246	ENST00000345093.4	37	c.738	CCDS8909.1	12																																																																																			RNF41	-	pfam_USP8_interacting	ENSG00000181852		0.562	RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF41	HGNC	protein_coding	OTTHUMT00000408525.1		0.00	49	0	C	NM_005785		56600447	-1			no_errors	ENST00000345093	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	T
RPE65	6121	genome.wustl.edu	37	1	68910473	68910473	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:68910473C>A	ENST00000262340.5	-	4	392	c.339G>T	c.(337-339)aaG>aaT	p.K113N		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	113					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						AAAATATATTCTTGCAGGGAT	0.408																																																	0													83.0	85.0	84.0					1																	68910473		2203	4300	6503	SO:0001583	missense	0			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.339G>T	1.37:g.68910473C>A	ENSP00000262340:p.Lys113Asn		A8K1L0|Q5T9U3	Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.K113N	ENST00000262340.5	37	c.339	CCDS643.1	1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597412	0.66332	.	.	ENSG00000116745	ENST00000262340	D	0.95272	-3.66	4.88	3.89	0.44902	.	0.182301	0.64402	D	0.000018	D	0.96204	0.8762	M	0.83223	2.63	0.80722	D	1	D	0.63046	0.992	D	0.70227	0.968	D	0.94456	0.7672	10	0.28530	T	0.3	-12.2395	13.7509	0.62906	0.0:0.9135:0.0:0.0865	.	113	Q16518	RPE65_HUMAN	N	113	ENSP00000262340:K113N	ENSP00000262340:K113N	K	-	3	2	RPE65	68683061	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.218000	0.42889	2.545000	0.85829	0.655000	0.94253	AAG	RPE65	-	pfam_Carotenoid_Oase	ENSG00000116745		0.408	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	HGNC	protein_coding	OTTHUMT00000025509.1		0.00	22	0	C	NM_000329		68910473	-1			no_errors	ENST00000262340	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
RRP15	51018	genome.wustl.edu	37	1	218480911	218480911	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:218480911G>A	ENST00000366932.3	+	4	672	c.642G>A	c.(640-642)ttG>ttA	p.L214L		NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)	214						mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.L214F(2)	ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		TCAGTGTTTTGAGAGGGATGG	0.368																																																	2	Substitution - Missense(2)	lung(2)											109.0	106.0	107.0					1																	218480911		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.642G>A	1.37:g.218480911G>A				Silent	SNP	pfam_DUF1665	p.L214	ENST00000366932.3	37	c.642	CCDS1520.2	1																																																																																			RRP15	-	pfam_DUF1665	ENSG00000067533		0.368	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP15	HGNC	protein_coding	OTTHUMT00000095284.1	-	0.00	46	0	G	NM_016052		218480911	+1	tier1	-	no_errors	ENST00000366932	ensembl	human	known	74_37	silent	10.89	90	11	SNP	0.295	A
RTKN	6242	genome.wustl.edu	37	2	74657797	74657797	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:74657797C>G	ENST00000233330.6	-	3	486	c.169G>C	c.(169-171)Gac>Cac	p.D57H	RTKN_ENST00000305557.5_Missense_Mutation_p.D94H|RTKN_ENST00000272430.5_Missense_Mutation_p.D107H|RTKN_ENST00000484453.1_5'Flank	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						GGGCCACTGTCAGAAGGCCTG	0.627																																																	0													29.0	36.0	33.0					2																	74657797		2200	4300	6500	SO:0001583	missense	0			AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.169G>C	2.37:g.74657797C>G	ENSP00000233330:p.Asp57His			Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D107H	ENST00000233330.6	37	c.319	CCDS42699.1	2	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542341	0.45280	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	T;T;T	0.35048	1.34;1.33;1.34	4.81	4.81	0.61882	.	0.290535	0.37095	N	0.002242	T	0.26122	0.0637	N	0.22421	0.69	0.58432	D	0.999992	B;B	0.20887	0.049;0.016	B;B	0.21151	0.033;0.018	T	0.04796	-1.0926	10	0.40728	T	0.16	.	13.2592	0.60097	0.0:1.0:0.0:0.0	.	107;94	Q9BST9;Q9BST9-2	RTKN_HUMAN;.	H	94;107;57	ENSP00000305298:D94H;ENSP00000272430:D107H;ENSP00000233330:D57H	ENSP00000233330:D57H	D	-	1	0	RTKN	74511305	0.992000	0.36948	0.996000	0.52242	0.907000	0.53573	3.755000	0.55197	2.476000	0.83614	0.655000	0.94253	GAC	RTKN	-	NULL	ENSG00000114993		0.627	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	RTKN	HGNC	protein_coding	OTTHUMT00000328236.3	-	0.00	60	0	C	NM_001015055		74657797	-1	tier1	-	no_errors	ENST00000272430	ensembl	human	known	74_37	missense	8.86	72	7	SNP	0.996	G
RUSC2	9853	genome.wustl.edu	37	9	35547582	35547582	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:35547582C>T	ENST00000455600.1	+	2	1633	c.1064C>T	c.(1063-1065)tCt>tTt	p.S355F		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	355						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CCTCATGCCTCTTCTCCTGAG	0.577																																																	0													113.0	95.0	101.0					9																	35547582		2203	4300	6503	SO:0001583	missense	0			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1064C>T	9.37:g.35547582C>T	ENSP00000393922:p.Ser355Phe		A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.S355F	ENST00000455600.1	37	c.1064	CCDS35008.1	9	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849882	0.71603	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.31510	1.49;1.49	5.67	5.67	0.87782	.	0.151836	0.47093	D	0.000246	T	0.46054	0.1373	L	0.32530	0.975	0.54753	D	0.999982	D	0.71674	0.998	D	0.65573	0.936	T	0.40701	-0.9549	10	0.87932	D	0	-11.2096	18.7684	0.91881	0.0:1.0:0.0:0.0	.	355	Q8N2Y8	RUSC2_HUMAN	F	355	ENSP00000355177:S355F;ENSP00000393922:S355F	ENSP00000355177:S355F	S	+	2	0	RUSC2	35537582	1.000000	0.71417	0.977000	0.42913	0.938000	0.57974	7.136000	0.77285	2.675000	0.91044	0.655000	0.94253	TCT	RUSC2	-	NULL	ENSG00000198853		0.577	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	HGNC	protein_coding	OTTHUMT00000052309.1	-	0.00	24	0	C	XM_048462		35547582	+1	tier1	-	no_errors	ENST00000361226	ensembl	human	known	74_37	missense	29.55	31	13	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237895425	237895425	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:237895425G>C	ENST00000366574.2	+	78	11332	c.11015G>C	c.(11014-11016)aGt>aCt	p.S3672T	RYR2_ENST00000542537.1_Missense_Mutation_p.S3656T|RYR2_ENST00000360064.6_Missense_Mutation_p.S3670T|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3672					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTCTGTTTAGTCGGACAGCT	0.438																																																	0													97.0	97.0	97.0					1																	237895425		1854	4088	5942	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11015G>C	1.37:g.237895425G>C	ENSP00000355533:p.Ser3672Thr		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.S3670T	ENST00000366574.2	37	c.11009	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209997	0.79240	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96992	-4.2;-4.14;-4.19	5.62	4.71	0.59529	.	0.139342	0.44097	D	0.000483	D	0.97760	0.9265	M	0.80183	2.485	0.80722	D	1	D;D	0.69078	0.989;0.997	D;D	0.72338	0.977;0.91	D	0.97385	0.9985	10	0.33940	T	0.23	-14.3905	14.5497	0.68057	0.0702:0.0:0.9298:0.0	.	627;3672	B4DGV4;Q92736	.;RYR2_HUMAN	T	3672;3670;3656;627	ENSP00000355533:S3672T;ENSP00000353174:S3670T;ENSP00000443798:S3656T	ENSP00000353174:S3670T	S	+	2	0	RYR2	235962048	1.000000	0.71417	0.992000	0.48379	0.950000	0.60333	9.485000	0.97942	1.392000	0.46585	-0.140000	0.14226	AGT	RYR2	-	NULL	ENSG00000198626		0.438	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	36	0	G	NM_001035		237895425	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	14.06	55	9	SNP	1.000	C
RYR3	6263	genome.wustl.edu	37	15	34078107	34078107	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:34078107C>T	ENST00000389232.4	+	66	9583	c.9513C>T	c.(9511-9513)ctC>ctT	p.L3171L	RYR3_ENST00000415757.3_Silent_p.L3171L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3171					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACCTCAGTCTCATCCTGGGCA	0.567																																																	0													153.0	165.0	161.0					15																	34078107		2145	4276	6421	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9513C>T	15.37:g.34078107C>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L3171	ENST00000389232.4	37	c.9513	CCDS45210.1	15																																																																																			RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	33	0	C			34078107	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	14.00	43	7	SNP	1.000	T
SAMD4A	23034	genome.wustl.edu	37	14	55203862	55203862	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:55203862G>C	ENST00000554335.1	+	4	1499	c.836G>C	c.(835-837)aGa>aCa	p.R279T	SAMD4A_ENST00000357634.3_Missense_Mutation_p.R278T|SAMD4A_ENST00000392067.3_Missense_Mutation_p.R279T|SAMD4A_ENST00000251091.5_Intron			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	279					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TTACGAGCTAGAGGACCCCAG	0.537																																																	0													238.0	223.0	228.0					14																	55203862		2203	4300	6503	SO:0001583	missense	0			AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.836G>C	14.37:g.55203862G>C	ENSP00000452535:p.Arg279Thr		A8MPZ5|Q0VA96|Q6PEW4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.R279T	ENST00000554335.1	37	c.836	CCDS32084.2	14	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033993	0.75504	.	.	ENSG00000020577	ENST00000554335;ENST00000392067;ENST00000357634	.	.	.	5.67	5.67	0.87782	.	0.052954	0.64402	D	0.000001	T	0.67126	0.2860	L	0.58101	1.795	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.63875	-0.6538	9	0.87932	D	0	-19.8493	19.7848	0.96432	0.0:0.0:1.0:0.0	.	279	Q9UPU9	SMAG1_HUMAN	T	279;279;278	.	ENSP00000350261:R278T	R	+	2	0	SAMD4A	54273612	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.985000	0.70556	2.673000	0.90976	0.655000	0.94253	AGA	SAMD4A	-	NULL	ENSG00000020577		0.537	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4A	HGNC	protein_coding	OTTHUMT00000411186.1	-	0.00	55	0	G	NM_015589		55203862	+1	tier1	-	no_errors	ENST00000392067	ensembl	human	known	74_37	missense	11.11	88	11	SNP	1.000	C
SCAF8	22828	genome.wustl.edu	37	6	155153402	155153402	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:155153402C>A	ENST00000367178.3	+	20	3265	c.2689C>A	c.(2689-2691)Ctg>Atg	p.L897M	TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000367186.4_Missense_Mutation_p.L963M|SCAF8_ENST00000417268.1_Missense_Mutation_p.L897M	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	897	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TCCTGGACTTCTGGGAACACA	0.458																																																	0													107.0	112.0	111.0					6																	155153402		2203	4300	6503	SO:0001583	missense	0			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2689C>A	6.37:g.155153402C>A	ENSP00000356146:p.Leu897Met		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.L963M	ENST00000367178.3	37	c.2887	CCDS5247.1	6	.	.	.	.	.	.	.	.	.	.	C	9.270	1.045402	0.19748	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.53640	0.63;0.63;0.61	5.58	1.91	0.25777	.	0.101689	0.38959	U	0.001520	T	0.14184	0.0343	L	0.35723	1.085	0.34327	D	0.687282	P;P;P	0.43287	0.802;0.802;0.615	B;B;B	0.37091	0.122;0.122;0.241	T	0.04870	-1.0921	10	0.44086	T	0.13	.	2.7618	0.05308	0.3299:0.2874:0.0:0.3827	.	942;963;897	B7Z876;B7Z888;Q9UPN6	.;.;SCAF8_HUMAN	M	897;897;963	ENSP00000356146:L897M;ENSP00000413098:L897M;ENSP00000356154:L963M	ENSP00000356146:L897M	L	+	1	2	SCAF8	155195094	0.583000	0.26757	1.000000	0.80357	0.999000	0.98932	0.515000	0.22801	0.397000	0.25310	0.655000	0.94253	CTG	SCAF8	-	NULL	ENSG00000213079		0.458	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF8	HGNC	protein_coding	OTTHUMT00000042798.1	-	0.00	33	0	C	NM_014892		155153402	+1	tier1	-	no_errors	ENST00000367186	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.996	A
SCG2	7857	genome.wustl.edu	37	2	224463090	224463090	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:224463090G>A	ENST00000305409.2	-	2	1143	c.911C>T	c.(910-912)tCa>tTa	p.S304L		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0	Interaction with FANCD2.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GACATCATCTGAGAGTTGGTC	0.428																																																	0													146.0	146.0	146.0					2																	224463090		2203	4300	6503	SO:0001583	missense	0			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.911C>T	2.37:g.224463090G>A	ENSP00000304133:p.Ser304Leu		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	pfam_Granin	p.S304L	ENST00000305409.2	37	c.911	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.223717	0.79576	.	.	ENSG00000171951	ENST00000305409;ENST00000450330	T	0.01933	4.55	5.6	5.6	0.85130	.	0.070649	0.64402	D	0.000017	T	0.11707	0.0285	M	0.64997	1.995	0.58432	D	0.99999	D	0.69078	0.997	D	0.69142	0.962	T	0.00157	-1.1977	10	0.72032	D	0.01	.	19.6177	0.95640	0.0:0.0:1.0:0.0	.	304	P13521	SCG2_HUMAN	L	304;164	ENSP00000304133:S304L	ENSP00000304133:S304L	S	-	2	0	SCG2	224171334	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.193000	0.72075	2.632000	0.89209	0.650000	0.86243	TCA	SCG2	-	pfam_Granin	ENSG00000171951		0.428	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	-	0.00	41	0	G	NM_003469		224463090	-1	tier1	-	no_errors	ENST00000305409	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	A
SCML2	10389	genome.wustl.edu	37	X	18275038	18275038	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:18275038C>G	ENST00000251900.4	-	11	1545	c.1386G>C	c.(1384-1386)ttG>ttC	p.L462F	SCML2_ENST00000398048.3_Missense_Mutation_p.L198F	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	462					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					GCTGGCTACTCAAAAGGTTAT	0.448																																					Esophageal Squamous(100;1252 1965 19021 35517)												0													148.0	136.0	140.0					X																	18275038		2203	4300	6503	SO:0001583	missense	0			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1386G>C	X.37:g.18275038C>G	ENSP00000251900:p.Leu462Phe		Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.L462F	ENST00000251900.4	37	c.1386	CCDS14185.1	X	.	.	.	.	.	.	.	.	.	.	C	3.063	-0.192903	0.06259	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.39592	1.07;1.07	5.44	4.5	0.54988	.	0.286793	0.32608	N	0.005871	T	0.15782	0.0380	N	0.01679	-0.765	0.39564	D	0.969177	B;B;B	0.33964	0.004;0.434;0.004	B;B;B	0.40741	0.015;0.339;0.023	T	0.36648	-0.9739	10	0.02654	T	1	.	6.5589	0.22476	0.4183:0.4409:0.1408:0.0	.	430;198;462	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	F	462;198;430	ENSP00000251900:L462F;ENSP00000381126:L198F	ENSP00000251900:L462F	L	-	3	2	SCML2	18184959	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.781000	0.47750	2.258000	0.74832	0.513000	0.50165	TTG	SCML2	-	pfam_DUF3588	ENSG00000102098		0.448	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1		0.00	14	0	C	NM_006089		18275038	-1			no_errors	ENST00000251900	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	G
SEC61A1	29927	genome.wustl.edu	37	3	127786785	127786785	+	Intron	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:127786785C>T	ENST00000243253.3	+	11	1351				SEC61A1_ENST00000464451.1_Intron|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000424880.2_Intron|SEC61A1_ENST00000483956.1_Intron	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						ATTTCCCCTTCAGCCTCCAAT	0.507											OREG0015775	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													66.0	68.0	67.0					3																	127786785		2203	4300	6503	SO:0001627	intron_variant	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.1168-41C>T	3.37:g.127786785C>T		1559	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	RNA	SNP	-	NULL	ENST00000243253.3	37	NULL	CCDS3046.1	3																																																																																			SEC61A1	-	-	ENSG00000058262		0.507	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	-	0.00	45	0	C	NM_013336		127786785	+1	tier1	-	no_errors	ENST00000498837	ensembl	human	known	74_37	rna	12.50	63	9	SNP	0.000	T
SEMA4G	57715	genome.wustl.edu	37	10	102739898	102739898	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:102739898G>T	ENST00000370250.4	+	10	1521	c.1148G>T	c.(1147-1149)cGc>cTc	p.R383L	SEMA4G_ENST00000517724.1_Missense_Mutation_p.R383L|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.R383L|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000370242.4_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	383	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R383H(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		GATTCATTGCGCAGCCAAGGC	0.582																																																	1	Substitution - Missense(1)	large_intestine(1)											131.0	96.0	108.0					10																	102739898		2203	4300	6503	SO:0001583	missense	0			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1148G>T	10.37:g.102739898G>T	ENSP00000359270:p.Arg383Leu		A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.R383L	ENST00000370250.4	37	c.1148		10	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586314	0.86851	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.14	5.14	0.70334	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.998	T	0.73232	-0.4048	10	0.87932	D	0	.	17.5741	0.87943	0.0:0.0:1.0:0.0	.	383;383;383	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	L	383	ENSP00000428896:R383L;ENSP00000359270:R383L;ENSP00000430175:R383L;ENSP00000210633:R383L	ENSP00000210633:R383L	R	+	2	0	SEMA4G	102729888	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.314000	0.96306	2.405000	0.81733	0.484000	0.47621	CGC	SEMA4G	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000095539		0.582	SEMA4G-002	KNOWN	basic	protein_coding	SEMA4G	HGNC	protein_coding	OTTHUMT00000049920.2		0.00	27	0	G			102739898	+1			no_errors	ENST00000210633	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.995	T
SEMG2	6407	genome.wustl.edu	37	20	43850642	43850642	+	Silent	SNP	T	T	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:43850642T>C	ENST00000372769.3	+	2	459	c.369T>C	c.(367-369)ttT>ttC	p.F123F		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	123	Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AAGGTCATTTTCACATGATAG	0.393																																																	0													100.0	90.0	94.0					20																	43850642		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.369T>C	20.37:g.43850642T>C			Q53ZU2|Q6X2M5|Q6X2M6	Silent	SNP	pfam_Semenogelin	p.F123	ENST00000372769.3	37	c.369	CCDS13346.1	20																																																																																			SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.393	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	-	0.00	40	0	T	NM_003008		43850642	+1	tier1	-	no_errors	ENST00000372769	ensembl	human	known	74_37	silent	19.35	50	12	SNP	0.001	C
SERPINA4	5267	genome.wustl.edu	37	14	95033361	95033361	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:95033361T>A	ENST00000557004.1	+	3	1125	c.704T>A	c.(703-705)gTt>gAt	p.V235D	SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000555095.1_Missense_Mutation_p.V235D|SERPINA4_ENST00000298841.5_Missense_Mutation_p.V235D			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	235					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GACTTCTATGTTGATGAGAAC	0.512																																																	0													111.0	102.0	105.0					14																	95033361		2203	4300	6503	SO:0001583	missense	0			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.704T>A	14.37:g.95033361T>A	ENSP00000450838:p.Val235Asp		Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V235D	ENST00000557004.1	37	c.704	CCDS9927.1	14	.	.	.	.	.	.	.	.	.	.	T	17.14	3.314714	0.60524	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.84442	-1.85;-1.85;-1.85	4.44	3.29	0.37713	Serpin domain (3);	0.000000	0.48767	D	0.000172	D	0.93383	0.7890	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	D	0.92808	0.6262	10	0.87932	D	0	.	9.2913	0.37789	0.0:0.0864:0.0:0.9136	.	235;235	B2R815;P29622	.;KAIN_HUMAN	D	235	ENSP00000450838:V235D;ENSP00000451172:V235D;ENSP00000298841:V235D	ENSP00000298841:V235D	V	+	2	0	SERPINA4	94103114	0.998000	0.40836	0.008000	0.14137	0.012000	0.07955	4.220000	0.58567	0.673000	0.31224	0.459000	0.35465	GTT	SERPINA4	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000100665		0.512	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA4	HGNC	protein_coding	OTTHUMT00000410718.1	-	0.00	77	0	T	NM_006215		95033361	+1	tier1	-	no_errors	ENST00000298841	ensembl	human	known	74_37	missense	10.08	116	13	SNP	0.970	A
SETBP1	26040	genome.wustl.edu	37	18	42532279	42532279	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr18:42532279C>T	ENST00000282030.5	+	4	3270	c.2974C>T	c.(2974-2976)Cac>Tac	p.H992Y		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	992						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TAATTTTGATCACTATTACCC	0.448									Schinzel-Giedion syndrome																																								0													125.0	121.0	123.0					18																	42532279		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2974C>T	18.37:g.42532279C>T	ENSP00000282030:p.His992Tyr		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.H992Y	ENST00000282030.5	37	c.2974	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617663	0.46736	.	.	ENSG00000152217	ENST00000282030	D	0.89939	-2.59	5.91	5.91	0.95273	.	0.050711	0.85682	D	0.000000	D	0.88202	0.6373	N	0.19112	0.55	0.45490	D	0.998451	P	0.48589	0.912	P	0.51742	0.678	D	0.88921	0.3366	10	0.59425	D	0.04	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	992	Q9Y6X0	SETBP_HUMAN	Y	992	ENSP00000282030:H992Y	ENSP00000282030:H992Y	H	+	1	0	SETBP1	40786277	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.857000	0.62939	2.808000	0.96608	0.655000	0.94253	CAC	SETBP1	-	NULL	ENSG00000152217		0.448	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	59	0	C	NM_001130110		42532279	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	9.68	56	6	SNP	1.000	T
SETD2	29072	genome.wustl.edu	37	3	47122509	47122509	+	Intron	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:47122509G>T	ENST00000409792.3	-	12	6103				SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GTTGGAAATGGAGTTGAGAAA	0.433			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													124.0	107.0	112.0					3																	47122509		692	1591	2283	SO:0001627	intron_variant	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6060+2700C>A	3.37:g.47122509G>T			O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	RNA	SNP	-	NULL	ENST00000409792.3	37	NULL	CCDS2749.2	3																																																																																			SETD2	-	-	ENSG00000181555		0.433	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	-	0.00	38	0	G	NM_014159		47122509	-1	tier1	-	no_errors	ENST00000492397	ensembl	human	known	74_37	rna	5.56	68	4	SNP	1.000	T
SETDB1	9869	genome.wustl.edu	37	1	150923931	150923931	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:150923931G>A	ENST00000271640.5	+	14	2494	c.2304G>A	c.(2302-2304)aaG>aaA	p.K768K	SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Silent_p.K768K	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	768	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCAGTACAAGAGACTAGAAG	0.478																																																	0													88.0	77.0	81.0					1																	150923931		2203	4300	6503	SO:0001819	synonymous_variant	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2304G>A	1.37:g.150923931G>A			A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Silent	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.K768	ENST00000271640.5	37	c.2304	CCDS44217.1	1																																																																																			SETDB1	-	pfam_Pre-SET_dom,smart_Pre-SET_Zn-bd_sub,pfscan_Pre-SET_dom	ENSG00000143379		0.478	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	-	0.00	62	0	G			150923931	+1	tier1	-	no_errors	ENST00000271640	ensembl	human	known	74_37	silent	13.64	95	15	SNP	1.000	A
SIPA1L1	26037	genome.wustl.edu	37	14	72055797	72055797	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:72055797G>C	ENST00000555818.1	+	2	1556	c.1208G>C	c.(1207-1209)gGa>gCa	p.G403A	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.G403A|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.G403A	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	403					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ATGGACCAGGGAGATGATAAA	0.463																																																	0													86.0	87.0	87.0					14																	72055797		2203	4300	6503	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1208G>C	14.37:g.72055797G>C	ENSP00000450832:p.Gly403Ala		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.G403A	ENST00000555818.1	37	c.1208	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226673	0.79576	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	D;D;D	0.87179	-2.22;-2.18;-2.22	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.94948	0.8366	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	0.97;1.0;0.999	P;D;D	0.85130	0.77;0.997;0.995	D	0.95044	0.8181	10	0.87932	D	0	-22.2422	20.2187	0.98312	0.0:0.0:1.0:0.0	.	403;403;403	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	A	403	ENSP00000370630:G403A;ENSP00000450832:G403A;ENSP00000351352:G403A	ENSP00000351352:G403A	G	+	2	0	SIPA1L1	71125550	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	GGA	SIPA1L1	-	NULL	ENSG00000197555		0.463	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	-	0.00	50	0	G	NM_015556		72055797	+1	tier1	-	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	10.19	95	11	SNP	1.000	C
SLC13A4	26266	genome.wustl.edu	37	7	135386446	135386446	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:135386446C>G	ENST00000354042.4	-	7	1382	c.693G>C	c.(691-693)aaG>aaC	p.K231N	RP11-644N4.1_ENST00000609370.1_RNA	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	231					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						GGTGTTGCTTCTTGCCCTGGT	0.507																																																	0													386.0	286.0	320.0					7																	135386446		2203	4300	6503	SO:0001583	missense	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.693G>C	7.37:g.135386446C>G	ENSP00000297282:p.Lys231Asn		A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.K231N	ENST00000354042.4	37	c.693	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852145	0.32699	.	.	ENSG00000164707	ENST00000354042	T	0.69040	-0.37	4.94	4.94	0.65067	.	0.449691	0.22165	N	0.063723	T	0.44891	0.1315	N	0.08118	0	0.31760	N	0.633494	B;B	0.10296	0.003;0.001	B;B	0.16289	0.015;0.001	T	0.48514	-0.9029	10	0.33940	T	0.23	.	10.7033	0.45939	0.1902:0.8098:0.0:0.0	.	100;231	Q59HF0;Q9UKG4	.;S13A4_HUMAN	N	231	ENSP00000297282:K231N	ENSP00000297282:K231N	K	-	3	2	SLC13A4	135036986	1.000000	0.71417	0.991000	0.47740	0.953000	0.61014	2.173000	0.42472	2.551000	0.86045	0.655000	0.94253	AAG	SLC13A4	-	pfam_Na/sul_symport	ENSG00000164707		0.507	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	-	0.00	179	0	C	NM_012450		135386446	-1	tier1	-	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	14.15	181	30	SNP	1.000	G
SLC16A2	6567	genome.wustl.edu	37	X	73749129	73749129	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:73749129C>G	ENST00000587091.1	+	5	1429	c.1252C>G	c.(1252-1254)Ctt>Gtt	p.L418V	SLC16A2_ENST00000276033.5_Missense_Mutation_p.L492V	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	418					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	CGTCGTCTGTCTTTTCCTGGG	0.577																																																	0													114.0	101.0	105.0					X																	73749129		2203	4300	6503	SO:0001583	missense	0				CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.1252C>G	X.37:g.73749129C>G	ENSP00000465734:p.Leu418Val		Q7Z797	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L492V	ENST00000587091.1	37	c.1474	CCDS14426.2	X	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655052	0.29425	.	.	ENSG00000147100	ENST00000276033	T	0.32988	1.43	5.44	5.44	0.79542	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.200055	0.43110	D	0.000619	T	0.29028	0.0721	L	0.43757	1.38	0.46149	D	0.998898	B	0.23806	0.091	B	0.31101	0.124	T	0.06481	-1.0824	10	0.35671	T	0.21	.	11.8302	0.52290	0.0:0.9177:0.0:0.0823	.	418	P36021	MOT8_HUMAN	V	492	ENSP00000276033:L492V	ENSP00000276033:L492V	L	+	1	0	SLC16A2	73665854	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.403000	0.44530	2.269000	0.75478	0.529000	0.55759	CTT	SLC16A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000147100		0.577	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A2	HGNC	protein_coding	OTTHUMT00000057266.3	-	0.00	34	0	C			73749129	+1	tier1	-	no_errors	ENST00000276033	ensembl	human	known	74_37	missense	8.33	55	5	SNP	1.000	G
SLC25A51	92014	genome.wustl.edu	37	9	37888332	37888332	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:37888332C>T	ENST00000377716.2	-	3	959	c.216G>A	c.(214-216)ttG>ttA	p.L72L	SLC25A51_ENST00000496760.1_Intron|RP11-613M10.9_ENST00000540557.1_Intron|SLC25A51_ENST00000380590.3_Silent_p.L72L|SLC25A51_ENST00000242275.6_Silent_p.L72L			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	72					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											CATCCCTTCTCAACTGAAGTA	0.438																																																	0													113.0	101.0	105.0					9																	37888332		2203	4300	6503	SO:0001819	synonymous_variant	0			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.216G>A	9.37:g.37888332C>T				Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.L72	ENST00000377716.2	37	c.216	CCDS6614.1	9																																																																																			SLC25A51	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000122696		0.438	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC25A51	HGNC	protein_coding	OTTHUMT00000313746.1	-	0.00	68	0	C	NM_033412		37888332	-1	tier1	-	no_errors	ENST00000242275	ensembl	human	known	74_37	silent	29.09	78	32	SNP	0.995	T
SLC44A4	80736	genome.wustl.edu	37	6	31833354	31833354	+	Missense_Mutation	SNP	C	C	G	rs537294061	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:31833354C>G	ENST00000229729.6	-	16	1627	c.1607G>C	c.(1606-1608)tGc>tCc	p.C536S	SLC44A4_ENST00000544672.1_Missense_Mutation_p.C460S|SLC44A4_ENST00000375562.4_Missense_Mutation_p.C494S|NEU1_ENST00000375631.4_5'Flank	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	536					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GCACATGATGCAGCGGGCTAC	0.527																																																	0													92.0	97.0	95.0					6																	31833354		1511	2709	4220	SO:0001583	missense	0			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1607G>C	6.37:g.31833354C>G	ENSP00000229729:p.Cys536Ser		A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.C536S	ENST00000229729.6	37	c.1607	CCDS4724.2	6	.	.	.	.	.	.	.	.	.	.	C	18.72	3.685108	0.68157	.	.	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.24538	1.85;1.85;1.85	5.38	5.38	0.77491	.	0.051514	0.85682	D	0.000000	T	0.34745	0.0908	M	0.84948	2.725	0.41386	D	0.98758	B	0.22541	0.071	B	0.43082	0.407	T	0.22556	-1.0213	10	0.39692	T	0.17	-24.972	13.0601	0.59002	0.1609:0.8391:0.0:0.0	.	536	Q53GD3	CTL4_HUMAN	S	536;494;460	ENSP00000229729:C536S;ENSP00000364712:C494S;ENSP00000444109:C460S	ENSP00000229729:C536S	C	-	2	0	SLC44A4	31941333	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.063000	0.57499	2.813000	0.96785	0.655000	0.94253	TGC	SLC44A4	-	pfam_Choline_transptr-like	ENSG00000204385		0.527	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC44A4	HGNC	protein_coding	OTTHUMT00000076234.3	-	0.00	39	0	C			31833354	-1	tier1	-	no_errors	ENST00000229729	ensembl	human	known	74_37	missense	11.90	36	5	SNP	0.999	G
SLC6A13	6540	genome.wustl.edu	37	12	330676	330676	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr12:330676G>T	ENST00000343164.4	-	14	1604	c.1552C>A	c.(1552-1554)Ctg>Atg	p.L518M	SLC6A13_ENST00000445055.2_Missense_Mutation_p.L426M|SLC6A13_ENST00000539668.1_5'Flank	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	518					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TTGTAGGTCAGCGGAGTGTAC	0.617																																																	0													68.0	75.0	72.0					12																	330676		2203	4300	6503	SO:0001583	missense	0			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1552C>A	12.37:g.330676G>T	ENSP00000339260:p.Leu518Met		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.L518M	ENST00000343164.4	37	c.1552	CCDS8502.1	12	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840590	0.71488	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.76060	-0.99;-0.99	5.24	4.24	0.50183	.	0.000000	0.64402	D	0.000001	D	0.86834	0.6028	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;D;D	0.85130	0.997;0.984;0.984	D	0.87171	0.2221	10	0.48119	T	0.1	.	11.6591	0.51337	0.1591:0.0:0.8409:0.0	.	426;497;518	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	M	426;497;518	ENSP00000407104:L426M;ENSP00000339260:L518M	ENSP00000318097:L497M	L	-	1	2	SLC6A13	200937	1.000000	0.71417	0.869000	0.34112	0.985000	0.73830	5.793000	0.69060	1.039000	0.40074	0.448000	0.29417	CTG	SLC6A13	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000010379		0.617	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1		0.00	61	0	G	NM_016615		330676	-1			no_errors	ENST00000343164	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.995	T
SLC9A4	389015	genome.wustl.edu	37	2	103141509	103141509	+	Silent	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:103141509C>G	ENST00000295269.4	+	10	2302	c.1845C>G	c.(1843-1845)ctC>ctG	p.L615L		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	615					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						AATACAACCTCAAACCCCAAA	0.483																																																	0													190.0	204.0	199.0					2																	103141509		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1845C>G	2.37:g.103141509C>G			Q69YK0	Silent	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.L615	ENST00000295269.4	37	c.1845	CCDS33264.1	2																																																																																			SLC9A4	-	tigrfam_NaH_exchanger	ENSG00000180251		0.483	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	-	0.00	39	0	C	NM_001011552.3		103141509	+1	tier1	-	no_errors	ENST00000295269	ensembl	human	known	74_37	silent	9.72	65	7	SNP	0.038	G
SLC9A5	6553	genome.wustl.edu	37	16	67292260	67292260	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:67292260G>A	ENST00000299798.11	+	10	1601	c.1536G>A	c.(1534-1536)ctG>ctA	p.L512L	CTC-277H1.7_ENST00000573063.1_RNA	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	512					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GTCAGCTGCTGATGCGACGAT	0.592																																																	0													59.0	65.0	63.0					16																	67292260		2071	4212	6283	SO:0001819	synonymous_variant	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.1536G>A	16.37:g.67292260G>A			A5PKY7|Q9Y626	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L512	ENST00000299798.11	37	c.1536	CCDS42178.1	16																																																																																			SLC9A5	-	tigrfam_NaH_exchanger	ENSG00000135740		0.592	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1	-	0.00	36	0	G			67292260	+1	tier1	-	no_errors	ENST00000299798	ensembl	human	known	74_37	silent	13.89	62	10	SNP	1.000	A
SLCO2A1	6578	genome.wustl.edu	37	3	133664007	133664007	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:133664007C>G	ENST00000310926.4	-	10	1666	c.1393G>C	c.(1393-1395)Gag>Cag	p.E465Q	SLCO2A1_ENST00000493729.1_Missense_Mutation_p.E389Q	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	465	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	GAGAGGTACTCGATTCCATTG	0.567																																																	0													159.0	160.0	160.0					3																	133664007		2203	4300	6503	SO:0001583	missense	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1393G>C	3.37:g.133664007C>G	ENSP00000311291:p.Glu465Gln		Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.E465Q	ENST00000310926.4	37	c.1393	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577477	0.65878	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.04406	3.63;3.63	5.45	5.45	0.79879	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	0.050543	0.85682	D	0.000000	T	0.18964	0.0455	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	T	0.00192	-1.1935	10	0.41790	T	0.15	.	19.268	0.93997	0.0:1.0:0.0:0.0	.	284;389;465	B7Z8J8;E7EU40;Q92959	.;.;SO2A1_HUMAN	Q	465;389	ENSP00000311291:E465Q;ENSP00000418893:E389Q	ENSP00000311291:E465Q	E	-	1	0	SLCO2A1	135146697	1.000000	0.71417	0.950000	0.38849	0.659000	0.38960	7.078000	0.76821	2.559000	0.86315	0.491000	0.48974	GAG	SLCO2A1	-	pfam_OA_transporter,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000174640		0.567	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	-	0.00	41	0	C	NM_005630		133664007	-1	tier1	-	no_errors	ENST00000310926	ensembl	human	known	74_37	missense	14.04	49	8	SNP	1.000	G
SMG1	23049	genome.wustl.edu	37	16	18823362	18823362	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:18823362G>A	ENST00000446231.2	-	61	11121	c.10709C>T	c.(10708-10710)tCa>tTa	p.S3570L	SMG1_ENST00000389467.3_Missense_Mutation_p.S3571L|RP11-1035H13.2_ENST00000569096.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3570					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						AGTATCAGCTGATGTAGCAAG	0.458																																																	0													102.0	93.0	96.0					16																	18823362		1914	4133	6047	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.10709C>T	16.37:g.18823362G>A	ENSP00000402515:p.Ser3570Leu		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S3571L	ENST00000446231.2	37	c.10712	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832788	0.91036	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01304	5.03;5.03	5.87	5.87	0.94306	.	0.355680	0.24499	N	0.037996	T	0.01661	0.0053	L	0.29908	0.895	0.50632	D	0.999881	P	0.37466	0.596	B	0.29785	0.107	T	0.73094	-0.4091	10	0.25106	T	0.35	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	3570	Q96Q15	SMG1_HUMAN	L	3570;3571	ENSP00000402515:S3570L;ENSP00000374118:S3571L	ENSP00000374118:S3571L	S	-	2	0	SMG1	18730863	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.417000	0.97391	2.941000	0.99782	0.655000	0.94253	TCA	SMG1	-	NULL	ENSG00000157106		0.458	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	-	0.00	47	0	G	NM_015092		18823362	-1	tier1	-	no_errors	ENST00000389467	ensembl	human	known	74_37	missense	13.51	96	15	SNP	1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52613043	52613043	+	Intron	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr3:52613043C>T	ENST00000296302.7	-	21	3535				PBRM1_ENST00000394830.3_Intron|PBRM1_ENST00000409767.1_Intron|PBRM1_ENST00000409057.1_Intron|SMIM4_ENST00000476842.1_Missense_Mutation_p.S54L|PBRM1_ENST00000409114.3_Intron|PBRM1_ENST00000410007.1_Intron|PBRM1_ENST00000337303.4_Intron|PBRM1_ENST00000356770.4_Intron			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GATTCAACCTCATCTTCCCTA	0.488			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													98.0	90.0	93.0					3																	52613043		2203	4300	6503	SO:0001627	intron_variant	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3533+26G>A	3.37:g.52613043C>T			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	NULL	p.S54L	ENST00000296302.7	37	c.161		3	.	.	.	.	.	.	.	.	.	.	C	9.461	1.093194	0.20471	.	.	ENSG00000168273	ENST00000476842	.	.	.	4.09	-2.89	0.05665	.	.	.	.	.	T	0.34483	0.0899	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41592	-0.9500	5	0.87932	D	0	.	4.1404	0.10191	0.2571:0.3021:0.0:0.4408	.	.	.	.	L	54	.	ENSP00000418000:S54L	S	+	2	0	C3orf78	52588083	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.341000	0.07811	-0.660000	0.05352	-1.057000	0.02308	TCA	SMIM4	-	NULL	ENSG00000168273		0.488	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	SMIM4	HGNC	protein_coding	OTTHUMT00000327232.1	-	0.00	31	0	C	NM_018165		52613043	+1	tier1	-	no_errors	ENST00000476842	ensembl	human	putative	74_37	missense	13.33	26	4	SNP	0.000	T
TRNAU1AP	54952	genome.wustl.edu	37	1	28907438	28907438	+	IGR	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:28907438A>G	ENST00000373830.3	+	0	1793				SNHG12_ENST00000475441.1_RNA|SNHG12_ENST00000384584.1_RNA|SNORD99_ENST00000408612.1_RNA|SNHG12_ENST00000483436.1_RNA|SNHG12_ENST00000488745.1_RNA|SNHG12_ENST00000384581.1_RNA|SNHG12_ENST00000531126.1_RNA|SNHG12_ENST00000384342.1_RNA	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1						selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						ATGGAACTGTATTTTCCCAAA	0.473																																																	0													165.0	160.0	161.0					1																	28907438		876	1991	2867	SO:0001628	intergenic_variant	0				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653		1.37:g.28907438A>G			Q86SU7	RNA	SNP	-	NULL	ENST00000373830.3	37	NULL	CCDS324.1	1																																																																																			SNHG12	-	-	ENSG00000197989		0.473	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNHG12	HGNC	protein_coding	OTTHUMT00000010346.1	-	0.00	47	0	A	NM_017846		28907438	-1	tier1	-	no_errors	ENST00000384342	ensembl	human	known	74_37	rna	10.34	52	6	SNP	1.000	G
SNAPIN	23557	genome.wustl.edu	37	1	153631615	153631615	+	Splice_Site	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:153631615G>C	ENST00000368685.5	+	2	235	c.145G>C	c.(145-147)Gag>Cag	p.E49Q	SNAPIN_ENST00000478558.1_3'UTR|ILF2_ENST00000480213.1_5'Flank	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	49					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCTTTGCAGAGAGAGCCAGGT	0.532																																																	0													49.0	49.0	49.0					1																	153631615		2203	4300	6503	SO:0001630	splice_region_variant	0			AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.144-1G>C	1.37:g.153631615G>C			D3DV56|Q5SXU8	Missense_Mutation	SNP	pirsf_Snapin	p.E49Q	ENST00000368685.5	37	c.145	CCDS1049.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936639	0.73442	.	.	ENSG00000143553	ENST00000368685	T	0.44482	0.92	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.14442	0.0349	N	0.04994	-0.135	0.54753	D	0.999985	B	0.18013	0.025	B	0.11329	0.006	T	0.03651	-1.1016	10	0.42905	T	0.14	-36.9764	17.2626	0.87075	0.0:0.0:1.0:0.0	.	49	O95295	SNAPN_HUMAN	Q	49	ENSP00000357674:E49Q	ENSP00000357674:E49Q	E	+	1	0	SNAPIN	151898239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.515000	0.73751	2.941000	0.99782	0.655000	0.94253	GAG	SNAPIN	-	pirsf_Snapin	ENSG00000143553		0.532	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPIN	HGNC	protein_coding	OTTHUMT00000090036.1	-	0.00	51	0	G	NM_012437	Missense_Mutation	153631615	+1	tier1	-	no_errors	ENST00000368685	ensembl	human	known	74_37	missense	11.36	78	10	SNP	1.000	C
RPL30	6156	genome.wustl.edu	37	8	99054836	99054837	+	Intron	INS	-	-	AAAA	rs3073528|rs143116921|rs56899568		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:99054836_99054837insAAAA	ENST00000521291.1	-	3	445				RPL30_ENST00000396070.2_Intron|RPL30_ENST00000287038.3_Intron|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000518164.1_Intron			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			ATTAGAAAGGCAAAAAAAAAAA	0.361																																																	0																																										SO:0001627	intron_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+35->TTTT	8.37:g.99054841_99054844dupAAAA			B2R591|P04645|Q502Z6	RNA	INS	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.361	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1		0.00	22	0	-			99054837	+1	tier1		no_errors	ENST00000501016	ensembl	human	known	74_37	rna	15.00	34	6	INS	0.001:0.049	AAAA
MTCL1	23255	genome.wustl.edu	37	18	8813075	8813075	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr18:8813075G>C	ENST00000306329.11	+	10	3660	c.3660G>C	c.(3658-3660)ctG>ctC	p.L1220L	SOGA2_ENST00000518815.1_Silent_p.L254L|SOGA2_ENST00000306285.7_Silent_p.L254L|SOGA2_ENST00000400050.3_Silent_p.L860L|SOGA2_ENST00000359865.3_Silent_p.L901L|SOGA2_ENST00000517570.1_Silent_p.L860L																							AGAAGCTCCTGGCAGACAGTC	0.572																																																	0													55.0	53.0	54.0					18																	8813075		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000306329.11:c.3660G>C	18.37:g.8813075G>C				Silent	SNP	pfam_SOGA	p.L901	ENST00000306329.11	37	c.2703		18	.	.	.	.	.	.	.	.	.	.	G	9.850	1.193463	0.22037	.	.	ENSG00000168502	ENST00000519823	.	.	.	4.96	-0.896	0.10557	.	.	.	.	.	T	0.49983	0.1589	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38779	-0.9645	4	.	.	.	-7.2696	5.1749	0.15129	0.0736:0.1061:0.3925:0.4277	.	.	.	.	R	35	.	.	G	+	1	0	CCDC165	8803075	0.616000	0.27035	0.951000	0.38953	0.953000	0.61014	-0.300000	0.08243	-0.031000	0.13781	0.462000	0.41574	GGC	SOGA2	-	NULL	ENSG00000168502		0.572	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1		0.00	16	0	G			8813075	+1			no_errors	ENST00000359865	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.998	C
SP100	6672	genome.wustl.edu	37	2	231307706	231307706	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:231307706C>G	ENST00000264052.5	+	3	517	c.162C>G	c.(160-162)ttC>ttG	p.F54L	SP100_ENST00000340126.4_Missense_Mutation_p.F54L|SP100_ENST00000409341.1_Missense_Mutation_p.F54L|SP100_ENST00000409112.1_Missense_Mutation_p.F54L|SP100_ENST00000409824.1_Missense_Mutation_p.F29L|SP100_ENST00000409897.1_Missense_Mutation_p.F19L|SP100_ENST00000341950.4_Missense_Mutation_p.F54L|SP100_ENST00000427101.2_Missense_Mutation_p.F29L	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	54	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ACATTGTATTCAAGCACTTCA	0.408																																																	0													125.0	125.0	125.0					2																	231307706		2203	4300	6503	SO:0001583	missense	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.162C>G	2.37:g.231307706C>G	ENSP00000264052:p.Phe54Leu		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.F54L	ENST00000264052.5	37	c.162	CCDS2477.1	2	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689596	0.48097	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000432979;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	D;D;D;D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	4.08	-2.58	0.06228	Sp100 (2);	.	.	.	.	D	0.90693	0.7080	L	0.49256	1.55	0.09310	N	1	P;P;P;P;P;P;B;P	0.50617	0.923;0.898;0.937;0.725;0.844;0.561;0.394;0.923	P;P;P;P;P;B;P;P	0.57720	0.569;0.754;0.794;0.696;0.826;0.207;0.708;0.69	T	0.81302	-0.0994	9	0.34782	T	0.22	.	3.2922	0.06953	0.4559:0.2561:0.0:0.288	.	29;54;19;54;54;54;29;54	F8WFE2;B4E2B9;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.;.;.;.;SP100_HUMAN;.;.;.	L	54;29;29;29;54;54;54;54;19	ENSP00000264052:F54L;ENSP00000399389:F29L;ENSP00000391616:F29L;ENSP00000387311:F29L;ENSP00000386404:F54L;ENSP00000386427:F54L;ENSP00000343023:F54L;ENSP00000342729:F54L;ENSP00000386998:F19L	ENSP00000264052:F54L	F	+	3	2	SP100	231015950	0.003000	0.15002	0.000000	0.03702	0.031000	0.12232	0.085000	0.14912	-0.559000	0.06110	0.563000	0.77884	TTC	SP100	-	pfam_Sp100	ENSG00000067066		0.408	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000256914.2	-	0.00	53	0	C	NM_003113		231307706	+1	tier1	-	no_errors	ENST00000340126	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	G
SPAG17	200162	genome.wustl.edu	37	1	118596628	118596628	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:118596628G>C	ENST00000336338.5	-	20	2876	c.2811C>G	c.(2809-2811)ctC>ctG	p.L937L		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	937						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ggaTTACCTTGAGAGAGCCTT	0.353																																																	0													57.0	58.0	58.0					1																	118596628		2200	4297	6497	SO:0001819	synonymous_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2811C>G	1.37:g.118596628G>C			Q8NAZ1|Q9NT21	Silent	SNP	NULL	p.L937	ENST00000336338.5	37	c.2811	CCDS899.1	1																																																																																			SPAG17	-	NULL	ENSG00000155761		0.353	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	-	0.00	54	0	G	NM_206996		118596628	-1	tier1	-	no_errors	ENST00000336338	ensembl	human	known	74_37	silent	5.26	90	5	SNP	0.998	C
SPAG9	9043	genome.wustl.edu	37	17	49197792	49197792	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:49197792C>G	ENST00000262013.7	-	1	434	c.226G>C	c.(226-228)Gag>Cag	p.E76Q	SPAG9_ENST00000357122.4_Missense_Mutation_p.E76Q|SPAG9_ENST00000505279.1_Missense_Mutation_p.E76Q	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	76					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CGCAGCAGCTCCAGCTCCACC	0.667																																																	0													46.0	37.0	40.0					17																	49197792		2203	4300	6503	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.226G>C	17.37:g.49197792C>G	ENSP00000262013:p.Glu76Gln		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.E76Q	ENST00000262013.7	37	c.226	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940725	0.92526	.	.	ENSG00000008294	ENST00000262013;ENST00000505279;ENST00000357122;ENST00000546269	T;T;T	0.48201	0.82;0.82;0.82	4.19	3.19	0.36642	JNK/Rab-associated protein-1, N-terminal (1);	0.000000	0.64402	U	0.000003	T	0.64472	0.2601	M	0.64997	1.995	0.46774	D	0.999191	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.999	T	0.67933	-0.5542	10	0.87932	D	0	-8.9148	13.6399	0.62243	0.1558:0.8442:0.0:0.0	.	76;76;76	O60271-2;O60271;O60271-4	.;JIP4_HUMAN;.	Q	76	ENSP00000262013:E76Q;ENSP00000426900:E76Q;ENSP00000349636:E76Q	ENSP00000262013:E76Q	E	-	1	0	SPAG9	46552791	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.312000	0.65792	0.854000	0.35336	0.449000	0.29647	GAG	SPAG9	-	pfam_JNK/Rab-associated_protein-1_N	ENSG00000008294		0.667	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2		0.00	49	0	C	NM_003971		49197792	-1			no_errors	ENST00000262013	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	G
SRSF7	6432	genome.wustl.edu	37	2	38973295	38973295	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:38973295G>C	ENST00000313117.6	-	7	890	c.653C>G	c.(652-654)cCa>cGa	p.P218R	SRSF7_ENST00000446327.2_Intron|SRSF7_ENST00000409276.1_Missense_Mutation_p.P215R	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	218	6 X 8 AA repeats of R-R-S-R-S-X-S-X.|Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCTTCTTTTTGGAGATGGAGA	0.393																																																	0													113.0	108.0	110.0					2																	38973295		2203	4300	6503	SO:0001583	missense	0			L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.653C>G	2.37:g.38973295G>C	ENSP00000325905:p.Pro218Arg		B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	pfam_RRM_dom,superfamily_Znf_CCHC,smart_RRM_dom,pfscan_Znf_CCHC,pfscan_RRM_dom	p.P218R	ENST00000313117.6	37	c.653	CCDS33183.1	2	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781599	0.49891	.	.	ENSG00000115875	ENST00000313117;ENST00000409276	T;T	0.13307	2.6;3.06	6.16	5.29	0.74685	.	0.000000	0.64402	D	0.000002	T	0.05640	0.0148	N	0.04260	-0.245	0.80722	D	1	P	0.42039	0.769	B	0.37387	0.248	T	0.37820	-0.9689	10	0.07482	T	0.82	.	12.2577	0.54633	0.1349:0.0:0.8651:0.0	.	218	Q16629	SRSF7_HUMAN	R	218;215	ENSP00000325905:P218R;ENSP00000386806:P215R	ENSP00000325905:P218R	P	-	2	0	SRSF7	38826799	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.202000	0.58446	1.616000	0.50265	0.650000	0.86243	CCA	SRSF7	-	NULL	ENSG00000115875		0.393	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF7	HGNC	protein_coding	OTTHUMT00000219889.2	-	0.00	46	0	G	NM_001031684		38973295	-1	tier1	-	no_errors	ENST00000313117	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	C
SPATA3	130560	genome.wustl.edu	37	2	231865090	231865090	+	Missense_Mutation	SNP	T	T	C	rs2271376	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:231865090T>C	ENST00000452881.1	+	2	419	c.311T>C	c.(310-312)aTt>aCt	p.I104T	SPATA3_ENST00000433428.2_Missense_Mutation_p.I104T|SPATA3_ENST00000455816.1_Missense_Mutation_p.I104T|SPATA3_ENST00000424440.1_Missense_Mutation_p.I104T|SPATA3_ENST00000409956.1_Intron			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	104				I -> T (in Ref. 4; AAH47704). {ECO:0000305}.						endometrium(2)|lung(1)	3						GGGCCTCTGATTCGCGCCGGC	0.657													C|||	2248	0.448882	0.4644	0.3617	5008	,	,		17108	0.4742		0.4095	False		,,,				2504	0.5041																0								C	THR/ILE	637,747		147,343,202	39.0	38.0	38.0		311	-0.7	0.0	2	dbSNP_100	38	1228,1954		215,798,578	yes	missense	SPATA3	NM_139073.3	89	362,1141,780	CC,CT,TT		38.5921,46.026,40.8454	benign	104/193	231865090	1865,2701	692	1591	2283	SO:0001583	missense	0			AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.311T>C	2.37:g.231865090T>C	ENSP00000388895:p.Ile104Thr		Q86WX5|Q8N9Y6	Missense_Mutation	SNP	NULL	p.I104T	ENST00000452881.1	37	c.311	CCDS2481.1	2	935	0.4281135531135531	240	0.4878048780487805	132	0.36464088397790057	244	0.42657342657342656	319	0.420844327176781	C	0.016	-1.514670	0.00975	0.46026	0.385921	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662	.	.	.	4.25	-0.717	0.11208	.	1.005100	0.08013	N	0.990612	T	0.00012	0.0000	N	0.02247	-0.625	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43814	-0.9368	8	0.02654	T	1	-2.041	4.8384	0.13476	0.0:0.3588:0.1618:0.4794	rs2271376;rs17857338;rs60977521;rs2271376	95	Q8NHX4	SPTA3_HUMAN	T	104;104;104;104;95	.	ENSP00000347884:I95T	I	+	2	0	SPATA3	231573334	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.835000	0.04386	-0.390000	0.07774	-0.733000	0.03571	ATT	SPATA3	-	NULL	ENSG00000173699		0.657	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA3	HGNC	protein_coding	OTTHUMT00000256956.2		0.00	44	0	T	NM_139073		231865090	+1			no_errors	ENST00000424440	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.002	C
STK31	56164	genome.wustl.edu	37	7	23826213	23826213	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:23826213C>G	ENST00000355870.3	+	19	2480	c.2361C>G	c.(2359-2361)gaC>gaG	p.D787E	STK31_ENST00000433467.2_Missense_Mutation_p.D787E|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Missense_Mutation_p.D764E|STK31_ENST00000354639.3_Missense_Mutation_p.D764E	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	787	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CTGAAGGAGACTCAGGGTTAC	0.398																																																	0													123.0	113.0	117.0					7																	23826213		2203	4300	6503	SO:0001583	missense	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2361C>G	7.37:g.23826213C>G	ENSP00000348132:p.Asp787Glu		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	pfam_Tudor,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tudor,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Tudor,pfscan_Prot_kinase_dom	p.D787E	ENST00000355870.3	37	c.2361	CCDS5386.1	7	.	.	.	.	.	.	.	.	.	.	C	0.688	-0.795616	0.02862	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.73575	-0.76;2.15;-0.76;-0.76	5.17	-1.08	0.09936	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.428344	0.23362	N	0.049012	T	0.31888	0.0811	N	0.01576	-0.805	0.09310	N	0.999991	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33979	-0.9847	10	0.02654	T	1	-0.2871	0.8931	0.01258	0.3376:0.1133:0.3205:0.2286	.	787;787	B4DZ06;Q9BXU1	.;STK31_HUMAN	E	787;787;764;764	ENSP00000348132:D787E;ENSP00000411852:D787E;ENSP00000346660:D764E;ENSP00000406146:D764E	ENSP00000346660:D764E	D	+	3	2	STK31	23792738	0.393000	0.25237	0.924000	0.36721	0.824000	0.46624	-0.520000	0.06252	-0.290000	0.09025	-0.359000	0.07587	GAC	STK31	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000196335		0.398	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2	-	0.00	56	0	C	NM_031414		23826213	+1	tier1	-	no_errors	ENST00000355870	ensembl	human	known	74_37	missense	35.64	64	36	SNP	0.955	G
STARD3NL	83930	genome.wustl.edu	37	7	38259194	38259194	+	Missense_Mutation	SNP	G	G	C	rs376265781		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:38259194G>C	ENST00000009041.7	+	7	839	c.582G>C	c.(580-582)gaG>gaC	p.E194D	STARD3NL_ENST00000396013.1_Missense_Mutation_p.E194D|STARD3NL_ENST00000434197.1_Missense_Mutation_p.E176D|STARD3NL_ENST00000544203.1_Missense_Mutation_p.E187D	NM_032016.3	NP_114405.1	O95772	MENTO_HUMAN	STARD3 N-terminal like	194	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.					endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10						ATGCTTCAGAGAGGGCAGCAC	0.413																																																	0													148.0	137.0	141.0					7																	38259194		2203	4300	6503	SO:0001583	missense	0			AJ492267	CCDS5455.1	7p14-p13	2003-02-06			ENSG00000010270	ENSG00000010270			19169	protein-coding gene	gene with protein product		611759				12393907	Standard	NM_032016		Approved	MENTHO, MGC3251	uc003tfr.3	O95772	OTTHUMG00000023659	ENST00000009041.7:c.582G>C	7.37:g.38259194G>C	ENSP00000009041:p.Glu194Asp		A4D1X0	Missense_Mutation	SNP	pfam_MENTAL	p.E194D	ENST00000009041.7	37	c.582	CCDS5455.1	7	.	.	.	.	.	.	.	.	.	.	G	19.80	3.893926	0.72639	.	.	ENSG00000010270	ENST00000009041;ENST00000544203;ENST00000434197;ENST00000396013;ENST00000429075	T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85	5.89	5.89	0.94794	MENTAL domain (2);	0.047154	0.85682	D	0.000000	T	0.52549	0.1741	L	0.49455	1.56	0.49687	D	0.999816	P;P	0.48294	0.899;0.908	P;P	0.52031	0.688;0.472	T	0.44513	-0.9323	10	0.34782	T	0.22	-16.1369	12.3726	0.55263	0.0778:0.0:0.9222:0.0	.	176;194	C9JKL2;O95772	.;MENTO_HUMAN	D	194;187;176;194;194	ENSP00000009041:E194D;ENSP00000439436:E187D;ENSP00000394000:E176D;ENSP00000379334:E194D;ENSP00000402028:E194D	ENSP00000009041:E194D	E	+	3	2	STARD3NL	38225719	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	1.794000	0.38774	2.793000	0.96121	0.643000	0.83706	GAG	STARD3NL	-	pfam_MENTAL	ENSG00000010270		0.413	STARD3NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3NL	HGNC	protein_coding	OTTHUMT00000226929.2	-	0.00	73	0	G			38259194	+1	tier1	-	no_errors	ENST00000009041	ensembl	human	known	74_37	missense	13.67	120	19	SNP	1.000	C
STX17	55014	genome.wustl.edu	37	9	102713413	102713413	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr9:102713413G>A	ENST00000259400.6	+	4	397	c.261G>A	c.(259-261)ctG>ctA	p.L87L	STX17_ENST00000525847.1_3'UTR|STX17_ENST00000534052.1_Silent_p.L87L|STX17_ENST00000525640.1_Silent_p.L87L	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	87					autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				TAGTACTTCTGAAGAGAATGA	0.358																																																	0													89.0	88.0	89.0					9																	102713413		2203	4299	6502	SO:0001819	synonymous_variant	0			AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.261G>A	9.37:g.102713413G>A			Q4VXC2	Silent	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L87	ENST00000259400.6	37	c.261	CCDS6745.1	9																																																																																			STX17	-	superfamily_t-SNARE	ENSG00000136874		0.358	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	STX17	HGNC	protein_coding	OTTHUMT00000053398.3	-	0.00	39	0	G	NM_017919		102713413	+1	tier1	-	no_errors	ENST00000259400	ensembl	human	known	74_37	silent	19.18	59	14	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152644662	152644662	+	Missense_Mutation	SNP	C	C	G	rs555495237		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:152644662C>G	ENST00000367255.5	-	82	16469	c.15868G>C	c.(15868-15870)Gag>Cag	p.E5290Q	SYNE1_ENST00000265368.4_Missense_Mutation_p.E5290Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E5219Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.E4983Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E5219Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5290					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCGGAGGCTCTTCCCCAGGG	0.547										HNSCC(10;0.0054)																																							0													70.0	71.0	71.0					6																	152644662		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15868G>C	6.37:g.152644662C>G	ENSP00000356224:p.Glu5290Gln		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E5290Q	ENST00000367255.5	37	c.15868	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	7.808	0.715168	0.15306	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.55052	0.63;0.63;0.54;0.63;1.36	5.35	4.48	0.54585	.	0.106561	0.40908	D	0.000987	T	0.30293	0.0760	L	0.59436	1.845	0.80722	D	1	B;B;B;B	0.10296	0.003;0.002;0.002;0.003	B;B;B;B	0.19148	0.024;0.006;0.006;0.021	T	0.12811	-1.0533	10	0.21014	T	0.42	.	9.9502	0.41634	0.0:0.7846:0.1404:0.075	.	5290;5290;5290;5219	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	Q	5290;5219;5290;5219;4983	ENSP00000356224:E5290Q;ENSP00000396024:E5219Q;ENSP00000265368:E5290Q;ENSP00000390975:E5219Q;ENSP00000341887:E4983Q	ENSP00000265368:E5290Q	E	-	1	0	SYNE1	152686355	0.975000	0.34042	0.447000	0.26932	0.004000	0.04260	1.851000	0.39338	2.503000	0.84419	0.591000	0.81541	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.547	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	27	0	C	NM_182961		152644662	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	13.64	38	6	SNP	0.990	G
SYNE2	23224	genome.wustl.edu	37	14	64457753	64457753	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:64457753G>A	ENST00000344113.4	+	21	2778	c.2566G>A	c.(2566-2568)Gaa>Aaa	p.E856K	SYNE2_ENST00000358025.3_Missense_Mutation_p.E856K|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.E856K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	856					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ATCCCAGAAGGAACTTGAATC	0.433																																																	0													76.0	73.0	74.0					14																	64457753		1843	4097	5940	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2566G>A	14.37:g.64457753G>A	ENSP00000341781:p.Glu856Lys		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E856K	ENST00000344113.4	37	c.2566	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261616	0.59431	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59772	0.58;0.58;0.24	6.06	6.06	0.98353	.	0.114811	0.37955	N	0.001869	T	0.67674	0.2918	L	0.38531	1.155	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.63664	-0.6586	10	0.37606	T	0.19	.	16.1209	0.81357	0.0:0.0:1.0:0.0	.	856;856	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	K	856	ENSP00000350719:E856K;ENSP00000341781:E856K;ENSP00000452570:E856K	ENSP00000261678:E856K	E	+	1	0	SYNE2	63527506	1.000000	0.71417	0.956000	0.39512	0.484000	0.33280	3.071000	0.50041	2.882000	0.98803	0.655000	0.94253	GAA	SYNE2	-	NULL	ENSG00000054654		0.433	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	29	0	G	NM_182914		64457753	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	18.37	40	9	SNP	0.998	A
SYNE2	23224	genome.wustl.edu	37	14	64469753	64469753	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:64469753C>T	ENST00000344113.4	+	30	4314	c.4102C>T	c.(4102-4104)Cat>Tat	p.H1368Y	SYNE2_ENST00000358025.3_Missense_Mutation_p.H1368Y|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.H1368Y	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1368					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGGAGAAATTCATCTGATGAA	0.413																																																	0													79.0	73.0	75.0					14																	64469753		1852	4103	5955	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.4102C>T	14.37:g.64469753C>T	ENSP00000341781:p.His1368Tyr		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.H1368Y	ENST00000344113.4	37	c.4102	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	2.723	-0.266076	0.05754	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56103	0.85;0.85;0.48	5.65	-1.17	0.09648	.	1.528650	0.04135	N	0.318559	T	0.29716	0.0742	N	0.22421	0.69	0.09310	N	0.999998	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.12837	-1.0532	10	0.02654	T	1	.	2.105	0.03688	0.1294:0.321:0.1177:0.4319	.	1368;1368	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	Y	1368	ENSP00000350719:H1368Y;ENSP00000341781:H1368Y;ENSP00000452570:H1368Y	ENSP00000261678:H1368Y	H	+	1	0	SYNE2	63539506	0.000000	0.05858	0.000000	0.03702	0.391000	0.30476	-0.668000	0.05268	-0.248000	0.09583	-0.142000	0.14014	CAT	SYNE2	-	NULL	ENSG00000054654		0.413	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2		0.00	15	0	C	NM_182914		64469753	+1			no_errors	ENST00000358025	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.000	T
TAF4	6874	genome.wustl.edu	37	20	60578929	60578929	+	Silent	SNP	G	G	T	rs369202948		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:60578929G>T	ENST00000252996.4	-	8	2228	c.2229C>A	c.(2227-2229)atC>atA	p.I743I		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	743					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			GAGGCTGCTGGATGACCTGAG	0.647																																																	0													35.0	33.0	34.0					20																	60578929		2203	4300	6503	SO:0001819	synonymous_variant	0			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2229C>A	20.37:g.60578929G>T			A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.I743	ENST00000252996.4	37	c.2229	CCDS33500.1	20																																																																																			TAF4	-	NULL	ENSG00000130699		0.647	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	-	0.00	53	0	G	NM_003185		60578929	-1	tier1	-	no_errors	ENST00000252996	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.998	T
TBC1D19	55296	genome.wustl.edu	37	4	26744169	26744169	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:26744169C>T	ENST00000264866.4	+	18	1545	c.1267C>T	c.(1267-1269)Caa>Taa	p.Q423*	TBC1D19_ENST00000511789.1_Nonsense_Mutation_p.Q358*	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	423	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				AACTCTTCTTCAAACTTATCT	0.328																																																	0													127.0	132.0	130.0					4																	26744169		2203	4300	6503	SO:0001587	stop_gained	0			AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1267C>T	4.37:g.26744169C>T	ENSP00000264866:p.Gln423*		B9A6M0|Q9NUX1	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q423*	ENST00000264866.4	37	c.1267	CCDS3439.1	4	.	.	.	.	.	.	.	.	.	.	C	36	5.748803	0.96882	.	.	ENSG00000109680	ENST00000264866;ENST00000511789	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-14.2779	20.3812	0.98933	0.0:1.0:0.0:0.0	.	.	.	.	X	423;358	.	ENSP00000264866:Q423X	Q	+	1	0	TBC1D19	26353267	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.044000	0.76578	2.821000	0.97095	0.650000	0.86243	CAA	TBC1D19	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000109680		0.328	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D19	HGNC	protein_coding	OTTHUMT00000215052.2	-	0.00	53	0	C	NM_018317		26744169	+1	tier1	-	no_errors	ENST00000264866	ensembl	human	known	74_37	nonsense	19.35	50	12	SNP	1.000	T
TBC1D29	26083	genome.wustl.edu	37	17	28887700	28887700	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:28887700G>A	ENST00000580161.1	+	4	2641	c.144G>A	c.(142-144)atG>atA	p.M48I	TBC1D29_ENST00000579181.1_Missense_Mutation_p.M48I|TBC1D29_ENST00000584297.1_Missense_Mutation_p.M48I|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	48							Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				AGATGTTGATGCTGATAACAA	0.567																																																	0													157.0	133.0	141.0					17																	28887700		2203	4300	6503	SO:0001583	missense	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.144G>A	17.37:g.28887700G>A	ENSP00000462799:p.Met48Ile			Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.M48I	ENST00000580161.1	37	c.144	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	11.75	1.730367	0.30684	.	.	ENSG00000197689	ENST00000329040;ENST00000378698	.	.	.	.	.	.	Rab-GAP/TBC domain (1);	.	.	.	.	T	0.34542	0.0901	L	0.54323	1.7	0.20489	N	0.999891	B	0.33000	0.393	B	0.36030	0.216	T	0.25641	-1.0126	6	0.23891	T	0.37	.	.	.	.	.	48	Q9UFV1	TBC29_HUMAN	I	48	.	ENSP00000330052:M48I	M	+	3	0	TBC1D29	25911826	0.899000	0.30636	0.011000	0.14972	0.011000	0.07611	-0.477000	0.06583	0.121000	0.18284	0.123000	0.15791	ATG	TBC1D29	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000266733		0.567	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1	-	0.00	86	0	G	NM_015594		28887700	+1	tier1	-	no_errors	ENST00000579181	ensembl	human	known	74_37	missense	9.89	82	9	SNP	0.997	A
TCTE1	202500	genome.wustl.edu	37	6	44250020	44250020	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:44250020C>G	ENST00000371505.4	-	4	1245	c.1123G>C	c.(1123-1125)Gag>Cag	p.E375Q	RP11-444E17.6_ENST00000505802.1_Intron|TCTE1_ENST00000371503.3_Intron|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371504.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	375										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCCTCATCCTCGATGCAGTTG	0.612																																																	0													233.0	177.0	196.0					6																	44250020		2203	4300	6503	SO:0001583	missense	0			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.1123G>C	6.37:g.44250020C>G	ENSP00000360560:p.Glu375Gln		B4DX59|Q8IYS6	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E375Q	ENST00000371505.4	37	c.1123	CCDS4910.1	6	.	.	.	.	.	.	.	.	.	.	C	10.72	1.429629	0.25726	.	.	ENSG00000146221	ENST00000371505	T	0.53640	0.61	5.22	4.35	0.52113	.	0.225836	0.45867	D	0.000333	T	0.20129	0.0484	N	0.12831	0.26	0.80722	D	1	P	0.35011	0.48	B	0.41666	0.363	T	0.10314	-1.0635	10	0.23302	T	0.38	-38.7966	14.3335	0.66574	0.0:0.9277:0.0:0.0723	.	375	Q5JU00	TCTE1_HUMAN	Q	375	ENSP00000360560:E375Q	ENSP00000360560:E375Q	E	-	1	0	TCTE1	44357998	0.967000	0.33354	0.993000	0.49108	0.969000	0.65631	2.276000	0.43408	1.356000	0.45884	-0.463000	0.05309	GAG	TCTE1	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000146221		0.612	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTE1	HGNC	protein_coding	OTTHUMT00000040736.1	-	0.00	31	0	C	NM_182539		44250020	-1	tier1	-	no_errors	ENST00000371505	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.999	G
TBP	6908	genome.wustl.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																																	0													43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q60	ENST00000392092.2	37	c.180	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	-	0.00	45	0	G	NM_003194		170871004	+1	tier1	-	no_errors	ENST00000230354	ensembl	human	known	74_37	silent	13.79	75	12	SNP	0.991	A
TDP1	55775	genome.wustl.edu	37	14	90446926	90446926	+	Silent	SNP	C	C	T	rs377532827		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:90446926C>T	ENST00000335725.4	+	8	1084	c.834C>T	c.(832-834)gtC>gtT	p.V278V	TDP1_ENST00000393452.3_Silent_p.V278V|TDP1_ENST00000555880.1_Silent_p.V278V|TDP1_ENST00000357382.3_Silent_p.V39V|TDP1_ENST00000393454.2_Silent_p.V278V|TDP1_ENST00000555565.1_3'UTR	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	278					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		TCCGGGTTGTCATACACACCT	0.443								Repair of DNA-protein crosslinks																																									0								C	,	1,4405	2.1+/-5.4	0,1,2202	118.0	110.0	113.0		834,834	6.1	1.0	14		113	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TDP1	NM_001008744.1,NM_018319.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	278/609,278/609	90446926	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.834C>T	14.37:g.90446926C>T			Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	pfam_Tyr-DNA_phospho	p.V278	ENST00000335725.4	37	c.834	CCDS9888.1	14																																																																																			TDP1	-	pfam_Tyr-DNA_phospho	ENSG00000042088		0.443	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDP1	HGNC	protein_coding	OTTHUMT00000411239.1	-	0.00	63	0	C	NM_018319		90446926	+1	tier1	-	no_errors	ENST00000335725	ensembl	human	known	74_37	silent	9.90	91	10	SNP	1.000	T
TEX2	55852	genome.wustl.edu	37	17	62290620	62290620	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:62290620C>A	ENST00000583097.1	-	2	1130	c.958G>T	c.(958-960)Gcc>Tcc	p.A320S	TEX2_ENST00000258991.3_Missense_Mutation_p.A320S|TEX2_ENST00000584379.1_Missense_Mutation_p.A320S			Q8IWB9	TEX2_HUMAN	testis expressed 2	320					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GAAGATAAGGCTTTGGGCCTA	0.433																																																	0													55.0	56.0	55.0					17																	62290620		2203	4300	6503	SO:0001583	missense	0			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.958G>T	17.37:g.62290620C>A	ENSP00000462665:p.Ala320Ser		Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	pfam_DUF2404	p.A320S	ENST00000583097.1	37	c.958		17	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417204	0.25552	.	.	ENSG00000136478	ENST00000258991	T	0.52295	0.67	6.03	6.03	0.97812	.	0.169730	0.52532	D	0.000063	T	0.45418	0.1341	L	0.54323	1.7	0.40780	D	0.983169	P;P	0.39352	0.669;0.539	B;B	0.34824	0.19;0.093	T	0.34700	-0.9818	10	0.22109	T	0.4	-18.4586	20.5568	0.99304	0.0:1.0:0.0:0.0	.	320;320	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	S	320	ENSP00000258991:A320S	ENSP00000258991:A320S	A	-	1	0	TEX2	59644352	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.025000	0.49681	2.861000	0.98227	0.655000	0.94253	GCC	TEX2	-	NULL	ENSG00000136478		0.433	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	HGNC	protein_coding	OTTHUMT00000443745.1		0.00	22	0	C	NM_018469		62290620	-1			no_errors	ENST00000258991	ensembl	human	known	74_37	missense	8.11	33	3	SNP	1.000	A
TGFB3	7043	genome.wustl.edu	37	14	76447096	76447096	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr14:76447096G>C	ENST00000238682.3	-	1	438	c.141C>G	c.(139-141)atC>atG	p.I47M	TGFB3_ENST00000556674.1_5'Flank|TGFB3_ENST00000556285.1_Missense_Mutation_p.I47M	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	47					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		GCTTGCTCAAGATCTGTCCCC	0.587																																																	0													157.0	149.0	152.0					14																	76447096		2203	4300	6503	SO:0001583	missense	0				CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.141C>G	14.37:g.76447096G>C	ENSP00000238682:p.Ile47Met		Q8WV88	Missense_Mutation	SNP	pirsf_TGF-beta,pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Transform_grow_fac_b3,prints_TGF-beta	p.I47M	ENST00000238682.3	37	c.141	CCDS9846.1	14	.	.	.	.	.	.	.	.	.	.	G	14.72	2.618695	0.46736	.	.	ENSG00000119699	ENST00000238682;ENST00000556285	T;T	0.70986	-0.53;-0.53	4.65	4.65	0.58169	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83751	0.5322	M	0.85859	2.78	0.53005	D	0.999961	D	0.89917	1.0	D	0.97110	1.0	D	0.85767	0.1353	10	0.87932	D	0	-0.5976	10.3778	0.44092	0.0922:0.0:0.9078:0.0	.	47	P10600	TGFB3_HUMAN	M	47	ENSP00000238682:I47M;ENSP00000451110:I47M	ENSP00000238682:I47M	I	-	3	3	TGFB3	75516849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.225000	0.42954	2.302000	0.77476	0.561000	0.74099	ATC	TGFB3	-	pirsf_TGF-beta,pfam_TGF-b_N	ENSG00000119699		0.587	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB3	HGNC	protein_coding	OTTHUMT00000413685.1	-	0.00	70	0	G	NM_003239		76447096	-1	tier1	-	no_errors	ENST00000238682	ensembl	human	known	74_37	missense	15.97	100	19	SNP	1.000	C
TIAM1	7074	genome.wustl.edu	37	21	32638328	32638328	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr21:32638328G>A	ENST00000286827.3	-	5	1432	c.961C>T	c.(961-963)Cag>Tag	p.Q321*	TIAM1_ENST00000541036.1_Nonsense_Mutation_p.Q321*|TIAM1_ENST00000469412.1_Intron	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	321					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CACTTTACCTGAGTTGTTTTA	0.408																																																	0													76.0	71.0	72.0					21																	32638328		2203	4300	6503	SO:0001587	stop_gained	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.961C>T	21.37:g.32638328G>A	ENSP00000286827:p.Gln321*		B7ZLR6|F5GZ53|Q17RT7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.Q321*	ENST00000286827.3	37	c.961	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	G	41	8.544143	0.98857	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.7554	0.91830	0.0:0.0:1.0:0.0	.	.	.	.	X	321;162;321	.	ENSP00000286827:Q321X	Q	-	1	0	TIAM1	31560199	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.653000	0.91088	2.731000	0.93534	0.591000	0.81541	CAG	TIAM1	-	NULL	ENSG00000156299		0.408	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	64	0	G	NM_003253		32638328	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	nonsense	5.36	106	6	SNP	1.000	A
TMEM105	284186	genome.wustl.edu	37	17	79288254	79288254	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:79288254G>C	ENST00000332900.1	-	2	558	c.9C>G	c.(7-9)ctC>ctG	p.L3L		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	3						integral component of membrane (GO:0016021)				NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			TCCTCACCTTGAGAAGCATCG	0.662																																																	0													44.0	35.0	38.0					17																	79288254		2199	4299	6498	SO:0001819	synonymous_variant	0			AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.9C>G	17.37:g.79288254G>C				Silent	SNP	NULL	p.L3	ENST00000332900.1	37	c.9	CCDS11781.1	17																																																																																			TMEM105	-	NULL	ENSG00000185332		0.662	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM105	HGNC	protein_coding	OTTHUMT00000439607.1	-	0.00	51	0	G	NM_178520		79288254	-1	tier1	-	no_errors	ENST00000332900	ensembl	human	known	74_37	silent	16.09	73	14	SNP	0.014	C
TMEM173	340061	genome.wustl.edu	37	5	138860385	138860385	+	Silent	SNP	C	C	A	rs200049390	byFrequency	TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:138860385C>A	ENST00000330794.4	-	5	843	c.510G>T	c.(508-510)ctG>ctT	p.L170L	TMEM173_ENST00000511850.1_5'UTR	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	170	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTGGCAGGATCAGCCGCAGAT	0.517																																																	0													57.0	52.0	53.0					5																	138860385		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.510G>T	5.37:g.138860385C>A			A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Silent	SNP	NULL	p.L170	ENST00000330794.4	37	c.510	CCDS4215.1	5																																																																																			TMEM173	-	NULL	ENSG00000184584		0.517	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM173	HGNC	protein_coding	OTTHUMT00000251338.1		0.00	31	0	C	NM_198282		138860385	-1			no_errors	ENST00000330794	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.999	A
TMEM209	84928	genome.wustl.edu	37	7	129832592	129832592	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:129832592C>G	ENST00000397622.2	-	6	767	c.645G>C	c.(643-645)ttG>ttC	p.L215F	TMEM209_ENST00000336804.8_Missense_Mutation_p.L214F|TMEM209_ENST00000462753.1_Missense_Mutation_p.L214F|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000473456.1_Missense_Mutation_p.L215F	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	215	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					AGCGAGATCTCAATCCACTGC	0.453																																																	0													104.0	106.0	106.0					7																	129832592		1904	4127	6031	SO:0001583	missense	0				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.645G>C	7.37:g.129832592C>G	ENSP00000380747:p.Leu215Phe		A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	pfam_Cytochrome_B561-rel	p.L215F	ENST00000397622.2	37	c.645	CCDS47712.1	7	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763590	0.49574	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	M	0.73598	2.24	0.51767	D	0.999935	D;D	0.58268	0.977;0.982	P;P	0.60473	0.803;0.875	T	0.39418	-0.9615	10	0.32370	T	0.25	-12.4272	14.3345	0.66578	0.0:0.9267:0.0:0.0733	.	215;215	Q96SK2-3;Q96SK2	.;TM209_HUMAN	F	215;214;215;214	ENSP00000380747:L215F;ENSP00000419697:L214F;ENSP00000417258:L215F;ENSP00000338388:L214F	ENSP00000338388:L214F	L	-	3	2	TMEM209	129619828	1.000000	0.71417	0.857000	0.33713	0.260000	0.26232	1.577000	0.36515	2.835000	0.97688	0.591000	0.81541	TTG	TMEM209	-	pfam_Cytochrome_B561-rel	ENSG00000146842		0.453	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	HGNC	protein_coding	OTTHUMT00000349339.1	-	0.00	74	0	C	NM_032842		129832592	-1	tier1	-	no_errors	ENST00000397622	ensembl	human	known	74_37	missense	19.54	70	17	SNP	1.000	G
TMEM71	137835	genome.wustl.edu	37	8	133759306	133759306	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr8:133759306G>C	ENST00000377901.4	-	5	511	c.369C>G	c.(367-369)ctC>ctG	p.L123L	TMEM71_ENST00000523829.1_Silent_p.L123L|TMEM71_ENST00000517538.1_5'UTR|TMEM71_ENST00000356838.3_Intron	NM_001145153.1	NP_001138625.1	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	123						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGGAGGTACTGAGGTTGAAGA	0.413																																																	0													92.0	83.0	86.0					8																	133759306		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000377901.4:c.369C>G	8.37:g.133759306G>C			Q3KRC2|Q8WVZ4|Q96LX9	Silent	SNP	NULL	p.L123	ENST00000377901.4	37	c.369	CCDS47921.1	8																																																																																			TMEM71	-	NULL	ENSG00000165071		0.413	TMEM71-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM71	HGNC	protein_coding	OTTHUMT00000379592.1	-	0.00	67	0	G	NM_144649		133759306	-1	tier1	-	no_errors	ENST00000377901	ensembl	human	known	74_37	silent	10.34	78	9	SNP	0.004	C
TNFRSF1B	7133	genome.wustl.edu	37	1	12251047	12251047	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:12251047C>T	ENST00000376259.3	+	3	301	c.212C>T	c.(211-213)tCg>tTg	p.S71L	TNFRSF1B_ENST00000492361.1_3'UTR|TNFRSF1B_ENST00000536782.1_Missense_Mutation_p.S71L|MIR4632_ENST00000584158.1_RNA	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	71					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	ACCAAGACCTCGGACACCGTG	0.587																																																	0													152.0	147.0	149.0					1																	12251047		2203	4300	6503	SO:0001583	missense	0			M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.212C>T	1.37:g.12251047C>T	ENSP00000365435:p.Ser71Leu		B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_1B	p.S71L	ENST00000376259.3	37	c.212	CCDS145.1	1	.	.	.	.	.	.	.	.	.	.	C	8.341	0.828689	0.16749	.	.	ENSG00000028137	ENST00000376259;ENST00000400863;ENST00000536782	D;D	0.91945	-2.94;-2.94	4.1	3.19	0.36642	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.586689	0.16510	N	0.211286	D	0.85186	0.5639	L	0.51422	1.61	0.09310	N	1	P	0.37083	0.581	B	0.23419	0.046	T	0.74743	-0.3562	10	0.30854	T	0.27	-6.5634	7.7434	0.28853	0.0:0.8851:0.0:0.1149	.	71	P20333	TNR1B_HUMAN	L	71	ENSP00000365435:S71L;ENSP00000440425:S71L	ENSP00000365435:S71L	S	+	2	0	TNFRSF1B	12173634	0.528000	0.26314	0.084000	0.20598	0.022000	0.10575	1.851000	0.39338	1.103000	0.41568	0.655000	0.94253	TCG	TNFRSF1B	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000028137		0.587	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1B	HGNC	protein_coding	OTTHUMT00000005133.1	-	0.00	32	0	C	NM_001066		12251047	+1	tier1	-	no_errors	ENST00000376259	ensembl	human	known	74_37	missense	10.77	58	7	SNP	0.068	T
TNRC18	84629	genome.wustl.edu	37	7	5396810	5396810	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:5396810G>A	ENST00000430969.1	-	16	5279	c.4931C>T	c.(4930-4932)tCg>tTg	p.S1644L	TNRC18_ENST00000399537.4_Missense_Mutation_p.S1644L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1644							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTTGAAGGGCGACTTCAACTT	0.552																																																	0													41.0	41.0	41.0					7																	5396810		2033	4179	6212	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4931C>T	7.37:g.5396810G>A	ENSP00000395538:p.Ser1644Leu		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S1644L	ENST00000430969.1	37	c.4931	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	g	27.6	4.850138	0.91277	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.52983	2.38;2.33;0.64	5.25	5.25	0.73442	.	0.000000	0.34603	N	0.003839	T	0.38746	0.1052	L	0.45137	1.4	0.38584	D	0.950266	P;P	0.44429	0.772;0.835	B;B	0.32211	0.142;0.06	T	0.44877	-0.9299	10	0.38643	T	0.18	.	18.8572	0.92257	0.0:0.0:1.0:0.0	.	699;1644	A8MSW5;O15417	.;TNC18_HUMAN	L	1644;1644;699;134	ENSP00000382452:S1644L;ENSP00000395538:S1644L;ENSP00000395990:S134L	ENSP00000382452:S1644L	S	-	2	0	TNRC18	5363336	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.164000	0.71885	2.456000	0.83038	0.561000	0.74099	TCG	TNRC18	-	NULL	ENSG00000182095		0.552	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		-	0.00	50	0	G			5396810	-1	tier1	-	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	11.32	94	12	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R282W	ENST00000269305.4	37	c.844	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	38	0	G	NM_000546		7577094	-1	tier1	rs28934574	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.997	A
TOM1L2	146691	genome.wustl.edu	37	17	17788081	17788081	+	Splice_Site	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr17:17788081G>A	ENST00000379504.3	-	5	451	c.368C>T	c.(367-369)gCa>gTa	p.A123V	TOM1L2_ENST00000540946.1_Intron|TOM1L2_ENST00000395739.4_Intron|TOM1L2_ENST00000535933.1_Splice_Site_p.A123V|TOM1L2_ENST00000581396.1_Splice_Site_p.A73V|TOM1L2_ENST00000542206.1_Intron|TOM1L2_ENST00000318094.10_Intron	NM_001082968.1	NP_001076437.1	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 (chicken)	123	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	clathrin binding (GO:0030276)|protein kinase binding (GO:0019901)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(2)	10	all_neural(463;0.228)					ATCAGCCCATGCCTGGGATAA	0.517																																					Melanoma(192;2505 2909 14455 25269)												0													123.0	109.0	114.0					17																	17788081		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ230803	CCDS32584.1, CCDS42270.1, CCDS74000.1, CCDS74001.1, CCDS74002.1, CCDS74003.1	17p11.2	2008-07-03	2001-11-28		ENSG00000175662	ENSG00000175662			11984	protein-coding gene	gene with protein product		615519	"""target of myb1 (chicken) homolog-like 1"""			10036180	Standard	NM_001082968		Approved		uc002grz.4	Q6ZVM7	OTTHUMG00000059353	ENST00000379504.3:c.367-1C>T	17.37:g.17788081G>A			B7Z2L7|B7Z7F4|Q86V61|Q8TDE7|Q96M88	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.A123V	ENST00000379504.3	37	c.368	CCDS42270.1	17	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832301	0.91036	.	.	ENSG00000175662	ENST00000379504;ENST00000318094;ENST00000535933;ENST00000537091	T;T	0.22743	1.94;1.94	5.97	5.97	0.96955	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.046723	0.85682	D	0.000000	T	0.45236	0.1332	M	0.77712	2.385	0.80722	D	1	D;B;D;B	0.67145	0.996;0.24;0.983;0.0	D;B;P;B	0.70016	0.967;0.14;0.746;0.0	T	0.40403	-0.9565	10	0.02654	T	1	-21.7119	20.428	0.99075	0.0:0.0:1.0:0.0	.	73;123;123;73	B7Z8F0;B7Z2L7;Q6ZVM7;Q6ZVM7-2	.;.;TM1L2_HUMAN;.	V	123;73;123;73	ENSP00000368818:A123V;ENSP00000438621:A123V	ENSP00000312860:A73V	A	-	2	0	TOM1L2	17728806	1.000000	0.71417	0.992000	0.48379	0.895000	0.52256	9.408000	0.97327	2.837000	0.97791	0.655000	0.94253	GCA	TOM1L2	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_VHS	ENSG00000175662		0.517	TOM1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOM1L2	HGNC	protein_coding	OTTHUMT00000131928.1		0.00	46	0	G		Missense_Mutation	17788081	-1			no_errors	ENST00000379504	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
TRIM22	10346	genome.wustl.edu	37	11	5717813	5717813	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:5717813G>A	ENST00000379965.3	+	2	628	c.351G>A	c.(349-351)tgG>tgA	p.W117*	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	117					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TCATTTGCTGGGTTTGTGAAC	0.478																																					GBM(104;491 2336 5222)												0													71.0	77.0	75.0					11																	5717813		2091	4247	6338	SO:0001587	stop_gained	0			X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.351G>A	11.37:g.5717813G>A	ENSP00000369299:p.Trp117*		Q05CQ0|Q15521	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.W117*	ENST00000379965.3	37	c.351	CCDS41612.1	11	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870918	0.91587	.	.	ENSG00000132274	ENST00000379965;ENST00000425490;ENST00000454828;ENST00000414641	.	.	.	4.71	1.66	0.24008	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.347	0.11138	0.0897:0.1577:0.5899:0.1627	.	.	.	.	X	117	.	ENSP00000369299:W117X	W	+	3	0	TRIM22	5674389	0.044000	0.20184	0.076000	0.20297	0.655000	0.38815	0.042000	0.13949	0.492000	0.27815	-0.518000	0.04402	TGG	TRIM22	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000132274		0.478	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM22	HGNC	protein_coding	OTTHUMT00000143387.2	-	0.00	15	0	G	NM_006074		5717813	+1	tier1	-	no_errors	ENST00000379965	ensembl	human	known	74_37	nonsense	21.05	15	4	SNP	0.320	A
TRIM7	81786	genome.wustl.edu	37	5	180622300	180622300	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr5:180622300C>G	ENST00000274773.7	-	7	1463	c.1402G>C	c.(1402-1404)Gag>Cag	p.E468Q	CTC-338M12.5_ENST00000508877.1_RNA|TRIM7_ENST00000504241.1_5'UTR|TRIM7_ENST00000393315.1_Missense_Mutation_p.E260Q|CTC-338M12.6_ENST00000512508.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000361809.3_Missense_Mutation_p.E260Q|TRIM7_ENST00000422067.2_Missense_Mutation_p.E260Q|CTC-338M12.5_ENST00000514487.1_RNA|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000393319.3_Missense_Mutation_p.E286Q	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	468	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		GCTCCCACCTCCAGGTCCAGG	0.672																																					Esophageal Squamous(128;2258 2308 35507 48647)												0													38.0	25.0	30.0					5																	180622300		2194	4296	6490	SO:0001583	missense	0			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1402G>C	5.37:g.180622300C>G	ENSP00000274773:p.Glu468Gln		A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.E468Q	ENST00000274773.7	37	c.1402	CCDS4462.1	5	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029267	0.75504	.	.	ENSG00000146054	ENST00000274773;ENST00000393315;ENST00000361809;ENST00000393319;ENST00000422067	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	5.07	5.07	0.68467	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000018	D	0.82637	0.5080	M	0.90595	3.13	0.35825	D	0.824892	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.89406	0.3699	10	0.66056	D	0.02	.	15.9335	0.79683	0.0:1.0:0.0:0.0	.	468;286	Q9C029;Q9C029-4	TRIM7_HUMAN;.	Q	468;260;260;286;260	ENSP00000274773:E468Q;ENSP00000376991:E260Q;ENSP00000355059:E260Q;ENSP00000376994:E286Q;ENSP00000391458:E260Q	ENSP00000274773:E468Q	E	-	1	0	TRIM7	180554906	0.106000	0.21978	0.997000	0.53966	0.857000	0.48899	1.641000	0.37197	2.349000	0.79799	0.478000	0.44815	GAG	TRIM7	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000146054		0.672	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	HGNC	protein_coding	OTTHUMT00000253569.3		0.00	18	0	C	NM_203296		180622300	-1			no_errors	ENST00000274773	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.997	G
TRMT2A	27037	genome.wustl.edu	37	22	20104018	20104018	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr22:20104018C>T	ENST00000252136.7	-	2	530	c.142G>A	c.(142-144)Ggg>Agg	p.G48R	TRMT2A_ENST00000404751.3_Missense_Mutation_p.G48R|TRMT2A_ENST00000439169.2_Missense_Mutation_p.G48R|TRMT2A_ENST00000403707.3_Missense_Mutation_p.G48R|RANBP1_ENST00000402752.1_5'Flank|RANBP1_ENST00000331821.3_5'Flank|TRMT2A_ENST00000492988.1_5'Flank|RANBP1_ENST00000430524.1_Intron	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	48					RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						GTAGCCGCCCCAGCGCCCTCT	0.647																																																	0													20.0	26.0	24.0					22																	20104018		2153	4174	6327	SO:0001583	missense	0			BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.142G>A	22.37:g.20104018C>T	ENSP00000252136:p.Gly48Arg		D3DX25|Q32P57|Q96ME6|Q9H732	Missense_Mutation	SNP	pfam_U5_MeTrfase,pfam_PCMT,pfam_Small_mtfrase_dom,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_Methyltransf_11,pfam_tRNA_(Gua-N-7)_MeTrfase,pfam_UbiE/COQ5_MeTrFase,pfscan_RRM_dom	p.G48R	ENST00000252136.7	37	c.142	CCDS13774.1	22	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631863	0.67015	.	.	ENSG00000099899	ENST00000252136;ENST00000403707;ENST00000404751;ENST00000439169;ENST00000445045	T;T;T	0.44881	0.91;0.91;0.91	4.35	2.11	0.27256	.	0.571146	0.17672	N	0.165927	T	0.31389	0.0795	L	0.50333	1.59	0.19300	N	0.999978	B;B;B	0.15141	0.012;0.003;0.003	B;B;B	0.10450	0.005;0.002;0.002	T	0.13656	-1.0501	10	0.29301	T	0.29	-24.2906	5.5016	0.16831	0.0:0.6113:0.1617:0.227	.	48;48;48	B4E213;F2Z2W7;Q8IZ69	.;.;TRM2A_HUMAN	R	48;48;48;48;36	ENSP00000252136:G48R;ENSP00000385807:G48R;ENSP00000395738:G48R	ENSP00000252136:G48R	G	-	1	0	TRMT2A	18484018	0.001000	0.12720	0.002000	0.10522	0.035000	0.12851	1.155000	0.31700	1.072000	0.40860	0.491000	0.48974	GGG	TRMT2A	-	NULL	ENSG00000099899		0.647	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT2A	HGNC	protein_coding	OTTHUMT00000318168.3		0.00	57	0	C	NM_022727		20104018	-1			no_errors	ENST00000252136	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.000	T
TSSC2	650368	genome.wustl.edu	37	11	3424843	3424843	+	RNA	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:3424843G>C	ENST00000529482.1	+	0	845									tumor suppressing subtransferable candidate 2 pseudogene																		ACTGACTCTTGATGGACACAA	0.453																																																	0																																												0					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3424843G>C				RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-	ENSG00000223756		0.453	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	-	0.00	75	0	G			3424843	+1	tier1	-	no_errors	ENST00000533775	ensembl	human	known	74_37	rna	6.33	74	5	SNP	0.001	C
TTC21B	79809	genome.wustl.edu	37	2	166788351	166788351	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:166788351C>G	ENST00000243344.7	-	8	948	c.811G>C	c.(811-813)Gaa>Caa	p.E271Q	AC010127.5_ENST00000440322.1_RNA|AC010127.5_ENST00000443032.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	271					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						CCCAAGTTTTCCAGCTTGGTG	0.368																																																	0													130.0	119.0	123.0					2																	166788351		2203	4300	6503	SO:0001583	missense	0			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.811G>C	2.37:g.166788351C>G	ENSP00000243344:p.Glu271Gln		A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E271Q	ENST00000243344.7	37	c.811	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	C	2.196	-0.384120	0.04966	.	.	ENSG00000123607	ENST00000243344	T	0.52057	0.68	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);	0.252521	0.40554	N	0.001062	T	0.22666	0.0547	N	0.10945	0.07	0.80722	D	1	P;P	0.47106	0.89;0.586	B;B	0.40506	0.331;0.146	T	0.31752	-0.9932	10	0.02654	T	1	-13.2035	9.0779	0.36534	0.1491:0.7737:0.0:0.0772	.	271;271	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	Q	271	ENSP00000243344:E271Q	ENSP00000243344:E271Q	E	-	1	0	TTC21B	166496597	1.000000	0.71417	0.985000	0.45067	0.055000	0.15305	1.242000	0.32755	2.554000	0.86153	0.655000	0.94253	GAA	TTC21B	-	NULL	ENSG00000123607		0.368	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	HGNC	protein_coding	OTTHUMT00000333770.1	-	0.00	69	0	C	NM_024753		166788351	-1	tier1	-	no_errors	ENST00000243344	ensembl	human	known	74_37	missense	11.76	90	12	SNP	0.975	G
TTC30B	150737	genome.wustl.edu	37	2	178417447	178417447	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:178417447G>A	ENST00000408939.3	-	1	295	c.45C>T	c.(43-45)acC>acT	p.T15T		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	15					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			ACACGACCGCGGTGAACTCCC	0.672																																																	0													7.0	8.0	8.0					2																	178417447		2044	4153	6197	SO:0001819	synonymous_variant	0			AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.45C>T	2.37:g.178417447G>A			Q63HQ1|Q96NE6	Silent	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.T15	ENST00000408939.3	37	c.45	CCDS42784.1	2																																																																																			TTC30B	-	pfscan_TPR-contain_dom	ENSG00000196659		0.672	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30B	HGNC	protein_coding	OTTHUMT00000334193.2	-	0.00	53	0	G	NM_152517		178417447	-1	tier1	-	no_errors	ENST00000408939	ensembl	human	known	74_37	silent	23.53	39	12	SNP	0.059	A
TTN	7273	genome.wustl.edu	37	2	179399355	179399355	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:179399355G>T	ENST00000591111.1	-	308	97288	c.97064C>A	c.(97063-97065)aCa>aAa	p.T32355K	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T31428K|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.T24931K|TTN_ENST00000359218.5_Missense_Mutation_p.T25056K|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T25123K|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T33996K			Q8WZ42	TITIN_HUMAN	titin	32355	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACATGTCTGTGGCTGTGCT	0.468																																																	0													116.0	113.0	114.0					2																	179399355		2022	4199	6221	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97064C>A	2.37:g.179399355G>T	ENSP00000465570:p.Thr32355Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T31428K	ENST00000591111.1	37	c.94283		2	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597890	0.66332	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.71484	0.3345	M	0.87547	2.89	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.74919	-0.3500	9	0.87932	D	0	.	19.3087	0.94175	0.0:0.0:1.0:0.0	.	24931;25056;25123;32355	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	31428;24931;25123;25056;24928	ENSP00000343764:T31428K;ENSP00000434586:T24931K;ENSP00000340554:T25123K;ENSP00000352154:T25056K	ENSP00000340554:T25123K	T	-	2	0	TTN	179107601	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.837000	0.99465	2.857000	0.98124	0.650000	0.86243	ACA	TTN	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	79	0	G	NM_133378		179399355	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	9.89	82	9	SNP	1.000	T
TYR	7299	genome.wustl.edu	37	11	88911211	88911211	+	Silent	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:88911211G>C	ENST00000263321.5	+	1	592	c.90G>C	c.(88-90)ctG>ctC	p.L30L	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	30					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CTAAGAACCTGATGGAGAAGG	0.547																																																	0													78.0	76.0	77.0					11																	88911211		2201	4299	6500	SO:0001819	synonymous_variant	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.90G>C	11.37:g.88911211G>C			Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.L30	ENST00000263321.5	37	c.90	CCDS8284.1	11																																																																																			TYR	-	NULL	ENSG00000077498		0.547	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2		0.00	32	0	G	NM_000372		88911211	+1			no_errors	ENST00000263321	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.955	C
UBE3C	9690	genome.wustl.edu	37	7	156963014	156963014	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:156963014G>T	ENST00000348165.5	+	4	572	c.212G>T	c.(211-213)aGt>aTt	p.S71I	UBE3C_ENST00000389103.4_Missense_Mutation_p.S28I	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	71	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ATCCAAAGAAGTGCATTTGAT	0.403																																																	0													147.0	146.0	146.0					7																	156963014		2203	4300	6503	SO:0001583	missense	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.212G>T	7.37:g.156963014G>T	ENSP00000309198:p.Ser71Ile		A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.S71I	ENST00000348165.5	37	c.212	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180816	0.57800	.	.	ENSG00000009335	ENST00000348165;ENST00000389103	T	0.45668	0.89	4.82	4.82	0.62117	.	0.102459	0.64402	D	0.000003	T	0.37489	0.1005	L	0.47716	1.5	0.51767	D	0.999931	B;B;P	0.35348	0.003;0.077;0.496	B;B;B	0.30401	0.002;0.033;0.115	T	0.24835	-1.0149	10	0.36615	T	0.2	.	17.917	0.88954	0.0:0.0:1.0:0.0	.	71;71;28	Q15386;Q15386-2;Q15386-3	UBE3C_HUMAN;.;.	I	71;28	ENSP00000309198:S71I	ENSP00000309198:S71I	S	+	2	0	UBE3C	156655775	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	3.407000	0.52644	2.219000	0.72066	0.650000	0.86243	AGT	UBE3C	-	pfscan_IQ_motif_EF-hand-BS	ENSG00000009335		0.403	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1		0.00	32	0	G	NM_014671		156963014	+1			no_errors	ENST00000348165	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
UNC5C	8633	genome.wustl.edu	37	4	96222865	96222865	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr4:96222865G>A	ENST00000453304.1	-	3	730	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C	UNC5C_ENST00000506749.1_Missense_Mutation_p.R128C|UNC5C_ENST00000504962.1_Missense_Mutation_p.R128C	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	128	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ACTTGCTGGCGCGAAATCTCA	0.468																																																	0													72.0	59.0	64.0					4																	96222865		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.382C>T	4.37:g.96222865G>A	ENSP00000406022:p.Arg128Cys		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.R128C	ENST00000453304.1	37	c.382	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458370	0.84317	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749;ENST00000504962	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.72	4.86	0.63082	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.59115	0.2170	M	0.90369	3.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.982	T	0.70048	-0.4979	10	0.87932	D	0	.	15.9424	0.79768	0.0:0.0:0.864:0.136	.	128;128;128	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	C	128;87;128;128;128	ENSP00000406022:R128C;ENSP00000426924:R128C;ENSP00000426153:R128C;ENSP00000425117:R128C	ENSP00000328673:R87C	R	-	1	0	UNC5C	96441888	1.000000	0.71417	0.959000	0.39883	0.988000	0.76386	5.334000	0.65923	1.374000	0.46228	0.650000	0.86243	CGC	UNC5C	-	NULL	ENSG00000182168		0.468	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	35	0	G	NM_003728		96222865	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.997	A
UPF1	5976	genome.wustl.edu	37	19	18972827	18972827	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:18972827G>A	ENST00000599848.1	+	18	2708	c.2499G>A	c.(2497-2499)gaG>gaA	p.E833E	UPF1_ENST00000262803.5_Silent_p.E822E			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	833					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						AGGAGGTGGAGATCGCCAGTG	0.557																																																	0													71.0	57.0	62.0					19																	18972827		2203	4300	6503	SO:0001819	synonymous_variant	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2499G>A	19.37:g.18972827G>A			O00239|O43343|Q86Z25|Q92842	Silent	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.E833	ENST00000599848.1	37	c.2499		19																																																																																			UPF1	-	superfamily_P-loop_NTPase	ENSG00000005007		0.557	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	-	0.00	24	0	G	NM_002911		18972827	+1	tier1	-	no_errors	ENST00000599848	ensembl	human	known	74_37	silent	20.83	38	10	SNP	0.998	A
UPF1	5976	genome.wustl.edu	37	19	18972858	18972858	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:18972858G>A	ENST00000599848.1	+	18	2739	c.2530G>A	c.(2530-2532)Gag>Aag	p.E844K	UPF1_ENST00000262803.5_Missense_Mutation_p.E833K			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	844					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TCAGGGACGCGAGAAGGACTT	0.582																																																	0													95.0	76.0	83.0					19																	18972858		2203	4300	6503	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2530G>A	19.37:g.18972858G>A	ENSP00000470142:p.Glu844Lys		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.E844K	ENST00000599848.1	37	c.2530		19	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833489	0.91036	.	.	ENSG00000005007	ENST00000262803	D	0.96300	-3.97	5.06	4.02	0.46733	.	0.116998	0.64402	D	0.000018	D	0.99039	0.9671	H	0.99958	5.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.955	D	0.97631	1.0142	10	0.87932	D	0	-55.069	10.4419	0.44471	0.0901:0.0:0.9099:0.0	.	844;833	Q92900;Q92900-2	RENT1_HUMAN;.	K	833	ENSP00000262803:E833K	ENSP00000262803:E833K	E	+	1	0	UPF1	18833858	1.000000	0.71417	0.818000	0.32626	0.974000	0.67602	9.396000	0.97270	1.118000	0.41863	0.563000	0.77884	GAG	UPF1	-	superfamily_P-loop_NTPase	ENSG00000005007		0.582	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	-	0.00	23	0	G	NM_002911		18972858	+1	tier1	-	no_errors	ENST00000599848	ensembl	human	known	74_37	missense	13.73	44	7	SNP	0.998	A
USP35	57558	genome.wustl.edu	37	11	77907300	77907300	+	Silent	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:77907300G>A	ENST00000529308.1	+	2	270	c.9G>A	c.(7-9)aaG>aaA	p.K3K	USP35_ENST00000441408.2_5'Flank|USP35_ENST00000530535.1_Intron|USP35_ENST00000530267.1_Intron|USP35_ENST00000526425.1_5'Flank	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	3					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCATGGACAAGATCTTGGAGG	0.682																																																	0													43.0	49.0	47.0					11																	77907300		2180	4278	6458	SO:0001819	synonymous_variant	0			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.9G>A	11.37:g.77907300G>A				Silent	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.K3	ENST00000529308.1	37	c.9	CCDS41693.1	11																																																																																			USP35	-	NULL	ENSG00000118369		0.682	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	HGNC	protein_coding	OTTHUMT00000390026.1		0.00	32	0	G	XM_290527		77907300	+1			no_errors	ENST00000529308	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
USP8	9101	genome.wustl.edu	37	15	50792993	50792993	+	3'UTR	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr15:50792993G>A	ENST00000396444.3	+	0	5403				USP50_ENST00000532404.1_Silent_p.F326F|USP8_ENST00000433963.1_3'UTR|RP11-562A8.4_ENST00000560380.1_RNA|USP50_ENST00000530218.1_5'Flank	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		AATTCTTGCAGAAAGCAGTGT	0.408																																																	0													70.0	66.0	67.0					15																	50792993		1881	4113	5994	SO:0001624	3_prime_UTR_variant	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.*1708G>A	15.37:g.50792993G>A			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.F326	ENST00000396444.3	37	c.978	CCDS10137.1	15																																																																																			USP50	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000170236		0.408	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP50	HGNC	protein_coding	OTTHUMT00000254541.1	-	0.00	34	0	G	NM_005154		50792993	-1	tier1	-	no_errors	ENST00000532404	ensembl	human	known	74_37	silent	7.58	61	5	SNP	1.000	A
VPS13D	55187	genome.wustl.edu	37	1	12304375	12304375	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:12304375C>T	ENST00000358136.3	+	4	378	c.248C>T	c.(247-249)tCc>tTc	p.S83F	VPS13D_ENST00000356315.4_Missense_Mutation_p.S83F	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATCTCCATCTCCAGCCTTCAC	0.463																																																	0													73.0	74.0	74.0					1																	12304375		2203	4300	6503	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.248C>T	1.37:g.12304375C>T	ENSP00000350854:p.Ser83Phe			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S83F	ENST00000358136.3	37	c.248	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902046	0.92035	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	D;D	0.83250	-1.7;-1.7	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.90490	0.7021	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	D	0.90331	0.4352	10	0.87932	D	0	.	19.5705	0.95413	0.0:1.0:0.0:0.0	.	83;83	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	F	83	ENSP00000348666:S83F;ENSP00000350854:S83F	ENSP00000348666:S83F	S	+	2	0	VPS13D	12226962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.147000	0.77382	2.941000	0.99782	0.655000	0.94253	TCC	VPS13D	-	NULL	ENSG00000048707		0.463	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	27	0	C	NM_015378		12304375	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	19.35	50	12	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	50186394	50186394	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:50186394G>A	ENST00000325239.5	+	59	9359	c.9332G>A	c.(9331-9333)cGg>cAg	p.R3111Q	WDFY4_ENST00000465910.1_3'UTR|RP11-523O18.5_ENST00000428825.4_RNA|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	3111						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GTTCCTGGACGGCCAGCAGGA	0.602																																																	0													73.0	79.0	77.0					10																	50186394		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.9332G>A	10.37:g.50186394G>A	ENSP00000320563:p.Arg3111Gln		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R3111Q	ENST00000325239.5	37	c.9332	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.230|6.230	0.410491|0.410491	0.11812|0.11812	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000265453|ENST00000325239;ENST00000544136	.|T	.|0.54866	.|0.55	4.34|4.34	-8.68|-8.68	0.00859|0.00859	.|WD40 repeat-like-containing domain (1);	.|.	.|.	.|.	.|.	T|T	0.15998|0.15998	0.0385|0.0385	N|N	0.01705|0.01705	-0.755|-0.755	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.14144|0.14144	-1.0483|-1.0483	5|8	.|.	.|.	.|.	.|.	2.6836|2.6836	0.05101|0.05101	0.2746:0.1043:0.4144:0.2067|0.2746:0.1043:0.4144:0.2067	.|.	.|3111	.|Q6ZS81	.|WDFY4_HUMAN	S|Q	1198|3111;574	.|ENSP00000320563:R3111Q	.|.	G|R	+|+	1|2	0|0	WDFY4|WDFY4	49856400|49856400	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	-1.064000|-1.064000	0.03461|0.03461	-2.248000|-2.248000	0.00703|0.00703	-2.034000|-2.034000	0.00421|0.00421	GGC|CGG	WDFY4	-	superfamily_WD40_repeat_dom	ENSG00000128815		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding			0.00	35	0	G	XM_033379		50186394	+1			no_errors	ENST00000325239	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.000	A
WDR64	128025	genome.wustl.edu	37	1	241943353	241943353	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr1:241943353C>T	ENST00000366552.2	+	21	2761	c.2554C>T	c.(2554-2556)Cat>Tat	p.H852Y	WDR64_ENST00000437684.2_Missense_Mutation_p.H685Y	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	852										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GGATCCACCTCATGATGAAAA	0.303																																																	0													88.0	86.0	87.0					1																	241943353		2203	4299	6502	SO:0001583	missense	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2554C>T	1.37:g.241943353C>T	ENSP00000355510:p.His852Tyr		B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H852Y	ENST00000366552.2	37	c.2554		1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.175234	0.57692	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.37584	1.19;1.19;1.19	5.5	3.58	0.41010	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.166051	0.42964	D	0.000621	T	0.44891	0.1315	L	0.60455	1.87	0.21105	N	0.999789	D;B	0.65815	0.995;0.006	P;B	0.55615	0.78;0.006	T	0.29852	-0.9998	10	0.56958	D	0.05	-10.9186	8.122	0.30976	0.1568:0.7621:0.0:0.0811	.	852;405	B1ANS9;D1MPS4	WDR64_HUMAN;.	Y	852;685;456	ENSP00000355510:H852Y;ENSP00000402446:H685Y;ENSP00000406656:H456Y	ENSP00000355510:H852Y	H	+	1	0	WDR64	240009976	0.984000	0.35163	1.000000	0.80357	0.991000	0.79684	0.833000	0.27504	0.754000	0.32968	0.650000	0.86243	CAT	WDR64	-	superfamily_WD40_repeat_dom	ENSG00000162843		0.303	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		-	0.00	38	0	C	NM_144625		241943353	+1	tier1	-	no_errors	ENST00000366552	ensembl	human	known	74_37	missense	7.81	59	5	SNP	1.000	T
WISP2	8839	genome.wustl.edu	37	20	43353384	43353384	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:43353384G>C	ENST00000372868.2	+	4	626	c.283G>C	c.(283-285)Gag>Cag	p.E95Q	WISP2_ENST00000372865.4_Intron|WISP2_ENST00000471629.1_3'UTR|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000190983.4_Missense_Mutation_p.E95Q|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	95					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CGCAGTGGCAGAGGACGACAG	0.667																																																	0													39.0	32.0	34.0					20																	43353384		2202	4300	6502	SO:0001583	missense	0			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.283G>C	20.37:g.43353384G>C	ENSP00000361959:p.Glu95Gln		B2R9N4|E1P612|Q6PEG3	Missense_Mutation	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.E95Q	ENST00000372868.2	37	c.283	CCDS13336.1	20	.	.	.	.	.	.	.	.	.	.	G	7.693	0.691388	0.15039	.	.	ENSG00000064205	ENST00000372868;ENST00000190983	T;T	0.62788	0.0;0.0	4.66	4.66	0.58398	.	0.480131	0.23067	N	0.052310	T	0.54854	0.1884	L	0.52364	1.645	0.09310	N	1	B	0.21606	0.058	B	0.18263	0.021	T	0.39210	-0.9625	10	0.14252	T	0.57	-29.5886	15.7214	0.77713	0.0:0.0:1.0:0.0	.	95	O76076	WISP2_HUMAN	Q	95	ENSP00000361959:E95Q;ENSP00000190983:E95Q	ENSP00000190983:E95Q	E	+	1	0	WISP2	42786798	1.000000	0.71417	0.337000	0.25536	0.089000	0.18198	5.818000	0.69236	2.141000	0.66446	0.455000	0.32223	GAG	WISP2	-	NULL	ENSG00000064205		0.667	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	-	0.00	73	0	G	NM_003881		43353384	+1	tier1	-	no_errors	ENST00000190983	ensembl	human	known	74_37	missense	9.77	120	13	SNP	0.239	C
XIRP2	129446	genome.wustl.edu	37	2	168101829	168101829	+	Silent	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr2:168101829A>G	ENST00000409195.1	+	9	4016	c.3927A>G	c.(3925-3927)gtA>gtG	p.V1309V	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Silent_p.V1087V|XIRP2_ENST00000295237.9_Silent_p.V1309V|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1134					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGGGTGATGTAAAAAGCTACA	0.358																																																	0													72.0	68.0	69.0					2																	168101829		1853	4100	5953	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3927A>G	2.37:g.168101829A>G			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat	p.V1309	ENST00000409195.1	37	c.3927	CCDS42769.1	2																																																																																			XIRP2	-	pfam_Actin-binding_Xin_repeat	ENSG00000163092		0.358	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	62	0	A	NM_152381		168101829	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	silent	12.86	61	9	SNP	1.000	G
XIST	7503	genome.wustl.edu	37	X	73065478	73065478	+	lincRNA	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:73065478G>C	ENST00000429829.1	-	0	7110					NR_001564.2				X inactive specific transcript (non-protein coding)																		AAGGGCATCTGAGAGTAGGAC	0.443																																																	0													145.0	129.0	134.0					X																	73065478		876	1991	2867			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73065478G>C				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.443	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	-	0.00	27	0	G	NR_001564		73065478	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	10.42	43	5	SNP	0.001	C
YAP1	10413	genome.wustl.edu	37	11	102094417	102094417	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:102094417C>G	ENST00000282441.5	+	7	1485	c.1097C>G	c.(1096-1098)tCt>tGt	p.S366C	YAP1_ENST00000531439.1_Missense_Mutation_p.S350C|YAP1_ENST00000345877.2_Missense_Mutation_p.S316C|YAP1_ENST00000537274.1_Missense_Mutation_p.S354C|YAP1_ENST00000526343.1_Missense_Mutation_p.S312C|YAP1_ENST00000524575.1_Missense_Mutation_p.S188C	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	366	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		AATCCAGTGTCTTCTCCCGGG	0.433																																					Colon(50;247 1103 7861 28956)												0													110.0	99.0	103.0					11																	102094417		2203	4299	6502	SO:0001583	missense	0				CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1097C>G	11.37:g.102094417C>G	ENSP00000282441:p.Ser366Cys		B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.S366C	ENST00000282441.5	37	c.1097	CCDS44716.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.13|15.13	2.740774|2.740774	0.49045|0.49045	.|.	.|.	ENSG00000137693|ENSG00000137693	ENST00000529029|ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439;ENST00000524575	.|T;T;T	.|0.49432	.|0.8;0.78;0.84	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.107644	.|0.64402	.|D	.|0.000003	T|T	0.38692|0.38692	0.1050|0.1050	N|N	0.19112|0.19112	0.55|0.55	0.53688|0.53688	D|D	0.999973|0.999973	.|B;B;B;B;B;B	.|0.23650	.|0.001;0.002;0.028;0.089;0.003;0.023	.|B;B;B;B;B;B	.|0.31547	.|0.002;0.008;0.009;0.132;0.002;0.016	T|T	0.28964|0.28964	-1.0027|-1.0027	5|10	.|0.62326	.|D	.|0.03	.|.	15.246|15.246	0.73507|0.73507	0.0:0.8601:0.1399:0.0|0.0:0.8601:0.1399:0.0	.|.	.|188;283;312;350;366;316	.|B4DTY1;F5GWC5;E9PRV2;P46937-2;P46937;P46937-3	.|.;.;.;.;YAP1_HUMAN;.	V|C	120|312;366;354;316;283;350;188	.|ENSP00000434134:S312C;ENSP00000331023:S316C;ENSP00000435602:S188C	.|ENSP00000282441:S366C	L|S	+|+	1|2	0|0	YAP1|YAP1	101599627|101599627	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	5.295000|5.295000	0.65692|0.65692	2.753000|2.753000	0.94483|0.94483	0.555000|0.555000	0.69702|0.69702	CTT|TCT	YAP1	-	NULL	ENSG00000137693		0.433	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YAP1	HGNC	protein_coding	OTTHUMT00000394151.1	-	0.00	57	0	C	NM_006106		102094417	+1	tier1	-	no_errors	ENST00000282441	ensembl	human	known	74_37	missense	17.20	77	16	SNP	1.000	G
YWHAB	7529	genome.wustl.edu	37	20	43533668	43533668	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr20:43533668A>G	ENST00000372839.3	+	5	758	c.484A>G	c.(484-486)Atg>Gtg	p.M162V	YWHAB_ENST00000353703.4_Missense_Mutation_p.M162V|YWHAB_ENST00000479421.1_3'UTR	NM_003404.3	NP_003395.1	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta	162					activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cytoplasmic sequestering of protein (GO:0051220)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|MAPK cascade (GO:0000165)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of catalytic activity (GO:0043085)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein heterooligomerization (GO:0051291)|protein targeting (GO:0006605)|Ras protein signal transduction (GO:0007265)|RNA metabolic process (GO:0016070)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(1)	12		Myeloproliferative disorder(115;0.0122)				TAAGAAAGAAATGCAGCCTAC	0.413																																																	0													89.0	86.0	87.0					20																	43533668		2203	4300	6503	SO:0001583	missense	0			X57346	CCDS13339.1	20q13.1	2013-12-03	2013-12-03		ENSG00000166913	ENSG00000166913			12849	protein-coding gene	gene with protein product	"""14-3-3 beta"", ""14-3-3 alpha"""	601289	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide"""	YWHAA		8617504, 7890696	Standard	NM_003404		Approved		uc002xmu.3	P31946	OTTHUMG00000032549	ENST00000372839.3:c.484A>G	20.37:g.43533668A>G	ENSP00000361930:p.Met162Val		A8K9K2|E1P616	Missense_Mutation	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.M162V	ENST00000372839.3	37	c.484	CCDS13339.1	20	.	.	.	.	.	.	.	.	.	.	A	29.3	4.991240	0.93106	.	.	ENSG00000166913	ENST00000353703;ENST00000372839	T;T	0.42131	0.98;0.98	5.87	5.87	0.94306	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.82323	2.585	0.80722	D	1	D	0.56746	0.977	P	0.57960	0.83	T	0.70182	-0.4942	10	0.87932	D	0	-21.9534	16.5764	0.84681	1.0:0.0:0.0:0.0	.	162	P31946	1433B_HUMAN	V	162	ENSP00000300161:M162V;ENSP00000361930:M162V	ENSP00000300161:M162V	M	+	1	0	YWHAB	42967082	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	ATG	YWHAB	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	ENSG00000166913		0.413	YWHAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAB	HGNC	protein_coding	OTTHUMT00000079386.3	-	0.00	26	0	A	NM_003404		43533668	+1	tier1	-	no_errors	ENST00000353703	ensembl	human	known	74_37	missense	40.38	31	21	SNP	1.000	G
ZMYM3	9203	genome.wustl.edu	37	X	70471431	70471431	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chrX:70471431C>T	ENST00000353904.2	-	3	875	c.688G>A	c.(688-690)Gcg>Acg	p.A230T	ZMYM3_ENST00000373978.1_Missense_Mutation_p.A230T|ZMYM3_ENST00000373984.3_Missense_Mutation_p.A230T|ZMYM3_ENST00000373998.1_Missense_Mutation_p.A230T|ZMYM3_ENST00000373982.1_Missense_Mutation_p.A230T|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.A230T|ZMYM3_ENST00000314425.5_Missense_Mutation_p.A230T|ZMYM3_ENST00000373981.1_Missense_Mutation_p.A230T	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	230					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TTCTCACTCGCCTTCGCAGTC	0.612																																																	0													52.0	31.0	38.0					X																	70471431		2200	4293	6493	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.688G>A	X.37:g.70471431C>T	ENSP00000343909:p.Ala230Thr		D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.A230T	ENST00000353904.2	37	c.688	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179181	0.38511	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T	0.44083	1.52;0.93;1.52;1.52;1.51;0.93;0.93	4.3	2.33	0.28932	.	0.683194	0.13647	N	0.372541	T	0.19005	0.0456	N	0.08118	0	0.19775	N	0.99996	B;B;B	0.27559	0.181;0.065;0.001	B;B;B	0.19148	0.024;0.017;0.0	T	0.18178	-1.0345	10	0.15499	T	0.54	-2.264	8.6745	0.34170	0.0:0.7784:0.0:0.2216	.	230;230;230	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	T	230	ENSP00000322845:A230T;ENSP00000363110:A230T;ENSP00000343909:A230T;ENSP00000363096:A230T;ENSP00000363100:A230T;ENSP00000363094:A230T;ENSP00000363093:A230T	ENSP00000322845:A230T	A	-	1	0	ZMYM3	70388156	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	2.954000	0.49113	0.836000	0.34901	0.425000	0.28330	GCG	ZMYM3	-	NULL	ENSG00000147130		0.612	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	18	0	C	NM_201599		70471431	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	50.00	20	20	SNP	0.881	T
ZNF143	7702	genome.wustl.edu	37	11	9522726	9522728	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr11:9522726_9522728delAGG	ENST00000396602.2	+	11	1175_1177	c.1056_1058delAGG	c.(1054-1059)acagga>aca	p.G353del	ZNF143_ENST00000299606.2_In_Frame_Del_p.G325del|ZNF143_ENST00000396604.1_In_Frame_Del_p.G352del|ZNF143_ENST00000396597.3_In_Frame_Del_p.G322del|ZNF143_ENST00000530463.1_In_Frame_Del_p.G352del	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	353					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		GGACACACACAGGAGAAAGACCT	0.443																																																	0																																										SO:0001651	inframe_deletion	0			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.1056_1058delAGG	11.37:g.9522726_9522728delAGG	ENSP00000379847:p.Gly353del		A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G353in_frame_del	ENST00000396602.2	37	c.1056_1058	CCDS7799.2	11																																																																																			ZNF143	-	pfscan_Znf_C2H2	ENSG00000166478		0.443	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF143	HGNC	protein_coding	OTTHUMT00000313921.2		0.00	34	0	AGG	NM_003442		9522728	+1	tier1		no_errors	ENST00000396602	ensembl	human	known	74_37	in_frame_del	11.69	68	9	DEL	0.999:1.000:1.000	-
ZNF213	7760	genome.wustl.edu	37	16	3190882	3190882	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr16:3190882G>A	ENST00000396878.3	+	6	1389	c.914G>A	c.(913-915)cGg>cAg	p.R305Q	ZNF213_ENST00000574902.1_Missense_Mutation_p.R305Q|ZNF213_ENST00000416391.2_Missense_Mutation_p.R147Q|ZNF213_ENST00000576416.1_Missense_Mutation_p.R305Q	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	305					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						CCCACTCGCCGGCGCCAGTTC	0.761																																																	0													4.0	7.0	6.0					16																	3190882		1817	3697	5514	SO:0001583	missense	0			AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.914G>A	16.37:g.3190882G>A	ENSP00000380087:p.Arg305Gln		A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R305Q	ENST00000396878.3	37	c.914	CCDS10495.1	16	.	.	.	.	.	.	.	.	.	.	G	7.688	0.690480	0.15039	.	.	ENSG00000085644	ENST00000396878;ENST00000416391	T;T	0.05319	3.48;3.46	4.67	3.7	0.42460	.	0.000000	0.36972	N	0.002320	T	0.05364	0.0142	L	0.32530	0.975	0.31437	N	0.672436	B	0.24882	0.113	B	0.11329	0.006	T	0.13980	-1.0489	10	0.20519	T	0.43	.	11.9939	0.53189	0.0:0.0:0.826:0.174	.	305	O14771	ZN213_HUMAN	Q	305;147	ENSP00000380087:R305Q;ENSP00000403892:R147Q	ENSP00000380087:R305Q	R	+	2	0	ZNF213	3130883	0.000000	0.05858	0.533000	0.28001	0.620000	0.37586	0.412000	0.21131	0.946000	0.37632	0.462000	0.41574	CGG	ZNF213	-	NULL	ENSG00000085644		0.761	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF213	HGNC	protein_coding	OTTHUMT00000437334.1	-	0.00	10	0	G	NM_004220		3190882	+1	tier1	-	no_errors	ENST00000396878	ensembl	human	known	74_37	missense	23.81	15	5	SNP	0.875	A
ZNF311	282890	genome.wustl.edu	37	6	28963076	28963076	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr6:28963076G>C	ENST00000377179.3	-	7	2215	c.1703C>G	c.(1702-1704)tCa>tGa	p.S568*	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						CCTCAGGACTGAACTATGATG	0.493																																																	0													115.0	101.0	106.0					6																	28963076		1511	2709	4220	SO:0001587	stop_gained	0			AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1703C>G	6.37:g.28963076G>C	ENSP00000366384:p.Ser568*		A2BFK5|B0S7Y4|Q92971	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S568*	ENST00000377179.3	37	c.1703	CCDS34357.1	6	.	.	.	.	.	.	.	.	.	.	G	40	8.299825	0.98750	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	.	.	.	3.79	2.9	0.33743	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-1.0188	11.6711	0.51401	0.0:0.1816:0.8184:0.0	.	.	.	.	X	568;476	.	ENSP00000366384:S568X	S	-	2	0	ZNF311	29071055	0.002000	0.14202	0.002000	0.10522	0.994000	0.84299	1.178000	0.31981	0.869000	0.35703	0.585000	0.79938	TCA	ZNF311	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197935		0.493	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	HGNC	protein_coding	OTTHUMT00000076631.3	-	0.00	32	0	G	XM_212581		28963076	-1	tier1	-	no_errors	ENST00000377179	ensembl	human	known	74_37	nonsense	15.94	58	11	SNP	0.002	C
ZNF438	220929	genome.wustl.edu	37	10	31138696	31138696	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:31138696C>G	ENST00000361310.3	-	6	967	c.638G>C	c.(637-639)aGt>aCt	p.S213T	ZNF438_ENST00000413025.1_Missense_Mutation_p.S213T|ZNF438_ENST00000436087.2_Missense_Mutation_p.S213T|ZNF438_ENST00000452305.1_Missense_Mutation_p.S203T|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000538351.2_Missense_Mutation_p.S164T|ZNF438_ENST00000444692.2_Missense_Mutation_p.S203T|ZNF438_ENST00000442986.1_Missense_Mutation_p.S213T|ZNF438_ENST00000331737.6_Missense_Mutation_p.S203T			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	213					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				AGGGTTCAGACTGCCATGGGT	0.552																																																	0													132.0	120.0	124.0					10																	31138696		2203	4300	6503	SO:0001583	missense	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.638G>C	10.37:g.31138696C>G	ENSP00000354663:p.Ser213Thr		A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S213T	ENST00000361310.3	37	c.638	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	C	1.832	-0.469580	0.04445	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	T;T;T;T;T;T;T;T	0.09538	2.97;2.98;2.98;2.98;2.98;2.97;2.97;2.99	5.01	-5.09	0.02920	.	1.869190	0.01912	N	0.039917	T	0.04634	0.0126	N	0.14661	0.345	0.09310	N	1	B;B	0.12013	0.0;0.005	B;B	0.06405	0.0;0.002	T	0.34030	-0.9845	10	0.05436	T	0.98	-0.9454	4.45	0.11616	0.1005:0.4109:0.3134:0.1751	.	213;203	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	T	203;213;213;213;213;203;203;164	ENSP00000333571:S203T;ENSP00000354663:S213T;ENSP00000406934:S213T;ENSP00000412363:S213T;ENSP00000387546:S213T;ENSP00000413060:S203T;ENSP00000410898:S203T;ENSP00000445461:S164T	ENSP00000333571:S203T	S	-	2	0	ZNF438	31178702	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.383000	0.07398	-0.522000	0.06417	-1.004000	0.02495	AGT	ZNF438	-	NULL	ENSG00000183621		0.552	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	-	0.00	85	0	C	NM_182755		31138696	-1	tier1	-	no_errors	ENST00000361310	ensembl	human	known	74_37	missense	8.33	88	8	SNP	0.000	G
ZNF518A	9849	genome.wustl.edu	37	10	97918367	97918367	+	RNA	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr10:97918367G>C	ENST00000534948.1	+	0	3145							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		ATGATGCCTAGAATCACATCT	0.373																																																	0													37.0	37.0	37.0					10																	97918367		1849	4093	5942			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97918367G>C			A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.373	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		-	0.00	19	0	G	NM_014803		97918367	+1	tier1	-	no_errors	ENST00000316045	ensembl	human	known	74_37	rna	17.39	38	8	SNP	1.000	C
ZNF700	90592	genome.wustl.edu	37	19	12059541	12059541	+	Silent	SNP	C	C	T			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:12059541C>T	ENST00000254321.5	+	4	845	c.702C>T	c.(700-702)ttC>ttT	p.F234F	ZNF763_ENST00000590798.1_Intron|ZNF700_ENST00000482090.1_Silent_p.F216F|ZNF763_ENST00000538752.1_Intron|ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TCCATTCTTTCAGTTTATATC	0.348																																																	0													63.0	68.0	66.0					19																	12059541		2203	4299	6502	SO:0001819	synonymous_variant	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.702C>T	19.37:g.12059541C>T			B9EGU4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F234	ENST00000254321.5	37	c.702	CCDS32915.1	19																																																																																			ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196757		0.348	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	-	0.00	39	0	C	NM_144566		12059541	+1	tier1	-	no_errors	ENST00000254321	ensembl	human	known	74_37	silent	7.04	66	5	SNP	0.000	T
ZNF585B	92285	genome.wustl.edu	37	19	37680968	37680968	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr19:37680968G>C	ENST00000532828.2	-	3	408	c.157C>G	c.(157-159)Cgg>Ggg	p.R53G	ZNF585B_ENST00000531805.1_5'UTR|ZNF585B_ENST00000586320.1_Missense_Mutation_p.R38G|CTC-454I21.3_ENST00000585860.2_Missense_Mutation_p.R53G|ZNF585B_ENST00000312908.5_5'Flank|ZNF585B_ENST00000527838.1_Missense_Mutation_p.R53G	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATCACATCCCGGTACAGGTTT	0.517																																					Melanoma(93;882 1454 18863 28917 48427)												0													121.0	101.0	108.0					19																	37680968		2203	4300	6503	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.157C>G	19.37:g.37680968G>C	ENSP00000433773:p.Arg53Gly		Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R53G	ENST00000532828.2	37	c.157	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452539	0.43531	.	.	ENSG00000245680	ENST00000532828;ENST00000527838	T;T	0.02656	4.21;4.21	2.95	-1.12	0.09808	Krueppel-associated box (4);	0.508491	0.14847	N	0.294936	T	0.06917	0.0176	M	0.89601	3.045	0.80722	D	1	P	0.34743	0.466	B	0.40677	0.337	T	0.13575	-1.0504	10	0.87932	D	0	.	2.5891	0.04838	0.2717:0.0:0.3497:0.3786	.	53	Q52M93	Z585B_HUMAN	G	53	ENSP00000433773:R53G;ENSP00000435268:R53G	ENSP00000435268:R53G	R	-	1	2	ZNF585B	42372808	0.000000	0.05858	0.954000	0.39281	0.881000	0.50899	-1.572000	0.02136	-0.275000	0.09219	-0.680000	0.03767	CGG	ZNF585B	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000245680		0.517	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2		0.00	58	0	G	NM_152279		37680968	-1			no_errors	ENST00000532828	ensembl	human	known	74_37	missense	5.04	112	6	SNP	0.882	C
ZNF804B	219578	genome.wustl.edu	37	7	88963860	88963860	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3Y9-01A-12D-A247-09	TCGA-IG-A3Y9-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d490dc67-08e6-4d8e-b641-c405b20d86e1	98880f6a-bdae-4313-8eff-525d22ab97a5	g.chr7:88963860G>C	ENST00000333190.4	+	4	2173	c.1564G>C	c.(1564-1566)Gac>Cac	p.D522H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	522							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TTTAACTGAAGACCAACAAAA	0.368										HNSCC(36;0.09)																																							0													42.0	44.0	43.0					7																	88963860		2200	4300	6500	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1564G>C	7.37:g.88963860G>C	ENSP00000329638:p.Asp522His		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.D522H	ENST00000333190.4	37	c.1564	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	7.921	0.738614	0.15642	.	.	ENSG00000182348	ENST00000333190	T	0.05319	3.46	5.49	5.49	0.81192	.	0.251558	0.35262	N	0.003339	T	0.05914	0.0154	L	0.43152	1.355	0.30892	N	0.730203	P	0.36378	0.55	B	0.26614	0.071	T	0.13176	-1.0519	10	0.29301	T	0.29	-8.7811	12.9941	0.58635	0.0:0.2091:0.7909:0.0	.	522	A4D1E1	Z804B_HUMAN	H	522	ENSP00000329638:D522H	ENSP00000329638:D522H	D	+	1	0	ZNF804B	88801796	1.000000	0.71417	1.000000	0.80357	0.404000	0.30871	1.414000	0.34736	2.865000	0.98341	0.655000	0.94253	GAC	ZNF804B	-	NULL	ENSG00000182348		0.368	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	38	0	G	NM_181646		88963860	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	C
