#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA4	24	genome.wustl.edu	37	1	94502778	94502778	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:94502778delG	ENST00000370225.3	-	25	3822	c.3736delC	c.(3736-3738)cttfs	p.L1246fs		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1246					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCTCTGAAAAGGCTGGCATAT	0.483																																																	0													110.0	111.0	110.0					1																	94502778		2203	4300	6503	SO:0001589	frameshift_variant	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3736delC	1.37:g.94502778delG	ENSP00000359245:p.Leu1246fs		O15112|O60438|O60915|Q0QD48|Q4LE31	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.L1246fs	ENST00000370225.3	37	c.3736	CCDS747.1	1																																																																																			ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.483	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1		0.00	19	0	G	NM_000350		94502778	-1	tier1		no_errors	ENST00000370225	ensembl	human	known	74_37	frame_shift_del	15.38	22	4	DEL	1.000	-
ADAMTS2	9509	genome.wustl.edu	37	5	178541072	178541072	+	Silent	SNP	G	G	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr5:178541072G>C	ENST00000251582.7	-	22	3533	c.3432C>G	c.(3430-3432)ctC>ctG	p.L1144L		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1144					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGGAGGCATTGAGAGGGACCT	0.567																																																	0													197.0	183.0	188.0					5																	178541072		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3432C>G	5.37:g.178541072G>C				Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.L1144	ENST00000251582.7	37	c.3432	CCDS4444.1	5																																																																																			ADAMTS2	-	NULL	ENSG00000087116		0.567	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	55	0	G	NM_014244		178541072	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	silent	23.08	70	21	SNP	0.003	C
ADCY3	109	genome.wustl.edu	37	2	25141856	25141856	+	Start_Codon_SNP	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:25141856T>C	ENST00000260600.5	-	1	852	c.1A>G	c.(1-3)Atg>Gtg	p.M1V		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	1					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TTCCTCGGCATACTGGCTGGT	0.657																																																	0													5.0	6.0	6.0					2																	25141856		2056	4100	6156	SO:0001582	initiator_codon_variant	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1A>G	2.37:g.25141856T>C	ENSP00000260600:p.Met1Val		B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.M1V	ENST00000260600.5	37	c.1	CCDS1715.1	2	.	.	.	.	.	.	.	.	.	.	T	18.52	3.642219	0.67244	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000435135;ENST00000438445	T;T;T	0.79454	-1.27;-0.93;0.82	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.84719	0.5534	.	.	.	0.80722	D	1	P;P	0.45715	0.865;0.865	P;P	0.57620	0.824;0.824	D	0.86589	0.1859	9	0.87932	D	0	.	12.1635	0.54117	0.0:0.0:0.0:1.0	.	1;1	B7ZLX9;O60266	.;ADCY3_HUMAN	V	1	ENSP00000260600:M1V;ENSP00000389799:M1V;ENSP00000406153:M1V	ENSP00000260600:M1V	M	-	1	0	ADCY3	24995360	1.000000	0.71417	0.982000	0.44146	0.571000	0.35966	7.230000	0.78097	1.744000	0.51775	0.383000	0.25322	ATG	ADCY3	-	NULL	ENSG00000138031		0.657	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2		0.00	10	0	T		Missense_Mutation	25141856	-1			no_errors	ENST00000260600	ensembl	human	known	74_37	missense	50.00	2	2	SNP	0.997	C
ANKRD30A	91074	genome.wustl.edu	37	10	37507906	37507906	+	Splice_Site	SNP	A	A	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr10:37507906A>T	ENST00000602533.1	+	34	3198		c.e34-1		ANKRD30A_ENST00000361713.1_Splice_Site|ANKRD30A_ENST00000374660.1_Splice_Site			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TGTTTTATTTAGGTTTCTCAC	0.303																																																	0													22.0	20.0	21.0					10																	37507906		1781	4002	5783	SO:0001630	splice_region_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3100-1A>T	10.37:g.37507906A>T			Q5W025	Splice_Site	SNP	-	e34-2	ENST00000602533.1	37	c.3100-2		10	.	.	.	.	.	.	.	.	.	.	a	4.742	0.138058	0.09083	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	.	.	.	2.65	2.65	0.31530	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5253	0.33302	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKRD30A	37547912	1.000000	0.71417	0.953000	0.39169	0.020000	0.10135	5.468000	0.66743	1.083000	0.41159	0.381000	0.24937	.	ANKRD30A	-	-	ENSG00000148513		0.303	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	10	0	A	NM_052997	Intron	37507906	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	splice_site	40.74	16	11	SNP	0.822	T
ANKRD36C	400986	genome.wustl.edu	37	2	96601238	96601238	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:96601238C>T	ENST00000456556.1	-	24	1783	c.1699G>A	c.(1699-1701)Gcc>Acc	p.A567T				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	567							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CTTCTCATGGCTGCTTTTGAA	0.348																																																	0																																										SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1699G>A	2.37:g.96601238C>T	ENSP00000403302:p.Ala567Thr		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A567T	ENST00000456556.1	37	c.1699		2	.	.	.	.	.	.	.	.	.	.	-	10.78	1.447799	0.26074	.	.	ENSG00000174501	ENST00000456556	T	0.76709	-1.04	0.967	0.967	0.19674	.	.	.	.	.	T	0.67730	0.2924	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57382	-0.7821	6	0.36615	T	0.2	.	5.2538	0.15537	0.0:1.0:0.0:0.0	.	.	.	.	T	567	ENSP00000403302:A567T	ENSP00000403302:A567T	A	-	1	0	AC073995.2	95964965	0.003000	0.15002	0.002000	0.10522	0.041000	0.13682	0.043000	0.13971	0.824000	0.34613	0.176000	0.17051	GCC	ANKRD36C	-	NULL	ENSG00000174501		0.348	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2		0.00	57	0	C	NM_001010914		96601238	-1			no_errors	ENST00000456556	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.002	T
AP1G2	8906	genome.wustl.edu	37	14	24031497	24031499	+	Splice_Site	DEL	TTG	TTG	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	TTG	TTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:24031497_24031499delTTG	ENST00000308724.5	-	15	2381_2383	c.1626_1628delCAA	c.(1624-1629)aacaac>aac	p.542_543NN>N	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'Flank|AP1G2_ENST00000397120.3_Splice_Site_p.542_543NN>N|RP11-66N24.4_ENST00000553985.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	542					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CCCTTCTTACTTGTTGTCCCCAC	0.576											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001630	splice_region_variant	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1628+1CAA>-	14.37:g.24031500_24031502delTTG		768	D3DS51|O75504	In_Frame_Del	DEL	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.N543in_frame_del	ENST00000308724.5	37	c.1628_1626	CCDS9602.1	14																																																																																			AP1G2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000213983		0.576	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	HGNC	protein_coding	OTTHUMT00000071812.4		0.00	31	0	TTG	NM_003917	In_Frame_Del	24031499	-1	tier1		no_errors	ENST00000308724	ensembl	human	known	74_37	in_frame_del	17.95	32	7	DEL	1.000:1.000:0.997	-
AP1G2	8906	genome.wustl.edu	37	14	24035498	24035498	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:24035498C>T	ENST00000308724.5	-	3	1215	c.460G>A	c.(460-462)Gtg>Atg	p.V154M	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'UTR|AP1G2_ENST00000397120.3_Missense_Mutation_p.V154M	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	154					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TTCTTGCGCACGTAGGGACTG	0.602																																																	0													67.0	65.0	66.0					14																	24035498		2203	4300	6503	SO:0001583	missense	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.460G>A	14.37:g.24035498C>T	ENSP00000312442:p.Val154Met		D3DS51|O75504	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.V154M	ENST00000308724.5	37	c.460	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431327	0.62844	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189	T;T;T	0.48201	0.82;0.82;0.82	5.01	4.05	0.47172	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.189742	0.44285	D	0.000473	T	0.59088	0.2168	M	0.64676	1.99	0.80722	D	1	P;D	0.59767	0.924;0.986	P;P	0.61132	0.661;0.884	T	0.61855	-0.6977	10	0.87932	D	0	-14.8633	10.1973	0.43062	0.0:0.8951:0.0:0.1049	.	154;154	G3V532;O75843	.;AP1G2_HUMAN	M	154	ENSP00000312442:V154M;ENSP00000380309:V154M;ENSP00000452153:V154M	ENSP00000312442:V154M	V	-	1	0	AP1G2	23105338	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	0.690000	0.25451	2.595000	0.87683	0.561000	0.74099	GTG	AP1G2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000213983		0.602	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	HGNC	protein_coding	OTTHUMT00000071812.4	-	0.00	44	0	C	NM_003917		24035498	-1	tier1	-	no_errors	ENST00000308724	ensembl	human	known	74_37	missense	28.30	38	15	SNP	0.995	T
APBB1	322	genome.wustl.edu	37	11	6423342	6423342	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:6423342C>T	ENST00000609360.1	-	8	1451	c.1352G>A	c.(1351-1353)cGc>cAc	p.R451H	APBB1_ENST00000608645.1_Missense_Mutation_p.R192H|APBB1_ENST00000389906.2_Missense_Mutation_p.R451H|APBB1_ENST00000608655.1_Missense_Mutation_p.R231H|APBB1_ENST00000608704.1_Missense_Mutation_p.R192H|APBB1_ENST00000529519.1_5'UTR|APBB1_ENST00000299402.6_Missense_Mutation_p.R451H|APBB1_ENST00000530885.1_Missense_Mutation_p.R231H|APBB1_ENST00000608394.1_Missense_Mutation_p.R192H|APBB1_ENST00000311051.3_Missense_Mutation_p.R451H|APBB1_ENST00000609331.1_Missense_Mutation_p.R216H	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	451	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GCCCCACACGCGGATGCTGAT	0.582																																					GBM(147;1810 2556 5672 39622)												0													122.0	99.0	107.0					11																	6423342		2201	4296	6497	SO:0001583	missense	0			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1352G>A	11.37:g.6423342C>T	ENSP00000477213:p.Arg451His		A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_WW_dom,pfam_PTB,superfamily_WW_dom,smart_WW_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_WW_dom	p.R451H	ENST00000609360.1	37	c.1352		11	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392409	0.83011	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885;ENST00000533407	T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07	4.31	4.31	0.51392	.	0.000000	0.64402	D	0.000002	T	0.47358	0.1441	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.69824	0.927;0.956;0.966	T	0.54296	-0.8315	10	0.87932	D	0	-15.7101	14.3225	0.66496	0.0:1.0:0.0:0.0	.	216;231;451	F5H1C5;B7Z2Y0;O00213-2	.;.;.	H	451;451;451;300;192;216;231;192	ENSP00000299402:R451H;ENSP00000311912:R451H;ENSP00000374556:R451H;ENSP00000433338:R231H;ENSP00000437114:R192H	ENSP00000299402:R451H	R	-	2	0	APBB1	6379918	1.000000	0.71417	0.670000	0.29842	0.839000	0.47603	5.486000	0.66856	2.212000	0.71576	0.467000	0.42956	CGC	APBB1	-	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000166313		0.582	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	APBB1	HGNC	protein_coding	OTTHUMT00000471831.1	-	0.00	53	0	C	NM_001164		6423342	-1	tier1	-	no_errors	ENST00000389906	ensembl	human	known	74_37	missense	32.84	45	22	SNP	0.997	T
ARHGEF12	23365	genome.wustl.edu	37	11	120317153	120317153	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:120317153C>T	ENST00000397843.2	+	17	1553	c.1387C>T	c.(1387-1389)Cac>Tac	p.H463Y	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.H360Y|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.H444Y	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	463	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TCTGCATCGCCACTATATCCA	0.368			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													95.0	88.0	90.0					11																	120317153		1888	4132	6020	SO:0001583	missense	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1387C>T	11.37:g.120317153C>T	ENSP00000380942:p.His463Tyr		O15086|Q6P526	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.H444Y	ENST00000397843.2	37	c.1330	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204601	0.79127	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.82255	-1.59;-1.59;-1.59	6.17	6.17	0.99709	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.125177	0.35677	N	0.003059	D	0.82393	0.5027	L	0.36672	1.1	0.37752	D	0.926	B;B;B	0.33238	0.403;0.244;0.288	B;B;B	0.40038	0.173;0.212;0.317	T	0.81604	-0.0857	10	0.52906	T	0.07	-6.4076	20.8794	0.99867	0.0:1.0:0.0:0.0	.	360;444;463	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	Y	463;444;360	ENSP00000380942:H463Y;ENSP00000349056:H444Y;ENSP00000432984:H360Y	ENSP00000349056:H444Y	H	+	1	0	ARHGEF12	119822363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.972000	0.76110	2.941000	0.99782	0.655000	0.94253	CAC	ARHGEF12	-	pfam_RGS-like_dom,superfamily_Regulat_G_prot_signal_superfam	ENSG00000196914		0.368	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	-	0.00	11	0	C	NM_015313		120317153	+1	tier1	-	no_errors	ENST00000356641	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
ASNS	440	genome.wustl.edu	37	7	97481732	97481732	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr7:97481732T>C	ENST00000394309.3	-	13	1996	c.1525A>G	c.(1525-1527)Act>Gct	p.T509A	ASNS_ENST00000437628.1_Missense_Mutation_p.T426A|ASNS_ENST00000394308.3_Missense_Mutation_p.T509A|ASNS_ENST00000422745.1_Missense_Mutation_p.T488A|ASNS_ENST00000455086.1_Missense_Mutation_p.T426A|ASNS_ENST00000444334.1_Missense_Mutation_p.T488A|ASNS_ENST00000175506.4_Missense_Mutation_p.T509A	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	509	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GTTTTAGGAGTATTGAAGGGA	0.433																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)												0													163.0	158.0	159.0					7																	97481732		2203	4300	6503	SO:0001583	missense	0			M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1525A>G	7.37:g.97481732T>C	ENSP00000377846:p.Thr509Ala		A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	pfam_Asn_synthase,pfam_GATase_dom,tigrfam_Asn_synth_AEB	p.T509A	ENST00000394309.3	37	c.1525	CCDS5652.1	7	.	.	.	.	.	.	.	.	.	.	T	14.91	2.675104	0.47781	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.86;0.85;0.86	5.23	4.07	0.47477	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.050881	0.85682	D	0.000000	T	0.48169	0.1485	M	0.84846	2.72	0.42318	D	0.992249	P	0.37122	0.583	B	0.30646	0.118	T	0.54596	-0.8270	10	0.66056	D	0.02	-12.9074	9.9396	0.41572	0.0:0.0:0.3295:0.6705	.	509	P08243	ASNS_HUMAN	A	509;509;426;509;488;426;488	ENSP00000175506:T509A;ENSP00000377846:T509A;ENSP00000414379:T426A;ENSP00000377845:T509A;ENSP00000414901:T488A;ENSP00000408472:T426A;ENSP00000406994:T488A	ENSP00000175506:T509A	T	-	1	0	ASNS	97319668	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.433000	0.59929	0.925000	0.37094	0.459000	0.35465	ACT	ASNS	-	NULL	ENSG00000070669		0.433	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASNS	HGNC	protein_coding	OTTHUMT00000333645.1	-	0.00	53	0	T	NM_001673, NM_183356		97481732	-1	tier1	-	no_errors	ENST00000175506	ensembl	human	known	74_37	missense	57.35	28	39	SNP	1.000	C
ASTN2	23245	genome.wustl.edu	37	9	119188344	119188344	+	Missense_Mutation	SNP	C	C	A	rs200117563		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:119188344C>A	ENST00000313400.4	-	23	3906	c.3806G>T	c.(3805-3807)cGa>cTa	p.R1269L	ASTN2_ENST00000361477.3_Missense_Mutation_p.R321L|ASTN2_ENST00000373996.3_Missense_Mutation_p.R1265L|ASTN2_ENST00000288520.5_Missense_Mutation_p.R370L|ASTN2_ENST00000341734.4_Missense_Mutation_p.R321L|ASTN2_ENST00000361209.2_Missense_Mutation_p.R1218L			O75129	ASTN2_HUMAN	astrotactin 2	1269					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CCTCTCCAGTCGCCGTAGAAT	0.532																																																	0													37.0	36.0	37.0					9																	119188344		2203	4300	6503	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3806G>T	9.37:g.119188344C>A	ENSP00000314038:p.Arg1269Leu		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.R1269L	ENST00000313400.4	37	c.3806		9	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303241	0.81136	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.16073	2.78;2.78;2.37;2.39;2.6;2.81;2.39	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.30947	0.0781	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D;D;D	0.71674	0.996;0.996;0.998;0.997;0.965;0.996;0.996	D;D;D;D;P;D;D	0.80764	0.988;0.988;0.994;0.987;0.828;0.988;0.992	T	0.07597	-1.0764	10	0.72032	D	0.01	-24.1634	20.1821	0.98206	0.0:1.0:0.0:0.0	.	321;321;1218;1269;1265;321;370	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	L	1269;1265;370;321;992;1218;321	ENSP00000314038:R1269L;ENSP00000363108:R1265L;ENSP00000288520:R370L;ENSP00000339925:R321L;ENSP00000363098:R992L;ENSP00000354504:R1218L;ENSP00000355116:R321L	ENSP00000288520:R370L	R	-	2	0	ASTN2	118228165	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.957000	0.76019	2.761000	0.94854	0.655000	0.94253	CGA	ASTN2	-	NULL	ENSG00000148219		0.532	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		-	0.00	31	0	C	NM_014010		119188344	-1	tier1	-	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	A
BCKDHA	593	genome.wustl.edu	37	19	41931756	41931756	+	IGR	SNP	A	A	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:41931756A>G	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000321702.2_Missense_Mutation_p.Y310H|CTC-435M10.6_ENST00000598887.1_RNA|B3GNT8_ENST00000601379.1_5'Flank	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						GCAATGACGTAGCCACCCCCG	0.647																																																	0													29.0	31.0	30.0					19																	41931756		2201	4296	6497	SO:0001628	intergenic_variant	0			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41931756A>G			B4DP47|E7EW46|Q16034|Q16472	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.Y310H	ENST00000269980.2	37	c.928	CCDS12581.1	19	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820665	0.50633	.	.	ENSG00000177191	ENST00000321702	T	0.64991	-0.13	3.81	3.81	0.43845	.	0.244486	0.34200	N	0.004172	T	0.80747	0.4682	M	0.90425	3.115	0.53005	D	0.99996	D	0.76494	0.999	D	0.74348	0.983	D	0.84386	0.0552	10	0.66056	D	0.02	.	11.9954	0.53198	1.0:0.0:0.0:0.0	.	310	Q7Z7M8	B3GN8_HUMAN	H	310	ENSP00000312700:Y310H	ENSP00000312700:Y310H	Y	-	1	0	B3GNT8	46623596	1.000000	0.71417	0.965000	0.40720	0.208000	0.24298	5.716000	0.68437	1.737000	0.51674	0.533000	0.62120	TAC	B3GNT8	-	pfam_Glyco_trans_31	ENSG00000177191		0.647	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT8	HGNC	protein_coding	OTTHUMT00000398313.3	-	0.00	42	0	A	NM_000709		41931756	-1	tier1	-	no_errors	ENST00000321702	ensembl	human	known	74_37	missense	44.90	27	22	SNP	1.000	G
BICC1	80114	genome.wustl.edu	37	10	60573752	60573752	+	Intron	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr10:60573752C>T	ENST00000373886.3	+	18	2537				BICC1_ENST00000263103.1_Missense_Mutation_p.R473C	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1						multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ATCAAGTGAGCGTTGTGTTTT	0.423																																																	0													122.0	113.0	116.0					10																	60573752		2203	4300	6503	SO:0001627	intron_variant	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2533+6C>T	10.37:g.60573752C>T				Missense_Mutation	SNP	NULL	p.R473C	ENST00000373886.3	37	c.1417	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	C	9.660	1.143876	0.21205	.	.	ENSG00000122870	ENST00000263103	T	0.48201	0.82	5.93	2.54	0.30619	.	.	.	.	.	T	0.27169	0.0666	.	.	.	0.26331	N	0.977521	B	0.33904	0.431	B	0.27796	0.083	T	0.10268	-1.0637	7	.	.	.	.	5.964	0.19315	0.0:0.6118:0.0:0.3882	.	767	E7EU62	.	C	473	ENSP00000263103:R473C	.	R	+	1	0	BICC1	60243758	0.998000	0.40836	0.942000	0.38095	0.292000	0.27327	0.720000	0.25896	0.755000	0.32990	-0.345000	0.07892	CGT	BICC1	-	NULL	ENSG00000122870		0.423	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	81	0	C	NM_025044		60573752	+1	tier1	-	no_errors	ENST00000263103	ensembl	human	known	74_37	missense	60.49	32	49	SNP	0.304	T
BOD1L1	259282	genome.wustl.edu	37	4	13590374	13590374	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:13590374C>A	ENST00000040738.5	-	15	8387	c.8252G>T	c.(8251-8253)gGt>gTt	p.G2751V		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2751						nucleus (GO:0005634)	DNA binding (GO:0003677)										AACACTGTGACCGCTTATGGC	0.299																																																	0													59.0	58.0	59.0					4																	13590374		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8252G>T	4.37:g.13590374C>A	ENSP00000040738:p.Gly2751Val		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.G2751V	ENST00000040738.5	37	c.8252	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243288	0.22796	.	.	ENSG00000038219	ENST00000040738	T	0.08807	3.05	4.54	1.72	0.24424	.	0.826719	0.10581	N	0.657890	T	0.06462	0.0166	L	0.27053	0.805	0.09310	N	0.999994	B	0.23058	0.079	B	0.21360	0.034	T	0.37596	-0.9699	10	0.62326	D	0.03	-0.772	6.6004	0.22697	0.0:0.66:0.0:0.34	.	2751	Q8NFC6	BOD1L_HUMAN	V	2751	ENSP00000040738:G2751V	ENSP00000040738:G2751V	G	-	2	0	BOD1L	13199472	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.027000	0.13621	0.183000	0.20059	0.655000	0.94253	GGT	BOD1L1	-	NULL	ENSG00000038219		0.299	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	41	0	C	NM_148894		13590374	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	61.90	16	26	SNP	0.000	A
C14orf39	317761	genome.wustl.edu	37	14	60936309	60936309	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:60936309G>T	ENST00000321731.3	-	8	776	c.617C>A	c.(616-618)tCa>tAa	p.S206*		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	206					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		CAATTCGGATGAACTTTTGGT	0.244																																																	0													57.0	55.0	55.0					14																	60936309		2198	4268	6466	SO:0001587	stop_gained	0			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.617C>A	14.37:g.60936309G>T	ENSP00000324920:p.Ser206*		Q08AQ4	Nonsense_Mutation	SNP	NULL	p.S206*	ENST00000321731.3	37	c.617	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.771675	0.96922	.	.	ENSG00000179008	ENST00000321731	.	.	.	4.86	4.86	0.63082	.	0.000000	0.48767	D	0.000177	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0163	9.4747	0.38864	0.0977:0.0:0.9023:0.0	.	.	.	.	X	206	.	ENSP00000324920:S206X	S	-	2	0	C14orf39	60006062	1.000000	0.71417	0.981000	0.43875	0.983000	0.72400	5.292000	0.65673	2.401000	0.81631	0.585000	0.79938	TCA	C14orf39	-	NULL	ENSG00000179008		0.244	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	-	0.00	66	0	G	NM_174978		60936309	-1	tier1	-	no_errors	ENST00000321731	ensembl	human	known	74_37	nonsense	6.33	74	5	SNP	0.676	T
C19orf66	55337	genome.wustl.edu	37	19	10200373	10200373	+	Splice_Site	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:10200373T>C	ENST00000253110.11	+	4	532		c.e4+2		C19orf66_ENST00000591813.1_Splice_Site|CTD-2240E14.4_ENST00000589622.1_RNA|C19orf66_ENST00000397881.3_Splice_Site	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66											large_intestine(3)|skin(1)	4						GACATTCAGGTGAGTTGGTGG	0.587																																																	0													45.0	49.0	48.0					19																	10200373		2003	4173	6176	SO:0001630	splice_region_variant	0				CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.234+2T>C	19.37:g.10200373T>C			A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Splice_Site	SNP	-	e4+2	ENST00000253110.11	37	c.234+2	CCDS45957.1	19	.	.	.	.	.	.	.	.	.	.	t	7.536	0.659743	0.14645	.	.	ENSG00000130813	ENST00000253110;ENST00000397881	.	.	.	4.37	3.36	0.38483	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4257	0.21768	0.0:0.1103:0.0:0.8897	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf66	10061373	1.000000	0.71417	0.971000	0.41717	0.153000	0.21895	3.303000	0.51858	0.734000	0.32515	-0.255000	0.11280	.	C19orf66	-	-	ENSG00000130813		0.587	C19orf66-001	KNOWN	basic|CCDS	protein_coding	C19orf66	HGNC	protein_coding	OTTHUMT00000451129.1	-	0.00	37	0	T	NM_018381	Intron	10200373	+1	tier1	-	no_errors	ENST00000253110	ensembl	human	known	74_37	splice_site	52.50	19	21	SNP	0.990	C
DDAH2	23564	genome.wustl.edu	37	6	31692792	31692792	+	IGR	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:31692792C>T	ENST00000375789.2	-	0	1688				C6orf25_ENST00000375810.4_3'UTR|DDAH2_ENST00000480913.1_5'Flank|C6orf25_ENST00000375809.3_Missense_Mutation_p.P229L|C6orf25_ENST00000375805.2_Missense_Mutation_p.R199C			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2						arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	CAGCAGGCCCCGCCGGCTGTC	0.587																																																	0													64.0	67.0	66.0					6																	31692792		1511	2709	4220	SO:0001628	intergenic_variant	0			AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212		6.37:g.31692792C>T			A2BEZ7	Missense_Mutation	SNP	NULL	p.R223C	ENST00000375789.2	37	c.667	CCDS4718.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.724|7.724	0.697766|0.697766	0.15106|0.15106	.|.	.|.	ENSG00000204420|ENSG00000204420	ENST00000375809;ENST00000375804|ENST00000375805;ENST00000375814;ENST00000375806	T|T;T;T	0.39406|0.51325	1.08|0.71;0.71;0.71	4.76|4.76	-1.94|-1.94	0.07571|0.07571	.|.	.|1.550420	.|0.04154	.|N	.|0.321788	T|T	0.12305|0.12305	0.0299|0.0299	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	B;B|B;B;B	0.17465|0.06786	0.022;0.022|0.001;0.001;0.001	B;B|B;B;B	0.08055|0.06405	0.003;0.003|0.002;0.002;0.001	T|T	0.24368|0.24368	-1.0162|-1.0162	9|10	0.49607|0.87932	T|D	0.09|0	-0.7027|-0.7027	0.265|0.265	0.00224|0.00224	0.3355:0.2646:0.1488:0.2511|0.3355:0.2646:0.1488:0.2511	.|.	185;229|199;179;223	O95866-4;B0V023|O95866-3;O95866-5;O95866	.;.|.;.;G6B_HUMAN	L|C	229;185|199;179;223	ENSP00000364967:P229L|ENSP00000364963:R199C;ENSP00000364972:R179C;ENSP00000364964:R223C	ENSP00000364962:P185L|ENSP00000364963:R199C	P|R	+|+	2|1	0|0	C6orf25|C6orf25	31800771|31800771	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.013000|0.013000	0.08279|0.08279	-1.122000|-1.122000	0.03267|0.03267	-0.184000|-0.184000	0.10567|0.10567	0.655000|0.655000	0.94253|0.94253	CCG|CGC	C6orf25	-	NULL	ENSG00000204420		0.587	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf25	HGNC	protein_coding	OTTHUMT00000076432.2	-	0.00	11	0	C			31692792	+1	tier1	-	no_errors	ENST00000375806	ensembl	human	known	74_37	missense	53.33	7	8	SNP	0.000	T
C8orf86	389649	genome.wustl.edu	37	8	38386079	38386079	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:38386079C>G	ENST00000358138.1	-	1	101	c.77G>C	c.(76-78)aGa>aCa	p.R26T	C8orf86_ENST00000437935.2_Missense_Mutation_p.R26T	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	26										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						CAGGCAGTCTCTAAGGCTCCT	0.557																																																	0													86.0	79.0	81.0					8																	38386079		2203	4300	6503	SO:0001583	missense	0			BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.77G>C	8.37:g.38386079C>G	ENSP00000350856:p.Arg26Thr		A4QPB7	Missense_Mutation	SNP	NULL	p.R26T	ENST00000358138.1	37	c.77	CCDS6108.1	8	.	.	.	.	.	.	.	.	.	.	C	9.181	1.023555	0.19433	.	.	ENSG00000196166	ENST00000358138;ENST00000437935	T;T	0.56611	0.49;0.45	3.98	-0.965	0.10323	.	.	.	.	.	T	0.25382	0.0617	N	0.08118	0	0.09310	N	1	P	0.41910	0.764	B	0.33295	0.161	T	0.13656	-1.0501	9	0.87932	D	0	.	7.1026	0.25346	0.0:0.428:0.0:0.572	.	26	Q6ZUL3	CH086_HUMAN	T	26	ENSP00000350856:R26T;ENSP00000389615:R26T	ENSP00000350856:R26T	R	-	2	0	C8orf86	38505236	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.050000	0.11904	-0.100000	0.12241	0.655000	0.94253	AGA	C8orf86	-	NULL	ENSG00000196166		0.557	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf86	HGNC	protein_coding	OTTHUMT00000376668.1	-	0.00	39	0	C	NM_207412		38386079	-1	tier1	-	no_errors	ENST00000358138	ensembl	human	known	74_37	missense	51.85	25	28	SNP	0.000	G
CAMK2B	816	genome.wustl.edu	37	7	44258964	44258964	+	3'UTR	DEL	G	G	-	rs13229610	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr7:44258964delG	ENST00000395749.2	-	0	2237				CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000350811.3_Intron|CAMK2B_ENST00000353625.4_3'UTR|CAMK2B_ENST00000457475.1_3'UTR|CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000440254.2_3'UTR|CAMK2B_ENST00000358707.3_3'UTR	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta						activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						ttttttttttgtttttttttA	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.*160C>-	7.37:g.44258964delG			A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	RNA	DEL	-	NULL	ENST00000395749.2	37	NULL	CCDS5483.1	7																																																																																			CAMK2B	-	-	ENSG00000058404		0.358	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	HGNC	protein_coding	OTTHUMT00000251138.2		0.00	43	0	G	NM_172084		44258964	-1	tier1		no_errors	ENST00000489429	ensembl	human	known	74_37	rna	6.82	41	3	DEL	0.011	-
CBWD6	644019	genome.wustl.edu	37	9	69238176	69238176	+	Intron	SNP	C	C	T	rs201155560		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:69238176C>T	ENST00000377457.5	-	8	768				CBWD6_ENST00000382399.4_Intron|CBWD6_ENST00000377449.1_Intron	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6								ATP binding (GO:0005524)			lung(4)	4						GAGTAAAAAACATTCTGTGTA	0.358																																																	0																																										SO:0001627	intron_variant	0				CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.662+53G>A	9.37:g.69238176C>T				RNA	SNP	-	NULL	ENST00000377457.5	37	NULL	CCDS43827.1	9	.	.	.	.	.	.	.	.	.	.	.	0.285	-0.984092	0.02180	.	.	ENSG00000204790	ENST00000377445	.	.	.	2.35	-3.22	0.05125	.	.	.	.	.	T	0.31482	0.0798	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29971	-0.9994	5	0.52906	T	0.07	.	3.5373	0.07798	0.1929:0.4168:0.0:0.3903	.	.	.	.	Y	239	.	ENSP00000366664:C239Y	C	-	2	0	CBWD6	68527996	0.055000	0.20627	0.005000	0.12908	0.212000	0.24457	-0.033000	0.12246	-1.548000	0.01712	-1.461000	0.01025	TGT	CBWD6	-	-	ENSG00000204790		0.358	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD6	HGNC	protein_coding	OTTHUMT00000143172.2	-	0.00	125	0	C	XM_928822		69238176	-1	tier1	rs201155560	no_errors	ENST00000461834	ensembl	human	known	74_37	rna	9.84	55	6	SNP	0.014	T
CCDC175	729665	genome.wustl.edu	37	14	60027867	60027867	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:60027867T>C	ENST00000537690.2	-	7	978	c.923A>G	c.(922-924)aAg>aGg	p.K308R	CCDC175_ENST00000556996.1_5'UTR|CCDC175_ENST00000281581.4_Missense_Mutation_p.K308R	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	308																	AAGGTCTTTCTTTAGCTCACT	0.303																																																	0													236.0	192.0	205.0					14																	60027867		692	1591	2283	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.923A>G	14.37:g.60027867T>C	ENSP00000453940:p.Lys308Arg		G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.K308R	ENST00000537690.2	37	c.923	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	T	5.131	0.209730	0.09757	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.49	-2.89	0.05665	.	0.520575	0.17690	N	0.165289	T	0.16557	0.0398	N	0.16656	0.425	0.09310	N	1	.	.	.	.	.	.	T	0.20009	-1.0288	6	.	.	.	-11.8552	4.4488	0.11611	0.1519:0.366:0.0:0.4821	.	.	.	.	R	308	.	.	K	-	2	0	C14orf38	59097620	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.110000	0.10824	-0.617000	0.05664	-1.145000	0.01858	AAG	CCDC175	-	superfamily_Prefoldin	ENSG00000151838		0.303	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1	-	0.00	46	0	T	NM_001164399		60027867	-1	tier1	-	no_errors	ENST00000281581	ensembl	human	known	74_37	missense	46.55	31	27	SNP	0.002	C
CDK11B	984	genome.wustl.edu	37	1	1575715	1575715	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:1575715C>T	ENST00000407249.3	-	12	1182	c.1183G>A	c.(1183-1185)Gac>Aac	p.D395N	CDK11B_ENST00000341832.6_Missense_Mutation_p.D348N|CDK11B_ENST00000340677.5_Missense_Mutation_p.D382N|CDK11B_ENST00000317673.7_Missense_Mutation_p.D393N			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	405					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						GGCACATAGTCGCCCTCTGTC	0.652																																																	0													51.0	57.0	55.0					1																	1575715		1981	4163	6144	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1183G>A	1.37:g.1575715C>T	ENSP00000464036:p.Asp395Asn		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D395N	ENST00000407249.3	37	c.1183		1																																																																																			CDK11B	-	NULL	ENSG00000248333		0.652	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		-	0.00	97	0	C	NM_001787		1575715	-1	tier1	-	no_errors	ENST00000407249	ensembl	human	known	74_37	missense	22.46	107	31	SNP	0.994	T
CLEC3A	10143	genome.wustl.edu	37	16	78062008	78062008	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:78062008G>T	ENST00000575655.1	+	2	201	c.120G>T	c.(118-120)aaG>aaT	p.K40N	RP11-281J9.2_ENST00000563114.1_RNA|CLEC3A_ENST00000299642.4_Missense_Mutation_p.K49N	NM_005752.4	NP_005743.4	O75596	CLC3A_HUMAN	C-type lectin domain family 3, member A	40					skeletal system development (GO:0001501)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	18						CCCCAGACAAGGATGGAGATC	0.438																																																	0													88.0	86.0	87.0					16																	78062008		2198	4300	6498	SO:0001583	missense	0			AF077345	CCDS10927.1, CCDS10927.2	16q23	2008-02-05	2005-02-09	2005-02-11	ENSG00000166509	ENSG00000166509		"""C-type lectin domain containing"""	2052	protein-coding gene	gene with protein product		613588	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1 (cartilage-derived)"""	CLECSF1		10524194	Standard	NM_001244755		Approved		uc002ffh.5	O75596	OTTHUMG00000137620	ENST00000575655.1:c.120G>T	16.37:g.78062008G>T	ENSP00000460682:p.Lys40Asn		B2R8C4|Q3SX91|Q6UXF5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.K49N	ENST00000575655.1	37	c.147		16	.	.	.	.	.	.	.	.	.	.	G	8.658	0.899909	0.17686	.	.	ENSG00000166509	ENST00000299642	T	0.08634	3.07	5.28	-0.178	0.13303	.	0.244803	0.46758	D	0.000268	T	0.04543	0.0124	L	0.29908	0.895	0.30937	N	0.72623	B	0.06786	0.001	B	0.04013	0.001	T	0.20338	-1.0278	10	0.46703	T	0.11	-3.3581	0.6131	0.00764	0.3466:0.1205:0.2861:0.2469	.	40	O75596	CLC3A_HUMAN	N	40	ENSP00000299642:K40N	ENSP00000299642:K40N	K	+	3	2	CLEC3A	76619509	0.974000	0.33945	0.979000	0.43373	0.305000	0.27757	0.142000	0.16096	-0.159000	0.11021	0.561000	0.74099	AAG	CLEC3A	-	NULL	ENSG00000166509		0.438	CLEC3A-201	KNOWN	basic|appris_principal	protein_coding	CLEC3A	HGNC	protein_coding		-	0.00	30	0	G	NM_005752		78062008	+1	tier1	-	no_errors	ENST00000299642	ensembl	human	known	74_37	missense	25.00	39	13	SNP	0.952	T
CLTCL1	8218	genome.wustl.edu	37	22	19220752	19220752	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr22:19220752G>T	ENST00000263200.10	-	9	1530	c.1458C>A	c.(1456-1458)agC>agA	p.S486R	CLTCL1_ENST00000353891.5_Missense_Mutation_p.S486R|CLTCL1_ENST00000427926.1_Missense_Mutation_p.S486R	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	486	Flexible linker.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GGATCACTTTGCTTGGCACAT	0.493			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													168.0	165.0	166.0					22																	19220752		1957	4160	6117	SO:0001583	missense	0				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.1458C>A	22.37:g.19220752G>T	ENSP00000445677:p.Ser486Arg		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.S486R	ENST00000263200.10	37	c.1458	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	G	14.08	2.427603	0.43122	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.22743	1.94;1.94;1.94	3.92	3.92	0.45320	Armadillo-type fold (2);	0.257041	0.39146	N	0.001455	T	0.18045	0.0433	L	0.34521	1.04	0.45995	D	0.998807	B;B	0.22746	0.074;0.073	B;B	0.26094	0.062;0.066	T	0.05835	-1.0861	10	0.20046	T	0.44	-6.2135	16.4728	0.84119	0.0:0.0:1.0:0.0	.	486;486	P53675-2;P53675	.;CLH2_HUMAN	R	486	ENSP00000439662:S486R;ENSP00000445677:S486R;ENSP00000441158:S486R	ENSP00000445677:S486R	S	-	3	2	CLTCL1	17600752	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	5.574000	0.67424	2.177000	0.69029	0.591000	0.81541	AGC	CLTCL1	-	superfamily_ARM-type_fold,pirsf_Clathrin_heavy_chain	ENSG00000070371		0.493	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	-	0.00	73	0	G	NM_007098		19220752	-1	tier1	-	no_errors	ENST00000263200	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
CNOT1	23019	genome.wustl.edu	37	16	58577404	58577404	+	Intron	SNP	T	T	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:58577404T>G	ENST00000317147.5	-	31	4767				CNOT1_ENST00000569240.1_Intron|CNOT1_ENST00000441024.2_Missense_Mutation_p.N1514T|CNOT1_ENST00000245138.4_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		atggtgattattaagaataag	0.313																																																	0													41.0	47.0	45.0					16																	58577404		1277	2285	3562	SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+106A>C	16.37:g.58577404T>G			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N1514T	ENST00000317147.5	37	c.4541	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	T	10.40	1.338935	0.24253	.	.	ENSG00000125107	ENST00000441024	T	0.45276	0.9	3.69	0.146	0.14833	.	.	.	.	.	T	0.29817	0.0745	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.27739	-1.0065	8	0.87932	D	0	.	5.8406	0.18630	0.0:0.3709:0.0:0.6291	.	1514	A5YKK6-4	.	T	1514	ENSP00000413113:N1514T	ENSP00000413113:N1514T	N	-	2	0	CNOT1	57134905	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.815000	0.04481	-0.101000	0.12219	0.477000	0.44152	AAT	CNOT1	-	NULL	ENSG00000125107		0.313	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	28	0	T	NM_016284		58577404	-1	tier1	-	no_errors	ENST00000441024	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.000	G
CSMD3	114788	genome.wustl.edu	37	8	113277777	113277777	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:113277777C>G	ENST00000297405.5	-	60	9795	c.9551G>C	c.(9550-9552)aGa>aCa	p.R3184T	CSMD3_ENST00000352409.3_Missense_Mutation_p.R3114T|CSMD3_ENST00000343508.3_Missense_Mutation_p.R3144T|CSMD3_ENST00000455883.2_Missense_Mutation_p.R3015T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3184	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATCTCCATATCTCAGTCCATT	0.423										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													197.0	165.0	176.0					8																	113277777		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9551G>C	8.37:g.113277777C>G	ENSP00000297405:p.Arg3184Thr		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R3184T	ENST00000297405.5	37	c.9551	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466393	0.84425	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	5.75	5.75	0.90469	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.81128	0.4758	M	0.85373	2.75	0.52501	D	0.999952	D;D;D	0.67145	0.995;0.996;0.971	D;D;P	0.72625	0.962;0.978;0.674	T	0.77313	-0.2634	10	0.21540	T	0.41	.	19.9273	0.97107	0.0:1.0:0.0:0.0	.	3015;3184;3144	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	T	3144;3184;2454;3015;3114	ENSP00000345799:R3144T;ENSP00000297405:R3184T;ENSP00000341558:R2454T;ENSP00000412263:R3015T;ENSP00000343124:R3114T	ENSP00000297405:R3184T	R	-	2	0	CSMD3	113346953	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.968000	0.70413	2.718000	0.92993	0.591000	0.81541	AGA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.423	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	48	0	C	NM_052900		113277777	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	44.74	42	34	SNP	1.000	G
DCAF7	10238	genome.wustl.edu	37	17	61671337	61671337	+	3'UTR	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:61671337C>T	ENST00000310827.4	+	0	6049				DCAF7_ENST00000577702.1_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						GAAGCTGCCCCTTGCAGAACT	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*4803C>T	17.37:g.61671337C>T			B4E039|D3DU14|O15491|Q9DAE4	RNA	SNP	-	NULL	ENST00000310827.4	37	NULL		17																																																																																			DCAF7	-	-	ENSG00000136485		0.358	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	HGNC	protein_coding		-	0.00	26	0	C	NM_005828		61671337	+1	tier1	-	no_errors	ENST00000577702	ensembl	human	known	74_37	rna	66.67	12	24	SNP	0.022	T
DET1	55070	genome.wustl.edu	37	15	89074851	89074851	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr15:89074851G>T	ENST00000268148.8	-	2	231	c.86C>A	c.(85-87)tCa>tAa	p.S29*	DET1_ENST00000564406.1_Nonsense_Mutation_p.S40*|DET1_ENST00000558413.1_Nonsense_Mutation_p.S29*|DET1_ENST00000559656.1_5'Flank|DET1_ENST00000444300.1_Nonsense_Mutation_p.S40*	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	29						nucleus (GO:0005634)		p.S40*(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGCCTTGCCTGAACTGATCCG	0.468																																																	1	Substitution - Nonsense(1)	lung(1)											135.0	136.0	136.0					15																	89074851		2004	4175	6179	SO:0001587	stop_gained	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.86C>A	15.37:g.89074851G>T	ENSP00000268148:p.Ser29*		B3KNN6|Q2VPC0|Q9NWD5	Nonsense_Mutation	SNP	pfam_De-etiolated_protein_1_Det1	p.S40*	ENST00000268148.8	37	c.119	CCDS45344.1	15	.	.	.	.	.	.	.	.	.	.	G	36	5.845155	0.97016	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-19.5618	19.2867	0.94077	0.0:0.0:1.0:0.0	.	.	.	.	X	40;29	.	ENSP00000268148:S29X	S	-	2	0	DET1	86875855	1.000000	0.71417	0.979000	0.43373	0.999000	0.98932	8.788000	0.91834	2.793000	0.96121	0.655000	0.94253	TCA	DET1	-	NULL	ENSG00000140543		0.468	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2		0.00	48	0	G	NM_017996		89074851	-1			no_errors	ENST00000444300	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	0.999	T
DNAH10	196385	genome.wustl.edu	37	12	124364180	124364180	+	Splice_Site	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr12:124364180G>T	ENST00000409039.3	+	49	8137		c.e49-1			NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCTGTTTCAAGGTACAACAGC	0.443																																																	0													219.0	202.0	207.0					12																	124364180		1954	4145	6099	SO:0001630	splice_region_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.8113-1G>T	12.37:g.124364180G>T			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Splice_Site	SNP	-	e49-1	ENST00000409039.3	37	c.8113-1	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928324	0.52759	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.89	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4109	0.83712	0.0:0.0:0.8673:0.1327	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH10	122930133	1.000000	0.71417	0.954000	0.39281	0.004000	0.04260	9.466000	0.97665	1.480000	0.48289	-0.181000	0.13052	.	DNAH10	-	-	ENSG00000197653		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	79	0	G		Intron	124364180	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	splice_site	5.68	83	5	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7669692	7669692	+	Missense_Mutation	SNP	C	C	T	rs138479117		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:7669692C>T	ENST00000572933.1	+	22	5028	c.3568C>T	c.(3568-3570)Cgg>Tgg	p.R1190W	DNAH2_ENST00000389173.2_Missense_Mutation_p.R1190W			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1190	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TACACAAGTGCGGGCCATGCT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		18756	0.001		0.0	False		,,,				2504	0.0																0								C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	116.0	94.0	102.0		3568	4.7	1.0	17	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH2	NM_020877.2	101	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	1190/4428	7669692	2,13004	2203	4300	6503	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3568C>T	17.37:g.7669692C>T	ENSP00000458355:p.Arg1190Trp		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1190W	ENST00000572933.1	37	c.3568	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646550	0.47258	2.27E-4	1.16E-4	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.24350	1.86	5.71	4.71	0.59529	.	0.159592	0.40469	N	0.001081	T	0.25901	0.0631	L	0.56769	1.78	0.80722	D	1	B	0.26775	0.159	B	0.18561	0.022	T	0.04870	-1.0921	10	0.62326	D	0.03	.	11.8875	0.52610	0.3388:0.6612:0.0:0.0	.	1190	Q9P225	DYH2_HUMAN	W	1190	ENSP00000373825:R1190W	ENSP00000353818:R1190W	R	+	1	2	DNAH2	7610417	0.997000	0.39634	0.961000	0.40146	0.756000	0.42949	1.680000	0.37607	1.337000	0.45525	0.561000	0.74099	CGG	DNAH2	-	NULL	ENSG00000183914		0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	-	0.00	21	0	C	NM_020877		7669692	+1	tier1	rs138479117	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	55.81	19	24	SNP	0.998	T
DOCK6	57572	genome.wustl.edu	37	19	11354034	11354034	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:11354034C>T	ENST00000294618.7	-	12	1297	c.1286G>A	c.(1285-1287)cGc>cAc	p.R429H		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	429					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CCCCCGACGGCGGCGGTCTGT	0.627											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													10.0	13.0	12.0					19																	11354034		1869	4084	5953	SO:0001583	missense	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1286G>A	19.37:g.11354034C>T	ENSP00000294618:p.Arg429His	671	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N	p.R429H	ENST00000294618.7	37	c.1286	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336389	0.81801	.	.	ENSG00000130158	ENST00000294618	T	0.41400	1.0	3.63	3.63	0.41609	.	0.068167	0.52532	D	0.000072	T	0.48484	0.1502	L	0.54323	1.7	0.80722	D	1	D	0.59357	0.985	P	0.52514	0.701	T	0.52034	-0.8629	10	0.52906	T	0.07	-23.9778	12.8412	0.57805	0.0:1.0:0.0:0.0	.	429	Q96HP0	DOCK6_HUMAN	H	429	ENSP00000294618:R429H	ENSP00000294618:R429H	R	-	2	0	DOCK6	11215034	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.880000	0.48530	1.861000	0.53984	0.462000	0.41574	CGC	DOCK6	-	NULL	ENSG00000130158		0.627	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	-	0.00	56	0	C	NM_020812		11354034	-1	tier1	-	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	20.73	65	17	SNP	1.000	T
DSN1	79980	genome.wustl.edu	37	20	35396375	35396375	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr20:35396375G>T	ENST00000426836.1	-	4	798	c.426C>A	c.(424-426)ttC>ttA	p.F142L	DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000448110.2_Missense_Mutation_p.F126L|DSN1_ENST00000373734.4_Missense_Mutation_p.F35L|DSN1_ENST00000373740.3_Missense_Mutation_p.F70L|DSN1_ENST00000373750.4_Missense_Mutation_p.F142L|DSN1_ENST00000373745.3_Missense_Mutation_p.F142L	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	142				F -> S (in Ref. 1; BAC04024). {ECO:0000305}.	chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				ACCTTACCTGGAAACTGGAAA	0.418																																																	0													110.0	106.0	108.0					20																	35396375		2203	4300	6503	SO:0001583	missense	0			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.426C>A	20.37:g.35396375G>T	ENSP00000389810:p.Phe142Leu		B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Missense_Mutation	SNP	pfam_Dsn1/Mis13	p.F142L	ENST00000426836.1	37	c.426	CCDS13286.1	20	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099465	0.56183	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734;ENST00000449595;ENST00000447406;ENST00000438549	.	.	.	5.38	2.25	0.28309	.	0.210135	0.45361	D	0.000375	T	0.41834	0.1176	N	0.24115	0.695	0.29803	N	0.832261	D;D	0.76494	0.999;0.999	D;D	0.83275	0.992;0.996	T	0.26087	-1.0113	9	0.25106	T	0.35	-4.994	6.1936	0.20538	0.3099:0.0:0.6901:0.0	.	35;142	Q5JW55;Q9H410	.;DSN1_HUMAN	L	142;142;126;75;142;70;35;126;142;42	.	ENSP00000362838:F75L	F	-	3	2	DSN1	34829789	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	0.788000	0.26872	0.865000	0.35603	-0.136000	0.14681	TTC	DSN1	-	pfam_Dsn1/Mis13	ENSG00000149636		0.418	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	HGNC	protein_coding	OTTHUMT00000079043.2	-	0.00	21	0	G	NM_024918		35396375	-1	tier1	-	no_errors	ENST00000373745	ensembl	human	known	74_37	missense	67.65	11	23	SNP	1.000	T
DTNA	1837	genome.wustl.edu	37	18	32470965	32470965	+	3'UTR	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr18:32470965G>A	ENST00000444659.1	+	0	5500				DTNA_ENST00000399097.3_3'UTR|DTNA_ENST00000598334.1_3'UTR|DTNA_ENST00000269190.7_3'UTR|DTNA_ENST00000283365.9_3'UTR|DTNA_ENST00000399121.5_3'UTR|DTNA_ENST00000595022.1_3'UTR|DTNA_ENST00000592449.1_3'UTR	NM_001390.4	NP_001381.2	Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha						neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CCCTTGGTTCGATTCCACGCA	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000444659.1:c.*3267G>A	18.37:g.32470965G>A			A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	RNA	SNP	-	NULL	ENST00000444659.1	37	NULL		18																																																																																			DTNA	-	-	ENSG00000134769		0.403	DTNA-205	KNOWN	basic|appris_candidate_longest	protein_coding	DTNA	HGNC	protein_coding		-	0.00	44	0	G	NM_001390		32470965	+1	tier1	-	no_errors	ENST00000592449	ensembl	human	known	74_37	rna	37.21	27	16	SNP	0.693	A
ENPP1	5167	genome.wustl.edu	37	6	132190498	132190498	+	Splice_Site	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:132190498G>T	ENST00000360971.2	+	13	1294	c.1274G>T	c.(1273-1275)gGc>gTc	p.G425V		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	425	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TTTCTCCTAGGCATGGAACAA	0.318																																					Colon(104;336 1535 5856 11019 33782)												0													35.0	39.0	37.0					6																	132190498		2200	4296	6496	SO:0001630	splice_region_variant	0			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1274-1G>T	6.37:g.132190498G>T			Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.G425V	ENST00000360971.2	37	c.1274	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415533	0.83449	.	.	ENSG00000197594	ENST00000360971	D	0.98028	-4.67	5.29	5.29	0.74685	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.98333	1.0534	9	.	.	.	.	19.2877	0.94085	0.0:0.0:1.0:0.0	.	425;55	P22413;Q7Z3P5	ENPP1_HUMAN;.	V	425	ENSP00000354238:G425V	.	G	+	2	0	ENPP1	132232191	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.608000	0.90895	2.619000	0.88677	0.655000	0.94253	GGC	ENPP1	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000197594		0.318	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	HGNC	protein_coding	OTTHUMT00000042238.2	-	0.00	32	0	G		Missense_Mutation	132190498	+1	tier1	-	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
LILRB1	10859	genome.wustl.edu	37	19	55147381	55147381	+	Intron	SNP	A	A	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:55147381A>G	ENST00000396331.1	+	14	2007				LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000448689.1_Intron|AC009892.10_ENST00000456337.1_Silent_p.L64L|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000396317.1_Intron	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		ttcaaccagcaagtgttccca	0.612										HNSCC(37;0.09)																																							0																																										SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1650+321A>G	19.37:g.55147381A>G			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	NULL	p.L64	ENST00000396331.1	37	c.192	CCDS42617.1	19																																																																																			AC009892.10	-	NULL	ENSG00000224730		0.612	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000224730	Clone_based_vega_gene	protein_coding	OTTHUMT00000140796.4		0.00	35	0	A			55147381	-1			no_errors	ENST00000456337	ensembl	human	putative	74_37	silent	11.32	47	6	SNP	0.001	G
SRGAP2-AS1	100873165	genome.wustl.edu	37	1	121138853	121138853	+	lincRNA	SNP	G	G	A	rs184767318		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:121138853G>A	ENST00000417218.1	+	0	240				RP11-343N15.1_ENST00000437515.1_lincRNA																							GCCGAGGGGTGCTCCTGGTCC	0.692																																																	0																																												0																															1.37:g.121138853G>A				RNA	SNP	-	NULL	ENST00000417218.1	37	NULL		1																																																																																			AL592494.5	-	-	ENSG00000227082		0.692	AL592494.5-001	KNOWN	basic	lincRNA	ENSG00000227082	Clone_based_vega_gene	lincRNA	OTTHUMT00000036739.1	-	0.00	14	0	G			121138853	+1	tier1	rs184767318	no_errors	ENST00000417218	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.951	A
IRF2BP2	359948	genome.wustl.edu	37	1	234742800	234742801	+	3'UTR	DEL	AT	AT	-	rs142351268		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:234742800_234742801delAT	ENST00000366609.3	-	0	1876_1877				IRF2BP2_ENST00000366610.3_3'UTR|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CTTGTCTTGGATATATATATAT	0.287																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.*83AT>-	1.37:g.234742810_234742811delAT			B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	RNA	DEL	-	NULL	ENST00000366609.3	37	NULL	CCDS1602.1	1																																																																																			RP4-781K5.2	-	-	ENSG00000228830		0.287	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	ENSG00000228830	Clone_based_vega_gene	protein_coding	OTTHUMT00000092705.1		0.00	14	0	AT	NM_182972		234742801	+1	tier1		no_errors	ENST00000436039	ensembl	human	known	74_37	rna	12.00	22	3	DEL	1.000:1.000	-
RGS12	6002	genome.wustl.edu	37	4	3314644	3314644	+	5'Flank	DEL	A	A	-	rs76913216		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:3314644delA	ENST00000344733.5	+	0	0				RGS12_ENST00000336727.3_5'Flank|RGS12_ENST00000543385.1_Intron|RP11-357G3.2_ENST00000600073.1_RNA	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12						positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGTTTTCTCCAAAAAAAAAAA	0.433																																																	0																																										SO:0001631	upstream_gene_variant	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277		4.37:g.3314644delA	Exception_encountered		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	RNA	DEL	-	NULL	ENST00000344733.5	37	NULL	CCDS3366.1	4																																																																																			RP11-357G3.2	-	-	ENSG00000248840		0.433	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000248840	Clone_based_vega_gene	protein_coding	OTTHUMT00000206602.1		0.00	14	0	A	NM_002926		3314644	+1	tier1		no_errors	ENST00000600073	ensembl	human	known	74_37	rna	29.41	12	5	DEL	0.004	-
WASH6P	653440	genome.wustl.edu	37	X	155255241	155255243	+	RNA	DEL	GGG	GGG	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	GGG	GGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrX:155255241_155255243delGGG	ENST00000461007.1	+	0	4157_4159				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGTGCTCCATGGGGGGACGGCTC	0.581																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155255244_155255246delGGG			A6NGF1|Q8N305	RNA	DEL	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			AJ271736.10	-	-	ENSG00000270726		0.581	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	Clone_based_vega_gene	pseudogene	OTTHUMT00000058840.1		0.00	34	0	GGG	NG_008380		155255243	+1	tier1		no_errors	ENST00000285718	ensembl	human	known	74_37	rna	20.59	27	7	DEL	0.008:0.010:0.011	-
EPG5	57724	genome.wustl.edu	37	18	43435519	43435519	+	Intron	SNP	C	C	G	rs563721463	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr18:43435519C>G	ENST00000282041.5	-	43	7592				EPG5_ENST00000585906.1_5'Flank	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)						autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ACTTCTAACCCTTCATTGTAT	0.512																																																	0													39.0	42.0	41.0					18																	43435519		1993	4177	6170	SO:0001627	intron_variant	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7557+18G>C	18.37:g.43435519C>G			A2BDF3|Q9H8C8	RNA	SNP	-	NULL	ENST00000282041.5	37	NULL	CCDS11926.2	18																																																																																			EPG5	-	-	ENSG00000152223		0.512	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	-	0.00	15	0	C	NM_020964		43435519	-1	tier1	-	no_errors	ENST00000587262	ensembl	human	known	74_37	rna	53.33	7	8	SNP	0.000	G
EXOC8	149371	genome.wustl.edu	37	1	231472386	231472386	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:231472386T>C	ENST00000360394.2	-	1	1192	c.1106A>G	c.(1105-1107)gAt>gGt	p.D369G	SPRTN_ENST00000008440.9_5'Flank|SPRTN_ENST00000295050.7_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.D365G|SPRTN_ENST00000391858.4_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	369					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				GCTAGGTTTATCTTCCAGGTA	0.502																																																	0													66.0	70.0	69.0					1																	231472386		2203	4300	6503	SO:0001583	missense	0			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1106A>G	1.37:g.231472386T>C	ENSP00000353564:p.Asp369Gly		B3KU33|Q5TE82	Missense_Mutation	SNP	superfamily_Cullin_repeat-like_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D369G	ENST00000360394.2	37	c.1106	CCDS1593.1	1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.731066	0.30684	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.77750	-1.12;-1.12	5.16	4.01	0.46588	Cullin repeat-like-containing domain (1);	0.166473	0.51477	D	0.000092	T	0.65585	0.2705	L	0.36672	1.1	0.54753	D	0.999989	B	0.02656	0.0	B	0.01281	0.0	T	0.59595	-0.7425	10	0.19147	T	0.46	-18.1005	11.1481	0.48442	0.0:0.0826:0.0:0.9174	.	369	Q8IYI6	EXOC8_HUMAN	G	369;365	ENSP00000353564:D369G;ENSP00000355605:D365G	ENSP00000353564:D369G	D	-	2	0	EXOC8	229539009	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.062000	0.57492	2.148000	0.66965	0.533000	0.62120	GAT	EXOC8	-	superfamily_Cullin_repeat-like_dom	ENSG00000116903		0.502	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOC8	HGNC	protein_coding		-	0.00	18	0	T	NM_175876		231472386	-1	tier1	-	no_errors	ENST00000360394	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	C
FAM171B	165215	genome.wustl.edu	37	2	187615950	187615950	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:187615950C>G	ENST00000304698.5	+	5	1017	c.814C>G	c.(814-816)Caa>Gaa	p.Q272E		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	272						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TGGCTCTATTCAAGTTTCTCT	0.368																																																	0													109.0	116.0	113.0					2																	187615950		2203	4300	6503	SO:0001583	missense	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.814C>G	2.37:g.187615950C>G	ENSP00000304108:p.Gln272Glu		Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.Q272E	ENST00000304698.5	37	c.814	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489456	0.44249	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.30448	1.53	5.53	5.53	0.82687	.	0.053388	0.85682	D	0.000000	T	0.32466	0.0830	L	0.50333	1.59	0.51233	D	0.999916	B;B	0.10296	0.003;0.003	B;B	0.10450	0.005;0.005	T	0.03933	-1.0991	10	0.41790	T	0.15	-7.5437	17.6355	0.88121	0.0:1.0:0.0:0.0	.	272;273	Q6P995;A8K122	F171B_HUMAN;.	E	272	ENSP00000304108:Q272E	ENSP00000272804:Q272E	Q	+	1	0	FAM171B	187324195	1.000000	0.71417	0.904000	0.35570	0.753000	0.42808	4.535000	0.60629	2.611000	0.88343	0.609000	0.83330	CAA	FAM171B	-	pfam_Uncharacterised_FAM171	ENSG00000144369		0.368	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	-	0.00	65	0	C	NM_177454		187615950	+1	tier1	-	no_errors	ENST00000304698	ensembl	human	known	74_37	missense	13.85	112	18	SNP	1.000	G
FAM184A	79632	genome.wustl.edu	37	6	119288068	119288068	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:119288068C>G	ENST00000338891.7	-	15	3408	c.2965G>C	c.(2965-2967)Gat>Cat	p.D989H	FAM184A_ENST00000521531.1_Missense_Mutation_p.D940H|FAM184A_ENST00000352896.5_Missense_Mutation_p.D820H|FAM184A_ENST00000368475.4_Missense_Mutation_p.D820H|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	989						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						ATCTGTATATCTTCTGGTTTT	0.299																																																	0													134.0	122.0	125.0					6																	119288068		1797	4065	5862	SO:0001583	missense	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2965G>C	6.37:g.119288068C>G	ENSP00000342604:p.Asp989His		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	superfamily_Prefoldin	p.D989H	ENST00000338891.7	37	c.2965	CCDS43499.1	6	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671518	0.88348	.	.	ENSG00000111879	ENST00000521043;ENST00000338891;ENST00000352896;ENST00000368475;ENST00000368472;ENST00000521531	T;T;T;T;T	0.76316	0.18;0.52;1.06;-1.01;0.86	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.87931	0.6302	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87757	0.2596	10	0.87932	D	0	-24.5243	20.5373	0.99239	0.0:1.0:0.0:0.0	.	940;820;989	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	H	152;989;820;820;50;940	ENSP00000342604:D989H;ENSP00000326608:D820H;ENSP00000357460:D820H;ENSP00000357457:D50H;ENSP00000430442:D940H	ENSP00000342604:D989H	D	-	1	0	FAM184A	119329767	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.818000	0.75257	2.857000	0.98124	0.650000	0.86243	GAT	FAM184A	-	NULL	ENSG00000111879		0.299	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3	-	0.00	45	0	C	NM_024581		119288068	-1	tier1	-	no_errors	ENST00000338891	ensembl	human	known	74_37	missense	41.43	41	29	SNP	1.000	G
FBXW7	55294	genome.wustl.edu	37	4	153247289	153247289	+	Missense_Mutation	SNP	G	G	C	rs149680468		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:153247289G>C	ENST00000281708.4	-	10	2742	c.1513C>G	c.(1513-1515)Cgc>Ggc	p.R505G	FBXW7_ENST00000603841.1_Missense_Mutation_p.R505G|FBXW7_ENST00000603548.1_Missense_Mutation_p.R505G|FBXW7_ENST00000296555.5_Missense_Mutation_p.R387G|FBXW7_ENST00000393956.3_Missense_Mutation_p.R329G|FBXW7_ENST00000263981.5_Missense_Mutation_p.R425G	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	505			R -> L (in an ovarian cancer cell line). {ECO:0000269|PubMed:11565033, ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R505C(60)|p.R505G(18)|p.R425C(14)|p.R266C(13)|p.R425G(9)|p.R266G(9)|p.R387G(6)|p.R387C(3)|p.R505S(3)|p.R387S(1)|p.?(1)|p.R425S(1)|p.R266S(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGAACACAGCGGACTGCTGCA	0.468			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	139	Substitution - Missense(138)|Unknown(1)	haematopoietic_and_lymphoid_tissue(44)|large_intestine(26)|endometrium(20)|urinary_tract(15)|lung(15)|upper_aerodigestive_tract(8)|skin(8)|ovary(2)|biliary_tract(1)											167.0	156.0	160.0					4																	153247289		2203	4300	6503	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1513C>G	4.37:g.153247289G>C	ENSP00000281708:p.Arg505Gly		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R505G	ENST00000281708.4	37	c.1513	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513685	0.64522	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.72	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.101576	0.64402	D	0.000001	T	0.78679	0.4321	M	0.75085	2.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81858	-0.0739	10	0.87932	D	0	-12.0024	15.0746	0.72066	0.0681:0.0:0.9319:0.0	.	329;505;387;425	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	G	505;387;425;329	ENSP00000281708:R505G;ENSP00000296555:R387G;ENSP00000263981:R425G;ENSP00000377528:R329G	ENSP00000263981:R425G	R	-	1	0	FBXW7	153466739	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	9.772000	0.98984	1.559000	0.49555	-0.145000	0.13849	CGC	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.468	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	-	0.00	45	0	G			153247289	-1	tier1	-	no_errors	ENST00000281708	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	C
FKBP4	2288	genome.wustl.edu	37	12	2909017	2909017	+	Splice_Site	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr12:2909017T>C	ENST00000001008.4	+	6	860	c.673T>C	c.(673-675)Tat>Cat	p.Y225H	RP4-816N1.6_ENST00000547834.1_RNA|RP4-816N1.7_ENST00000547042.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	225	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CCCCTCCAGCTATGCTTTTGG	0.433																																																	0													104.0	109.0	107.0					12																	2909017		2203	4300	6503	SO:0001630	splice_region_variant	0			M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.672-1T>C	12.37:g.2909017T>C			D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.Y225H	ENST00000001008.4	37	c.673	CCDS8512.1	12	.	.	.	.	.	.	.	.	.	.	T	19.25	3.792249	0.70452	.	.	ENSG00000004478	ENST00000001008	D	0.85861	-2.04	5.38	4.24	0.50183	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.121009	0.64402	D	0.000016	D	0.91307	0.7259	M	0.85373	2.75	0.80722	D	1	D	0.55605	0.972	D	0.63703	0.917	D	0.90808	0.4699	10	0.56958	D	0.05	-12.2745	10.1696	0.42902	0.0:0.0789:0.0:0.9211	.	225	Q02790	FKBP4_HUMAN	H	225	ENSP00000001008:Y225H	ENSP00000001008:Y225H	Y	+	1	0	FKBP4	2779278	1.000000	0.71417	0.997000	0.53966	0.717000	0.41224	5.388000	0.66249	0.893000	0.36288	0.459000	0.35465	TAT	FKBP4	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000004478		0.433	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP4	HGNC	protein_coding	OTTHUMT00000206861.1	-	0.00	26	0	T		Missense_Mutation	2909017	+1	tier1	-	no_errors	ENST00000001008	ensembl	human	known	74_37	missense	15.00	34	6	SNP	1.000	C
FSIP2	401024	genome.wustl.edu	37	2	186664649	186664649	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:186664649T>C	ENST00000424728.1	+	17	10616	c.10616T>C	c.(10615-10617)aTt>aCt	p.I3539T	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.I3628T|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3539										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AGCAAGATTATTTCAATTCAT	0.308																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.10616T>C	2.37:g.186664649T>C	ENSP00000401306:p.Ile3539Thr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.I3628T	ENST00000424728.1	37	c.10883		2	.	.	.	.	.	.	.	.	.	.	T	12.72	2.023885	0.35701	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.55413	0.52;0.52	5.32	5.32	0.75619	.	0.104953	0.42821	D	0.000655	T	0.60130	0.2245	M	0.61703	1.905	0.25483	N	0.987712	.	.	.	.	.	.	T	0.59653	-0.7414	8	0.87932	D	0	.	11.6113	0.51062	0.0:0.0:0.0:1.0	.	.	.	.	T	3628;3539	ENSP00000344403:I3628T;ENSP00000401306:I3539T	ENSP00000344403:I3628T	I	+	2	0	FSIP2	186372894	0.998000	0.40836	0.975000	0.42487	0.491000	0.33493	3.395000	0.52558	2.233000	0.73108	0.455000	0.32223	ATT	FSIP2	-	NULL	ENSG00000188738		0.308	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	38	0	T	NM_173651		186664649	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	14.63	70	12	SNP	0.997	C
GNPTG	84572	genome.wustl.edu	37	16	1402138	1402138	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:1402138G>A	ENST00000204679.4	+	2	131	c.88G>A	c.(88-90)Gtg>Atg	p.V30M	TSR3_ENST00000007390.2_5'Flank	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit	30					carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				GATGAAGGTGGTGGAGGAGCC	0.756																																																	0													7.0	6.0	6.0					16																	1402138		2126	4161	6287	SO:0001583	missense	0			BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835	ENST00000204679.4:c.88G>A	16.37:g.1402138G>A	ENSP00000204679:p.Val30Met		B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.V30M	ENST00000204679.4	37	c.88	CCDS10436.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.0|27.0	4.792120|4.792120	0.90453|0.90453	.|.	.|.	ENSG00000090581|ENSG00000090581	ENST00000529110|ENST00000204679	.|D	.|0.93307	.|-3.2	4.34|4.34	3.39|3.39	0.38822|0.38822	.|.	.|0.077938	.|0.50627	.|N	.|0.000106	D|D	0.94827|0.94827	0.8329|0.8329	L|L	0.54323|0.54323	1.7|1.7	0.45567|0.45567	D|D	0.998511|0.998511	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.94101|0.94101	0.7362|0.7362	5|10	.|0.87932	.|D	.|0	.|.	10.0399|10.0399	0.42151|0.42151	0.1024:0.0:0.8976:0.0|0.1024:0.0:0.8976:0.0	.|.	.|30	.|Q9UJJ9	.|GNPTG_HUMAN	D|M	52|30	.|ENSP00000204679:V30M	.|ENSP00000204679:V30M	G|V	+|+	2|1	0|0	GNPTG|GNPTG	1342139|1342139	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.170000|4.170000	0.58229|0.58229	0.804000|0.804000	0.34136|0.34136	0.561000|0.561000	0.74099|0.74099	GGT|GTG	GNPTG	-	NULL	ENSG00000090581		0.756	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTG	HGNC	protein_coding	OTTHUMT00000109058.2	-	0.00	18	0	G	NM_032520		1402138	+1	tier1	-	no_errors	ENST00000204679	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	A
GPR84	53831	genome.wustl.edu	37	12	54757553	54757553	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr12:54757553A>C	ENST00000551809.1	-	1	718	c.83T>G	c.(82-84)gTg>gGg	p.V28G	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.V28G			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V28G(1)		NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AGCCACCACCACCCCCCAGCT	0.567																																																	1	Substitution - Missense(1)	large_intestine(1)											124.0	98.0	107.0					12																	54757553		2203	4300	6503	SO:0001583	missense	0			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.83T>G	12.37:g.54757553A>C	ENSP00000450310:p.Val28Gly		B6V9G7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V28G	ENST00000551809.1	37	c.83	CCDS8878.1	12	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550790	0.27739	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.37235	1.21;1.21	4.81	3.65	0.41850	.	0.771724	0.11153	N	0.593925	T	0.25531	0.0621	N	0.24115	0.695	0.22500	N	0.999047	B	0.02656	0.0	B	0.01281	0.0	T	0.18241	-1.0343	10	0.33141	T	0.24	-1.0996	10.4225	0.44359	0.8356:0.1644:0.0:0.0	.	28	Q9NQS5	GPR84_HUMAN	G	28	ENSP00000267015:V28G;ENSP00000450310:V28G	ENSP00000267015:V28G	V	-	2	0	GPR84	53043820	0.002000	0.14202	0.064000	0.19789	0.977000	0.68977	1.744000	0.38268	0.908000	0.36671	0.454000	0.30748	GTG	GPR84	-	prints_GPCR_Rhodpsn	ENSG00000139572		0.567	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR84	HGNC	protein_coding	OTTHUMT00000406156.1	-	0.00	48	0	A			54757553	-1	tier1	-	no_errors	ENST00000267015	ensembl	human	known	74_37	missense	72.34	13	34	SNP	0.003	C
GRID2	2895	genome.wustl.edu	37	4	93225753	93225753	+	5'UTR	DEL	A	A	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:93225753delA	ENST00000282020.4	+	0	204				RP11-9B6.1_ENST00000504213.1_5'Flank|GRID2_ENST00000510992.1_5'Flank|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGACTGTTTGAAAAAAAAAAA	0.423																																																	0													93.0	89.0	90.0					4																	93225753		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.-55A>-	4.37:g.93225753delA			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	RNA	DEL	-	NULL	ENST00000282020.4	37	NULL	CCDS3637.1	4																																																																																			GRID2	-	-	ENSG00000152208		0.423	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2		0.00	40	0	A			93225753	+1	tier1		no_errors	ENST00000505687	ensembl	human	known	74_37	rna	9.09	50	5	DEL	0.000	-
GRXCR1	389207	genome.wustl.edu	37	4	43032468	43032468	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:43032468C>T	ENST00000399770.2	+	4	784	c.784C>T	c.(784-786)Cga>Tga	p.R262*		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	262					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.R262*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						GTCCATGTTTCGAAACTGCTT	0.473																																																	1	Substitution - Nonsense(1)	large_intestine(1)											174.0	164.0	167.0					4																	43032468		1945	4152	6097	SO:0001587	stop_gained	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.784C>T	4.37:g.43032468C>T	ENSP00000382670:p.Arg262*			Nonsense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.R262*	ENST00000399770.2	37	c.784	CCDS43225.1	4	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728299	0.89390	.	.	ENSG00000215203	ENST00000399770	.	.	.	5.64	5.64	0.86602	.	0.282108	0.28983	U	0.013518	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3762	18.6692	0.91504	0.0:1.0:0.0:0.0	.	.	.	.	X	262	.	ENSP00000382670:R262X	R	+	1	2	GRXCR1	42727225	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.588000	0.67517	2.649000	0.89929	0.579000	0.79373	CGA	GRXCR1	-	superfamily_HSP_DnaJ_Cys-rich_dom	ENSG00000215203		0.473	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1	-	0.00	51	0	C	NM_001080476		43032468	+1	tier1	-	no_errors	ENST00000399770	ensembl	human	known	74_37	nonsense	11.45	147	19	SNP	1.000	T
HDAC5	10014	genome.wustl.edu	37	17	42162043	42162043	+	Splice_Site	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:42162043G>T	ENST00000393622.2	-	16	2516	c.2185C>A	c.(2185-2187)Cgg>Agg	p.R729R	HDAC5_ENST00000336057.5_Intron|HDAC5_ENST00000225983.6_Splice_Site_p.R730R|HDAC5_ENST00000586802.1_Splice_Site_p.R729R	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	729	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		CCTCGGATCCGCTGCCAGGAG	0.587											OREG0024450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													142.0	118.0	126.0					17																	42162043		2203	4300	6503	SO:0001630	splice_region_variant	0			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2185-1C>A	17.37:g.42162043G>T		906	C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.R730	ENST00000393622.2	37	c.2188	CCDS45696.1	17																																																																																			HDAC5	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000108840		0.587	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1		0.00	29	0	G	NM_001015053	Silent	42162043	-1			no_errors	ENST00000225983	ensembl	human	known	74_37	silent	7.32	38	3	SNP	1.000	T
HECW2	57520	genome.wustl.edu	37	2	197184302	197184302	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:197184302C>A	ENST00000260983.3	-	9	1494	c.1312G>T	c.(1312-1314)Gag>Tag	p.E438*	HECW2_ENST00000409111.1_Nonsense_Mutation_p.E82*	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	438					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ATGGACCTCTCAGAGCAGGTC	0.502																																																	0													54.0	55.0	54.0					2																	197184302		2203	4300	6503	SO:0001587	stop_gained	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1312G>T	2.37:g.197184302C>A	ENSP00000260983:p.Glu438*		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.E438*	ENST00000260983.3	37	c.1312	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.125645	0.94429	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	.	.	.	5.64	4.75	0.60458	.	0.885835	0.10160	N	0.708386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	14.4253	0.67212	0.1475:0.8525:0.0:0.0	.	.	.	.	X	82;438	.	ENSP00000260983:E438X	E	-	1	0	HECW2	196892547	1.000000	0.71417	0.725000	0.30721	0.026000	0.11368	4.832000	0.62759	1.603000	0.50134	-0.188000	0.12872	GAG	HECW2	-	NULL	ENSG00000138411		0.502	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3		0.00	19	0	C	NM_020760		197184302	-1			no_errors	ENST00000260983	ensembl	human	known	74_37	nonsense	9.09	40	4	SNP	0.957	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29977358	29977359	+	RNA	DNP	TG	TG	CA	rs367861986|rs3831361|rs370297731	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:29977358_29977359TG>CA	ENST00000376797.3	-	0	731				ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|HLA-J_ENST00000462773.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		GATTTGTTCATGCCTTCCCTTT	0.45																																																	0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109	Exception_encountered	6.37:g.29977358_29977359delinsCA				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.450	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1		0.00	29	0	T|G	NR_026751		29977358|29977359	+1			no_errors	ENST00000462773	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.000	C|A
HYPK	25764	genome.wustl.edu	37	15	44092665	44092665	+	5'UTR	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr15:44092665G>A	ENST00000442995.2	+	0	45				HYPK_ENST00000406925.1_Intron|SERF2_ENST00000594896.1_Intron|HYPK_ENST00000498605.1_3'UTR|HYPK_ENST00000458412.1_5'Flank|RP11-296A16.1_ENST00000417761.2_5'Flank|SERINC4_ENST00000319327.6_5'Flank|SERINC4_ENST00000299969.6_5'Flank|SERINC4_ENST00000249714.3_5'Flank|SERF2_ENST00000600633.1_5'UTR			Q9NX55	HYPK_HUMAN	huntingtin interacting protein K							cytoplasm (GO:0005737)|nucleus (GO:0005634)							all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;8.1e-07)		AAGGAAGTCTGAGAGACGAAC	0.597											OREG0003941|OREG0003945	type=REGULATORY REGION|Gene=BC019262|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=BX647438|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0																																										SO:0001623	5_prime_UTR_variant	0			AF049613	CCDS10104.1	15q14	2012-10-08	2012-10-08	2012-10-08	ENSG00000242028	ENSG00000242028			18418	protein-coding gene	gene with protein product	"""Huntingtin yeast partner K"""	612784	"""chromosome 15 open reading frame 63"""	C15orf63		9700202, 20154145	Standard	NM_016400		Approved	HSPC136, FLJ20431	uc001ztf.3	Q9NX55	OTTHUMG00000060146	ENST00000442995.2:c.-132G>A	15.37:g.44092665G>A		921	C9JKJ0|O75408|Q8WUW8|Q9P024	RNA	SNP	-	NULL	ENST00000442995.2	37	NULL	CCDS10104.1	15																																																																																			HYPK	-	-	ENSG00000242028		0.597	HYPK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HYPK	HGNC	protein_coding	OTTHUMT00000133492.3	-	0.00	23	0	G	NM_016400		44092665	+1	tier1	-	no_errors	ENST00000498605	ensembl	human	known	74_37	rna	20.00	28	7	SNP	0.000	A
IGF2	3481	genome.wustl.edu	37	11	2161524	2161524	+	Intron	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:2161524C>G	ENST00000381389.1	-	1	160				IGF2-AS_ENST00000381361.3_RNA|IGF2_ENST00000416167.2_5'Flank|IGF2_ENST00000300632.5_Intron|IGF2_ENST00000434045.2_Start_Codon_SNP_p.M1I|IGF2-AS_ENST00000381363.4_RNA|IGF2-AS_ENST00000445504.2_RNA|IGF2_ENST00000418738.2_5'Flank|IGF2_ENST00000381406.4_5'Flank			P01344	IGF2_HUMAN	insulin-like growth factor 2						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)			central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		CTGGGGAAACCATCTCCTGGA	0.537																																																	0													27.0	29.0	29.0					11																	2161524		1567	3581	5148	SO:0001627	intron_variant	0			M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000381389.1:c.5+562G>C	11.37:g.2161524C>G			B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Missense_Mutation	SNP	pfam_IGF2_C,pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_IGF2,prints_Insulin_family,prints_Insulin-like_growth_factor	p.M1I	ENST00000381389.1	37	c.3	CCDS7728.1	11	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389735	0.42410	.	.	ENSG00000167244	ENST00000434045	D	0.91792	-2.91	1.94	0.971	0.19698	.	.	.	.	.	D	0.85712	0.5760	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.78414	-0.2213	8	0.87932	D	0	.	3.8218	0.08839	0.0:0.7549:0.0:0.2451	.	1	C9JAF2	.	I	1	ENSP00000391826:M1I	ENSP00000391826:M1I	M	-	3	0	IGF2	2118100	0.927000	0.31430	0.996000	0.52242	0.991000	0.79684	0.064000	0.14437	0.352000	0.24053	0.484000	0.47621	ATG	IGF2	-	NULL	ENSG00000167244		0.537	IGF2-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate|CCDS	protein_coding	IGF2	HGNC	protein_coding	OTTHUMT00000026386.1	-	0.00	76	0	C	NM_000612		2161524	-1	tier1	-	no_errors	ENST00000434045	ensembl	human	known	74_37	missense	50.00	29	29	SNP	0.998	G
INTS8	55656	genome.wustl.edu	37	8	95841223	95841223	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:95841223delA	ENST00000523731.1	+	5	672	c.539delA	c.(538-540)gaafs	p.E180fs	INTS8_ENST00000447247.1_Frame_Shift_Del_p.E180fs	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	180					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					ATGCAACAGGAAAAAGAGCTA	0.323																																																	0													111.0	105.0	107.0					8																	95841223		2202	4300	6502	SO:0001589	frameshift_variant	0			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.539delA	8.37:g.95841223delA	ENSP00000430338:p.Glu180fs		B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Frame_Shift_Del	DEL	NULL	p.E182fs	ENST00000523731.1	37	c.539	CCDS34925.1	8																																																																																			INTS8	-	NULL	ENSG00000164941		0.323	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS8	HGNC	protein_coding	OTTHUMT00000379794.1		0.00	34	0	A	NM_017864		95841223	+1	tier1		no_errors	ENST00000523731	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
KCNH4	23415	genome.wustl.edu	37	17	40321669	40321669	+	Silent	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:40321669C>G	ENST00000264661.3	-	9	1748	c.1416G>C	c.(1414-1416)ggG>ggC	p.G472G	KCNH4_ENST00000607371.1_Silent_p.G472G	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	472					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CTGTCACGTTCCCGAACACCA	0.662																																					NSCLC(117;707 1703 2300 21308 31858)												0													80.0	64.0	70.0					17																	40321669		2203	4300	6503	SO:0001819	synonymous_variant	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1416G>C	17.37:g.40321669C>G				Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.G472	ENST00000264661.3	37	c.1416	CCDS11420.1	17																																																																																			KCNH4	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000089558		0.662	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	-	0.00	64	0	C	NM_012285		40321669	-1	tier1	-	no_errors	ENST00000264661	ensembl	human	known	74_37	silent	66.67	27	54	SNP	0.879	G
KIAA1257	57501	genome.wustl.edu	37	3	128707650	128707650	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:128707650G>A	ENST00000265068.5	-	3	541	c.374C>T	c.(373-375)cCg>cTg	p.P125L	KIAA1257_ENST00000515659.1_Missense_Mutation_p.P13L|KIAA1257_ENST00000510149.1_5'UTR|KIAA1257_ENST00000511438.1_Missense_Mutation_p.P125L	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	125										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						TTCATCGTCCGGCAGAAGGAA	0.388																																																	0													110.0	113.0	112.0					3																	128707650		2027	4196	6223	SO:0001583	missense	0			AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.374C>T	3.37:g.128707650G>A	ENSP00000265068:p.Pro125Leu		Q8IXY7|Q8N5T4	Missense_Mutation	SNP	NULL	p.P125L	ENST00000265068.5	37	c.374	CCDS46905.1	3	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449788	0.63290	.	.	ENSG00000114656	ENST00000511438;ENST00000265068;ENST00000515659	.	.	.	5.67	5.67	0.87782	.	0.000000	0.47093	D	0.000260	T	0.67173	0.2865	L	0.32530	0.975	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69435	-0.5146	9	0.87932	D	0	-10.4373	15.2707	0.73699	0.0:0.0:1.0:0.0	.	125;125	Q9ULG3;D6RH05	K1257_HUMAN;.	L	125;125;13	.	ENSP00000265068:P125L	P	-	2	0	KIAA1257	130190340	1.000000	0.71417	0.961000	0.40146	0.225000	0.24961	6.232000	0.72313	2.678000	0.91216	0.650000	0.86243	CCG	KIAA1257	-	NULL	ENSG00000114656		0.388	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	KIAA1257	HGNC	protein_coding	OTTHUMT00000358430.1	-	0.00	60	0	G	NM_020741		128707650	-1	tier1	-	no_errors	ENST00000265068	ensembl	human	known	74_37	missense	17.44	71	15	SNP	0.992	A
KIF5C	3800	genome.wustl.edu	37	2	149633197	149633197	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:149633197C>T	ENST00000435030.1	+	1	379	c.11C>T	c.(10-12)cCa>cTa	p.P4L	AC105402.4_ENST00000446781.2_RNA|AC105402.4_ENST00000601658.1_RNA			O60282	KIF5C_HUMAN	kinesin family member 5C	4					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		ATGGCGGATCCAGCCGAATGC	0.667																																																	0													16.0	18.0	17.0					2																	149633197		1776	4022	5798	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.11C>T	2.37:g.149633197C>T	ENSP00000393379:p.Pro4Leu		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.P4L	ENST00000435030.1	37	c.11		2	.	.	.	.	.	.	.	.	.	.	c	17.73	3.460920	0.63513	.	.	ENSG00000168280	ENST00000451033;ENST00000435030	T	0.75154	-0.91	5.0	4.09	0.47781	.	.	.	.	.	T	0.67487	0.2898	.	.	.	0.80722	D	1	B	0.14805	0.011	B	0.14578	0.011	T	0.63337	-0.6660	8	0.45353	T	0.12	.	14.1533	0.65401	0.1513:0.8487:0.0:0.0	.	4	O60282	KIF5C_HUMAN	L	4	ENSP00000393379:P4L	ENSP00000393379:P4L	P	+	2	0	KIF5C	149349667	1.000000	0.71417	0.980000	0.43619	0.965000	0.64279	7.379000	0.79691	1.061000	0.40601	0.444000	0.29173	CCA	KIF5C	-	NULL	ENSG00000168280		0.667	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	-	0.00	19	0	C	NM_004522		149633197	+1	tier1	-	no_errors	ENST00000435030	ensembl	human	known	74_37	missense	72.83	25	67	SNP	1.000	T
KIF5C	3800	genome.wustl.edu	37	2	149840246	149840246	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:149840246T>A	ENST00000435030.1	+	15	2050	c.1682T>A	c.(1681-1683)aTa>aAa	p.I561K	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.I466K|KIF5C_ENST00000397413.1_Missense_Mutation_p.I329K			O60282	KIF5C_HUMAN	kinesin family member 5C	561					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		CTGGGGGAGATAGGTGGAATT	0.463																																																	0													76.0	75.0	75.0					2																	149840246		1901	4134	6035	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1682T>A	2.37:g.149840246T>A	ENSP00000393379:p.Ile561Lys		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.I561K	ENST00000435030.1	37	c.1682		2	.	.	.	.	.	.	.	.	.	.	T	28.5	4.928918	0.92389	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.81163	-1.46;-1.46;-1.46	5.46	5.46	0.80206	.	0.065505	0.64402	D	0.000005	D	0.89167	0.6638	.	.	.	0.80722	D	1	P;D	0.76494	0.956;0.999	P;D	0.70227	0.786;0.968	D	0.89855	0.4012	9	0.54805	T	0.06	.	15.7119	0.77635	0.0:0.0:0.0:1.0	.	561;127	O60282;Q3LIE3	KIF5C_HUMAN;.	K	561;466;464;329	ENSP00000393379:I561K;ENSP00000410115:I466K;ENSP00000380560:I329K	ENSP00000334176:I464K	I	+	2	0	KIF5C	149548492	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	7.868000	0.87116	2.291000	0.77112	0.533000	0.62120	ATA	KIF5C	-	NULL	ENSG00000168280		0.463	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	-	0.00	71	0	T	NM_004522		149840246	+1	tier1	-	no_errors	ENST00000435030	ensembl	human	known	74_37	missense	80.70	44	184	SNP	1.000	A
LARS2	23395	genome.wustl.edu	37	3	45500280	45500280	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:45500280G>T	ENST00000415258.1	+	7	793	c.652G>T	c.(652-654)Gag>Tag	p.E218*	LARS2_ENST00000414984.1_Nonsense_Mutation_p.E175*|LARS2_ENST00000265537.3_Nonsense_Mutation_p.E218*			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	218					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	GCTTGCCAATGAGCAGGTGGA	0.433																																																	0													120.0	111.0	114.0					3																	45500280		2203	4300	6503	SO:0001587	stop_gained	0			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.652G>T	3.37:g.45500280G>T	ENSP00000408576:p.Glu218*			Nonsense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Leu-tRNA-ligase_bac/mito,tigrfam_Leu-tRNA-ligase_bac/mito	p.E218*	ENST00000415258.1	37	c.652	CCDS2728.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.196116	0.98129	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-38.891	19.5567	0.95351	0.0:0.0:1.0:0.0	.	.	.	.	X	218;218;175	.	ENSP00000265537:E218X	E	+	1	0	LARS2	45475284	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	9.420000	0.97426	2.711000	0.92665	0.563000	0.77884	GAG	LARS2	-	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,prints_Leu-tRNA-ligase_bac/mito,tigrfam_Leu-tRNA-ligase_bac/mito	ENSG00000011376		0.433	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	HGNC	protein_coding	OTTHUMT00000345001.1	-	0.00	28	0	G	NM_015340		45500280	+1	tier1	-	no_errors	ENST00000265537	ensembl	human	known	74_37	nonsense	11.11	32	4	SNP	1.000	T
LCN6	158062	genome.wustl.edu	37	9	139642865	139642865	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:139642865C>G	ENST00000341206.4	-	1	115	c.71G>C	c.(70-72)gGa>gCa	p.G24A	LCN6_ENST00000476567.1_5'Flank|LCN6_ENST00000480584.1_5'Flank|LCN6_ENST00000435202.1_Missense_Mutation_p.G14A|LCN6_ENST00000471509.1_5'Flank	NM_198946.2	NP_945184.1	P62502	LCN6_HUMAN	lipocalin 6	24					single fertilization (GO:0007338)	extracellular region (GO:0005576)				lung(3)|upper_aerodigestive_tract(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		GTCCAGTCTTCCCAACCACAC	0.682																																					Melanoma(172;919 2704 37090 48131)												0													53.0	51.0	52.0					9																	139642865		2198	4300	6498	SO:0001583	missense	0			AF303084	CCDS7005.1	9q34.3	2012-10-08			ENSG00000267206	ENSG00000267206		"""Lipocalins"""	17337	protein-coding gene	gene with protein product		609379					Standard	NM_198946		Approved		uc004ciy.2	P62502	OTTHUMG00000020941	ENST00000341206.4:c.71G>C	9.37:g.139642865C>G	ENSP00000339621:p.Gly24Ala		B0QZ80|Q71SF6	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	p.G24A	ENST00000341206.4	37	c.71	CCDS7005.1	9	.	.	.	.	.	.	.	.	.	.	C	0.819	-0.749248	0.03065	.	.	ENSG00000204003	ENST00000341206	T	0.10860	2.83	2.94	2.94	0.34122	Calycin-like (1);Calycin (1);	.	.	.	.	T	0.16171	0.0389	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.07635	-1.0762	9	0.09338	T	0.73	-11.4818	9.5947	0.39567	0.0:1.0:0.0:0.0	.	24	P62502	LCN6_HUMAN	A	24	ENSP00000339621:G24A	ENSP00000339621:G24A	G	-	2	0	LCN6	138762686	0.802000	0.28943	0.967000	0.41034	0.252000	0.25951	1.220000	0.32491	1.960000	0.56953	0.556000	0.70494	GGA	LCN6	-	superfamily_Calycin-like	ENSG00000267206		0.682	LCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN6	HGNC	protein_coding	OTTHUMT00000055107.3	-	0.00	65	0	C	NM_198946		139642865	-1	tier1	-	no_errors	ENST00000341206	ensembl	human	known	74_37	missense	72.63	26	69	SNP	0.972	G
LDHAL6B	92483	genome.wustl.edu	37	15	59499600	59499600	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr15:59499600C>T	ENST00000307144.4	+	1	559	c.461C>T	c.(460-462)aCg>aTg	p.T154M	MYO1E_ENST00000288235.4_Intron	NM_033195.2	NP_149972.1	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	154					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)	10						AAGGGAGAAACGCGCCTTAAT	0.413																																																	0													131.0	130.0	130.0					15																	59499600		2191	4290	6481	SO:0001583	missense	0			AY009108	CCDS10171.1	15q21.3	2011-01-27	2004-07-27	2004-07-28	ENSG00000171989	ENSG00000171989			21481	protein-coding gene	gene with protein product			"""lactate dehydrogenase A-like 6"""	LDHAL6		15870898	Standard	NM_033195		Approved	LDHL, LDH6B	uc002agb.4	Q9BYZ2	OTTHUMG00000132714	ENST00000307144.4:c.461C>T	15.37:g.59499600C>T	ENSP00000302393:p.Thr154Met		Q6DUY4|Q96LI2	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.T154M	ENST00000307144.4	37	c.461	CCDS10171.1	15	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681227	0.47886	.	.	ENSG00000171989	ENST00000307144	D	0.90069	-2.61	1.47	-1.94	0.07571	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.237149	0.32190	U	0.006455	D	0.93815	0.8022	H	0.97051	3.93	0.28681	N	0.905117	D	0.76494	0.999	P	0.62491	0.903	D	0.86912	0.2061	10	0.87932	D	0	.	4.2702	0.10783	0.2309:0.3095:0.4596:0.0	.	154	Q9BYZ2	LDH6B_HUMAN	M	154	ENSP00000302393:T154M	ENSP00000302393:T154M	T	+	2	0	LDHAL6B	57286892	1.000000	0.71417	0.009000	0.14445	0.433000	0.31745	3.198000	0.51035	-0.069000	0.12931	0.305000	0.20034	ACG	LDHAL6B	-	pfam_Lactate/malate_DH_N,pirsf_L-lactate/malate_DH,tigrfam_L-lactate_DH	ENSG00000171989		0.413	LDHAL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDHAL6B	HGNC	protein_coding	OTTHUMT00000256015.1	-	0.00	52	0	C	NM_033195		59499600	+1	tier1	-	no_errors	ENST00000307144	ensembl	human	known	74_37	missense	17.86	69	15	SNP	0.996	T
RP11-1398P2.1	0	genome.wustl.edu	37	4	1576058	1576058	+	lincRNA	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:1576058C>G	ENST00000466692.1	-	0	309																											GCTTGACATCCTGCAGAGTGT	0.637																																																	0																																												0																															4.37:g.1576058C>G				RNA	SNP	-	NULL	ENST00000466692.1	37	NULL		4																																																																																			RP11-1398P2.1	-	-	ENSG00000244459		0.637	RP11-1398P2.1-001	KNOWN	basic	lincRNA	LOC100507054	Clone_based_vega_gene	lincRNA	OTTHUMT00000350727.2	-	0.00	30	0	C			1576058	-1	tier1	-	no_errors	ENST00000466692	ensembl	human	known	74_37	rna	64.44	16	29	SNP	0.005	G
LOC101927209	101927209	genome.wustl.edu	37	1	142621506	142621506	+	lincRNA	SNP	T	T	C	rs2484386	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:142621506T>C	ENST00000610091.1	-	0	6364				RP11-417J8.3_ENST00000426408.1_lincRNA																							TGTTTTGCAGTGGAAATGGTC	0.478																																																	0																																												0																															1.37:g.142621506T>C				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.3	-	-	ENSG00000230880		0.478	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC101927209	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	13	0	T			142621506	+1	tier1	rs2484386	no_errors	ENST00000412092	ensembl	human	known	74_37	rna	25.00	18	6	SNP	0.042	C
RP11-435B5.5	0	genome.wustl.edu	37	1	143392625	143392625	+	lincRNA	SNP	G	G	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:143392625G>C	ENST00000428624.1	+	0	2248				RP11-435B5.4_ENST00000423249.1_lincRNA																							AGCATTGAAAGCTAACAGTTC	0.289																																																	0																																												0																															1.37:g.143392625G>C				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.289	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	148	0	G			143392625	+1	tier1	-	no_errors	ENST00000415543	ensembl	human	known	74_37	rna	28.97	103	42	SNP	0.001	C
LOC729218	729218	genome.wustl.edu	37	4	119554790	119554790	+	lincRNA	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:119554790T>C	ENST00000567913.2	+	0	4301																											TCCGGCCTCTTGGCGGCCTCT	0.682																																																	0																																												0																															4.37:g.119554790T>C				RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-	ENSG00000260404		0.682	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC101929676	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2		0.00	41	0	T			119554790	+1			no_errors	ENST00000567913	ensembl	human	known	74_37	rna	5.00	57	3	SNP	0.759	C
LOC645752	645752	genome.wustl.edu	37	15	78217292	78217292	+	lincRNA	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr15:78217292G>A	ENST00000565869.1	+	0	706				RP11-114H24.2_ENST00000567226.1_RNA																							CCAGGTGAGTGGCAACCACCA	0.527																																																	0																																												0																															15.37:g.78217292G>A				RNA	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			RP11-114H24.2	-	-	ENSG00000260776		0.527	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	-	0.00	95	0	G			78217292	-1	tier1	-	no_errors	ENST00000567226	ensembl	human	known	74_37	rna	43.80	68	53	SNP	0.002	A
LRIG2	9860	genome.wustl.edu	37	1	113655143	113655143	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:113655143G>T	ENST00000361127.5	+	14	2039	c.1841G>T	c.(1840-1842)cGc>cTc	p.R614L	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	614	Ig-like C2-type 2.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CTGACTATTCGCACTGGTGCC	0.478																																																	0													145.0	139.0	141.0					1																	113655143		2203	4300	6503	SO:0001583	missense	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1841G>T	1.37:g.113655143G>T	ENSP00000355396:p.Arg614Leu		Q9NSN2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R614L	ENST00000361127.5	37	c.1841	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	g	34	5.351914	0.95830	.	.	ENSG00000198799	ENST00000361127	T	0.67523	-0.27	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.57344	0.2047	N	0.24115	0.695	0.80722	D	1	P	0.43314	0.803	P	0.53006	0.715	T	0.55140	-0.8187	10	0.24483	T	0.36	.	19.2881	0.94087	0.0:0.0:1.0:0.0	.	614	O94898	LRIG2_HUMAN	L	614	ENSP00000355396:R614L	ENSP00000355396:R614L	R	+	2	0	LRIG2	113456666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.560000	0.86352	0.591000	0.81541	CGC	LRIG2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000198799		0.478	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2		0.00	30	0	G	NM_014813		113655143	+1			no_errors	ENST00000361127	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
LRP5	4041	genome.wustl.edu	37	11	68174018	68174018	+	Frame_Shift_Del	DEL	G	G	-	rs80358313		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:68174018delG	ENST00000294304.7	+	9	1934	c.1828delG	c.(1828-1830)gggfs	p.G611fs		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	611	EGF-like 2.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGACAGGAACGGGGGGTGCAG	0.622																																																	0			GRCh37	CM053295|CM053961	LRP5	M	rs80358313						71.0	68.0	69.0					11																	68174018		2200	4294	6494	SO:0001589	frameshift_variant	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1828delG	11.37:g.68174018delG	ENSP00000294304:p.Gly611fs		Q96TD6|Q9UES7|Q9UP66	Frame_Shift_Del	DEL	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.C612fs	ENST00000294304.7	37	c.1828	CCDS8181.1	11																																																																																			LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_EG-like_dom	ENSG00000162337		0.622	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1		0.00	64	0	G	NM_002335		68174018	+1	tier1		no_errors	ENST00000294304	ensembl	human	known	74_37	frame_shift_del	17.14	58	12	DEL	1.000	-
LTBP1	4052	genome.wustl.edu	37	2	33335690	33335690	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:33335690G>T	ENST00000404816.2	+	4	1258	c.905G>T	c.(904-906)gGc>gTc	p.G302V	LTBP1_ENST00000354476.3_Missense_Mutation_p.G302V			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	302					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ATTCACCATGGCCAGACCCAG	0.443																																																	0													116.0	118.0	117.0					2																	33335690		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.905G>T	2.37:g.33335690G>T	ENSP00000386043:p.Gly302Val		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G302V	ENST00000404816.2	37	c.905	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386311	0.42308	.	.	ENSG00000049323	ENST00000404816;ENST00000354476	T;T	0.80480	-1.38;-1.36	5.51	4.62	0.57501	.	.	.	.	.	T	0.75657	0.3879	L	0.36672	1.1	0.80722	D	1	P	0.39131	0.661	B	0.40101	0.319	T	0.76340	-0.2995	9	0.49607	T	0.09	.	16.1598	0.81693	0.0:0.1337:0.8663:0.0	.	302	Q14766-4	.	V	302	ENSP00000386043:G302V;ENSP00000346467:G302V	ENSP00000346467:G302V	G	+	2	0	LTBP1	33189194	1.000000	0.71417	0.995000	0.50966	0.164000	0.22412	5.019000	0.64060	1.280000	0.44463	0.650000	0.86243	GGC	LTBP1	-	NULL	ENSG00000049323		0.443	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2		0.00	76	0	G	NM_206943		33335690	+1			no_errors	ENST00000354476	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
LTN1	26046	genome.wustl.edu	37	21	30339206	30339206	+	Frame_Shift_Del	DEL	T	T	-	rs560176639	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr21:30339206delT	ENST00000361371.5	-	10	1686	c.1607delA	c.(1606-1608)aatfs	p.N536fs	LTN1_ENST00000389195.2_Frame_Shift_Del_p.N582fs|LTN1_ENST00000389194.2_Frame_Shift_Del_p.N582fs			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	536					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N536fs*33(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						AACCTTACCATTTTTTTTTTT	0.378													|||unknown(HR)	455	0.0908546	0.1248	0.0461	5008	,	,		18798	0.0714		0.0586	False		,,,				2504	0.1299																1	Deletion - Frameshift(1)	ovary(1)											50.0	47.0	48.0					21																	30339206		2203	4300	6503	SO:0001589	frameshift_variant	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1607delA	21.37:g.30339206delT	ENSP00000354977:p.Asn536fs		A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.N582fs	ENST00000361371.5	37	c.1745		21																																																																																			LTN1	-	superfamily_ARM-type_fold	ENSG00000198862		0.378	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1		0.00	54	0	T	NM_015565		30339206	-1			no_errors	ENST00000389194	ensembl	human	known	74_37	frame_shift_del	5.77	98	6	DEL	0.000	0
MAP1B	4131	genome.wustl.edu	37	5	71495635	71495635	+	Silent	SNP	C	C	T	rs543732551		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr5:71495635C>T	ENST00000296755.7	+	5	6751	c.6453C>T	c.(6451-6453)agC>agT	p.S2151S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2151					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCTCAGTCAGCGAGTCAGCCC	0.597																																					Melanoma(17;367 822 11631 31730 47712)												0													90.0	80.0	84.0					5																	71495635		2203	4300	6503	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6453C>T	5.37:g.71495635C>T			A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.S2151	ENST00000296755.7	37	c.6453	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.597	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	40	0	C	NM_005909		71495635	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.689	T
MAP2	4133	genome.wustl.edu	37	2	210559188	210559188	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:210559188A>T	ENST00000360351.4	+	7	2800	c.2294A>T	c.(2293-2295)gAg>gTg	p.E765V	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E761V|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	765					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAAAGCAAAGAGGAAGAACAG	0.433																																					Pancreas(27;423 979 28787 29963)												0													62.0	63.0	62.0					2																	210559188		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2294A>T	2.37:g.210559188A>T	ENSP00000353508:p.Glu765Val		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.E765V	ENST00000360351.4	37	c.2294	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	16.05	3.013630	0.54468	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.26067	1.76;1.76	5.64	5.64	0.86602	MAP2/Tau projection (1);	0.088928	0.48767	D	0.000180	T	0.43545	0.1252	L	0.59436	1.845	0.52099	D	0.999944	D;D	0.58970	0.98;0.984	P;P	0.57679	0.731;0.825	T	0.37526	-0.9702	10	0.87932	D	0	-12.2349	15.8564	0.78979	1.0:0.0:0.0:0.0	.	761;765	P11137-3;P11137	.;MAP2_HUMAN	V	765;761	ENSP00000353508:E765V;ENSP00000392164:E761V	ENSP00000353508:E765V	E	+	2	0	MAP2	210267433	1.000000	0.71417	0.979000	0.43373	0.770000	0.43624	5.742000	0.68646	2.160000	0.67779	0.528000	0.53228	GAG	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.433	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	11	0	A	NM_001039538		210559188	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	52.94	8	9	SNP	0.978	T
MARCH1	55016	genome.wustl.edu	37	4	164534146	164534146	+	Intron	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:164534146C>T	ENST00000503008.1	-	5	1219				MARCH1_ENST00000339875.5_Intron|MARCH1_ENST00000274056.7_Intron|MARCH1_ENST00000514618.1_Missense_Mutation_p.C96Y	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GACAGGGGTGCAATACTCAAA	0.478																																																	0																																										SO:0001627	intron_variant	0			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+319G>A	4.37:g.164534146C>T			D3DP29|Q9NWR0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.C96Y	ENST00000503008.1	37	c.287	CCDS54814.1	4	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746241	0.30955	.	.	ENSG00000145416	ENST00000514618	T	0.30182	1.54	6.06	4.14	0.48551	.	.	.	.	.	T	0.42854	0.1221	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38993	-0.9635	6	0.87932	D	0	.	8.6413	0.33978	0.0:0.5643:0.3364:0.0993	.	.	.	.	Y	96	ENSP00000421322:C96Y	ENSP00000421322:C96Y	C	-	2	0	MARCH1	164753596	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	2.113000	0.41902	1.403000	0.46800	0.655000	0.94253	TGC	MARCH1	-	NULL	ENSG00000145416		0.478	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	-	0.00	10	0	C	NM_017923		164534146	-1	tier1	-	no_errors	ENST00000514618	ensembl	human	novel	74_37	missense	33.33	8	4	SNP	0.989	T
MBNL1	4154	genome.wustl.edu	37	3	152175980	152175980	+	Intron	SNP	A	A	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:152175980A>G	ENST00000463374.1	+	8	1621				MBNL1_ENST00000485509.1_Missense_Mutation_p.M322V|MBNL1_ENST00000498502.1_Intron|MBNL1_ENST00000357472.3_Intron|MBNL1_ENST00000324210.5_Intron|MBNL1_ENST00000324196.5_Missense_Mutation_p.M322V|MBNL1_ENST00000282486.6_Intron|MBNL1_ENST00000282488.7_Intron|RP11-362A9.3_ENST00000463255.1_RNA|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000485910.1_Intron|MBNL1_ENST00000492948.1_Intron|MBNL1_ENST00000545754.1_Intron|MBNL1_ENST00000355460.2_Intron	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AGCAGGAAAAATGGTATGAGA	0.433																																																	0													141.0	106.0	118.0					3																	152175980		2203	4300	6503	SO:0001627	intron_variant	0			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.1111-1080A>G	3.37:g.152175980A>G			E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.M322V	ENST00000463374.1	37	c.964	CCDS3165.1	3	.	.	.	.	.	.	.	.	.	.	A	5.103	0.204720	0.09704	.	.	ENSG00000152601	ENST00000324196;ENST00000485509	.	.	.	5.92	4.73	0.59995	.	.	.	.	.	T	0.42921	0.1224	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20273	-1.0280	8	0.37606	T	0.19	.	11.8481	0.52395	0.854:0.146:0.0:0.0	.	322	E9PBW7	.	V	322	.	ENSP00000319374:M322V	M	+	1	0	MBNL1	153658670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.073000	0.57570	1.008000	0.39264	0.533000	0.62120	ATG	MBNL1	-	NULL	ENSG00000152601		0.433	MBNL1-006	KNOWN	basic|CCDS	protein_coding	MBNL1	HGNC	protein_coding	OTTHUMT00000353604.1	-	0.00	49	0	A	NM_021038		152175980	+1	tier1	-	no_errors	ENST00000324196	ensembl	human	known	74_37	missense	40.51	47	32	SNP	1.000	G
MDN1	23195	genome.wustl.edu	37	6	90385858	90385858	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:90385858T>G	ENST00000369393.3	-	77	12723	c.12608A>C	c.(12607-12609)cAt>cCt	p.H4203P	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.H4203P			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4203					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAGCCTGGCATGCCGTGCAAG	0.458																																																	0													115.0	102.0	106.0					6																	90385858		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12608A>C	6.37:g.90385858T>G	ENSP00000358400:p.His4203Pro		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.H4203P	ENST00000369393.3	37	c.12608	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	16.38	3.107428	0.56291	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03152	4.03;4.03	5.64	4.46	0.54185	.	0.062472	0.64402	D	0.000007	T	0.02083	0.0065	M	0.68317	2.08	0.34304	D	0.684679	P	0.49961	0.93	B	0.41571	0.36	T	0.51560	-0.8690	10	0.36615	T	0.2	.	6.9701	0.24644	0.133:0.0698:0.0:0.7971	.	4203	Q9NU22	MDN1_HUMAN	P	4203	ENSP00000358400:H4203P;ENSP00000413970:H4203P	ENSP00000358400:H4203P	H	-	2	0	MDN1	90442579	1.000000	0.71417	0.950000	0.38849	0.970000	0.65996	3.206000	0.51098	1.041000	0.40125	0.459000	0.35465	CAT	MDN1	-	pirsf_Midasin	ENSG00000112159		0.458	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	28	0	T			90385858	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	26.83	30	11	SNP	0.996	G
TRIM13	10206	genome.wustl.edu	37	13	50570573	50570575	+	5'Flank	DEL	CTT	CTT	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr13:50570573_50570575delCTT	ENST00000378182.3	+	0	0				MIR3613_ENST00000579844.1_RNA|TRIM13_ENST00000420995.2_5'Flank|TRIM13_ENST00000356017.4_5'Flank|TRIM13_ENST00000457662.2_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		AAGGGTTGGGCTTTTTTTTTTGT	0.493																																																	0																																										SO:0001631	upstream_gene_variant	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926		13.37:g.50570573_50570575delCTT	Exception_encountered		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	-	NULL	ENST00000378182.3	37	NULL	CCDS9423.1	13																																																																																			MIR3613	-	-	ENSG00000264864		0.493	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	MIR3613	HGNC	protein_coding	OTTHUMT00000354875.1		0.00	44	0	CTT	NM_001007278		50570575	-1	tier1		no_errors	ENST00000579844	ensembl	human	known	74_37	rna	22.73	17	5	DEL	1.000:1.000:1.000	-
MIRLET7F1	406888	genome.wustl.edu	37	9	96938644	96938644	+	lincRNA	SNP	A	A	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:96938644A>T	ENST00000602652.1	+	0	0				MIRLET7D_ENST00000362263.1_RNA|MIRLET7DHG_ENST00000416309.2_lincRNA|MIRLET7F1_ENST00000362202.1_RNA|RP11-2B6.3_ENST00000602703.1_lincRNA|MIRLET7A1_ENST00000362295.2_RNA																							GTGAGGTAGTAGATTGTATAG	0.338																																																	0													87.0	79.0	81.0					9																	96938644		1568	3582	5150			0																															9.37:g.96938644A>T				RNA	SNP	-	NULL	ENST00000602652.1	37	NULL		9																																																																																			MIRLET7F1	-	-	ENSG00000199072		0.338	RP11-2B6.2-001	KNOWN	basic	lincRNA	MIRLET7F1	HGNC	lincRNA	OTTHUMT00000467606.1	-	0.00	36	0	A			96938644	+1	tier1	-	no_errors	ENST00000362202	ensembl	human	known	74_37	rna	75.00	14	42	SNP	1.000	T
MRC1	4360	genome.wustl.edu	37	10	18155626	18155626	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr10:18155626C>T	ENST00000239761.3	+	12	2022	c.1919C>T	c.(1918-1920)aCg>aTg	p.T640M	RP11-457D2.3_ENST00000442231.1_RNA	NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	640					receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						AAGCCCACGACGACTCCCGAA	0.493																																					GBM(115;1153 1594 28187 28781 35884)												0													2.0	2.0	2.0					10																	18155626		1355	2366	3721	SO:0001583	missense	0			J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.1919C>T	10.37:g.18155626C>T	ENSP00000239761:p.Thr640Met		A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.T640M	ENST00000239761.3	37	c.1919	CCDS7123.1	10	.	.	.	.	.	.	.	.	.	.	C	13.85	2.359781	0.41801	.	.	ENSG00000120586	ENST00000239761	T	0.18174	2.23	4.25	4.25	0.50352	.	0.109035	0.38720	U	0.001593	T	0.35335	0.0928	M	0.64997	1.995	0.51767	D	0.999935	D	0.89917	1.0	D	0.74348	0.983	T	0.03259	-1.1055	10	0.42905	T	0.14	-21.0101	11.4469	0.50129	0.0:0.9117:0.0:0.0883	.	640	P22897	MRC1_HUMAN	M	640	ENSP00000239761:T640M	ENSP00000239761:T640M	T	+	2	0	MRC1	18195632	0.999000	0.42202	0.182000	0.23118	0.211000	0.24417	4.427000	0.59888	2.184000	0.69523	0.436000	0.28706	ACG	MRC1	-	NULL	ENSG00000120586		0.493	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	HGNC	protein_coding	OTTHUMT00000047057.1	-	0.00	19	0	C	NM_002438		18155626	+1	tier1	-	no_errors	ENST00000239761	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.987	T
MRPL24	79590	genome.wustl.edu	37	1	156707997	156707997	+	Intron	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:156707997C>G	ENST00000361531.2	-	4	416				MRPL24_ENST00000368211.4_Intron|MRPL24_ENST00000478899.1_5'UTR			Q96A35	RM24_HUMAN	mitochondrial ribosomal protein L24						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(4)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCGGCGCATTCAGCCCAAGTT	0.542																																																	0																																										SO:0001627	intron_variant	0			AB051341	CCDS1155.1	1q23.1	2012-11-14			ENSG00000143314	ENSG00000143314		"""Mitochondrial ribosomal proteins / large subunits"""	14037	protein-coding gene	gene with protein product		611836					Standard	NM_145729		Approved	MRP-L18	uc001fpx.1	Q96A35	OTTHUMG00000041296	ENST00000361531.2:c.280-71G>C	1.37:g.156707997C>G			D3DVC8|Q53G65|Q53HT0|Q5SYZ9|Q5SZ00|Q5SZ02|Q96Q70|Q9H7G3	RNA	SNP	-	NULL	ENST00000361531.2	37	NULL	CCDS1155.1	1																																																																																			MRPL24	-	-	ENSG00000143314		0.542	MRPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL24	HGNC	protein_coding	OTTHUMT00000098955.1	-	0.00	51	0	C	NM_145729		156707997	-1	tier1	-	no_errors	ENST00000478899	ensembl	human	known	74_37	rna	6.76	69	5	SNP	0.000	G
MS4A8	83661	genome.wustl.edu	37	11	60470906	60470906	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:60470906C>T	ENST00000300226.2	+	3	478	c.275C>T	c.(274-276)aCg>aTg	p.T92M		NM_031457.1	NP_113645.1	Q9BY19	M4A8_HUMAN	membrane-spanning 4-domains, subfamily A, member 8	92						integral component of membrane (GO:0016021)											ATCATGGCGACGGTTCTCGTA	0.552																																																	0													151.0	139.0	143.0					11																	60470906		2203	4300	6503	SO:0001583	missense	0			AF237905	CCDS7990.1	11q12	2013-03-01	2013-03-01	2013-03-01	ENSG00000166959	ENSG00000166959			13380	protein-coding gene	gene with protein product		606549	"""membrane-spanning 4-domains, subfamily A, member 8B"""	MS4A8B		11245982, 11401424	Standard	NM_031457		Approved	MS4A4, CD20L5	uc001npv.3	Q9BY19	OTTHUMG00000167686	ENST00000300226.2:c.275C>T	11.37:g.60470906C>T	ENSP00000300226:p.Thr92Met		Q8TCA5	Missense_Mutation	SNP	pfam_CD20-like	p.T92M	ENST00000300226.2	37	c.275	CCDS7990.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.36|11.36	1.615604|1.615604	0.28801|0.28801	.|.	.|.	ENSG00000166959|ENSG00000166959	ENST00000525458|ENST00000300226;ENST00000529752	.|T;T	.|0.02301	.|4.35;4.35	3.62|3.62	2.6|2.6	0.31112|0.31112	.|.	.|0.472817	.|0.19530	.|N	.|0.112065	T|T	0.03739|0.03739	0.0106|0.0106	L|L	0.41573|0.41573	1.285|1.285	0.09310|0.09310	N|N	1|1	.|D;D	.|0.69078	.|0.964;0.997	.|P;P	.|0.53102	.|0.557;0.718	T|T	0.45818|0.45818	-0.9235|-0.9235	5|10	.|0.31617	.|T	.|0.26	-14.2382|-14.2382	7.6502|7.6502	0.28344|0.28344	0.2522:0.7478:0.0:0.0|0.2522:0.7478:0.0:0.0	.|.	.|92;92	.|E9PQE1;Q9BY19	.|.;M4A8B_HUMAN	W|M	74|92	.|ENSP00000300226:T92M;ENSP00000436857:T92M	.|ENSP00000300226:T92M	R|T	+|+	1|2	2|0	MS4A8B|MS4A8B	60227482|60227482	0.001000|0.001000	0.12720|0.12720	0.011000|0.011000	0.14972|0.14972	0.004000|0.004000	0.04260|0.04260	0.804000|0.804000	0.27098|0.27098	1.745000|1.745000	0.51790|0.51790	0.491000|0.491000	0.48974|0.48974	CGG|ACG	MS4A8	-	pfam_CD20-like	ENSG00000166959		0.552	MS4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A8	HGNC	protein_coding	OTTHUMT00000395605.1	-	0.00	83	0	C			60470906	+1	tier1	-	no_errors	ENST00000300226	ensembl	human	known	74_37	missense	13.16	99	15	SNP	0.004	T
MSLNL	401827	genome.wustl.edu	37	16	820093	820093	+	Silent	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:820093G>A	ENST00000442466.1	-	14	1838	c.1839C>T	c.(1837-1839)caC>caT	p.H613H	MSLNL_ENST00000293892.3_Silent_p.H964H|MIR662_ENST00000384847.1_RNA			Q96KJ4	MSLNL_HUMAN	mesothelin-like	613					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGAGCACTTGGTGGGTGGTGC	0.726																																																	0													12.0	15.0	14.0					16																	820093		2014	4086	6100	SO:0001819	synonymous_variant	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1839C>T	16.37:g.820093G>A				Silent	SNP	pfam_Mesothelin	p.H964	ENST00000442466.1	37	c.2892		16																																																																																			MSLNL	-	NULL	ENSG00000162006		0.726	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		-	0.00	21	0	G	NM_001025190		820093	-1	tier1	-	no_errors	ENST00000293892	ensembl	human	known	74_37	silent	46.43	15	13	SNP	0.000	A
MT-CO1	4512	genome.wustl.edu	37	M	6889	6889	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrM:6889G>A	ENST00000361624.2	+	1	986	c.986G>A	c.(985-987)gGa>gAa	p.G329E	MT-TQ_ENST00000387372.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	329					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CACACTCCACGGAAGCAATAT	0.478																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.986G>A	M.37:g.6889G>A	ENSP00000354499:p.Gly329Glu		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G329E	ENST00000361624.2	37	c.986		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.478	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	46	0	G	YP_003024028		6889	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	47.06	8	8	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13289	13289	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrM:13289G>A	ENST00000361567.2	+	1	953	c.953G>A	c.(952-954)gGc>gAc	p.G318D	MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	318					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AGTTACAATCGGCATCAACCA	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.953G>A	M.37:g.13289G>A	ENSP00000354813:p.Gly318Asp		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.G318D	ENST00000361567.2	37	c.953		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	56	0	G	YP_003024036		13289	+1	tier1	rs28683136	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	77.55	11	38	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	14120	14120	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrM:14120T>C	ENST00000361567.2	+	1	1784	c.1784T>C	c.(1783-1785)cTc>cCc	p.L595P	MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	0					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTTCTTCCCACTCATCCTAAC	0.383																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1784T>C	M.37:g.14120T>C	ENSP00000354813:p.Leu595Pro		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L595P	ENST00000361567.2	37	c.1784		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C	ENSG00000198786		0.383	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	74	0	T	YP_003024036		14120	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	9.09	40	4	SNP	NULL	C
MUC4	4585	genome.wustl.edu	37	3	195509034	195509034	+	Silent	SNP	G	G	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:195509034G>C	ENST00000463781.3	-	2	9876	c.9417C>G	c.(9415-9417)gtC>gtG	p.V3139V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.V3139V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGTGCTGGTGACAGGAAGAG	0.592																																																	0													22.0	11.0	14.0					3																	195509034		658	1552	2210	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9417C>G	3.37:g.195509034G>C			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V3139	ENST00000463781.3	37	c.9417	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	173	0	G	NM_018406		195509034	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	32.20	160	76	SNP	0.007	C
RECQL5	9400	genome.wustl.edu	37	17	73621887	73621887	+	IGR	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:73621887C>A	ENST00000317905.5	-	0	3704				RECQL5_ENST00000443199.2_5'Flank|MYO15B_ENST00000578382.2_3'UTR	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			AGGGCCCCAGCAGTCAGATTT	0.647								Other identified genes with known or suspected DNA repair function			OREG0024736	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001628	intergenic_variant	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762			17.37:g.73621887C>A		1146	Q9H0B1|Q9P1W7|Q9UNC8	RNA	SNP	-	NULL	ENST00000317905.5	37	NULL	CCDS42380.1	17																																																																																			MYO15B	-	-	ENSG00000266714		0.647	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MYO15B	HGNC	protein_coding	OTTHUMT00000448207.1	-	0.00	37	0	C	NM_004259		73621887	+1	tier1	-	no_errors	ENST00000578382	ensembl	human	known	74_37	rna	16.00	42	8	SNP	0.001	A
MYO18B	84700	genome.wustl.edu	37	22	26164786	26164786	+	Silent	SNP	C	C	T	rs369200662		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr22:26164786C>T	ENST00000407587.2	+	4	1072	c.903C>T	c.(901-903)gaC>gaT	p.D301D	MYO18B_ENST00000536101.1_Silent_p.D301D|MYO18B_ENST00000335473.7_Silent_p.D301D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	301						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TCTCTAAGGACGTAGGGAGTG	0.587																																																	0										1,3967		0,1,1983	24.0	26.0	25.0		903	-4.1	0.0	22		25	0,8304		0,0,4152	no	coding-synonymous	MYO18B	NM_032608.5		0,1,6135	TT,TC,CC		0.0,0.0252,0.0081		301/2568	26164786	1,12271	1984	4152	6136	SO:0001819	synonymous_variant	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.903C>T	22.37:g.26164786C>T			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D301	ENST00000407587.2	37	c.903		22																																																																																			MYO18B	-	NULL	ENSG00000133454		0.587	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	51	0	C	NM_032608		26164786	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	21.74	36	10	SNP	0.000	T
MYOF	26509	genome.wustl.edu	37	10	95111302	95111302	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr10:95111302G>T	ENST00000359263.4	-	34	3689	c.3690C>A	c.(3688-3690)agC>agA	p.S1230R	MYOF_ENST00000358334.5_Missense_Mutation_p.S1217R|MYOF_ENST00000371502.4_Missense_Mutation_p.S1230R|MYOF_ENST00000371501.4_Missense_Mutation_p.S1230R	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1230	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.S1230S(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GAGAGAAAATGCTTCGTCCTA	0.433																																																	1	Substitution - coding silent(1)	endometrium(1)											108.0	105.0	106.0					10																	95111302		1880	4106	5986	SO:0001583	missense	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.3690C>A	10.37:g.95111302G>T	ENSP00000352208:p.Ser1230Arg		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.S1230R	ENST00000359263.4	37	c.3690	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352625	0.61293	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.96	3.84	0.44239	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.040551	0.85682	D	0.000000	T	0.72748	0.3499	M	0.76574	2.34	0.47153	D	0.999335	P;D	0.57257	0.896;0.979	P;P	0.61533	0.745;0.89	T	0.70669	-0.4808	10	0.25106	T	0.35	-22.734	4.2857	0.10853	0.528:0.0:0.472:0.0	.	1217;1230	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	R	1217;1230;1230;1230	ENSP00000351094:S1217R;ENSP00000352208:S1230R;ENSP00000360556:S1230R;ENSP00000360557:S1230R	ENSP00000351094:S1217R	S	-	3	2	MYOF	95101292	0.041000	0.20044	1.000000	0.80357	0.969000	0.65631	0.377000	0.20552	1.444000	0.47605	0.650000	0.86243	AGC	MYOF	-	superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000138119		0.433	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2		0.00	25	0	G	NM_013451		95111302	-1			no_errors	ENST00000359263	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.942	T
NDRG2	57447	genome.wustl.edu	37	14	21487296	21487296	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:21487296C>T	ENST00000556147.1	-	11	1680	c.740G>A	c.(739-741)cGt>cAt	p.R247H	NDRG2_ENST00000555158.1_Missense_Mutation_p.R233H|NDRG2_ENST00000397858.1_Missense_Mutation_p.R247H|NDRG2_ENST00000554104.1_Missense_Mutation_p.R160H|NDRG2_ENST00000360463.3_Missense_Mutation_p.R233H|NDRG2_ENST00000397847.2_Missense_Mutation_p.R247H|NDRG2_ENST00000403829.3_Missense_Mutation_p.R243H|NDRG2_ENST00000397853.3_Missense_Mutation_p.R247H|NDRG2_ENST00000397855.3_Missense_Mutation_p.R204H|NDRG2_ENST00000350792.3_Missense_Mutation_p.R233H|NDRG2_ENST00000397856.3_Missense_Mutation_p.R233H|NDRG2_ENST00000553503.1_Missense_Mutation_p.R233H|NDRG2_ENST00000298684.5_Missense_Mutation_p.R204H|NDRG2_ENST00000554277.1_5'UTR|NDRG2_ENST00000298687.5_Missense_Mutation_p.R247H|NDRG2_ENST00000397851.2_Missense_Mutation_p.R247H|NDRG2_ENST00000397844.2_Missense_Mutation_p.R233H|NDRG2_ENST00000554143.1_Missense_Mutation_p.R233H			Q9UN36	NDRG2_HUMAN	NDRG family member 2	247					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ATCACCTCCACGCTCAAAGTT	0.453																																																	0													100.0	92.0	94.0					14																	21487296		2203	4300	6503	SO:0001583	missense	0			AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.740G>A	14.37:g.21487296C>T	ENSP00000451712:p.Arg247His		B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	pfam_Ndr	p.R247H	ENST00000556147.1	37	c.740	CCDS9565.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.154515|5.154515	0.94686|0.94686	.|.	.|.	ENSG00000165795|ENSG00000165795	ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000554104;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397855;ENST00000298684;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556366;ENST00000556974;ENST00000555026;ENST00000553867|ENST00000553593	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.19532|.	2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80396|0.80396	0.4615|0.4615	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.993;0.994;0.988;0.988;0.997;0.999|.	T|T	0.82612|0.82612	-0.0371|-0.0371	10|5	0.87932|.	D|.	0|.	-9.6496|-9.6496	16.42|16.42	0.83755|0.83755	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	243;247;233;228;247;204|.	B4DE86;Q9UN36-3;Q9UN36-5;G3V3N4;Q9UN36;Q9UN36-4|.	.;.;.;.;NDRG2_HUMAN;.|.	H|M	247;233;228;247;160;233;233;247;233;247;233;247;247;233;204;204;233;243;233;160;233;233;247|163	ENSP00000298687:R247H;ENSP00000344620:R233H;ENSP00000380956:R247H;ENSP00000452216:R160H;ENSP00000452038:R233H;ENSP00000452306:R233H;ENSP00000380951:R247H;ENSP00000353649:R233H;ENSP00000451712:R247H;ENSP00000452006:R233H;ENSP00000380949:R247H;ENSP00000380945:R247H;ENSP00000380954:R233H;ENSP00000380953:R204H;ENSP00000298684:R204H;ENSP00000380943:R233H;ENSP00000385889:R243H;ENSP00000451966:R233H;ENSP00000452413:R160H;ENSP00000452362:R233H;ENSP00000451274:R233H;ENSP00000450691:R247H|.	ENSP00000298684:R204H|.	R|V	-|-	2|1	0|0	NDRG2|NDRG2	20557136|20557136	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.995000|0.995000	0.86356|0.86356	4.768000|4.768000	0.62293|0.62293	2.735000|2.735000	0.93741|0.93741	0.563000|0.563000	0.77884|0.77884	CGT|GTG	NDRG2	-	pfam_Ndr	ENSG00000165795		0.453	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	NDRG2	HGNC	protein_coding	OTTHUMT00000411717.1	-	0.00	42	0	C			21487296	-1	tier1	-	no_errors	ENST00000298687	ensembl	human	known	74_37	missense	18.52	44	10	SNP	1.000	T
NDST2	8509	genome.wustl.edu	37	10	75563440	75563440	+	Silent	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr10:75563440G>T	ENST00000309979.6	-	11	2590	c.2034C>A	c.(2032-2034)acC>acA	p.T678T	NDST2_ENST00000299641.4_Silent_p.T555T|RP11-574K11.31_ENST00000603027.1_Silent_p.T678T|ZSWIM8-AS1_ENST00000456638.2_RNA			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	678	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					AGTCAAAGTAGGTGGCACTTT	0.512																																																	0													126.0	135.0	132.0					10																	75563440		2203	4300	6503	SO:0001819	synonymous_variant	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.2034C>A	10.37:g.75563440G>T			Q2TB32|Q59H89	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.T678	ENST00000309979.6	37	c.2034	CCDS7335.1	10																																																																																			NDST2	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000166507		0.512	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	-	0.00	70	0	G	NM_003635		75563440	-1	tier1	-	no_errors	ENST00000309979	ensembl	human	known	74_37	silent	6.90	54	4	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152525591	152525591	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:152525591C>T	ENST00000172853.10	-	39	4708	c.4561G>A	c.(4561-4563)Gaa>Aaa	p.E1521K	NEB_ENST00000603639.1_Missense_Mutation_p.E1521K|NEB_ENST00000397345.3_Missense_Mutation_p.E1521K|NEB_ENST00000604864.1_Missense_Mutation_p.E1521K|NEB_ENST00000427231.2_Missense_Mutation_p.E1521K|NEB_ENST00000409198.1_Missense_Mutation_p.E1521K			P20929	NEBU_HUMAN	nebulin	1521					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGAGGCAATTCAGGGTCAATA	0.423																																																	0													134.0	131.0	132.0					2																	152525591		1905	4122	6027	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4561G>A	2.37:g.152525591C>T	ENSP00000172853:p.Glu1521Lys		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.E1521K	ENST00000172853.10	37	c.4561		2	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682666	0.88542	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.06294	3.32;3.32;3.33;3.32	6.07	6.07	0.98685	.	0.212522	0.49305	D	0.000153	T	0.12092	0.0294	L	0.46157	1.445	0.80722	D	1	B	0.30104	0.268	B	0.36092	0.217	T	0.02885	-1.1098	10	0.72032	D	0.01	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1521	P20929	NEBU_HUMAN	K	1521	ENSP00000386259:E1521K;ENSP00000380505:E1521K;ENSP00000416578:E1521K;ENSP00000172853:E1521K	ENSP00000172853:E1521K	E	-	1	0	NEB	152233837	1.000000	0.71417	0.279000	0.24732	0.982000	0.71751	6.478000	0.73596	2.885000	0.99019	0.655000	0.94253	GAA	NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.423	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	47	0	C	NM_004543		152525591	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	24.64	51	17	SNP	0.995	T
NWD1	284434	genome.wustl.edu	37	19	16860996	16860996	+	Silent	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:16860996C>T	ENST00000552788.1	+	4	1543	c.1543C>T	c.(1543-1545)Ctg>Ttg	p.L515L	NWD1_ENST00000549814.1_Silent_p.L515L|NWD1_ENST00000523826.1_Silent_p.L309L|NWD1_ENST00000339803.6_Silent_p.L380L|NWD1_ENST00000379808.3_Silent_p.L515L|NWD1_ENST00000524140.2_Silent_p.L515L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	515	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AAGGAGGACGCTGAGCCCGGT	0.642																																																	0													40.0	39.0	39.0					19																	16860996		2203	4300	6503	SO:0001819	synonymous_variant	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1543C>T	19.37:g.16860996C>T			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L515	ENST00000552788.1	37	c.1543		19																																																																																			NWD1	-	superfamily_P-loop_NTPase	ENSG00000188039		0.642	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	-	0.00	38	0	C	NM_001007525		16860996	+1	tier1	-	no_errors	ENST00000379808	ensembl	human	known	74_37	silent	45.00	22	18	SNP	0.976	T
OR52K1	390036	genome.wustl.edu	37	11	4510932	4510932	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:4510932C>T	ENST00000307632.3	+	1	824	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R268S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCGTGTAGCCCGCCATGCTGC	0.507																																																	1	Substitution - Missense(1)	lung(1)											213.0	192.0	199.0					11																	4510932		2201	4298	6499	SO:0001583	missense	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.802C>T	11.37:g.4510932C>T	ENSP00000302422:p.Arg268Cys		B9EH54|Q6IFK5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R268C	ENST00000307632.3	37	c.802	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	C	3.130	-0.178651	0.06380	.	.	ENSG00000196778	ENST00000307632	T	0.37411	1.2	4.5	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.429234	0.17846	N	0.160035	T	0.28896	0.0717	L	0.42529	1.33	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.25328	-1.0135	10	0.87932	D	0	.	6.8973	0.24262	0.1728:0.7359:0.0:0.0912	.	268	Q8NGK4	O52K1_HUMAN	C	268	ENSP00000302422:R268C	ENSP00000302422:R268C	R	+	1	0	OR52K1	4467508	0.000000	0.05858	0.723000	0.30687	0.076000	0.17211	-0.593000	0.05740	1.235000	0.43724	0.411000	0.27672	CGC	OR52K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196778		0.507	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1	-	0.00	58	0	C	NM_001005171		4510932	+1	tier1	-	no_errors	ENST00000307632	ensembl	human	known	74_37	missense	35.44	51	28	SNP	0.001	T
PAPD5	64282	genome.wustl.edu	37	16	50263480	50263480	+	3'UTR	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:50263480G>T	ENST00000561678.1	+	0	2082				PAPD5_ENST00000436909.3_3'UTR|PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TATTTGATAAGTCATATGCTA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*241G>T	16.37:g.50263480G>T			B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			PAPD5	-	-	ENSG00000121274		0.299	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	-	0.00	31	0	G	NM_022447		50263480	+1	tier1	-	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	10.00	36	4	SNP	1.000	T
PAPPA2	60676	genome.wustl.edu	37	1	176679141	176679141	+	Missense_Mutation	SNP	G	G	T	rs200391413	byFrequency	TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:176679141G>T	ENST00000367662.3	+	11	4644	c.3480G>T	c.(3478-3480)atG>atT	p.M1160I		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1160					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TTTGCTACATGTATGAGGGAG	0.413																																																	0													120.0	112.0	115.0					1																	176679141		1897	4122	6019	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3480G>T	1.37:g.176679141G>T	ENSP00000356634:p.Met1160Ile		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.M1160I	ENST00000367662.3	37	c.3480	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.680263	0.00751	.	.	ENSG00000116183	ENST00000367662	T	0.40476	1.03	5.76	-3.33	0.04958	.	0.490362	0.23720	N	0.045224	T	0.06826	0.0174	N	0.00368	-1.59	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.34428	-0.9829	10	0.02654	T	1	0.0301	3.7975	0.08746	0.1742:0.4706:0.1985:0.1567	.	1160	Q9BXP8	PAPP2_HUMAN	I	1160	ENSP00000356634:M1160I	ENSP00000356634:M1160I	M	+	3	0	PAPPA2	174945764	0.594000	0.26849	0.003000	0.11579	0.222000	0.24845	-0.198000	0.09505	-0.571000	0.06014	-0.136000	0.14681	ATG	PAPPA2	-	NULL	ENSG00000116183		0.413	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	32	0	G			176679141	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.017	T
PAX5	5079	genome.wustl.edu	37	9	37006509	37006509	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:37006509G>T	ENST00000358127.4	-	4	510	c.436C>A	c.(436-438)Cca>Aca	p.P146T	PAX5_ENST00000520154.1_Missense_Mutation_p.P146T|PAX5_ENST00000520281.1_Missense_Mutation_p.P146T|PAX5_ENST00000377847.2_Missense_Mutation_p.P146T|RP11-297B17.3_ENST00000509911.2_RNA|PAX5_ENST00000377852.2_Missense_Mutation_p.P146T|PAX5_ENST00000523145.1_Missense_Mutation_p.P38T|PAX5_ENST00000523241.1_Missense_Mutation_p.P146T|PAX5_ENST00000446742.1_Missense_Mutation_p.P80T|PAX5_ENST00000414447.1_Missense_Mutation_p.P146T|PAX5_ENST00000377853.2_Missense_Mutation_p.P146T|PAX5_ENST00000522003.1_Missense_Mutation_p.P38T	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	146					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(40)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TGGTTGGGTGGCTGCTGTACT	0.413			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																			Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	40	Unknown(40)	haematopoietic_and_lymphoid_tissue(40)											189.0	184.0	186.0					9																	37006509		2203	4300	6503	SO:0001583	missense	0				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.436C>A	9.37:g.37006509G>T	ENSP00000350844:p.Pro146Thr		A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.P146T	ENST00000358127.4	37	c.436	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131166	0.56828	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847	D;D;D;D;D;D;D;D;D;D;D	0.99706	-4.05;-4.05;-4.05;-4.55;-4.53;-4.45;-6.47;-1.82;-2.41;-4.46;-4.54	5.32	5.32	0.75619	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.119717	0.56097	D	0.000022	D	0.99635	0.9866	M	0.72894	2.215	0.80722	D	1	D;B;D;D;B;B;D;D;D	0.89917	0.993;0.34;1.0;0.993;0.042;0.039;0.993;0.993;0.993	D;B;D;D;B;B;D;D;D	0.91635	0.928;0.043;0.999;0.928;0.011;0.018;0.928;0.928;0.928	D	0.98278	1.0507	10	0.54805	T	0.06	.	19.3463	0.94363	0.0:0.0:1.0:0.0	.	146;146;80;146;146;146;146;146;146	C0KTF8;C0KTF7;C0KTF9;C0KTF6;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;.;PAX5_HUMAN	T	146;38;146;146;146;146;146;80;38;38;146;146	ENSP00000350844:P146T;ENSP00000367084:P146T;ENSP00000367083:P146T;ENSP00000429637:P146T;ENSP00000429291:P146T;ENSP00000430773:P146T;ENSP00000404687:P80T;ENSP00000429359:P38T;ENSP00000429197:P38T;ENSP00000412188:P146T;ENSP00000367078:P146T	ENSP00000350844:P146T	P	-	1	0	PAX5	36996509	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.089000	0.94137	2.639000	0.89480	0.650000	0.86243	CCA	PAX5	-	NULL	ENSG00000196092		0.413	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1		0.00	52	0	G			37006509	-1			no_errors	ENST00000358127	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
PCDH7	5099	genome.wustl.edu	37	4	30724999	30725000	+	In_Frame_Ins	INS	-	-	GCA			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:30724999_30725000insGCA	ENST00000361762.2	+	1	2963_2964	c.1955_1956insGCA	c.(1954-1959)ttgcag>ttGCAgcag	p.653_654insQ	PCDH7_ENST00000543491.1_In_Frame_Ins_p.653_654insQ	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	653	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AAAGAAAACTTGCAGCCCAACA	0.475																																																	0																																										SO:0001652	inframe_insertion	0			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1956_1958dupGCA	4.37:g.30725000_30725002dupGCA	ENSP00000355243:p.Gln653_Gln653dup		O60246|O60247|Q4W5C4	In_Frame_Ins	INS	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.654in_frame_insQ	ENST00000361762.2	37	c.1955_1956	CCDS33971.1	4																																																																																			PCDH7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000169851		0.475	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1		0.00	37	0	-	NM_032457, NM_002589		30725000	+1	tier1		no_errors	ENST00000543491	ensembl	human	known	74_37	in_frame_ins	36.17	30	17	INS	1.000:0.999	GCA
PCDHA10	56139	genome.wustl.edu	37	5	140236873	140236873	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr5:140236873C>T	ENST00000307360.5	+	1	1240	c.1240C>T	c.(1240-1242)Cgc>Tgc	p.R414C	PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.R414C|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	414	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R414S(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTCTGGACCGCGAGAGGGT	0.642																																																	2	Substitution - Missense(2)	lung(2)											137.0	125.0	129.0					5																	140236873		2197	4274	6471	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1240C>T	5.37:g.140236873C>T	ENSP00000304234:p.Arg414Cys		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R414C	ENST00000307360.5	37	c.1240	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831543	0.32329	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.59772	4.64;0.24	3.96	2.09	0.27110	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.83138	0.5189	H	0.97896	4.1	0.37822	D	0.92843	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.88137	0.2842	9	0.87932	D	0	.	12.4563	0.55706	0.3052:0.6948:0.0:0.0	.	414;414;414	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	C	414	ENSP00000421030:R414C;ENSP00000304234:R414C	ENSP00000304234:R414C	R	+	1	0	PCDHA10	140217057	0.152000	0.22762	0.986000	0.45419	0.296000	0.27459	-0.148000	0.10219	0.402000	0.25451	0.556000	0.70494	CGC	PCDHA10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000250120		0.642	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	-	0.00	102	0	C	NM_018901		140236873	+1	tier1	-	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	62.09	58	95	SNP	1.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233394198	233394198	+	Silent	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:233394198G>A	ENST00000258229.9	-	5	1644	c.1410C>T	c.(1408-1410)taC>taT	p.Y470Y	PCNXL2_ENST00000430153.1_De_novo_Start_OutOfFrame	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	470						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CCCCAGATCCGTAGCCAGAAC	0.562																																																	0													58.0	61.0	60.0					1																	233394198		1981	4158	6139	SO:0001819	synonymous_variant	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1410C>T	1.37:g.233394198G>A			O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	pfam_Pecanex,superfamily_Trypsin-like_Pept_dom	p.Y470	ENST00000258229.9	37	c.1410	CCDS44335.1	1																																																																																			PCNXL2	-	NULL	ENSG00000135749		0.562	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	-	0.00	23	0	G	NM_014801		233394198	-1	tier1	-	no_errors	ENST00000258229	ensembl	human	known	74_37	silent	52.08	23	25	SNP	0.026	A
PDPR	55066	genome.wustl.edu	37	16	70190707	70190707	+	Silent	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:70190707C>G	ENST00000288050.4	+	19	3522	c.2565C>G	c.(2563-2565)ctC>ctG	p.L855L	RP11-296I10.3_ENST00000502126.1_RNA|PDPR_ENST00000567046.1_Silent_p.L213L|PDPR_ENST00000398122.3_Silent_p.L755L|PDPR_ENST00000568530.1_Silent_p.L855L|PDPR_ENST00000542659.1_Silent_p.L200L|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_3'UTR	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	855					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		AGGCCAAGCTCTACCCTGTCG	0.572																																																	0													69.0	83.0	78.0					16																	70190707		2095	4219	6314	SO:0001819	synonymous_variant	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2565C>G	16.37:g.70190707C>G			A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.L855	ENST00000288050.4	37	c.2565	CCDS45520.1	16																																																																																			PDPR	-	NULL	ENSG00000090857		0.572	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	109	0	C	NM_017990		70190707	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	silent	11.35	125	16	SNP	1.000	G
PHF8	23133	genome.wustl.edu	37	X	53970565	53970565	+	Splice_Site	SNP	A	A	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrX:53970565A>C	ENST00000357988.5	-	20	3116		c.e20+1		PHF8_ENST00000338946.6_Splice_Site|PHF8_ENST00000338154.6_Splice_Site|PHF8_ENST00000322659.8_Splice_Site	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8						brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GTCAGCACCTACCTGCTGGGC	0.562																																																	0													45.0	34.0	38.0					X																	53970565		2203	4300	6503	SO:0001630	splice_region_variant	0			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2757+1T>G	X.37:g.53970565A>C			B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Splice_Site	SNP	-	e20+2	ENST00000357988.5	37	c.2757+2	CCDS55420.1	X	.	.	.	.	.	.	.	.	.	.	A	19.02	3.745293	0.69418	.	.	ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000396282;ENST00000443302;ENST00000322659	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7721	0.57427	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHF8	53987290	1.000000	0.71417	0.996000	0.52242	0.948000	0.59901	7.663000	0.83820	1.653000	0.50694	0.427000	0.28365	.	PHF8	-	-	ENSG00000172943		0.562	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	-	0.00	38	0	A	NM_015107	Intron	53970565	-1	tier1	-	no_errors	ENST00000357988	ensembl	human	known	74_37	splice_site	68.42	18	39	SNP	1.000	C
PIGS	94005	genome.wustl.edu	37	17	26883215	26883215	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:26883215G>A	ENST00000308360.7	-	10	1525	c.1150C>T	c.(1150-1152)Cga>Tga	p.R384*	PIGS_ENST00000465444.1_5'Flank|PIGS_ENST00000395346.2_Nonsense_Mutation_p.R376*|PIGS_ENST00000543734.1_Nonsense_Mutation_p.R323*	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	384					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					TCCATCACTCGCACCATGTCC	0.507																																																	0													234.0	170.0	192.0					17																	26883215		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1150C>T	17.37:g.26883215G>A	ENSP00000309430:p.Arg384*		Q6UVX6	Nonsense_Mutation	SNP	pfam_PtdIno-glycan_biosynth_class_S	p.R384*	ENST00000308360.7	37	c.1150	CCDS11235.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.490754	0.98316	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000268758;ENST00000543734	.	.	.	5.63	5.63	0.86233	.	0.594940	0.17856	N	0.159684	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0204	15.6505	0.77088	0.0:0.1376:0.8624:0.0	.	.	.	.	X	376;384;127;323	.	ENSP00000268758:R127X	R	-	1	2	PIGS	23907342	0.599000	0.26891	0.857000	0.33713	0.982000	0.71751	3.745000	0.55119	2.653000	0.90120	0.563000	0.77884	CGA	PIGS	-	pfam_PtdIno-glycan_biosynth_class_S	ENSG00000087111		0.507	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGS	HGNC	protein_coding	OTTHUMT00000255833.3	-	0.00	82	0	G	NM_033198		26883215	-1	tier1	-	no_errors	ENST00000308360	ensembl	human	known	74_37	nonsense	12.36	78	11	SNP	0.605	A
PLA2G12A	81579	genome.wustl.edu	37	4	110650791	110650791	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:110650791C>T	ENST00000243501.5	-	1	442	c.175G>A	c.(175-177)Gag>Aag	p.E59K	PLA2G12A_ENST00000502283.1_Missense_Mutation_p.E59K	NM_030821.4	NP_110448.2	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA	59					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			kidney(1)|lung(1)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		AGACCGTCCTCGCCTCCCAGG	0.632																																																	0													49.0	44.0	46.0					4																	110650791		2203	4300	6503	SO:0001583	missense	0				CCDS3686.1	4q25	2010-11-24	2004-01-13	2004-01-14	ENSG00000123739	ENSG00000123739	3.1.1.4		18554	protein-coding gene	gene with protein product		611652	"""phospholipase A2, group XII"""	PLA2G12		11031251	Standard	NM_030821		Approved		uc003hzp.3	Q9BZM1	OTTHUMG00000131915	ENST00000243501.5:c.175G>A	4.37:g.110650791C>T	ENSP00000243501:p.Glu59Lys		Q9BZ89	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2_dom	p.E59K	ENST00000243501.5	37	c.175	CCDS3686.1	4	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045317	0.93685	.	.	ENSG00000123739	ENST00000243501;ENST00000502283	.	.	.	3.97	3.97	0.46021	Phospholipase A2 (1);	0.232816	0.39146	N	0.001459	T	0.30696	0.0773	N	0.14661	0.345	0.41460	D	0.988035	P;P	0.39520	0.676;0.676	B;B	0.35413	0.202;0.202	T	0.29305	-1.0016	9	0.05525	T	0.97	-17.5723	16.6038	0.84823	0.0:1.0:0.0:0.0	.	59;59	Q542Y6;Q9BZM1	.;PG12A_HUMAN	K	59	.	ENSP00000243501:E59K	E	-	1	0	PLA2G12A	110870240	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.702000	0.54800	2.190000	0.69967	0.467000	0.42956	GAG	PLA2G12A	-	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2_dom	ENSG00000123739		0.632	PLA2G12A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLA2G12A	HGNC	protein_coding	OTTHUMT00000254868.3	-	0.00	38	0	C			110650791	-1	tier1	-	no_errors	ENST00000243501	ensembl	human	known	74_37	missense	22.64	41	12	SNP	1.000	T
POLH	5429	genome.wustl.edu	37	6	43565542	43565542	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:43565542G>A	ENST00000372236.4	+	5	895	c.600G>A	c.(598-600)atG>atA	p.M200I	POLH_ENST00000372226.1_Missense_Mutation_p.M200I|POLH_ENST00000535400.1_Missense_Mutation_p.M138I	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TGGAGGAAATGAGAGCAGCCA	0.433								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																																								0													119.0	127.0	124.0					6																	43565542		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.600G>A	6.37:g.43565542G>A	ENSP00000361310:p.Met200Ile		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	p.M200I	ENST00000372236.4	37	c.600	CCDS4902.1	6	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297343	0.40694	.	.	ENSG00000170734	ENST00000372236;ENST00000535400;ENST00000372226	T;T;T	0.73575	-0.76;-0.76;-0.76	5.4	5.4	0.78164	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.208574	0.56097	D	0.000022	T	0.26412	0.0645	N	0.00707	-1.245	0.80722	D	1	B;B	0.25351	0.124;0.124	B;B	0.30943	0.122;0.1	T	0.51756	-0.8665	10	0.02654	T	1	-20.1829	18.003	0.89203	0.0:0.0:1.0:0.0	.	138;200	B4DG64;Q9Y253	.;POLH_HUMAN	I	200;138;200	ENSP00000361310:M200I;ENSP00000442102:M138I;ENSP00000361300:M200I	ENSP00000361300:M200I	M	+	3	0	POLH	43673520	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.123000	0.77176	2.537000	0.85549	0.573000	0.79308	ATG	POLH	-	pfam_DNA_repair_prot_UmuC-like,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	ENSG00000170734		0.433	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLH	HGNC	protein_coding	OTTHUMT00000040666.1	-	0.00	50	0	G	NM_006502		43565542	+1	tier1	-	no_errors	ENST00000372236	ensembl	human	known	74_37	missense	17.11	63	13	SNP	1.000	A
POM121L1P	25812	genome.wustl.edu	37	22	22981704	22981706	+	RNA	DEL	GGT	GGT	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	GGT	GGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr22:22981704_22981706delGGT	ENST00000402027.1	-	0	1875_1877					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		ATGGGCCGTGGGTGGTGTTGTCA	0.631																																																	0																																												0					22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22981707_22981709delGGT				RNA	DEL	-	NULL	ENST00000402027.1	37	NULL		22																																																																																			POM121L1P	-	-	ENSG00000183169		0.631	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	POM121L1P	HGNC	pseudogene	OTTHUMT00000468457.1		0.00	118	0	GGT	NR_024591		22981706	-1			no_errors	ENST00000402027	ensembl	human	known	74_37	rna	6.72	111	8	DEL	0.159:0.164:0.169	0
PPP1R12B	4660	genome.wustl.edu	37	1	202414308	202414308	+	Intron	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:202414308G>T	ENST00000608999.1	+	12	1820				PPP1R12B_ENST00000336894.4_Intron	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GCCTCTTCTTGCCCTGCACCA	0.488																																																	0																																										SO:0001627	intron_variant	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1667+2608G>T	1.37:g.202414308G>T			A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	RNA	SNP	-	NULL	ENST00000608999.1	37	NULL	CCDS1426.1	1																																																																																			PPP1R12B	-	-	ENSG00000077157		0.488	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3	-	0.00	43	0	G	NM_032105		202414308	+1	tier1	-	no_errors	ENST00000434615	ensembl	human	known	74_37	rna	5.32	89	5	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	68972969	68972969	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:68972969G>T	ENST00000288368.4	+	11	1571	c.1294G>T	c.(1294-1296)Gtg>Ttg	p.V432L	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	432	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.V432M(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGAGGAAGGCGTGCACTTGGG	0.358																																																	1	Substitution - Missense(1)	pancreas(1)											111.0	113.0	112.0					8																	68972969		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1294G>T	8.37:g.68972969G>T	ENSP00000288368:p.Val432Leu		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V432L	ENST00000288368.4	37	c.1294	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.209776	0.95069	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.25579	1.79	5.69	5.69	0.88448	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.69463	2.115	0.80722	D	1	P;D;D	0.61697	0.947;0.99;0.987	P;P;P	0.62740	0.863;0.906;0.904	T	0.49194	-0.8965	10	0.87932	D	0	.	19.817	0.96573	0.0:0.0:1.0:0.0	.	432;432;432	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	L	432	ENSP00000288368:V432L	ENSP00000288368:V432L	V	+	1	0	PREX2	69135523	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.062000	0.89475	2.678000	0.91216	0.655000	0.94253	GTG	PREX2	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000046889		0.358	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1		0.00	19	0	G	NM_025170		68972969	+1			no_errors	ENST00000288368	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
PRKD2	25865	genome.wustl.edu	37	19	47201016	47201016	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:47201016C>A	ENST00000291281.4	-	8	1438	c.1213G>T	c.(1213-1215)Gtt>Ttt	p.V405F	PRKD2_ENST00000595515.1_Missense_Mutation_p.V405F|PRKD2_ENST00000600194.1_Missense_Mutation_p.V248F|PRKD2_ENST00000433867.1_Missense_Mutation_p.V405F|PRKD2_ENST00000601806.1_Missense_Mutation_p.V248F			Q9BZL6	KPCD2_HUMAN	protein kinase D2	405	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CTGTAATGAACCACCCAACCC	0.657																																																	0													115.0	91.0	99.0					19																	47201016		2203	4300	6503	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1213G>T	19.37:g.47201016C>A	ENSP00000291281:p.Val405Phe		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.V405F	ENST00000291281.4	37	c.1213	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	c	34	5.371932	0.95923	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.75938	-0.98;-0.98	4.16	4.16	0.48862	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.53938	U	0.000051	D	0.87330	0.6150	M	0.89287	3.02	0.80722	D	1	B;P	0.46457	0.084;0.878	B;D	0.63033	0.377;0.91	D	0.89972	0.4094	10	0.87932	D	0	-20.1943	15.7239	0.77736	0.0:1.0:0.0:0.0	.	405;405	E7ER94;Q9BZL6	.;KPCD2_HUMAN	F	405	ENSP00000291281:V405F;ENSP00000393978:V405F	ENSP00000291281:V405F	V	-	1	0	PRKD2	51892856	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.495000	0.66912	2.338000	0.79540	0.537000	0.68136	GTT	PRKD2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105287		0.657	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1	-	0.00	23	0	C	NM_016457		47201016	-1	tier1	-	no_errors	ENST00000291281	ensembl	human	known	74_37	missense	22.73	34	10	SNP	1.000	A
PRRG1	5638	genome.wustl.edu	37	X	37312610	37312611	+	Frame_Shift_Ins	INS	-	-	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrX:37312610_37312611insC	ENST00000542554.1	+	5	665_666	c.393_394insC	c.(394-396)cccfs	p.P132fs	PRRG1_ENST00000449135.2_Frame_Shift_Ins_p.P132fs|PRRG1_ENST00000491253.1_3'UTR|PRRG1_ENST00000543642.1_Frame_Shift_Ins_p.P132fs|PRRG1_ENST00000378628.4_Frame_Shift_Ins_p.P132fs|TM4SF2_ENST00000465127.1_Intron	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	132	Poly-Pro.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P135fs*3(1)|p.P134fs*19(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						TTATCACCCCACCCCCCCCACC	0.485																																																	2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	ovary(2)																																								SO:0001589	frameshift_variant	0			AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.401dupC	X.37:g.37312618_37312618dupC	ENSP00000444278:p.Pro132fs		B2R7A3|C9JXL7|D3DWA9|Q5JT66	Frame_Shift_Ins	INS	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.P134fs	ENST00000542554.1	37	c.393_394	CCDS14239.1	X																																																																																			PRRG1	-	NULL	ENSG00000130962		0.485	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG1	HGNC	protein_coding	OTTHUMT00000056228.2		0.00	36	0	-	NM_000950		37312611	+1	tier1		no_errors	ENST00000378628	ensembl	human	known	74_37	frame_shift_ins	19.64	45	11	INS	0.008:0.109	C
RANBP3	8498	genome.wustl.edu	37	19	5918644	5918644	+	Silent	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:5918644G>T	ENST00000340578.6	-	15	1393	c.1336C>A	c.(1336-1338)Cgg>Agg	p.R446R	RANBP3_ENST00000541471.1_Silent_p.R318R|RANBP3_ENST00000034275.8_Silent_p.R378R|RANBP3_ENST00000439268.2_Silent_p.R441R|RANBP3_ENST00000591092.1_Silent_p.R373R	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	446	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CCCTGGGTCCGCATCACTACA	0.602																																																	0													110.0	122.0	118.0					19																	5918644		2103	4204	6307	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1336C>A	19.37:g.5918644G>T			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.R446	ENST00000340578.6	37	c.1336	CCDS42478.1	19																																																																																			RANBP3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000031823		0.602	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1		0.00	18	0	G	NM_007322		5918644	-1			no_errors	ENST00000340578	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	T
PSG4	5672	genome.wustl.edu	37	19	43699171	43699171	+	Missense_Mutation	SNP	C	C	T	rs576741968		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:43699171C>T	ENST00000405312.3	-	4	1201	c.964G>A	c.(964-966)Gac>Aac	p.D322N	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Missense_Mutation_p.D229N	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	322	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				GTGACTGGGTCACTGCGGATG	0.488																																																	0													120.0	111.0	114.0					19																	43699171		2201	4293	6494	SO:0001583	missense	0				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.964G>A	19.37:g.43699171C>T	ENSP00000384770:p.Asp322Asn		E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D322N	ENST00000405312.3	37	c.964	CCDS46093.1	19	.	.	.	.	.	.	.	.	.	.	c	7.094	0.572791	0.13623	.	.	ENSG00000243137	ENST00000405312;ENST00000433626	T;T	0.10763	2.84;2.84	1.45	1.45	0.22620	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.14700	0.0355	M	0.79693	2.465	0.20764	N	0.999859	B;B	0.14012	0.002;0.009	B;B	0.23574	0.033;0.047	T	0.22836	-1.0205	9	0.33940	T	0.23	.	6.2719	0.20959	0.0:1.0:0.0:0.0	.	229;322	E7EX79;Q00888	.;PSG4_HUMAN	N	322;229	ENSP00000384770:D322N;ENSP00000387864:D229N	ENSP00000384770:D322N	D	-	1	0	PSG4	48391011	0.918000	0.31147	0.075000	0.20258	0.043000	0.13939	0.740000	0.26188	0.774000	0.33427	0.391000	0.25812	GAC	PSG4	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000243137		0.488	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG4	HGNC	protein_coding	OTTHUMT00000323073.1	-	0.00	181	0	C	NM_213633		43699171	-1	tier1	-	no_errors	ENST00000405312	ensembl	human	known	74_37	missense	42.57	143	106	SNP	0.745	T
RASA3	22821	genome.wustl.edu	37	13	114793367	114793367	+	Silent	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr13:114793367C>A	ENST00000334062.7	-	6	607	c.486G>T	c.(484-486)ggG>ggT	p.G162G	RASA3_ENST00000542651.1_Missense_Mutation_p.A131S|RASA3_ENST00000389544.4_Silent_p.G130G	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	162	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GGTCACATTGCCCATTCACGA	0.637																																																	0													136.0	102.0	113.0					13																	114793367		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.486G>T	13.37:g.114793367C>A			A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A131S	ENST00000334062.7	37	c.391	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	9.469	1.095166	0.20471	.	.	ENSG00000185989	ENST00000542651	T	0.19105	2.17	4.38	1.03	0.20045	.	.	.	.	.	T	0.11067	0.0270	.	.	.	0.21527	N	0.999651	.	.	.	.	.	.	T	0.30650	-0.9971	5	.	.	.	.	0.3898	0.00408	0.1916:0.2208:0.1903:0.3973	.	.	.	.	S	131	ENSP00000439008:A131S	.	A	-	1	0	RASA3	113811469	0.697000	0.27767	0.997000	0.53966	0.021000	0.10359	-0.358000	0.07641	-0.002000	0.14469	-0.333000	0.08304	GCA	RASA3	-	NULL	ENSG00000185989		0.637	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	-	0.00	44	0	C	NM_007368		114793367	-1	tier1	-	no_errors	ENST00000542651	ensembl	human	known	74_37	missense	43.75	27	21	SNP	0.997	A
RGS6	9628	genome.wustl.edu	37	14	72939647	72939647	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:72939647G>A	ENST00000553530.1	+	9	811	c.604G>A	c.(604-606)Gtc>Atc	p.V202I	RGS6_ENST00000556437.1_Missense_Mutation_p.V202I|RGS6_ENST00000407322.4_Missense_Mutation_p.V202I|RGS6_ENST00000554782.1_Missense_Mutation_p.V63I|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000406236.4_Missense_Mutation_p.V202I|RGS6_ENST00000553525.1_Missense_Mutation_p.V202I|RGS6_ENST00000555571.1_Missense_Mutation_p.V202I|RGS6_ENST00000434263.2_Missense_Mutation_p.V133I|RGS6_ENST00000355512.6_Missense_Mutation_p.V202I|RGS6_ENST00000343854.6_Missense_Mutation_p.V202I|RGS6_ENST00000402788.2_Missense_Mutation_p.V202I|RGS6_ENST00000404301.2_Missense_Mutation_p.V202I	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	202					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CTTTTGGGATGTCCACAGGCC	0.373																																					Ovarian(143;1926 2468 21071 48641)												0													138.0	154.0	149.0					14																	72939647		2203	4300	6503	SO:0001583	missense	0			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.604G>A	14.37:g.72939647G>A	ENSP00000452331:p.Val202Ile		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.V202I	ENST00000553530.1	37	c.604	CCDS9808.1	14	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973868	0.92919	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.48836	0.93;0.82;0.82;0.93;0.83;0.95;0.96;0.92;0.82;0.8;0.93;1.05	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.69242	0.3089	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.71674	0.996;0.969;0.996;0.998	D;D;D;D	0.79108	0.992;0.918;0.992;0.927	T	0.70464	-0.4864	10	0.87932	D	0	-6.7768	19.6166	0.95636	0.0:0.0:1.0:0.0	.	133;202;207;202	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	I	202;202;202;202;202;202;202;202;202;202;174;133;63;63	ENSP00000451030:V202I;ENSP00000450936:V202I;ENSP00000452331:V202I;ENSP00000451855:V202I;ENSP00000347699:V202I;ENSP00000385243:V202I;ENSP00000384218:V202I;ENSP00000384612:V202I;ENSP00000383953:V202I;ENSP00000341199:V202I;ENSP00000412144:V133I;ENSP00000451912:V63I	ENSP00000341199:V202I	V	+	1	0	RGS6	72009400	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.011000	0.93618	2.735000	0.93741	0.650000	0.86243	GTC	RGS6	-	NULL	ENSG00000182732		0.373	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	HGNC	protein_coding	OTTHUMT00000413033.2	-	0.00	39	0	G			72939647	+1	tier1	-	no_errors	ENST00000553525	ensembl	human	known	74_37	missense	10.00	54	6	SNP	1.000	A
RP1	6101	genome.wustl.edu	37	8	55539064	55539064	+	Silent	SNP	G	G	T	rs369939931		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:55539064G>T	ENST00000220676.1	+	4	2770	c.2622G>T	c.(2620-2622)ggG>ggT	p.G874G		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	874					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AACGTAAAGGGGATAAAGTGA	0.353																																					Colon(91;1014 1389 7634 14542 40420)												0													36.0	39.0	38.0					8																	55539064		2195	4297	6492	SO:0001819	synonymous_variant	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2622G>T	8.37:g.55539064G>T				Silent	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.G874	ENST00000220676.1	37	c.2622	CCDS6160.1	8																																																																																			RP1	-	NULL	ENSG00000104237		0.353	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	30	0	G	NM_006269		55539064	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	silent	14.67	64	11	SNP	0.153	T
SEC23A	10484	genome.wustl.edu	37	14	39532558	39532558	+	Silent	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr14:39532558G>A	ENST00000307712.6	-	12	1885	c.1368C>T	c.(1366-1368)acC>acT	p.T456T	SEC23A_ENST00000553925.1_5'Flank|SEC23A_ENST00000536508.1_Silent_p.T330T|SEC23A_ENST00000537403.1_Silent_p.T254T|SEC23A_ENST00000545328.2_Silent_p.T427T	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	456					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		ATATGGCTAAGGTTGTAGTGG	0.368																																																	0													121.0	105.0	110.0					14																	39532558		2203	4300	6503	SO:0001819	synonymous_variant	0			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1368C>T	14.37:g.39532558G>A			B2R5P4|B3KXI2|Q8NE16	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.T456	ENST00000307712.6	37	c.1368	CCDS9668.1	14																																																																																			SEC23A	-	pfam_Sec23_24_beta_S	ENSG00000100934		0.368	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	-	0.00	57	0	G			39532558	-1	tier1	-	no_errors	ENST00000307712	ensembl	human	known	74_37	silent	25.00	42	14	SNP	0.926	A
SIGLEC9	27180	genome.wustl.edu	37	19	51633206	51633206	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:51633206C>T	ENST00000250360.3	+	7	1329	c.1262C>T	c.(1261-1263)tCt>tTt	p.S421F	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	421					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCCCCAGCTTCTGCCCGCTCC	0.617																																																	0													68.0	71.0	70.0					19																	51633206		2203	4300	6503	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1262C>T	19.37:g.51633206C>T	ENSP00000250360:p.Ser421Phe		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.S421F	ENST00000250360.3	37	c.1262	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	7.315	0.615696	0.14129	.	.	ENSG00000129450	ENST00000250360	T	0.10668	2.85	1.96	-3.92	0.04155	.	.	.	.	.	T	0.04272	0.0118	N	0.14661	0.345	0.09310	N	1	B	0.33694	0.421	B	0.26693	0.072	T	0.31280	-0.9949	9	0.56958	D	0.05	.	2.4026	0.04405	0.4262:0.2573:0.0:0.3165	.	421	Q9Y336	SIGL9_HUMAN	F	421	ENSP00000250360:S421F	ENSP00000250360:S421F	S	+	2	0	SIGLEC9	56325018	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.449000	0.21744	-0.981000	0.03520	-0.351000	0.07748	TCT	SIGLEC9	-	NULL	ENSG00000129450		0.617	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	-	0.00	21	0	C	NM_014441		51633206	+1	tier1	-	no_errors	ENST00000250360	ensembl	human	known	74_37	missense	17.50	33	7	SNP	0.000	T
SLC13A4	26266	genome.wustl.edu	37	7	135406264	135406264	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr7:135406264G>A	ENST00000354042.4	-	2	796	c.107C>T	c.(106-108)tCg>tTg	p.S36L		NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	36					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						GTAAGCACACGAGGCCTCCTG	0.602																																																	0													50.0	41.0	44.0					7																	135406264		2203	4300	6503	SO:0001583	missense	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.107C>T	7.37:g.135406264G>A	ENSP00000297282:p.Ser36Leu		A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.S36L	ENST00000354042.4	37	c.107	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258102	0.39896	.	.	ENSG00000164707	ENST00000354042	T	0.02656	4.21	5.17	5.17	0.71159	.	0.471664	0.22073	N	0.065006	T	0.02767	0.0083	N	0.25890	0.77	0.09310	N	0.999995	P	0.38455	0.632	B	0.34385	0.181	T	0.51004	-0.8760	10	0.34782	T	0.22	.	14.0474	0.64712	0.0:0.0:1.0:0.0	.	36	Q9UKG4	S13A4_HUMAN	L	36	ENSP00000297282:S36L	ENSP00000297282:S36L	S	-	2	0	SLC13A4	135056804	0.979000	0.34478	0.034000	0.17996	0.581000	0.36288	6.696000	0.74598	2.706000	0.92434	0.557000	0.71058	TCG	SLC13A4	-	pfam_Na/sul_symport	ENSG00000164707		0.602	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	-	0.00	24	0	G	NM_012450		135406264	-1	tier1	-	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.057	A
SLC6A3	6531	genome.wustl.edu	37	5	1403165	1403165	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr5:1403165G>T	ENST00000270349.9	-	13	1766	c.1639C>A	c.(1639-1641)Cac>Aac	p.H547N	SLC6A3_ENST00000453492.2_Missense_Mutation_p.H547N	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	547					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GCTCCGTAGTGGGGGGGTCTG	0.617																																																	0													64.0	52.0	56.0					5																	1403165		2203	4300	6503	SO:0001583	missense	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1639C>A	5.37:g.1403165G>T	ENSP00000270349:p.His547Asn		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.H547N	ENST00000270349.9	37	c.1639	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	-	3.314	-0.140109	0.06669	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	T;T	0.73789	-0.78;-0.78	4.04	3.04	0.35103	.	0.389804	0.25900	N	0.027570	T	0.44498	0.1296	N	0.02539	-0.55	0.27195	N	0.960308	B	0.02656	0.0	B	0.06405	0.002	T	0.29761	-1.0001	10	0.22706	T	0.39	.	7.9778	0.30166	0.0:0.0:0.5615:0.4385	.	547	Q01959	SC6A3_HUMAN	N	547	ENSP00000270349:H547N;ENSP00000399806:H547N	ENSP00000270349:H547N	H	-	1	0	SLC6A3	1456165	0.998000	0.40836	0.979000	0.43373	0.436000	0.31835	3.001000	0.49488	1.815000	0.52974	0.298000	0.19748	CAC	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport_dopamine	ENSG00000142319		0.617	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	-	0.00	27	0	G	NM_001044		1403165	-1	tier1	-	no_errors	ENST00000270349	ensembl	human	known	74_37	missense	23.91	35	11	SNP	0.931	T
SLC9A5	6553	genome.wustl.edu	37	16	67289823	67289823	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr16:67289823G>T	ENST00000299798.11	+	5	966	c.901G>T	c.(901-903)Gcc>Tcc	p.A301S	SLC9A5_ENST00000561472.2_3'UTR	NM_004594.2	NP_004585.1	Q14940	SL9A5_HUMAN	solute carrier family 9, subfamily A (NHE5, cation proton antiporter 5), member 5	301					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		CTCGCTCTCCGCCATTCTTGC	0.617																																																	0													28.0	29.0	29.0					16																	67289823		2122	4254	6376	SO:0001583	missense	0				CCDS42178.1	16q22.1	2013-05-22	2012-03-22		ENSG00000135740	ENSG00000135740		"""Solute carriers"""	11078	protein-coding gene	gene with protein product		600477	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 5"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 5"""			7759094, 9933642	Standard	NM_004594		Approved	NHE5	uc002esm.3	Q14940	OTTHUMG00000172935	ENST00000299798.11:c.901G>T	16.37:g.67289823G>T	ENSP00000299798:p.Ala301Ser		A5PKY7|Q9Y626	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.A301S	ENST00000299798.11	37	c.901	CCDS42178.1	16	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354061	0.61293	.	.	ENSG00000135740	ENST00000299798	T	0.15718	2.4	5.83	5.83	0.93111	Cation/H+ exchanger (1);	0.053861	0.64402	D	0.000001	T	0.12646	0.0307	L	0.27944	0.81	0.45403	D	0.998385	P	0.43607	0.812	B	0.36534	0.227	T	0.02567	-1.1140	10	0.46703	T	0.11	.	14.0005	0.64431	0.0:0.0:0.8489:0.1511	.	301	Q14940	SL9A5_HUMAN	S	301	ENSP00000299798:A301S	ENSP00000299798:A301S	A	+	1	0	SLC9A5	65847324	0.974000	0.33945	0.983000	0.44433	0.991000	0.79684	1.629000	0.37071	2.775000	0.95449	0.650000	0.86243	GCC	SLC9A5	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000135740		0.617	SLC9A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A5	HGNC	protein_coding	OTTHUMT00000421386.1		0.00	24	0	G			67289823	+1			no_errors	ENST00000299798	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
SLC9A7	84679	genome.wustl.edu	37	X	46502752	46502752	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chrX:46502752G>T	ENST00000328306.4	-	12	1557	c.1532C>A	c.(1531-1533)aCg>aAg	p.T511K		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	511					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)	p.T511M(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						AAGGGTGGTCGTGAACATCAT	0.527																																					Pancreas(118;454 1696 1930 13865 39976)												1	Substitution - Missense(1)	endometrium(1)											110.0	67.0	82.0					X																	46502752		2203	4300	6503	SO:0001583	missense	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1532C>A	X.37:g.46502752G>T	ENSP00000330320:p.Thr511Lys		O75827|Q5JXP9	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T511K	ENST00000328306.4	37	c.1532	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	G	32	5.122340	0.94429	.	.	ENSG00000065923	ENST00000328306	T	0.16324	2.35	5.33	5.33	0.75918	Cation/H+ exchanger (1);	0.229367	0.46145	D	0.000306	T	0.51736	0.1692	M	0.92691	3.335	0.58432	D	0.999995	D	0.55385	0.971	D	0.64144	0.922	T	0.65409	-0.6175	10	0.87932	D	0	.	18.1198	0.89567	0.0:0.0:1.0:0.0	.	511	Q96T83	SL9A7_HUMAN	K	511	ENSP00000330320:T511K	ENSP00000330320:T511K	T	-	2	0	SLC9A7	46387696	1.000000	0.71417	0.976000	0.42696	0.953000	0.61014	7.476000	0.81055	2.215000	0.71742	0.468000	0.43344	ACG	SLC9A7	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000065923		0.527	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1		0.00	25	0	G	NM_032591		46502752	-1			no_errors	ENST00000328306	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
SLFNL1	200172	genome.wustl.edu	37	1	41483479	41483479	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:41483479A>G	ENST00000359345.1	-	2	3361	c.785T>C	c.(784-786)gTa>gCa	p.V262A	SLFNL1_ENST00000397197.2_Missense_Mutation_p.V262A|SLFNL1_ENST00000439569.2_Missense_Mutation_p.V262A|SLFNL1_ENST00000372611.1_Missense_Mutation_p.V203A|SLFNL1_ENST00000302946.8_Missense_Mutation_p.V262A|SLFNL1_ENST00000372613.2_Missense_Mutation_p.V262A	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	262							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GCTGTCCTCTACTCCCACGAG	0.682																																																	0													51.0	49.0	49.0					1																	41483479		2203	4299	6502	SO:0001583	missense	0			BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.785T>C	1.37:g.41483479A>G	ENSP00000352299:p.Val262Ala		A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.V262A	ENST00000359345.1	37	c.785	CCDS460.1	1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.358343	0.41801	.	.	ENSG00000171790	ENST00000302946;ENST00000372613;ENST00000372611;ENST00000359345;ENST00000439569;ENST00000397197	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.42	4.28	0.50868	.	0.393405	0.21576	N	0.072339	T	0.71888	0.3393	M	0.87381	2.88	0.34529	D	0.708964	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.67725	0.941;0.921;0.953	T	0.80350	-0.1419	10	0.87932	D	0	-34.6004	8.6956	0.34293	0.8308:0.0:0.0:0.1692	.	262;203;262	Q499Z3-3;Q499Z3-2;Q499Z3	.;.;SLNL1_HUMAN	A	262;262;203;262;262;262	ENSP00000304401:V262A;ENSP00000361696:V262A;ENSP00000361694:V203A;ENSP00000352299:V262A;ENSP00000398938:V262A;ENSP00000380381:V262A	ENSP00000304401:V262A	V	-	2	0	SLFNL1	41256066	1.000000	0.71417	0.628000	0.29241	0.002000	0.02628	6.285000	0.72658	0.874000	0.35823	-0.516000	0.04426	GTA	SLFNL1	-	pfam_ATPase_AAA-4	ENSG00000171790		0.682	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFNL1	HGNC	protein_coding	OTTHUMT00000015650.1	-	0.00	33	0	A	NM_144990		41483479	-1	tier1	-	no_errors	ENST00000302946	ensembl	human	known	74_37	missense	41.30	27	19	SNP	0.914	G
SPDYE4	388333	genome.wustl.edu	37	17	8658868	8658868	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:8658868T>C	ENST00000328794.6	-	4	631	c.455A>G	c.(454-456)cAa>cGa	p.Q152R		NM_001128076.1	NP_001121548.1	A6NLX3	SPDE4_HUMAN	speedy/RINGO cell cycle regulator family member E4	152										breast(1)|endometrium(2)|kidney(1)	4						GCGTTGGTATTGCCACGAGAA	0.493																																																	0													109.0	93.0	98.0					17																	8658868		692	1591	2283	SO:0001583	missense	0			BC146949	CCDS45609.1	17p13.1	2013-05-08	2013-05-08			ENSG00000183318		"""Speedy homologs"""	35463	protein-coding gene	gene with protein product			"""speedy homolog E4 (Xenopus laevis)"""				Standard	NM_001128076		Approved		uc010cnz.1	A6NLX3		ENST00000328794.6:c.455A>G	17.37:g.8658868T>C	ENSP00000329522:p.Gln152Arg		B2RUZ6	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.Q152R	ENST00000328794.6	37	c.455	CCDS45609.1	17	.	.	.	.	.	.	.	.	.	.	T	4.788	0.146449	0.09134	.	.	ENSG00000183318	ENST00000328794	.	.	.	2.86	0.176	0.15049	.	0.335138	0.24815	N	0.035371	T	0.50497	0.1619	M	0.78916	2.43	0.09310	N	1	D	0.57571	0.98	P	0.55667	0.781	T	0.43180	-0.9407	9	0.62326	D	0.03	.	5.2493	0.15514	0.4742:0.0:0.0:0.5258	.	152	A6NLX3	SPDE4_HUMAN	R	152	.	ENSP00000329522:Q152R	Q	-	2	0	SPDYE4	8599593	0.008000	0.16893	0.004000	0.12327	0.007000	0.05969	-0.000000	0.12993	-0.125000	0.11703	0.338000	0.21704	CAA	SPDYE4	-	pfam_Cell_cycle_regulatory_Spy1	ENSG00000183318		0.493	SPDYE4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYE4	HGNC	protein_coding	OTTHUMT00000442494.1	-	0.00	189	0	T	NM_001128076		8658868	-1	tier1	-	no_errors	ENST00000328794	ensembl	human	known	74_37	missense	64.49	86	158	SNP	0.024	C
SPTA1	6708	genome.wustl.edu	37	1	158582626	158582626	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:158582626G>T	ENST00000368147.4	-	51	7295	c.7115C>A	c.(7114-7116)aCc>aAc	p.T2372N	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2372	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCTTCTTTGGTAATATATGA	0.453																																																	0													132.0	129.0	130.0					1																	158582626		1926	4135	6061	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.7115C>A	1.37:g.158582626G>T	ENSP00000357129:p.Thr2372Asn		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.T2372N	ENST00000368147.4	37	c.7115	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372494	0.82573	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.64085	-0.08;-0.08	5.09	5.09	0.68999	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.000000	0.33144	N	0.005239	T	0.64080	0.2566	L	0.60012	1.86	0.58432	D	0.999998	P	0.40553	0.721	P	0.49597	0.616	T	0.67902	-0.5550	10	0.87932	D	0	.	17.5944	0.88007	0.0:0.0:1.0:0.0	.	2372	P02549	SPTA1_HUMAN	N	2372;2369	ENSP00000357130:T2372N;ENSP00000357129:T2369N	ENSP00000357129:T2369N	T	-	2	0	SPTA1	156849250	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.747000	0.91610	2.795000	0.96236	0.655000	0.94253	ACC	SPTA1	-	pfam_EF-hand_Ca_insen	ENSG00000163554		0.453	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3		0.00	36	0	G	NM_003126		158582626	-1			no_errors	ENST00000368147	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
SPTAN1	6709	genome.wustl.edu	37	9	131370264	131370264	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:131370264delG	ENST00000372731.4	+	33	4390	c.4280delG	c.(4279-4281)cgtfs	p.R1427fs	SPTAN1_ENST00000358161.5_Frame_Shift_Del_p.R1427fs|SPTAN1_ENST00000372739.3_Frame_Shift_Del_p.R1427fs	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1427					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GACCAGGAGCGTGCAGACCTG	0.527																																					NSCLC(120;833 1744 2558 35612 37579)												0													95.0	101.0	99.0					9																	131370264		2203	4300	6503	SO:0001589	frameshift_variant	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4280delG	9.37:g.131370264delG	ENSP00000361816:p.Arg1427fs		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.R1427fs	ENST00000372731.4	37	c.4280	CCDS6905.1	9																																																																																			SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.527	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1		0.00	64	0	G	NM_003127		131370264	+1	tier1		no_errors	ENST00000358161	ensembl	human	known	74_37	frame_shift_del	12.16	65	9	DEL	1.000	-
ST18	9705	genome.wustl.edu	37	8	53126769	53126769	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr8:53126769T>A	ENST00000276480.7	-	7	732	c.49A>T	c.(49-51)Acc>Tcc	p.T17S		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	17					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TCACCCTCGGTTCCTTTAGAG	0.463																																																	0													219.0	173.0	188.0					8																	53126769		2203	4300	6503	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.49A>T	8.37:g.53126769T>A	ENSP00000276480:p.Thr17Ser		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.T17S	ENST00000276480.7	37	c.49	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	T	12.37	1.918238	0.33815	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.43688	0.99;0.94	5.49	4.33	0.51752	.	0.432641	0.23183	N	0.050987	T	0.30572	0.0769	L	0.29908	0.895	0.26377	N	0.976799	B	0.06786	0.001	B	0.09377	0.004	T	0.15263	-1.0443	10	0.33141	T	0.24	-0.6774	11.4119	0.49931	0.0:0.0707:0.0:0.9293	.	17	O60284	ST18_HUMAN	S	17	ENSP00000276480:T17S;ENSP00000428521:T17S	ENSP00000276480:T17S	T	-	1	0	ST18	53289322	1.000000	0.71417	0.980000	0.43619	0.823000	0.46562	2.497000	0.45354	1.032000	0.39892	0.533000	0.62120	ACC	ST18	-	NULL	ENSG00000147488		0.463	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	-	0.00	69	0	T			53126769	-1	tier1	-	no_errors	ENST00000276480	ensembl	human	known	74_37	missense	29.90	68	29	SNP	1.000	A
KIAA1731	85459	genome.wustl.edu	37	11	93464336	93464336	+	IGR	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:93464336T>C	ENST00000325212.6	+	0	8055				SNORA32_ENST00000384072.1_RNA|TAF1D_ENST00000546088.1_5'UTR|SNORA25_ENST00000384384.1_RNA|SNORA1_ENST00000384107.1_RNA|SNORA18_ENST00000384416.1_RNA|SNORD5_ENST00000459342.1_RNA|SNORA8_ENST00000384574.1_RNA|SNORD6_ENST00000365444.1_RNA|MIR1304_ENST00000408243.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731							centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTGGCTTCTGTCATCTCGTTT	0.294																																																	0																																										SO:0001628	intergenic_variant	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449		11.37:g.93464336T>C			C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	RNA	SNP	-	NULL	ENST00000325212.6	37	NULL	CCDS44708.1	11																																																																																			TAF1D	-	-	ENSG00000166012		0.294	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1D	HGNC	protein_coding	OTTHUMT00000394640.1	-	0.00	23	0	T	NM_033395		93464336	-1	tier1	-	no_errors	ENST00000530089	ensembl	human	known	74_37	rna	29.27	29	12	SNP	0.000	C
TAF1L	138474	genome.wustl.edu	37	9	32630449	32630449	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:32630449C>T	ENST00000242310.4	-	1	5218	c.5129G>A	c.(5128-5130)aGg>aAg	p.R1710K		NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1710					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTCACCCAGCCTACCTTGGCC	0.502																																																	0													175.0	161.0	166.0					9																	32630449		2203	4300	6503	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5129G>A	9.37:g.32630449C>T	ENSP00000418379:p.Arg1710Lys		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1710K	ENST00000242310.4	37	c.5129	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	4.514	0.095438	0.08681	.	.	ENSG00000122728	ENST00000242310	T	0.07444	3.19	0.149	0.149	0.14863	.	.	.	.	.	T	0.02649	0.0080	N	0.03608	-0.345	0.22017	N	0.999417	B	0.16802	0.019	B	0.14023	0.01	T	0.45673	-0.9245	9	0.02654	T	1	.	6.0152	0.19598	0.0:0.9995:0.0:5.0E-4	.	1710	Q8IZX4	TAF1L_HUMAN	K	1710	ENSP00000418379:R1710K	ENSP00000418379:R1710K	R	-	2	0	TAF1L	32620449	1.000000	0.71417	0.129000	0.21949	0.115000	0.19883	1.675000	0.37555	0.192000	0.20272	0.195000	0.17529	AGG	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.502	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	-	0.00	122	0	C			32630449	-1	tier1	-	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	65.03	57	106	SNP	0.996	T
TEC	7006	genome.wustl.edu	37	4	48141032	48141032	+	Silent	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:48141032G>A	ENST00000381501.3	-	16	1700	c.1543C>T	c.(1543-1545)Ctg>Ttg	p.L515L	TEC_ENST00000511471.2_5'Flank	NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	515	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						TGATCATCCAGAACATACCTA	0.403																																																	0													89.0	84.0	85.0					4																	48141032		2203	4300	6503	SO:0001819	synonymous_variant	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.1543C>T	4.37:g.48141032G>A			B7ZKZ6|Q3MIS5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.L515	ENST00000381501.3	37	c.1543	CCDS3481.1	4																																																																																			TEC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135605		0.403	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3		0.00	15	0	G			48141032	-1			no_errors	ENST00000381501	ensembl	human	known	74_37	silent	28.57	10	4	SNP	0.994	A
TECTA	7007	genome.wustl.edu	37	11	121000704	121000704	+	Missense_Mutation	SNP	C	C	T	rs139132568		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:121000704C>T	ENST00000392793.1	+	10	2996	c.2725C>T	c.(2725-2727)Cgc>Tgc	p.R909C	TECTA_ENST00000264037.2_Missense_Mutation_p.R909C			O75443	TECTA_HUMAN	tectorin alpha	909	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TTATCGAAGCCGCTCCAGGTG	0.562																																																	0								C	CYS/ARG	0,4406		0,0,2203	65.0	63.0	63.0		2725	5.8	1.0	11	dbSNP_134	63	4,8594	3.7+/-12.6	0,4,4295	yes	missense	TECTA	NM_005422.2	180	0,4,6498	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging	909/2156	121000704	4,13000	2203	4299	6502	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2725C>T	11.37:g.121000704C>T	ENSP00000376543:p.Arg909Cys			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.R909C	ENST00000392793.1	37	c.2725	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095954	0.76870	0.0	4.65E-4	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.77620	-1.11;-1.11	5.78	5.78	0.91487	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.060505	0.64402	D	0.000001	D	0.86802	0.6020	M	0.75085	2.285	0.53688	D	0.999972	D	0.89917	1.0	D	0.67231	0.95	D	0.87515	0.2442	10	0.66056	D	0.02	.	14.8062	0.69959	0.144:0.856:0.0:0.0	.	909	O75443	TECTA_HUMAN	C	909	ENSP00000376543:R909C;ENSP00000264037:R909C	ENSP00000264037:R909C	R	+	1	0	TECTA	120505914	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.404000	0.59735	2.742000	0.94016	0.650000	0.86243	CGC	TECTA	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000109927		0.562	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1		0.00	31	0	C	NM_005422		121000704	+1			no_errors	ENST00000264037	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
TLR10	81793	genome.wustl.edu	37	4	38776722	38776722	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr4:38776722G>C	ENST00000308973.4	-	4	1095	c.490C>G	c.(490-492)Cat>Gat	p.H164D	TLR10_ENST00000508334.1_Missense_Mutation_p.H164D|TLR10_ENST00000361424.2_Missense_Mutation_p.H164D|TLR10_ENST00000506111.1_Missense_Mutation_p.H164D|TLR10_ENST00000507953.1_5'Flank	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	164					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						AGATGCAGATGAGCAATTTTC	0.403																																																	0													63.0	66.0	65.0					4																	38776722		2202	4299	6501	SO:0001583	missense	0			AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.490C>G	4.37:g.38776722G>C	ENSP00000308925:p.His164Asp		A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.H164D	ENST00000308973.4	37	c.490	CCDS3445.1	4	.	.	.	.	.	.	.	.	.	.	G	11.87	1.769045	0.31320	.	.	ENSG00000174123	ENST00000308973;ENST00000506111;ENST00000361424;ENST00000508334	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.23	3.5	0.40072	.	0.246802	0.27384	N	0.019604	T	0.25606	0.0623	L	0.59436	1.845	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.20874	-1.0262	10	0.59425	D	0.04	.	10.2156	0.43166	0.0712:0.0:0.7928:0.136	.	164	Q9BXR5	TLR10_HUMAN	D	164	ENSP00000308925:H164D;ENSP00000421483:H164D;ENSP00000354459:H164D;ENSP00000424923:H164D	ENSP00000308925:H164D	H	-	1	0	TLR10	38453117	0.999000	0.42202	0.958000	0.39756	0.876000	0.50452	1.976000	0.40579	0.581000	0.29539	0.655000	0.94253	CAT	TLR10	-	pirsf_Toll-like_receptor	ENSG00000174123		0.403	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR10	HGNC	protein_coding	OTTHUMT00000250430.1	-	0.00	37	0	G			38776722	-1	tier1	-	no_errors	ENST00000308973	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.168	C
TMEM184A	202915	genome.wustl.edu	37	7	1590564	1590564	+	Missense_Mutation	SNP	G	G	T	rs201764681		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr7:1590564G>T	ENST00000297477.5	-	3	590	c.274C>A	c.(274-276)Cgc>Agc	p.R92S		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	92					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		AGGAGCAGGCGGATGATGTAA	0.627																																																	0													93.0	102.0	99.0					7																	1590564		2203	4300	6503	SO:0001583	missense	0				CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.274C>A	7.37:g.1590564G>T	ENSP00000297477:p.Arg92Ser		Q8TBQ6	Missense_Mutation	SNP	pfam_Ost-alpha	p.R92S	ENST00000297477.5	37	c.274	CCDS43537.1	7	.	.	.	.	.	.	.	.	.	.	G	19.63	3.862896	0.71949	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730;ENST00000441933;ENST00000431208	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.15	5.15	0.70609	.	0.000000	0.85682	U	0.000000	T	0.78935	0.4362	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.85964	0.1472	10	0.87932	D	0	-5.0589	18.6128	0.91293	0.0:0.0:1.0:0.0	.	92	Q6ZMB5	T184A_HUMAN	S	92	ENSP00000297477:R92S;ENSP00000325945:R92S;ENSP00000398382:R92S;ENSP00000389092:R92S;ENSP00000403499:R92S	ENSP00000297477:R92S	R	-	1	0	TMEM184A	1557090	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	9.650000	0.98490	2.396000	0.81511	0.407000	0.27541	CGC	TMEM184A	-	pfam_Ost-alpha	ENSG00000164855		0.627	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184A	HGNC	protein_coding	OTTHUMT00000239229.4		0.00	56	0	G	NM_152689		1590564	-1			no_errors	ENST00000297477	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175293656	175293656	+	Splice_Site	SNP	C	C	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:175293656C>A	ENST00000367674.2	-	22	4502		c.e22-1		RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Splice_Site			Q92752	TENR_HUMAN	tenascin R						associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGGGAGTCCCCTGCAAAAAAG	0.468																																																	0													187.0	166.0	173.0					1																	175293656		2203	4300	6503	SO:0001630	splice_region_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3794-1G>T	1.37:g.175293656C>A			C9J563|Q15568|Q5R3G0	Splice_Site	SNP	-	e20-1	ENST00000367674.2	37	c.3794-1	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715277	0.89112	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3551	0.94408	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNR	173560279	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.711000	0.84669	2.666000	0.90696	0.655000	0.94253	.	TNR	-	-	ENSG00000116147		0.468	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	37	0	C	NM_003285	Intron	175293656	-1	tier1	-	no_errors	ENST00000263525	ensembl	human	known	74_37	splice_site	21.43	44	12	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578547	7578547	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr17:7578547delG	ENST00000269305.4	-	5	572	c.383delC	c.(382-384)cctfs	p.P128fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.P128fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P128fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P128fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	128	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.P128L(3)|p.V73fs*9(1)|p.S127fs*36(1)|p.P128fs*18(1)|p.P128del(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.P13fs*18(1)|p.?(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGAGGGCAGGGGAGTACTG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Deletion - In frame(11)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - Missense(3)|Unknown(1)	upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|large_intestine(3)|breast(3)|urinary_tract(2)|lung(2)|ovary(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|oesophagus(1)|prostate(1)											44.0	45.0	44.0					17																	7578547		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.383delC	17.37:g.7578547delG	ENSP00000269305:p.Pro128fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P128fs	ENST00000269305.4	37	c.383	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	27	0	G	NM_000546		7578547	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	46.15	21	18	DEL	0.106	-
TRPC1	7220	genome.wustl.edu	37	3	142462342	142462342	+	Silent	SNP	T	T	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:142462342T>C	ENST00000476941.1	+	3	829	c.343T>C	c.(343-345)Ttg>Ctg	p.L115L	TRPC1_ENST00000273482.6_Intron	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	115					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						AGATGCACTTTTGGTGGCAAT	0.303																																																	0																																										SO:0001819	synonymous_variant	0			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.343T>C	3.37:g.142462342T>C			Q14CE4	Silent	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.L115	ENST00000476941.1	37	c.343	CCDS58856.1	3																																																																																			TRPC1	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000144935		0.303	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	-	0.00	45	0	T	NM_003304		142462342	+1	tier1	-	no_errors	ENST00000476941	ensembl	human	known	74_37	silent	23.21	43	13	SNP	1.000	C
TSSC2	650368	genome.wustl.edu	37	11	3424158	3424158	+	RNA	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr11:3424158C>T	ENST00000529482.1	+	0	817									tumor suppressing subtransferable candidate 2 pseudogene																		ACGAAGACTTCTCCATCTGCT	0.552																																																	0																																												0					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3424158C>T				RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-	ENSG00000223756		0.552	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	-	0.00	121	0	C			3424158	+1	tier1	-	no_errors	ENST00000529482	ensembl	human	known	74_37	rna	5.81	81	5	SNP	1.000	T
UBXN4	23190	genome.wustl.edu	37	2	136537813	136537813	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:136537813G>C	ENST00000272638.9	+	12	1557	c.1246G>C	c.(1246-1248)Gga>Cga	p.G416R	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	416					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						GACCTTGTTGGGAACAGTGCT	0.418																																																	0													187.0	171.0	176.0					2																	136537813		1920	4133	6053	SO:0001583	missense	0			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.1246G>C	2.37:g.136537813G>C	ENSP00000272638:p.Gly416Arg		A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.G416R	ENST00000272638.9	37	c.1246	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328610	0.81690	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.52295	0.67	4.79	4.79	0.61399	.	0.052027	0.85682	D	0.000000	T	0.68109	0.2965	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.68853	-0.5299	10	0.45353	T	0.12	.	18.0192	0.89250	0.0:0.0:1.0:0.0	.	416	Q92575	UBXN4_HUMAN	R	416;398	ENSP00000272638:G416R	ENSP00000272638:G416R	G	+	1	0	UBXN4	136254283	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.912000	0.69948	2.498000	0.84270	0.484000	0.47621	GGA	UBXN4	-	NULL	ENSG00000144224		0.418	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	-	0.00	72	0	G	NM_014607		136537813	+1	tier1	-	no_errors	ENST00000272638	ensembl	human	known	74_37	missense	26.37	67	24	SNP	1.000	C
TTC21B	79809	genome.wustl.edu	37	2	166756357	166756357	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr2:166756357G>A	ENST00000243344.7	-	21	2928	c.2791C>T	c.(2791-2793)Caa>Taa	p.Q931*		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	931					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						GGGTCATCTTGTGCCAGGTAT	0.458																																																	0													100.0	94.0	96.0					2																	166756357		2203	4300	6503	SO:0001587	stop_gained	0			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.2791C>T	2.37:g.166756357G>A	ENSP00000243344:p.Gln931*		A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q931*	ENST00000243344.7	37	c.2791	CCDS33315.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.207774	0.98706	.	.	ENSG00000123607	ENST00000243344	.	.	.	5.54	5.54	0.83059	.	0.113843	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-13.7984	14.0696	0.64852	0.0722:0.0:0.9278:0.0	.	.	.	.	X	931	.	ENSP00000243344:Q931X	Q	-	1	0	TTC21B	166464603	1.000000	0.71417	0.907000	0.35723	0.719000	0.41307	7.099000	0.76981	2.763000	0.94921	0.650000	0.86243	CAA	TTC21B	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000123607		0.458	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC21B	HGNC	protein_coding	OTTHUMT00000333770.1	-	0.00	46	0	G	NM_024753		166756357	-1	tier1	-	no_errors	ENST00000243344	ensembl	human	known	74_37	nonsense	23.08	40	12	SNP	1.000	A
WIZ	58525	genome.wustl.edu	37	19	15538262	15538262	+	Silent	SNP	G	G	A	rs558510562		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:15538262G>A	ENST00000389282.4	-	6	3396	c.3183C>T	c.(3181-3183)caC>caT	p.H1061H	WIZ_ENST00000263381.7_Silent_p.H204H|WIZ_ENST00000599686.3_Silent_p.H245H|WIZ_ENST00000545156.1_Silent_p.H375H|WIZ_ENST00000599910.2_Silent_p.H378H			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1061					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GGGAGCGCGCGTGGCTCGAGA	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20039	0.0		0.0	False		,,,				2504	0.0																0													31.0	32.0	32.0					19																	15538262		2109	4214	6323	SO:0001819	synonymous_variant	0			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3183C>T	19.37:g.15538262G>A			B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1061	ENST00000389282.4	37	c.3183		19																																																																																			WIZ	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000011451		0.627	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		-	0.00	99	0	G	NM_021241		15538262	-1	tier1	-	no_errors	ENST00000389282	ensembl	human	known	74_37	silent	6.76	69	5	SNP	0.130	A
XIRP1	165904	genome.wustl.edu	37	3	39227399	39227399	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:39227399G>T	ENST00000340369.3	-	2	3766	c.3538C>A	c.(3538-3540)Cca>Aca	p.P1180T	XIRP1_ENST00000396251.1_Intron|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1180					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CCCTGGAGTGGGCGGGGAGCC	0.672																																																	0													27.0	29.0	28.0					3																	39227399		2203	4300	6503	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3538C>A	3.37:g.39227399G>T	ENSP00000343140:p.Pro1180Thr		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.P1180T	ENST00000340369.3	37	c.3538	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	G	0.953	-0.705766	0.03255	.	.	ENSG00000168334	ENST00000340369	T	0.03717	3.83	3.94	2.14	0.27477	.	0.090813	0.44902	U	0.000407	T	0.03348	0.0097	L	0.47716	1.5	0.23050	N	0.998375	P	0.43287	0.802	B	0.35278	0.199	T	0.41556	-0.9502	10	0.59425	D	0.04	.	6.5791	0.22583	0.2211:0.0:0.7789:0.0	.	1180	Q702N8	XIRP1_HUMAN	T	1180	ENSP00000343140:P1180T	ENSP00000343140:P1180T	P	-	1	0	XIRP1	39202403	0.841000	0.29509	0.466000	0.27168	0.015000	0.08874	0.829000	0.27449	0.458000	0.26988	-1.036000	0.02392	CCA	XIRP1	-	NULL	ENSG00000168334		0.672	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1		0.00	31	0	G	XM_093522		39227399	-1			no_errors	ENST00000340369	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.175	T
ZDHHC23	254887	genome.wustl.edu	37	3	113676531	113676531	+	Intron	SNP	T	T	A			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr3:113676531T>A	ENST00000330212.3	+	5	1339				ZDHHC23_ENST00000488129.1_3'UTR|ZDHHC23_ENST00000498275.1_Intron	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23						protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						ctgaatgaACTTATTTCTAAC	0.418																																																	0													20.0	20.0	20.0					3																	113676531		876	1991	2867	SO:0001627	intron_variant	0			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.1041-679T>A	3.37:g.113676531T>A			D3DN76	RNA	SNP	-	NULL	ENST00000330212.3	37	NULL	CCDS33827.1	3																																																																																			ZDHHC23	-	-	ENSG00000184307		0.418	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	HGNC	protein_coding	OTTHUMT00000354702.1	-	0.00	65	0	T	NM_173570		113676531	+1	tier1	-	no_errors	ENST00000488129	ensembl	human	putative	74_37	rna	36.13	76	43	SNP	0.000	A
ZER1	10444	genome.wustl.edu	37	9	131517732	131517732	+	Missense_Mutation	SNP	G	G	T	rs540575103		TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr9:131517732G>T	ENST00000291900.2	-	2	519	c.113C>A	c.(112-114)cCg>cAg	p.P38Q	ZER1_ENST00000494461.1_Intron	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	38					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.P38L(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						GAAGATGTCCGGATGTAGCCG	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											138.0	122.0	128.0					9																	131517732		2203	4300	6503	SO:0001583	missense	0			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.113C>A	9.37:g.131517732G>T	ENSP00000291900:p.Pro38Gln		O00156|Q5T272|Q5T273	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.P38Q	ENST00000291900.2	37	c.113	CCDS6910.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.126458	0.94429	.	.	ENSG00000160445	ENST00000291900;ENST00000414921;ENST00000427848	T	0.42900	0.96	5.51	5.51	0.81932	.	0.053208	0.85682	D	0.000000	T	0.46946	0.1419	L	0.29908	0.895	0.80722	D	1	D	0.57571	0.98	P	0.54460	0.753	T	0.24119	-1.0169	10	0.34782	T	0.22	-15.6742	18.7539	0.91825	0.0:0.0:1.0:0.0	.	38	Q7Z7L7	ZER1_HUMAN	Q	38	ENSP00000291900:P38Q	ENSP00000291900:P38Q	P	-	2	0	ZER1	130557553	1.000000	0.71417	0.972000	0.41901	0.970000	0.65996	9.148000	0.94652	2.745000	0.94114	0.655000	0.94253	CCG	ZER1	-	NULL	ENSG00000160445		0.587	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZER1	HGNC	protein_coding	OTTHUMT00000054491.1		0.00	31	0	G	NM_006336		131517732	-1			no_errors	ENST00000291900	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
ZMYM6	9204	genome.wustl.edu	37	1	35480667	35480667	+	Silent	SNP	C	C	T			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr1:35480667C>T	ENST00000357182.4	-	5	752	c.525G>A	c.(523-525)gaG>gaA	p.E175E	ZMYM6_ENST00000373340.2_Silent_p.E175E|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Silent_p.E175E	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	175					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTTCTTTAGCTCATAAGATG	0.338																																																	0													91.0	86.0	88.0					1																	35480667		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.525G>A	1.37:g.35480667C>T			B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Silent	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.E175	ENST00000357182.4	37	c.525	CCDS387.2	1																																																																																			ZMYM6	-	smart_TRASH_dom	ENSG00000163867		0.338	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	48	0	C	NM_007167		35480667	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	silent	26.98	46	17	SNP	0.998	T
ZNF318	24149	genome.wustl.edu	37	6	43305847	43305847	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr6:43305847C>G	ENST00000361428.2	-	10	5966	c.5889G>C	c.(5887-5889)aaG>aaC	p.K1963N	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1963					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTGGCCTCTTCTTGTTTTCAT	0.418																																																	0													100.0	102.0	101.0					6																	43305847		2203	4300	6503	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.5889G>C	6.37:g.43305847C>G	ENSP00000354964:p.Lys1963Asn		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.K1963N	ENST00000361428.2	37	c.5889	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	3.927	-0.017023	0.07681	.	.	ENSG00000171467	ENST00000361428	T	0.12465	2.68	5.48	-1.53	0.08611	.	0.791679	0.10715	N	0.642464	T	0.01189	0.0039	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.47381	-0.9122	10	0.26408	T	0.33	1.3149	1.9361	0.03337	0.3162:0.3756:0.1579:0.1502	.	1963	Q5VUA4	ZN318_HUMAN	N	1963	ENSP00000354964:K1963N	ENSP00000354964:K1963N	K	-	3	2	ZNF318	43413825	0.000000	0.05858	0.222000	0.23844	0.258000	0.26162	-0.786000	0.04623	0.012000	0.14892	-0.182000	0.12963	AAG	ZNF318	-	NULL	ENSG00000171467		0.418	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	-	0.00	19	0	C	NM_014345		43305847	-1	tier1	-	no_errors	ENST00000361428	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.000	G
ZNF667	63934	genome.wustl.edu	37	19	56972059	56972059	+	Splice_Site	DEL	A	A	-			TCGA-IG-A3YB-01A-11D-A247-09	TCGA-IG-A3YB-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e9fe8f50-5356-4f40-a351-34ea4f99e438	3c15c909-6c3b-45cb-96e7-4aaadf93e541	g.chr19:56972059delA	ENST00000504904.3	-	5	878	c.159delT	c.(157-159)ctt>ct	p.L53fs	ZNF667_ENST00000292069.6_Splice_Site_p.L53fs|ZNF667_ENST00000591790.1_Splice_Site_p.L53fs|ZNF667_ENST00000342634.3_Splice_Site_p.L146fs			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		GAGCCTTACCAAGCGAGACCA	0.498																																																	0													103.0	92.0	96.0					19																	56972059		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.160+1T>-	19.37:g.56972059delA			B2RMS6|B9EK36|Q6B093|Q9H807	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G147fs	ENST00000504904.3	37	c.438	CCDS12944.1	19																																																																																			ZNF667	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198046		0.498	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1		0.00	22	0	A	NM_022103	Frame_Shift_Del	56972059	-1	tier1		no_errors	ENST00000342634	ensembl	human	known	74_37	frame_shift_del	27.27	24	9	DEL	0.001	-
