#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AACSP1	729522	genome.wustl.edu	37	5	178199531	178199531	+	RNA	SNP	C	C	T	rs540200724		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:178199531C>T	ENST00000503486.2	-	0	1004					NR_024035.1				acetoacetyl-CoA synthetase pseudogene 1																		GGCTGGAAGGCGTGCCCAGAG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		19640	0.0		0.0	False		,,,				2504	0.001																0																																												0					5q35	2010-09-29	2010-09-29	2010-09-29	ENSG00000250420	ENSG00000250420			18226	pseudogene	pseudogene			"""acetoacetyl-CoA synthetase-like"""	AACSL			Standard	NR_024035		Approved		uc011dgl.2		OTTHUMG00000163584		5.37:g.178199531C>T				RNA	SNP	-	NULL	ENST00000503486.2	37	NULL		5																																																																																			AACSP1	-	-	ENSG00000250420		0.587	AACSP1-002	KNOWN	basic	processed_transcript	AACSP1	HGNC	pseudogene	OTTHUMT00000374392.2	-	0.00	38	0	C	NR_024035		178199531	-1	tier1	-	no_errors	ENST00000503486	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.001	T
ALS2CL	259173	genome.wustl.edu	37	3	46721933	46721933	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:46721933G>A	ENST00000318962.4	-	14	1618	c.1535C>T	c.(1534-1536)gCg>gTg	p.A512V	ALS2CL_ENST00000415953.1_Missense_Mutation_p.A512V	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	512					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CGTCTTGTCCGCCTGGAAGGT	0.637																																																	0													111.0	105.0	107.0					3																	46721933		2203	4300	6503	SO:0001583	missense	0			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.1535C>T	3.37:g.46721933G>A	ENSP00000313670:p.Ala512Val		Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.A512V	ENST00000318962.4	37	c.1535	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563037	0.27915	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.45276	0.9;0.9	4.77	2.94	0.34122	.	0.433255	0.21595	N	0.072025	T	0.38852	0.1056	M	0.72118	2.19	0.19575	N	0.999966	P	0.45078	0.85	B	0.41374	0.355	T	0.20207	-1.0282	10	0.27785	T	0.31	.	7.686	0.28540	0.0942:0.1736:0.7321:0.0	.	512	Q60I27	AL2CL_HUMAN	V	512	ENSP00000313670:A512V;ENSP00000413223:A512V	ENSP00000313670:A512V	A	-	2	0	ALS2CL	46696937	0.083000	0.21467	0.431000	0.26735	0.113000	0.19764	1.701000	0.37825	0.586000	0.29626	0.462000	0.41574	GCG	ALS2CL	-	pfam_MORN,smart_MORN	ENSG00000178038		0.637	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	-	0.00	49	0	G	NM_147129		46721933	-1	tier1	-	no_errors	ENST00000318962	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.064	A
AMY2B	280	genome.wustl.edu	37	1	104112459	104112459	+	Intron	SNP	A	A	G	rs3762407		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:104112459A>G	ENST00000361355.4	+	3	570				AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GGGACTGCACATGGCCTTGGA	0.507																																																	0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.-46-1720A>G	1.37:g.104112459A>G			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	SNP	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.507	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1		0.00	26	0	A	NM_020978		104112459	+1			no_errors	ENST00000491397	ensembl	human	known	74_37	rna	12.12	29	4	SNP	1.000	G
ANKFY1	51479	genome.wustl.edu	37	17	4080500	4080500	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:4080500G>T	ENST00000341657.4	-	19	2731	c.2696C>A	c.(2695-2697)tCa>tAa	p.S899*	ANKFY1_ENST00000574367.1_Nonsense_Mutation_p.S900*|ANKFY1_ENST00000570535.1_Nonsense_Mutation_p.S941*|CYB5D2_ENST00000573984.1_Intron	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	899					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CTGGACTCTTGAATTCACATT	0.473																																																	0													131.0	123.0	126.0					17																	4080500		1978	4176	6154	SO:0001587	stop_gained	0			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.2696C>A	17.37:g.4080500G>T	ENSP00000343362:p.Ser899*		A8KA65|Q5RKV4|Q9ULG5	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_FYVE,pfam_BTB_POZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_BTB/POZ_fold,superfamily_Znf_FYVE_PHD,smart_BTB/POZ-like,smart_Ankyrin_rpt,smart_Znf_FYVE,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Znf_FYVE-rel,prints_Ankyrin_rpt	p.S941*	ENST00000341657.4	37	c.2822		17	.	.	.	.	.	.	.	.	.	.	G	39	7.872826	0.98537	.	.	ENSG00000185722	ENST00000341657;ENST00000535427	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7054	19.367	0.94468	0.0:0.0:1.0:0.0	.	.	.	.	X	900;841	.	ENSP00000343362:S900X	S	-	2	0	ANKFY1	4027249	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	9.609000	0.98334	2.826000	0.97356	0.563000	0.77884	TCA	ANKFY1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000185722		0.473	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	ANKFY1	HGNC	protein_coding	OTTHUMT00000438702.1	-	0.00	27	0	G	NM_016376		4080500	-1	tier1	-	no_errors	ENST00000570535	ensembl	human	known	74_37	nonsense	21.62	29	8	SNP	1.000	T
ANKRD20A11P	391267	genome.wustl.edu	37	21	15323581	15323581	+	RNA	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr21:15323581C>T	ENST00000344693.5	-	0	821					NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		TGCAGGAGGTCCTACAAAGCA	0.338																																																	0																																												0					21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15323581C>T				RNA	SNP	-	NULL	ENST00000344693.5	37	NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559		0.338	ANKRD20A11P-005	KNOWN	basic	processed_transcript	ANKRD20A11P	HGNC	pseudogene	OTTHUMT00000157750.1	-	0.00	155	0	C			15323581	-1	tier1	-	no_errors	ENST00000344693	ensembl	human	known	74_37	rna	14.74	133	23	SNP	0.365	T
ANKS1A	23294	genome.wustl.edu	37	6	34985823	34985823	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:34985823C>T	ENST00000360359.3	+	11	2135	c.1997C>T	c.(1996-1998)tCg>tTg	p.S666L	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	666					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCCTTCGCCTCGGAGTGGGAT	0.612																																																	0													73.0	76.0	75.0					6																	34985823		2203	4300	6503	SO:0001583	missense	0			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1997C>T	6.37:g.34985823C>T	ENSP00000353518:p.Ser666Leu		A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.S666L	ENST00000360359.3	37	c.1997	CCDS4798.1	6	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180217	0.57800	.	.	ENSG00000064999	ENST00000360359	T	0.46451	0.87	5.17	5.17	0.71159	.	0.000000	0.43747	D	0.000539	T	0.57184	0.2036	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.60845	-0.7182	10	0.87932	D	0	-9.4929	19.0382	0.92987	0.0:1.0:0.0:0.0	.	666	Q92625	ANS1A_HUMAN	L	666	ENSP00000353518:S666L	ENSP00000353518:S666L	S	+	2	0	ANKS1A	35093801	1.000000	0.71417	0.964000	0.40570	0.958000	0.62258	7.410000	0.80065	2.560000	0.86352	0.655000	0.94253	TCG	ANKS1A	-	NULL	ENSG00000064999		0.612	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	HGNC	protein_coding	OTTHUMT00000040262.1	-	0.00	30	0	C	XM_166478		34985823	+1	tier1	-	no_errors	ENST00000360359	ensembl	human	known	74_37	missense	52.17	11	12	SNP	1.000	T
ARHGAP5	394	genome.wustl.edu	37	14	32623846	32623846	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:32623846A>G	ENST00000345122.3	+	7	4516	c.4201A>G	c.(4201-4203)Atc>Gtc	p.I1401V	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.I1400V|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.I1401V|ARHGAP5_ENST00000433497.1_Missense_Mutation_p.I140V|ARHGAP5_ENST00000396582.2_Missense_Mutation_p.I136V|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.I1400V	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1401	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GCAACATAAAATCAACCTAAT	0.343																																					NSCLC(9;77 350 3443 29227 41353)												0													91.0	85.0	87.0					14																	32623846		2203	4300	6503	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4201A>G	14.37:g.32623846A>G	ENSP00000371897:p.Ile1401Val		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.I1401V	ENST00000345122.3	37	c.4201	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	A	2.666	-0.278747	0.05679	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497	T;T;T;T;T;T	0.20738	2.27;2.27;2.05;2.27;2.27;2.05	4.93	3.72	0.42706	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.236356	0.42420	N	0.000701	T	0.05181	0.0138	N	0.00517	-1.405	0.27820	N	0.941845	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.35025	-0.9805	10	0.07990	T	0.79	.	10.4212	0.44352	0.9176:0.0:0.0824:0.0	.	136;1400;1401	Q13017-3;Q13017-2;Q13017	.;.;RHG05_HUMAN	V	1400;1401;136;1401;1400;140	ENSP00000452222:I1400V;ENSP00000441692:I1401V;ENSP00000379827:I136V;ENSP00000371897:I1401V;ENSP00000393307:I1400V;ENSP00000407395:I140V	ENSP00000371897:I1401V	I	+	1	0	ARHGAP5	31693597	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.558000	0.53749	0.777000	0.33496	0.449000	0.29647	ATC	ARHGAP5	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000100852		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	33	0	A	NM_001030055		32623846	+1	tier1	-	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	17.02	39	8	SNP	1.000	G
ARID1B	57492	genome.wustl.edu	37	6	157517375	157517377	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:157517375_157517377delTCC	ENST00000350026.5	+	15	3901_3903	c.3900_3902delTCC	c.(3898-3903)agtccc>agc	p.P1301del	ARID1B_ENST00000275248.4_In_Frame_Del_p.P1296del|ARID1B_ENST00000367148.1_In_Frame_Del_p.P1354del|ARID1B_ENST00000346085.5_In_Frame_Del_p.P1314del	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1301					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ACAACCAAAGTCCCTCCGGAGCA	0.483																																																	0																																										SO:0001651	inframe_deletion	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3900_3902delTCC	6.37:g.157517375_157517377delTCC	ENSP00000055163:p.Pro1301del		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	In_Frame_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.P1354in_frame_del	ENST00000350026.5	37	c.4059_4061	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.483	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	28	0	TCC	NM_020732		157517377	+1	tier1		no_errors	ENST00000367148	ensembl	human	known	74_37	in_frame_del	19.23	21	5	DEL	0.052:0.997:0.998	-
ATF4	468	genome.wustl.edu	37	22	39918415	39918415	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr22:39918415C>G	ENST00000337304.2	+	2	1746	c.864C>G	c.(862-864)aaC>aaG	p.N288K	ATF4_ENST00000404241.2_Missense_Mutation_p.N288K|ATF4_ENST00000396680.1_Missense_Mutation_p.N288K	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	288	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TGGAGCAAAACAAGACAGCAG	0.493																																																	0													18.0	21.0	20.0					22																	39918415		2199	4282	6481	SO:0001583	missense	0			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.864C>G	22.37:g.39918415C>G	ENSP00000336790:p.Asn288Lys		Q9UH31	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.N288K	ENST00000337304.2	37	c.864	CCDS13996.1	22	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269194	0.59540	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	D;D;D	0.93189	-3.18;-3.18;-3.18	5.38	2.94	0.34122	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.95903	0.8666	M	0.90425	3.115	0.58432	D	0.999995	D	0.58970	0.984	P	0.59012	0.85	D	0.95458	0.8540	10	0.87932	D	0	-7.5453	8.6366	0.33953	0.0:0.7204:0.0:0.2796	.	288	P18848	ATF4_HUMAN	K	288	ENSP00000384587:N288K;ENSP00000336790:N288K;ENSP00000379912:N288K	ENSP00000336790:N288K	N	+	3	2	ATF4	38248361	0.995000	0.38212	1.000000	0.80357	0.967000	0.64934	0.418000	0.21230	1.267000	0.44247	0.462000	0.41574	AAC	ATF4	-	pfam_bZIP,smart_bZIP,pfscan_bZIP	ENSG00000128272		0.493	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	HGNC	protein_coding	OTTHUMT00000321305.1	-	0.00	48	0	C	NM_001675		39918415	+1	tier1	-	no_errors	ENST00000337304	ensembl	human	known	74_37	missense	17.78	35	8	SNP	1.000	G
ATM	472	genome.wustl.edu	37	11	108196809	108196809	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:108196809A>G	ENST00000452508.2	+	48	7021	c.6832A>G	c.(6832-6834)Att>Gtt	p.I2278V	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.I2278V			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2278	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AATATTTCAAATTAAACAGTA	0.363			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													69.0	70.0	70.0					11																	108196809		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6832A>G	11.37:g.108196809A>G	ENSP00000388058:p.Ile2278Val		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.I2278V	ENST00000452508.2	37	c.6832	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561607	0.86335	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.70399	-0.48;-0.48	5.58	5.58	0.84498	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-type fold (1);	0.041543	0.85682	D	0.000000	T	0.73337	0.3574	L	0.60455	1.87	0.80722	D	1	P	0.45240	0.854	P	0.46144	0.505	T	0.76817	-0.2819	10	0.66056	D	0.02	.	16.0489	0.80740	1.0:0.0:0.0:0.0	.	2278	Q13315	ATM_HUMAN	V	2278	ENSP00000278616:I2278V;ENSP00000388058:I2278V	ENSP00000278616:I2278V	I	+	1	0	ATM	107702019	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.868000	0.92320	2.253000	0.74438	0.455000	0.32223	ATT	ATM	-	pfam_PIK-rel_kinase_FAT,superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000149311		0.363	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1		0.00	30	0	A	NM_000051		108196809	+1			no_errors	ENST00000278616	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	G
ATP8B2	57198	genome.wustl.edu	37	1	154303339	154303339	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:154303339G>A	ENST00000368489.3	+	4	238	c.238G>A	c.(238-240)Gtc>Atc	p.V80I	ATP8B2_ENST00000368487.3_Missense_Mutation_p.V47I|ATP8B2_ENST00000341822.2_Missense_Mutation_p.V66I|ATP8B2_ENST00000426445.1_3'UTR	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	66					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTTCCTGCCTGTCAACCTCTT	0.478																																																	0													117.0	101.0	106.0					1																	154303339		2203	4300	6503	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.238G>A	1.37:g.154303339G>A	ENSP00000357475:p.Val80Ile		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V80I	ENST00000368489.3	37	c.238	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858849	0.51376	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	T;T;T	0.76316	-1.01;-1.01;-1.01	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000001	T	0.42177	0.1191	N	0.11364	0.135	0.52501	D	0.999957	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.10450	0.003;0.005;0.002	T	0.39143	-0.9628	10	0.16420	T	0.52	.	11.4524	0.50160	0.0812:0.0:0.9188:0.0	.	66;80;47	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	I	47;80;66	ENSP00000357472:V47I;ENSP00000357475:V80I;ENSP00000340448:V66I	ENSP00000340448:V66I	V	+	1	0	ATP8B2	152569963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.451000	0.73481	2.735000	0.93741	0.561000	0.74099	GTC	ATP8B2	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000143515		0.478	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	-	0.00	29	0	G	NM_020452		154303339	+1	tier1	-	no_errors	ENST00000368489	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
CMC1	152100	genome.wustl.edu	37	3	28364113	28364113	+	3'UTR	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:28364113A>G	ENST00000466830.1	+	0	3513				AZI2_ENST00000295748.3_5'UTR|AZI2_ENST00000479665.1_3'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						TATTTCTTTTATGCATATTGG	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.*2993A>G	3.37:g.28364113A>G			Q68DJ7	RNA	SNP	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			AZI2	-	-	ENSG00000163512		0.403	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000341087.1	-	0.00	70	0	A	NM_182523		28364113	-1	tier1	-	no_errors	ENST00000295748	ensembl	human	known	74_37	rna	40.82	29	20	SNP	1.000	G
BAI3	577	genome.wustl.edu	37	6	70082325	70082325	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:70082325G>T	ENST00000370598.1	+	30	5088	c.4267G>T	c.(4267-4269)Gac>Tac	p.D1423Y	BAI3_ENST00000238918.8_Missense_Mutation_p.D629Y|BAI3_ENST00000546190.1_Missense_Mutation_p.D387Y	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1423					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTCAGACCTTGACTTTGAGGT	0.239																																																	0													19.0	21.0	20.0					6																	70082325		2111	4155	6266	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4267G>T	6.37:g.70082325G>T	ENSP00000359630:p.Asp1423Tyr		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.D1423Y	ENST00000370598.1	37	c.4267	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190381	0.58017	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.08193	3.12;3.12;3.12	5.97	5.97	0.96955	.	0.046113	0.85682	D	0.000000	T	0.14657	0.0354	M	0.75085	2.285	0.50632	D	0.999881	P;D	0.59767	0.594;0.986	B;P	0.51415	0.365;0.669	T	0.00231	-1.1896	10	0.87932	D	0	.	17.3555	0.87334	0.0:0.0:1.0:0.0	.	629;1423	B7Z356;O60242	.;BAI3_HUMAN	Y	1423;629;387	ENSP00000359630:D1423Y;ENSP00000238918:D629Y;ENSP00000441821:D387Y	ENSP00000238918:D629Y	D	+	1	0	BAI3	70139046	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.873000	0.75541	2.836000	0.97738	0.655000	0.94253	GAC	BAI3	-	prints_GPCR_2_brain-spec_angio_inhib	ENSG00000135298		0.239	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	46	0	G			70082325	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
BARHL2	343472	genome.wustl.edu	37	1	91182354	91182354	+	Silent	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:91182354C>A	ENST00000370445.4	-	1	440	c.399G>T	c.(397-399)tcG>tcT	p.S133S		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	133					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		TCCTGGGGGCCGAGGCGGCCG	0.647																																					GBM(199;3561 4100 22440)												0													11.0	12.0	12.0					1																	91182354		2078	4119	6197	SO:0001819	synonymous_variant	0			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.399G>T	1.37:g.91182354C>A			A0AVP2|Q7Z4N7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.S133	ENST00000370445.4	37	c.399	CCDS730.1	1																																																																																			BARHL2	-	NULL	ENSG00000143032		0.647	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL2	HGNC	protein_coding	OTTHUMT00000027728.2		0.00	9	0	C			91182354	-1			no_errors	ENST00000370445	ensembl	human	known	74_37	silent	66.67	1	2	SNP	0.992	A
BAZ1A	11177	genome.wustl.edu	37	14	35255028	35255028	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:35255028G>T	ENST00000382422.2	-	13	2113	c.1786C>A	c.(1786-1788)Cta>Ata	p.L596I	BAZ1A_ENST00000360310.1_Missense_Mutation_p.L596I|BAZ1A_ENST00000358716.4_Missense_Mutation_p.L564I			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	596					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTCTTCACTAGACTGGGATTG	0.423																																																	0													131.0	109.0	117.0					14																	35255028		2203	4300	6503	SO:0001583	missense	0			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.1786C>A	14.37:g.35255028G>T	ENSP00000371859:p.Leu596Ile		Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L596I	ENST00000382422.2	37	c.1786	CCDS9651.1	14	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630826	0.28978	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.71341	-0.56;-0.5;-0.5	5.47	2.49	0.30216	.	0.075708	0.56097	D	0.000038	T	0.37348	0.1000	N	0.04203	-0.255	0.43073	D	0.994716	B;B	0.31318	0.319;0.108	B;B	0.22753	0.041;0.025	T	0.08472	-1.0720	10	0.15952	T	0.53	.	4.5028	0.11872	0.2182:0.0:0.5247:0.2571	.	564;596	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	I	564;596;596;248	ENSP00000351555:L564I;ENSP00000371859:L596I;ENSP00000353458:L596I	ENSP00000351555:L564I	L	-	1	2	BAZ1A	34324779	0.998000	0.40836	0.559000	0.28332	0.909000	0.53808	2.722000	0.47269	0.682000	0.31407	0.446000	0.29264	CTA	BAZ1A	-	NULL	ENSG00000198604		0.423	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	-	0.00	30	0	G			35255028	-1	tier1	-	no_errors	ENST00000360310	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.818	T
BICD2	23299	genome.wustl.edu	37	9	95526977	95526977	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:95526977G>T	ENST00000375512.3	-	1	117	c.50C>A	c.(49-51)gCg>gAg	p.A17E	BICD2_ENST00000356884.6_Missense_Mutation_p.A17E	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	17					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTCCGGCTGCGCCTCCATCAC	0.731																																																	0													9.0	10.0	9.0					9																	95526977		2068	4116	6184	SO:0001583	missense	0			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.50C>A	9.37:g.95526977G>T	ENSP00000364662:p.Ala17Glu		O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc	p.A17E	ENST00000375512.3	37	c.50	CCDS6700.1	9	.	.	.	.	.	.	.	.	.	.	.	16.77	3.215213	0.58452	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.44881	0.91;0.92	4.35	4.35	0.52113	.	0.211686	0.38548	N	0.001654	T	0.42539	0.1207	L	0.34521	1.04	0.43512	D	0.995772	D;P	0.55800	0.973;0.954	P;P	0.53360	0.724;0.534	T	0.10660	-1.0620	10	0.17832	T	0.49	-38.5328	15.1518	0.72706	0.0:0.0:1.0:0.0	.	17;17	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	E	17	ENSP00000349351:A17E;ENSP00000364662:A17E	ENSP00000349351:A17E	A	-	2	0	BICD2	94566798	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	8.700000	0.91322	2.349000	0.79799	0.195000	0.17529	GCG	BICD2	-	NULL	ENSG00000185963		0.731	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1		0.00	9	0	G	NM_015250		95526977	-1			no_errors	ENST00000356884	ensembl	human	known	74_37	missense	26.92	18	7	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13616992	13616992	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr4:13616992C>T	ENST00000040738.5	-	3	638	c.503G>A	c.(502-504)gGa>gAa	p.G168E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	168						nucleus (GO:0005634)	DNA binding (GO:0003677)										GTTGCCACTTCCTTCCTCTTT	0.438																																																	0													260.0	251.0	254.0					4																	13616992		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.503G>A	4.37:g.13616992C>T	ENSP00000040738:p.Gly168Glu		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.G168E	ENST00000040738.5	37	c.503	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194181	0.58017	.	.	ENSG00000038219	ENST00000040738	T	0.06068	3.35	5.42	2.74	0.32292	.	0.354060	0.20648	N	0.088273	T	0.04497	0.0123	N	0.22421	0.69	0.09310	N	1	B	0.17667	0.023	B	0.15870	0.014	T	0.37753	-0.9692	10	0.36615	T	0.2	-4.756	7.99	0.30235	0.138:0.2476:0.6144:0.0	.	168	Q8NFC6	BOD1L_HUMAN	E	168	ENSP00000040738:G168E	ENSP00000040738:G168E	G	-	2	0	BOD1L	13226090	0.308000	0.24509	0.195000	0.23364	0.825000	0.46686	2.370000	0.44240	0.779000	0.33543	-0.197000	0.12766	GGA	BOD1L1	-	NULL	ENSG00000038219		0.438	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	120	0	C	NM_148894		13616992	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	15.00	51	9	SNP	0.026	T
BRSK1	84446	genome.wustl.edu	37	19	55817695	55817695	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:55817695G>A	ENST00000309383.1	+	17	2243	c.1966G>A	c.(1966-1968)Gtc>Atc	p.V656I	BRSK1_ENST00000590333.1_Missense_Mutation_p.V672I|BRSK1_ENST00000326848.7_Missense_Mutation_p.V351I	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	656					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.V656I(4)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CGGCCCCTCCGTCTTCCAAAA	0.637																																																	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)											58.0	57.0	57.0					19																	55817695		2203	4300	6503	SO:0001583	missense	0			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1966G>A	19.37:g.55817695G>A	ENSP00000310649:p.Val656Ile		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.V672I	ENST00000309383.1	37	c.2014	CCDS12921.1	19	.	.	.	.	.	.	.	.	.	.	.	23.9	4.466384	0.84425	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.73789	-0.78;1.74	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000003	D	0.84946	0.5585	M	0.69358	2.11	0.54753	D	0.999987	D;D	0.71674	0.997;0.998	D;D	0.73708	0.959;0.981	D	0.86005	0.1497	10	0.62326	D	0.03	.	17.7465	0.88422	0.0:0.0:1.0:0.0	.	656;672	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	I	656;351;351	ENSP00000310649:V656I;ENSP00000320853:V351I	ENSP00000310649:V656I	V	+	1	0	BRSK1	60509507	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.189000	0.94928	2.572000	0.86782	0.555000	0.69702	GTC	BRSK1	-	NULL	ENSG00000160469		0.637	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRSK1	HGNC	protein_coding	OTTHUMT00000452787.1	-	0.00	42	0	G	NM_032430		55817695	+1	tier1	-	no_errors	ENST00000590333	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	A
BSDC1	55108	genome.wustl.edu	37	1	32846840	32846840	+	Silent	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:32846840T>C	ENST00000455895.2	-	5	420	c.387A>G	c.(385-387)ccA>ccG	p.P129P	BSDC1_ENST00000526031.1_Silent_p.P34P|BSDC1_ENST00000413080.1_Silent_p.P129P|BSDC1_ENST00000449308.1_Silent_p.P129P|BSDC1_ENST00000419121.2_Silent_p.P73P|BSDC1_ENST00000341071.7_Silent_p.P146P|BSDC1_ENST00000446293.2_Silent_p.P146P	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	129										breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGTAGGTTGCTGGGTCCGACT	0.512																																																	0													64.0	61.0	62.0					1																	32846840		2203	4300	6503	SO:0001819	synonymous_variant	0			BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.387A>G	1.37:g.32846840T>C			B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Silent	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.P146	ENST00000455895.2	37	c.438	CCDS363.2	1																																																																																			BSDC1	-	NULL	ENSG00000160058		0.512	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3	-	0.00	20	0	T	NM_018045		32846840	-1	tier1	-	no_errors	ENST00000341071	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.923	C
C12orf80	283403	genome.wustl.edu	37	12	52600360	52600360	+	lincRNA	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:52600360G>T	ENST00000551894.1	-	0	598									chromosome 12 open reading frame 80																		CTTGAGCCAGGTCCCCCTCTC	0.572																																																	0																																												0			BC038743		12q13.13	2013-06-20			ENSG00000257137	ENSG00000257137			27473	other	unknown							Standard	NM_001242696		Approved				OTTHUMG00000169626		12.37:g.52600360G>T				RNA	SNP	-	NULL	ENST00000551894.1	37	NULL		12																																																																																			C12orf80	-	-	ENSG00000257137		0.572	C12orf80-001	KNOWN	basic	lincRNA	C12orf80	HGNC	lincRNA	OTTHUMT00000405174.1	-	0.00	34	0	G	NM_001242696		52600360	-1	tier1	-	no_errors	ENST00000551332	ensembl	human	known	74_37	rna	8.16	45	4	SNP	0.112	T
C9orf3	84909	genome.wustl.edu	37	9	97555138	97555138	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:97555138G>T	ENST00000375315.2	+	3	1056	c.1056G>T	c.(1054-1056)gaG>gaT	p.E352D	C9orf3_ENST00000277198.2_Missense_Mutation_p.E352D|C9orf3_ENST00000297979.5_Missense_Mutation_p.E352D	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	352					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGAAGATGGAGACATGGTCAT	0.448																																																	0													217.0	213.0	214.0					9																	97555138		2203	4300	6503	SO:0001583	missense	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.1056G>T	9.37:g.97555138G>T	ENSP00000364464:p.Glu352Asp		Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.E352D	ENST00000375315.2	37	c.1056	CCDS55328.1	9	.	.	.	.	.	.	.	.	.	.	G	6.919	0.539128	0.13250	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000424143;ENST00000428313	T;T;T;T;T	0.02709	4.19;4.19;4.19;4.19;4.19	4.68	0.693	0.18056	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.290185	0.31636	N	0.007316	T	0.01156	0.0038	N	0.08118	0	0.19775	N	0.999951	B;B;B;B	0.30709	0.035;0.291;0.01;0.028	B;B;B;B	0.22386	0.018;0.039;0.006;0.01	T	0.49360	-0.8948	10	0.13470	T	0.59	-2.0645	4.5136	0.11924	0.3512:0.0:0.4975:0.1513	.	352;352;352;352	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	D	352;352;352;175;134	ENSP00000277198:E352D;ENSP00000297979:E352D;ENSP00000364464:E352D;ENSP00000402171:E175D;ENSP00000401854:E134D	ENSP00000277198:E352D	E	+	3	2	C9orf3	96594959	0.002000	0.14202	0.000000	0.03702	0.010000	0.07245	0.293000	0.19029	0.266000	0.21894	0.557000	0.71058	GAG	C9orf3	-	pfam_Peptidase_M1_N	ENSG00000148120		0.448	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		-	0.00	79	0	G	NM_032823		97555138	+1	tier1	-	no_errors	ENST00000375315	ensembl	human	known	74_37	missense	8.41	98	9	SNP	0.000	T
CACNA1A	773	genome.wustl.edu	37	19	13345781	13345781	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:13345781G>A	ENST00000360228.5	-	34	5202	c.5203C>T	c.(5203-5205)Cac>Tac	p.H1735Y	CACNA1A_ENST00000574822.1_5'UTR|CACNA1A_ENST00000573710.2_Missense_Mutation_p.H1736Y	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1736					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGTTATTGTGCTCAGTGATT	0.542											OREG0025293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													172.0	176.0	175.0					19																	13345781		2044	4189	6233	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5203C>T	19.37:g.13345781G>A	ENSP00000353362:p.His1735Tyr	686	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.H1735Y	ENST00000360228.5	37	c.5203	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910606	0.52439	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97430	-4.38	5.01	5.01	0.66863	Ion transport (1);	0.121440	0.56097	D	0.000039	D	0.97663	0.9234	L	0.46819	1.47	0.80722	D	1	B;B;D;B	0.76494	0.198;0.296;0.999;0.344	B;B;D;B	0.83275	0.19;0.223;0.996;0.227	D	0.98908	1.0779	10	0.87932	D	0	.	17.1472	0.86769	0.0:0.0:1.0:0.0	.	1736;1741;1735;1736	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	Y	1735;1741;1736;1736	ENSP00000353362:H1735Y	ENSP00000317661:H1736Y	H	-	1	0	CACNA1A	13206781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.996000	0.88334	2.336000	0.79503	0.551000	0.68910	CAC	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.542	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	33	0	G	NM_000068		13345781	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
CADM2	253559	genome.wustl.edu	37	3	85008594	85008594	+	5'Flank	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:85008594G>A	ENST00000407528.2	+	0	0				CADM2_ENST00000383699.3_De_novo_Start_OutOfFrame|CADM2_ENST00000485126.1_3'UTR	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGCCGCTTCTGCTGCCGCCGA	0.682																																																	0																																										SO:0001631	upstream_gene_variant	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990		3.37:g.85008594G>A	Exception_encountered		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	RNA	SNP	-	NULL	ENST00000407528.2	37	NULL	CCDS54614.1	3																																																																																			CADM2	-	-	ENSG00000175161		0.682	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1		0.00	16	0	G	NM_153184		85008594	+1			no_errors	ENST00000473523	ensembl	human	known	74_37	rna	27.27	8	3	SNP	0.342	A
CAND1	55832	genome.wustl.edu	37	12	67705481	67705481	+	Silent	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:67705481A>G	ENST00000545606.1	+	14	3806	c.3369A>G	c.(3367-3369)acA>acG	p.T1123T		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	1123					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AGATGCTGACATTTTTAATGT	0.348																																																	0													116.0	104.0	108.0					12																	67705481		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.3369A>G	12.37:g.67705481A>G			B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Silent	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.T1123	ENST00000545606.1	37	c.3369	CCDS8977.1	12																																																																																			CAND1	-	pfam_TATA-bd_TIP120,superfamily_ARM-type_fold	ENSG00000111530		0.348	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	-	0.00	49	0	A	NM_018448		67705481	+1	tier1	-	no_errors	ENST00000545606	ensembl	human	known	74_37	silent	16.98	44	9	SNP	1.000	G
CCDC82	79780	genome.wustl.edu	37	11	96104185	96104185	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:96104185G>A	ENST00000278520.5	-	6	1629	c.1201C>T	c.(1201-1203)Caa>Taa	p.Q401*	CCDC82_ENST00000542662.1_Nonsense_Mutation_p.Q401*|CCDC82_ENST00000423339.2_Nonsense_Mutation_p.Q401*			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	401										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		ACCTTATATTGCTCTTTCCAA	0.383																																																	0													84.0	86.0	85.0					11																	96104185		2201	4298	6499	SO:0001587	stop_gained	0			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.1201C>T	11.37:g.96104185G>A	ENSP00000278520:p.Gln401*		B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Nonsense_Mutation	SNP	NULL	p.Q401*	ENST00000278520.5	37	c.1201	CCDS8307.1	11	.	.	.	.	.	.	.	.	.	.	G	40	8.140967	0.98672	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339	.	.	.	5.76	2.79	0.32731	.	0.297363	0.30830	N	0.008797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-4.2017	9.0051	0.36106	0.0704:0.0:0.6662:0.2634	.	.	.	.	X	401	.	ENSP00000278520:Q401X	Q	-	1	0	CCDC82	95743833	0.648000	0.27313	0.412000	0.26496	0.912000	0.54170	2.607000	0.46300	0.322000	0.23283	0.585000	0.79938	CAA	CCDC82	-	NULL	ENSG00000149231		0.383	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	HGNC	protein_coding	OTTHUMT00000395542.2	-	0.00	62	0	G	NM_024725		96104185	-1	tier1	-	no_errors	ENST00000278520	ensembl	human	known	74_37	nonsense	8.93	51	5	SNP	0.233	A
CASP1	834	genome.wustl.edu	37	11	104901182	104901182	+	Missense_Mutation	SNP	T	T	C	rs376117763		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:104901182T>C	ENST00000533400.1	-	5	537	c.502A>G	c.(502-504)Atc>Gtc	p.I168V	CASP1_ENST00000527979.1_Missense_Mutation_p.I131V|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000598974.1_Missense_Mutation_p.I168V|CASP1_ENST00000526568.1_Missense_Mutation_p.I75V|CASP1_ENST00000594519.1_Missense_Mutation_p.I75V|CASP1_ENST00000393136.4_Missense_Mutation_p.I147V|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000534497.1_Missense_Mutation_p.I75V|CASP1_ENST00000436863.3_Missense_Mutation_p.I168V|CASP1_ENST00000528974.1_Missense_Mutation_p.I129V|CASP1_ENST00000525825.1_Missense_Mutation_p.I147V|CASP1_ENST00000593315.1_Missense_Mutation_p.I147V|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000446369.1_Missense_Mutation_p.I75V	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	168					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	TCATTGCAGATAATGAGAGCA	0.398																																					NSCLC(41;1246 1743 4934)												0								T	VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE,	0,4404		0,0,2202	132.0	115.0	121.0		439,502,223,223,	3.2	1.0	11		121	1,8597		0,1,4298	no	missense,missense,missense,missense,intron	CASP1	NM_001223.3,NM_033292.2,NM_033293.2,NM_033294.2,NM_033295.2	29,29,29,29,	0,1,6500	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,	147/384,168/405,75/312,75/264,	104901182	1,13001	2202	4299	6501	SO:0001583	missense	0			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.502A>G	11.37:g.104901182T>C	ENSP00000433138:p.Ile168Val		B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.I168V	ENST00000533400.1	37	c.502	CCDS8330.1	11	.	.	.	.	.	.	.	.	.	.	.	16.52	3.147400	0.57151	0.0	1.16E-4	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000446369;ENST00000393136;ENST00000525825;ENST00000534497;ENST00000528974	T;T;T;T;T;T;T;T;T;T	0.60424	1.33;1.33;1.33;1.33;1.33;0.19;1.33;1.33;0.19;1.33	4.37	3.24	0.37175	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.73040	0.3536	M	0.81112	2.525	0.46396	D	0.999026	D;D;D;D;D;D;D	0.76494	0.998;0.984;0.993;0.997;0.998;0.997;0.999	D;D;D;D;D;D;D	0.91635	0.994;0.971;0.958;0.995;0.997;0.995;0.999	T	0.73678	-0.3907	10	0.87932	D	0	.	8.0366	0.30496	0.0:0.0989:0.0:0.9011	.	129;75;168;147;168;131;75	B4DVD8;P29466-4;A8K249;P29466-2;P29466;G3V169;P29466-3	.;.;.;.;CASP1_HUMAN;.;.	V	17;75;131;168;168;75;147;147;75;129	ENSP00000435536:I17V;ENSP00000434250:I75V;ENSP00000432340:I131V;ENSP00000433138:I168V;ENSP00000410076:I168V;ENSP00000403260:I75V;ENSP00000376844:I147V;ENSP00000434779:I147V;ENSP00000436875:I75V;ENSP00000434259:I129V	ENSP00000376844:I147V	I	-	1	0	CASP1	104406392	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	5.956000	0.70315	0.829000	0.34733	0.455000	0.32223	ATC	CASP1	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000137752		0.398	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CASP1	HGNC	protein_coding	OTTHUMT00000388116.1	-	0.00	29	0	T	NM_033292		104901182	-1	tier1	-	no_errors	ENST00000436863	ensembl	human	known	74_37	missense	21.43	33	9	SNP	1.000	C
CCDC88A	55704	genome.wustl.edu	37	2	55566671	55566671	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:55566671C>T	ENST00000436346.1	-	13	2288	c.1447G>A	c.(1447-1449)Gtg>Atg	p.V483M	CCDC88A_ENST00000263630.8_Missense_Mutation_p.V483M|CCDC88A_ENST00000413716.2_Missense_Mutation_p.V483M|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000600219.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.V483M|AC012358.8_ENST00000599475.1_RNA|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000608103.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	483					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						ACAGAATCCACAGTAGTCCGA	0.353																																																	0													100.0	97.0	98.0					2																	55566671		2203	4300	6503	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1447G>A	2.37:g.55566671C>T	ENSP00000410608:p.Val483Met		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.V483M	ENST00000436346.1	37	c.1447		2	.	.	.	.	.	.	.	.	.	.	C	9.860	1.196094	0.22037	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.14	-2.49	0.06403	.	0.646248	0.13673	N	0.370775	T	0.09862	0.0242	N	0.19112	0.55	0.29575	N	0.849572	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.14023	0.01;0.001;0.001	T	0.28870	-1.0030	10	0.26408	T	0.33	0.0651	12.0214	0.53346	0.0:0.529:0.0:0.471	.	483;483;483	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	M	483	ENSP00000338728:V483M;ENSP00000263630:V483M;ENSP00000410608:V483M;ENSP00000404431:V483M	ENSP00000263630:V483M	V	-	1	0	CCDC88A	55420175	0.025000	0.19082	0.598000	0.28837	0.888000	0.51559	-0.554000	0.06006	-0.290000	0.09025	-0.438000	0.05819	GTG	CCDC88A	-	pfam_Hook-related_fam,superfamily_t-SNARE	ENSG00000115355		0.353	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		-	0.00	87	0	C	NM_017571		55566671	-1	tier1	-	no_errors	ENST00000436346	ensembl	human	known	74_37	missense	6.56	56	4	SNP	0.383	T
CCNL2	81669	genome.wustl.edu	37	1	1326172	1326172	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:1326172T>A	ENST00000400809.3	-	6	738	c.733A>T	c.(733-735)Att>Ttt	p.I245F	CCNL2_ENST00000408952.5_Missense_Mutation_p.I23F|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	245	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		GCAAGATAAATGCAGGCACAG	0.502																																																	0													81.0	83.0	82.0					1																	1326172		2203	4296	6499	SO:0001583	missense	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.733A>T	1.37:g.1326172T>A	ENSP00000383611:p.Ile245Phe		A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.I245F	ENST00000400809.3	37	c.733	CCDS30557.1	1	.	.	.	.	.	.	.	.	.	.	T	32	5.163932	0.94727	.	.	ENSG00000221978	ENST00000400809;ENST00000408952	T;T	0.24350	1.86;1.86	5.84	5.84	0.93424	Cyclin, C-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	M	0.88377	2.95	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.66168	-0.5991	10	0.66056	D	0.02	.	15.397	0.74805	0.0:0.0:0.0:1.0	.	245	Q96S94	CCNL2_HUMAN	F	245;23	ENSP00000383611:I245F;ENSP00000386132:I23F	ENSP00000383611:I245F	I	-	1	0	CCNL2	1316035	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.641000	0.83368	2.243000	0.73865	0.533000	0.62120	ATT	CCNL2	-	pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	ENSG00000221978		0.502	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	-	0.00	22	0	T	NM_030937		1326172	-1	tier1	-	no_errors	ENST00000400809	ensembl	human	known	74_37	missense	50.00	15	15	SNP	1.000	A
CCT5	22948	genome.wustl.edu	37	5	10258535	10258535	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:10258535C>A	ENST00000280326.4	+	6	1181	c.761C>A	c.(760-762)cCa>cAa	p.P254Q	CCT5_ENST00000515390.1_Missense_Mutation_p.P199Q|CCT5_ENST00000515676.1_Missense_Mutation_p.P216Q|CCT5_ENST00000506600.1_Missense_Mutation_p.P161Q|CCT5_ENST00000503026.1_Missense_Mutation_p.P233Q	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	254					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						CTCACATGTCCATTTGAACCA	0.388																																																	0													123.0	116.0	118.0					5																	10258535		2203	4300	6503	SO:0001583	missense	0			D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.761C>A	5.37:g.10258535C>A	ENSP00000280326:p.Pro254Gln		A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.P254Q	ENST00000280326.4	37	c.761	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	C	29.4	4.998802	0.93227	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.89829	0.6828	M	0.86864	2.845	0.80722	D	1	P;P;D;D;D;D	0.89917	0.795;0.874;1.0;0.999;0.999;0.999	P;P;D;D;D;D	0.81914	0.613;0.847;0.992;0.995;0.995;0.995	D	0.91329	0.5088	10	0.87932	D	0	-6.2705	18.3655	0.90389	0.0:1.0:0.0:0.0	.	161;199;103;252;254;254	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	Q	254;233;199;227;216;161	ENSP00000280326:P254Q;ENSP00000423318:P233Q;ENSP00000426923:P199Q;ENSP00000427297:P216Q;ENSP00000423052:P161Q	ENSP00000280326:P254Q	P	+	2	0	CCT5	10311535	1.000000	0.71417	0.922000	0.36590	0.963000	0.63663	7.352000	0.79404	2.561000	0.86390	0.650000	0.86243	CCA	CCT5	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_epsi	ENSG00000150753		0.388	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	HGNC	protein_coding	OTTHUMT00000253688.2	-	0.00	18	0	C			10258535	+1	tier1	-	no_errors	ENST00000280326	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	A
CDH10	1008	genome.wustl.edu	37	5	24487994	24487994	+	Silent	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:24487994A>G	ENST00000264463.4	-	12	2652	c.2145T>C	c.(2143-2145)aaT>aaC	p.N715N	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	715					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TTAGCCTTTCATTAATGAAAT	0.458										HNSCC(23;0.051)																																							0													94.0	99.0	98.0					5																	24487994		2203	4300	6503	SO:0001819	synonymous_variant	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2145T>C	5.37:g.24487994A>G			Q9ULB3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N715	ENST00000264463.4	37	c.2145	CCDS3892.1	5																																																																																			CDH10	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000040731		0.458	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	-	0.00	49	0	A	NM_006727		24487994	-1	tier1	-	no_errors	ENST00000264463	ensembl	human	known	74_37	silent	37.93	18	11	SNP	0.988	G
CDHR1	92211	genome.wustl.edu	37	10	85962761	85962761	+	Missense_Mutation	SNP	C	C	A	rs537851141		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr10:85962761C>A	ENST00000372117.3	+	8	768	c.665C>A	c.(664-666)gCt>gAt	p.A222D	CDHR1_ENST00000332904.3_Missense_Mutation_p.A222D|CDHR1_ENST00000440770.2_5'UTR	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	222	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CTTCATGGGGCTGATGTGGTG	0.547																																																	0													207.0	163.0	178.0					10																	85962761		2203	4300	6503	SO:0001583	missense	0			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.665C>A	10.37:g.85962761C>A	ENSP00000361189:p.Ala222Asp		Q69YZ8|Q8IXY5	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A222D	ENST00000372117.3	37	c.665	CCDS7372.1	10	.	.	.	.	.	.	.	.	.	.	C	7.671	0.686902	0.14973	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.02472	4.28;4.28	4.97	2.97	0.34412	Cadherin (4);Cadherin-like (1);	0.270585	0.37393	N	0.002102	T	0.02012	0.0063	N	0.26042	0.785	0.43569	D	0.995895	B;B	0.11235	0.003;0.004	B;B	0.18561	0.009;0.022	T	0.47959	-0.9076	10	0.11485	T	0.65	-12.1694	5.8836	0.18868	0.3192:0.5824:0.0:0.0983	.	222;222	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	D	222	ENSP00000331063:A222D;ENSP00000361189:A222D	ENSP00000331063:A222D	A	+	2	0	CDHR1	85952741	0.980000	0.34600	0.805000	0.32314	0.885000	0.51271	2.820000	0.48057	1.328000	0.45358	0.561000	0.74099	GCT	CDHR1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000148600		0.547	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	-	0.00	55	0	C	NM_033100		85962761	+1	tier1	-	no_errors	ENST00000372117	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.468	A
CEP164	22897	genome.wustl.edu	37	11	117222648	117222648	+	Frame_Shift_Del	DEL	A	A	-	rs75301270		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:117222648delA	ENST00000278935.3	+	5	484	c.337delA	c.(337-339)aaafs	p.K116fs		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	116	Interaction with ATRIP.|Lys-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		Taagaagaagaaaaaaaaaaa	0.507																																																	0													35.0	36.0	36.0					11																	117222648		2201	4296	6497	SO:0001589	frameshift_variant	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.337delA	11.37:g.117222648delA	ENSP00000278935:p.Lys116fs		Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Frame_Shift_Del	DEL	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.K116fs	ENST00000278935.3	37	c.337	CCDS31683.1	11																																																																																			CEP164	-	NULL	ENSG00000110274		0.507	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1		0.00	22	0	A	NM_014956		117222648	+1	tier1		no_errors	ENST00000278935	ensembl	human	known	74_37	frame_shift_del	17.39	19	4	DEL	1.000	-
CLTCL1	8218	genome.wustl.edu	37	22	19175595	19175595	+	Silent	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr22:19175595C>T	ENST00000263200.10	-	28	4404	c.4332G>A	c.(4330-4332)caG>caA	p.Q1444Q	CLTCL1_ENST00000353891.5_Silent_p.Q1444Q|CLTCL1_ENST00000442042.2_Intron|CLTCL1_ENST00000427926.1_Silent_p.Q1444Q	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1444	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CCAGGGGCAGCTGACCTGCCT	0.582			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													136.0	140.0	139.0					22																	19175595		2059	4191	6250	SO:0001819	synonymous_variant	0				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4332G>A	22.37:g.19175595C>T			B7Z7U5|Q14017|Q15808|Q15809	Silent	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.Q1444	ENST00000263200.10	37	c.4332	CCDS46662.1	22																																																																																			CLTCL1	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	ENSG00000070371		0.582	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	-	0.00	57	0	C	NM_007098		19175595	-1	tier1	-	no_errors	ENST00000263200	ensembl	human	known	74_37	silent	5.83	97	6	SNP	1.000	T
CNTNAP4	85445	genome.wustl.edu	37	16	76523630	76523630	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr16:76523630G>T	ENST00000476707.1	+	12	2078	c.1939G>T	c.(1939-1941)Gtc>Ttc	p.V647F	CNTNAP4_ENST00000478060.1_Missense_Mutation_p.V571F|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.V595F|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.V643F|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	644	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CTTAACAAGAGTCAGAAATAC	0.468																																																	0													44.0	38.0	40.0					16																	76523630		2198	4300	6498	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1939G>T	16.37:g.76523630G>T	ENSP00000417628:p.Val647Phe		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.V643F	ENST00000476707.1	37	c.1927		16	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430010	0.62844	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	4.55	4.55	0.56014	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	.	.	.	.	T	0.46795	0.1411	.	.	.	0.54753	D	0.999987	P;P;D;P	0.76494	0.883;0.883;0.999;0.556	P;P;D;B	0.66979	0.624;0.624;0.948;0.403	T	0.51474	-0.8701	8	0.87932	D	0	.	17.4696	0.87642	0.0:0.0:1.0:0.0	.	571;647;619;644	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	F	643;595;571;647	ENSP00000306893:V643F;ENSP00000439733:V595F;ENSP00000418741:V571F;ENSP00000417628:V647F	ENSP00000306893:V643F	V	+	1	0	CNTNAP4	75081131	1.000000	0.71417	0.592000	0.28758	0.981000	0.71138	4.171000	0.58236	2.527000	0.85204	0.557000	0.71058	GTC	CNTNAP4	-	NULL	ENSG00000152910		0.468	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	-	0.00	19	0	G	NM_033401		76523630	+1	tier1	-	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	T
COL21A1	81578	genome.wustl.edu	37	6	55988863	55988863	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:55988863G>T	ENST00000244728.5	-	16	2152	c.1755C>A	c.(1753-1755)ttC>ttA	p.F585L	COL21A1_ENST00000535941.1_Missense_Mutation_p.F585L|COL21A1_ENST00000370819.1_Missense_Mutation_p.F582L	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	585	Collagen-like 3.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			taaataCCTTGAAACCGGGAC	0.259																																																	0													22.0	19.0	20.0					6																	55988863		1628	3703	5331	SO:0001583	missense	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1755C>A	6.37:g.55988863G>T	ENSP00000244728:p.Phe585Leu		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.F585L	ENST00000244728.5	37	c.1755	CCDS55025.1	6	.	.	.	.	.	.	.	.	.	.	G	5.459	0.269854	0.10349	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	D;D;D	0.94046	-3.17;-3.34;-3.34	4.36	1.57	0.23409	.	0.259524	0.27236	N	0.020297	T	0.62454	0.2429	N	0.01631	-0.79	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50750	-0.8791	10	0.19590	T	0.45	.	6.7965	0.23729	0.3126:0.0:0.6874:0.0	.	585	Q96P44	COLA1_HUMAN	L	585;582;585;582	ENSP00000244728:F585L;ENSP00000359855:F582L;ENSP00000444384:F585L	ENSP00000244728:F585L	F	-	3	2	COL21A1	56096822	1.000000	0.71417	0.989000	0.46669	0.512000	0.34134	0.289000	0.18957	0.064000	0.16427	-0.424000	0.05967	TTC	COL21A1	-	NULL	ENSG00000124749		0.259	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	-	0.00	37	0	G			55988863	-1	tier1	-	no_errors	ENST00000244728	ensembl	human	known	74_37	missense	24.00	18	6	SNP	0.998	T
COL25A1	84570	genome.wustl.edu	37	4	109780831	109780831	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr4:109780831T>G	ENST00000399132.1	-	24	1831	c.1301A>C	c.(1300-1302)aAc>aCc	p.N434T	COL25A1_ENST00000399126.1_Missense_Mutation_p.N434T|COL25A1_ENST00000399127.1_Missense_Mutation_p.N415T	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TTCGTGGAGGTTGCCGTTGTA	0.488																																																	0													180.0	183.0	182.0					4																	109780831		2012	4163	6175	SO:0001583	missense	0			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1301A>C	4.37:g.109780831T>G	ENSP00000382083:p.Asn434Thr			Missense_Mutation	SNP	pfam_Collagen	p.N434T	ENST00000399132.1	37	c.1301	CCDS43258.1	4	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961196	0.53400	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.95554	-3.74;-2.71;-3.74	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.96664	0.8911	L	0.50333	1.59	0.40840	D	0.983664	D;D	0.71674	0.998;0.993	D;D	0.78314	0.991;0.971	D	0.96608	0.9450	9	.	.	.	-8.307	16.1787	0.81885	0.0:0.0:0.0:1.0	.	434;434	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	T	434;436;415;415;434;364	ENSP00000382083:N434T;ENSP00000382078:N415T;ENSP00000382077:N434T	.	N	-	2	0	COL25A1	110000280	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.435000	0.73412	2.219000	0.72066	0.528000	0.53228	AAC	COL25A1	-	NULL	ENSG00000188517		0.488	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL25A1	HGNC	protein_coding	OTTHUMT00000315938.2	-	0.00	81	0	T	NM_032518		109780831	-1	tier1	-	no_errors	ENST00000399132	ensembl	human	known	74_37	missense	14.49	59	10	SNP	1.000	G
COLCA2	120376	genome.wustl.edu	37	11	111179100	111179100	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:111179100T>C	ENST00000398035.2	+	5	1161	c.403T>C	c.(403-405)Tca>Cca	p.S135P	COLCA2_ENST00000526216.1_Missense_Mutation_p.S135P	NM_001136105.2	NP_001129577.1	A8K830	COLC2_HUMAN	colorectal cancer associated 2	135						cytoplasm (GO:0005737)											CTTTGCCCCCTCAGCAGCCGC	0.483																																																	0													47.0	45.0	46.0					11																	111179100		692	1591	2283	SO:0001583	missense	0			BC042557	CCDS44728.1, CCDS73378.1	11q23.1	2013-10-11	2013-08-22	2013-08-22	ENSG00000214290	ENSG00000214290			26978	protein-coding gene	gene with protein product	"""cancer susceptibility candidate 13"""	615694	"""chromosome 11 open reading frame 93"""	C11orf93		21071539	Standard	NM_001271457		Approved	CASC13	uc031qea.1	A8K830	OTTHUMG00000166657	ENST00000398035.2:c.403T>C	11.37:g.111179100T>C	ENSP00000381115:p.Ser135Pro		E9PMJ8|Q2TBJ3|V5LD62|V5LDI3|V5LDV1|V5LE09|V5LEU3	Missense_Mutation	SNP	NULL	p.S135P	ENST00000398035.2	37	c.403	CCDS44728.1	11	.	.	.	.	.	.	.	.	.	.	T	11.96	1.793893	0.31777	.	.	ENSG00000214290	ENST00000398035;ENST00000526216	.	.	.	5.77	2.08	0.27032	.	0.752361	0.10206	N	0.702703	T	0.25975	0.0633	N	0.20986	0.625	0.09310	N	1	B	0.19583	0.037	B	0.22386	0.039	T	0.27806	-1.0063	8	.	.	.	-16.5709	5.3245	0.15898	0.0:0.1585:0.1505:0.691	.	135	A8K830	CK093_HUMAN	P	135	.	.	S	+	1	0	C11orf93	110684310	0.101000	0.21875	0.392000	0.26245	0.600000	0.36913	0.688000	0.25422	0.403000	0.25479	0.459000	0.35465	TCA	COLCA2	-	NULL	ENSG00000214290		0.483	COLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLCA2	HGNC	protein_coding	OTTHUMT00000390991.1	-	0.00	25	0	T	NM_001136105		111179100	+1	tier1	-	no_errors	ENST00000398035	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.028	C
COPA	1314	genome.wustl.edu	37	1	160302324	160302324	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:160302324T>C	ENST00000241704.7	-	6	639	c.410A>G	c.(409-411)tAt>tGt	p.Y137C	COPA_ENST00000368069.3_Missense_Mutation_p.Y137C	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	137					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACACATCACATAATGGTTGTG	0.448																																																	0													121.0	108.0	112.0					1																	160302324		2203	4300	6503	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.410A>G	1.37:g.160302324T>C	ENSP00000241704:p.Tyr137Cys		Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Y137C	ENST00000241704.7	37	c.410	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392425	0.83011	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.60171	0.21;0.21	5.05	5.05	0.67936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65315	-0.6198	10	0.87932	D	0	-14.285	13.7615	0.62968	0.0:0.0:0.0:1.0	.	137;137	P53621;P53621-2	COPA_HUMAN;.	C	137	ENSP00000357048:Y137C;ENSP00000241704:Y137C	ENSP00000241704:Y137C	Y	-	2	0	COPA	158568948	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.622000	0.83099	2.117000	0.64856	0.459000	0.35465	TAT	COPA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000122218		0.448	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	14	0	T	NM_004371		160302324	-1			no_errors	ENST00000368069	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	C
CPXM2	119587	genome.wustl.edu	37	10	125530495	125530495	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr10:125530495delT	ENST00000241305.3	-	8	1193	c.1039delA	c.(1039-1041)agcfs	p.S347fs	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	347					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CCCTGGTGGCTTTTTCCAATG	0.458																																																	0													279.0	287.0	284.0					10																	125530495		2203	4300	6503	SO:0001589	frameshift_variant	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1039delA	10.37:g.125530495delT	ENSP00000241305:p.Ser347fs		B4E3Q2	Frame_Shift_Del	DEL	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.S347fs	ENST00000241305.3	37	c.1039	CCDS7637.1	10																																																																																			CPXM2	-	pfam_Peptidase_M14,prints_Peptidase_M14	ENSG00000121898		0.458	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1		0.00	44	0	T	NM_198148		125530495	-1	tier1		no_errors	ENST00000241305	ensembl	human	known	74_37	frame_shift_del	5.56	34	2	DEL	1.000	-
CRB1	23418	genome.wustl.edu	37	1	197297560	197297560	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:197297560T>C	ENST00000367400.3	+	2	214	c.79T>C	c.(79-81)Tgc>Cgc	p.C27R	CRB1_ENST00000538660.1_Missense_Mutation_p.C27R|CRB1_ENST00000535699.1_5'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.C27R	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	27			C -> F (in RP12). {ECO:0000269|PubMed:19956407}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						AGATTCCTTTTGCAATAAAAA	0.323																																																	0													38.0	39.0	38.0					1																	197297560		2198	4299	6497	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.79T>C	1.37:g.197297560T>C	ENSP00000356370:p.Cys27Arg		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C27R	ENST00000367400.3	37	c.79	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269556	0.59540	.	.	ENSG00000134376	ENST00000538660;ENST00000367400;ENST00000367399	D;D;D	0.92911	-3.13;-1.72;-2.34	5.52	4.38	0.52667	.	.	.	.	.	D	0.94886	0.8347	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	D	0.94666	0.7852	9	0.87932	D	0	.	11.7671	0.51937	0.0:0.0:0.147:0.853	.	27;27;27;52	B7Z5T2;P82279-3;P82279;Q59H36	.;.;CRUM1_HUMAN;.	R	27	ENSP00000438091:C27R;ENSP00000356370:C27R;ENSP00000356369:C27R	ENSP00000356369:C27R	C	+	1	0	CRB1	195564183	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.497000	0.45354	1.004000	0.39156	0.533000	0.62120	TGC	CRB1	-	NULL	ENSG00000134376		0.323	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	27	0	T	NM_201253		197297560	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	53.66	19	22	SNP	0.999	C
CRYAA	1409	genome.wustl.edu	37	21	44589921	44589921	+	Intron	DEL	C	C	-	rs71699904		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr21:44589921delC	ENST00000291554.2	+	1	281				CRYAA_ENST00000398132.1_5'Flank|CRYAA_ENST00000482775.1_Intron|CRYAA_ENST00000398133.1_Frame_Shift_Del_p.R29fs	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A						negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						GCAATGGACGCCCCCCCCCCC	0.612																																																	0																																										SO:0001627	intron_variant	0				CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.189+523C>-	21.37:g.44589921delC			Q53X53	Frame_Shift_Del	DEL	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.33fs	ENST00000291554.2	37	c.87	CCDS13695.1	21																																																																																			CRYAA	-	superfamily_HSP20-like_chaperone	ENSG00000160202		0.612	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYAA	HGNC	protein_coding	OTTHUMT00000195562.1		0.00	15	0	C			44589921	+1	tier1		no_errors	ENST00000398133	ensembl	human	putative	74_37	frame_shift_del	40.74	16	11	DEL	0.026	-
CTSL3P	392360	genome.wustl.edu	37	9	90388070	90388070	+	RNA	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:90388070G>A	ENST00000354530.2	+	0	141					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)										AGCACAGGAAGGGGAAAGTGC	0.448																																																	0													98.0	94.0	95.0					9																	90388070		2203	4300	6503			0			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90388070G>A				RNA	SNP	-	NULL	ENST00000354530.2	37	NULL		9																																																																																			CTSL3P	-	-	ENSG00000188029		0.448	CTSL3P-002	KNOWN	basic	processed_transcript	CTSL3P	HGNC	pseudogene	OTTHUMT00000356542.1	-	0.00	115	0	G	NR_027917		90388070	+1	tier1	-	no_errors	ENST00000354530	ensembl	human	known	74_37	rna	11.45	116	15	SNP	0.005	A
DGKB	1607	genome.wustl.edu	37	7	14661089	14661089	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:14661089T>C	ENST00000403951.2	-	15	1620	c.1201A>G	c.(1201-1203)Agt>Ggt	p.S401G	DGKB_ENST00000402815.1_Missense_Mutation_p.S400G|DGKB_ENST00000399322.3_Missense_Mutation_p.S401G|DGKB_ENST00000407950.1_Missense_Mutation_p.S393G|DGKB_ENST00000444700.2_Missense_Mutation_p.S382G|DGKB_ENST00000406247.3_Missense_Mutation_p.S401G|DGKB_ENST00000258767.5_Missense_Mutation_p.S401G|DGKB_ENST00000403963.1_5'UTR			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	401					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TGGGAACCACTCTTTTCCTTT	0.303																																																	0													150.0	126.0	133.0					7																	14661089		1819	4077	5896	SO:0001583	missense	0			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1201A>G	7.37:g.14661089T>C	ENSP00000385780:p.Ser401Gly		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.S401G	ENST00000403951.2	37	c.1201	CCDS47547.1	7	.	.	.	.	.	.	.	.	.	.	T	6.640	0.486491	0.12641	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.80393	-1.28;-1.28;-1.28;-1.27;-1.27;-1.25;-1.37	4.86	-3.61	0.04556	.	0.973157	0.08492	N	0.937826	T	0.51907	0.1702	N	0.01789	-0.72	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.38929	-0.9638	10	0.20519	T	0.43	.	8.8206	0.35023	0.1064:0.2621:0.0:0.6314	.	400;382;401;401	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	G	401;401;401;400;393;382;401	ENSP00000385780:S401G;ENSP00000382260:S401G;ENSP00000258767:S401G;ENSP00000384909:S400G;ENSP00000385031:S393G;ENSP00000388451:S382G;ENSP00000386066:S401G	ENSP00000258767:S401G	S	-	1	0	DGKB	14627614	0.000000	0.05858	0.067000	0.19924	0.917000	0.54804	-0.311000	0.08124	-0.753000	0.04721	0.260000	0.18958	AGT	DGKB	-	NULL	ENSG00000136267		0.303	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	HGNC	protein_coding	OTTHUMT00000326356.2	-	0.00	110	0	T	NM_004080		14661089	-1	tier1	-	no_errors	ENST00000258767	ensembl	human	known	74_37	missense	12.90	108	16	SNP	0.001	C
DIAPH3	81624	genome.wustl.edu	37	13	60686307	60686307	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr13:60686307G>T	ENST00000400324.4	-	3	447	c.227C>A	c.(226-228)gCc>gAc	p.A76D	DIAPH3_ENST00000267215.4_Missense_Mutation_p.A76D|DIAPH3_ENST00000400330.1_Missense_Mutation_p.A76D|DIAPH3_ENST00000400320.1_Missense_Mutation_p.A65D|DIAPH3_ENST00000377908.2_Missense_Mutation_p.A65D|DIAPH3_ENST00000400319.1_Intron	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	76					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TCTTATGCTGGCAAATTTGTC	0.423																																																	0													155.0	145.0	148.0					13																	60686307		1837	4092	5929	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.227C>A	13.37:g.60686307G>T	ENSP00000383178:p.Ala76Asp		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.A76D	ENST00000400324.4	37	c.227	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805455	0.90623	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000377908;ENST00000400320;ENST00000267215;ENST00000453990	D;D;D;D;D	0.90955	-1.75;-1.75;-1.84;-2.76;-1.71	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	L	0.53249	1.67	0.43667	D	0.99609	D;D;D	0.67145	0.996;0.996;0.995	P;P;P	0.60345	0.864;0.864;0.873	D	0.93587	0.6918	10	0.72032	D	0.01	.	19.0276	0.92939	0.0:0.0:1.0:0.0	.	65;65;76	C9JL55;C9JDG1;Q9NSV4	.;.;DIAP3_HUMAN	D	76;76;65;65;65;65;76;76	ENSP00000383178:A76D;ENSP00000383184:A76D;ENSP00000367141:A65D;ENSP00000383174:A65D;ENSP00000267215:A76D	ENSP00000267215:A76D	A	-	2	0	DIAPH3	59584308	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.157000	0.77461	2.797000	0.96272	0.563000	0.77884	GCC	DIAPH3	-	NULL	ENSG00000139734		0.423	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3		0.00	35	0	G	NM_001042517		60686307	-1			no_errors	ENST00000400324	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
DIS3L2	129563	genome.wustl.edu	37	2	233113982	233113982	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:233113982G>T	ENST00000409307.1	+	11	1351	c.1351G>T	c.(1351-1353)Gag>Tag	p.E451*	DIS3L2_ENST00000273009.6_Nonsense_Mutation_p.E451*|DIS3L2_ENST00000325385.7_Nonsense_Mutation_p.E451*					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GCTGTGTGAGGAGCTGTGCAG	0.547																																																	0													80.0	89.0	86.0					2																	233113982		2192	4284	6476	SO:0001587	stop_gained	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1351G>T	2.37:g.233113982G>T	ENSP00000386799:p.Glu451*			Nonsense_Mutation	SNP	NULL	p.E451*	ENST00000409307.1	37	c.1351	CCDS42834.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.640085	0.98406	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.2862	20.0706	0.97721	0.0:0.0:1.0:0.0	.	.	.	.	X	451;451;451;451;451;86	.	ENSP00000273009:E451X	E	+	1	0	DIS3L2	232822226	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.164000	0.94755	2.744000	0.94065	0.655000	0.94253	GAG	DIS3L2	-	NULL	ENSG00000144535		0.547	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1		0.00	23	0	G	NM_152383		233113982	+1			no_errors	ENST00000325385	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	1.000	T
DPPA4	55211	genome.wustl.edu	37	3	109050582	109050582	+	Splice_Site	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:109050582T>C	ENST00000335658.6	-	4	443	c.389A>G	c.(388-390)aAg>aGg	p.K130R	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	130					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						AAAAGTTACCTTTTGATTTGG	0.393																																																	0													97.0	93.0	95.0					3																	109050582		2203	4300	6503	SO:0001630	splice_region_variant	0			AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.390+1A>G	3.37:g.109050582T>C			A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	NULL	p.K130R	ENST00000335658.6	37	c.389	CCDS33814.1	3	.	.	.	.	.	.	.	.	.	.	T	11.89	1.773388	0.31411	.	.	ENSG00000121570	ENST00000335658	T	0.41758	0.99	4.11	0.0308	0.14168	.	0.665338	0.14460	N	0.318235	T	0.35566	0.0936	M	0.62723	1.935	0.18873	N	0.999982	B;D;B	0.54047	0.126;0.964;0.016	B;B;B	0.43508	0.025;0.422;0.008	T	0.22103	-1.0226	9	.	.	.	-4.9072	4.2906	0.10876	0.3721:0.0:0.1785:0.4493	.	120;130;130	B7Z5Q7;B7Z595;Q7L190	.;.;DPPA4_HUMAN	R	130	ENSP00000335306:K130R	.	K	-	2	0	DPPA4	110533272	0.998000	0.40836	0.642000	0.29436	0.225000	0.24961	0.874000	0.28065	0.017000	0.15025	0.529000	0.55759	AAG	DPPA4	-	NULL	ENSG00000121570		0.393	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA4	HGNC	protein_coding	OTTHUMT00000353897.1	-	0.00	54	0	T	NM_018189	Missense_Mutation	109050582	-1	tier1	-	no_errors	ENST00000335658	ensembl	human	known	74_37	missense	16.18	57	11	SNP	0.749	C
DPRX	503834	genome.wustl.edu	37	19	54139880	54139880	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:54139880A>G	ENST00000376650.1	+	3	265	c.214A>G	c.(214-216)Aag>Gag	p.K72E		NM_001012728.1	NP_001012746.1	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	72					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(4)|large_intestine(1)|lung(7)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		AGCAAAACTCAAGAAAGCGAA	0.423																																																	0													75.0	74.0	74.0					19																	54139880		2203	4300	6503	SO:0001583	missense	0				CCDS33103.1	19q13.42	2011-06-20			ENSG00000204595	ENSG00000204595		"""Homeoboxes / PRD class"""	32166	protein-coding gene	gene with protein product		611165					Standard	NM_001012728		Approved		uc002qcf.1	A6NFQ7		ENST00000376650.1:c.214A>G	19.37:g.54139880A>G	ENSP00000365838:p.Lys72Glu			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.K72E	ENST00000376650.1	37	c.214	CCDS33103.1	19	.	.	.	.	.	.	.	.	.	.	a	9.484	1.098864	0.20552	.	.	ENSG00000204595	ENST00000376650	D	0.98296	-4.85	1.45	1.45	0.22620	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	.	.	.	.	D	0.98845	0.9610	H	0.95043	3.615	0.09310	N	1	D	0.59357	0.985	P	0.62382	0.901	D	0.94650	0.7838	9	0.87932	D	0	.	5.0324	0.14417	1.0:0.0:0.0:0.0	.	72	A6NFQ7	DPRX_HUMAN	E	72	ENSP00000365838:K72E	ENSP00000365838:K72E	K	+	1	0	DPRX	58831692	0.615000	0.27026	0.020000	0.16555	0.220000	0.24768	0.440000	0.21592	0.918000	0.36919	0.459000	0.35465	AAG	DPRX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000204595		0.423	DPRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPRX	HGNC	protein_coding	OTTHUMT00000409880.1	-	0.00	40	0	A	NM_001012728		54139880	+1	tier1	-	no_errors	ENST00000376650	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.036	G
DUS4L	11062	genome.wustl.edu	37	7	107217834	107217834	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:107217834C>G	ENST00000265720.3	+	8	1145	c.783C>G	c.(781-783)atC>atG	p.I261M	RP4-593H12.1_ENST00000610269.1_RNA|BCAP29_ENST00000465919.1_5'Flank|BCAP29_ENST00000005259.4_5'Flank|BCAP29_ENST00000445771.2_5'Flank|DUS4L_ENST00000402620.1_Missense_Mutation_p.I140M	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	261							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						TGAAATGCATCTGGGACTGGG	0.428																																																	0													199.0	194.0	196.0					7																	107217834		2203	4300	6503	SO:0001583	missense	0			U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.783C>G	7.37:g.107217834C>G	ENSP00000265720:p.Ile261Met		B4DLX0|Q2NKK1	Missense_Mutation	SNP	pfam_tRNA_hU_synthase,pfam_OxRdtase_FMN_N,pirsf_tRNA_hU_synthase	p.I261M	ENST00000265720.3	37	c.783	CCDS5745.1	7	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355230	0.61293	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.22945	1.93;1.93	5.56	5.56	0.83823	.	0.273432	0.40908	N	0.000996	T	0.46737	0.1408	M	0.62209	1.925	0.49915	D	0.999837	P;P	0.34587	0.458;0.458	P;P	0.59487	0.858;0.858	T	0.42682	-0.9437	10	0.51188	T	0.08	.	9.0926	0.36621	0.1473:0.7791:0.0:0.0736	.	261;261	A4D0R5;O95620	.;DUS4L_HUMAN	M	261;140	ENSP00000265720:I261M;ENSP00000385274:I140M	ENSP00000265720:I261M	I	+	3	3	DUS4L	107005070	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.118000	0.31246	2.765000	0.95021	0.655000	0.94253	ATC	DUS4L	-	pfam_tRNA_hU_synthase,pirsf_tRNA_hU_synthase	ENSG00000105865		0.428	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS4L	HGNC	protein_coding	OTTHUMT00000336967.2	-	0.00	81	0	C	NM_181581		107217834	+1	tier1	-	no_errors	ENST00000265720	ensembl	human	known	74_37	missense	9.40	106	11	SNP	1.000	G
DUSP27	92235	genome.wustl.edu	37	1	167096073	167096073	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:167096073G>T	ENST00000361200.2	+	6	1871	c.1705G>T	c.(1705-1707)Gag>Tag	p.E569*	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Nonsense_Mutation_p.E569*|DUSP27_ENST00000443333.1_Nonsense_Mutation_p.E569*			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	569					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CAGCAGCGGTGAGCCCGGTGC	0.557																																																	0													53.0	55.0	55.0					1																	167096073		2203	4300	6503	SO:0001587	stop_gained	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1705G>T	1.37:g.167096073G>T	ENSP00000354483:p.Glu569*		A0AUM4|Q9C074	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.E569*	ENST00000361200.2	37	c.1705	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.085175	0.94100	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	.	.	.	5.05	5.05	0.67936	.	0.680848	0.12955	N	0.425487	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.9713	14.4354	0.67277	0.0:0.1924:0.8076:0.0	.	.	.	.	X	569	.	ENSP00000271385:E569X	E	+	1	0	DUSP27	165362697	1.000000	0.71417	0.394000	0.26270	0.064000	0.16182	3.434000	0.52841	2.336000	0.79503	0.643000	0.83706	GAG	DUSP27	-	NULL	ENSG00000198842		0.557	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	-	0.00	19	0	G	NM_001080426		167096073	+1	tier1	-	no_errors	ENST00000271385	ensembl	human	known	74_37	nonsense	41.67	14	10	SNP	0.941	T
EFCAB1	79645	genome.wustl.edu	37	8	49644005	49644005	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:49644005A>G	ENST00000262103.3	-	2	196	c.116T>C	c.(115-117)gTa>gCa	p.V39A	EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000523092.1_Intron|EFCAB1_ENST00000433756.1_Intron	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	39							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TTGCCTCTCTACTCCTCCCAC	0.353																																																	0													101.0	93.0	96.0					8																	49644005		2203	4300	6503	SO:0001583	missense	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.116T>C	8.37:g.49644005A>G	ENSP00000262103:p.Val39Ala		B4DSB4|E7EVN7	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.V39A	ENST00000262103.3	37	c.116	CCDS6145.1	8	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.516284	0.00975	.	.	ENSG00000034239	ENST00000262103;ENST00000450553	T	0.67523	-0.27	4.77	0.742	0.18341	EF-hand-like domain (1);	0.911550	0.09544	N	0.787871	T	0.33147	0.0853	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25710	-1.0124	10	0.02654	T	1	.	7.4233	0.27083	0.5507:0.0:0.4493:0.0	.	39	Q9HAE3	EFCB1_HUMAN	A	39	ENSP00000262103:V39A	ENSP00000262103:V39A	V	-	2	0	EFCAB1	49806558	0.000000	0.05858	0.018000	0.16275	0.135000	0.20990	0.192000	0.17096	0.017000	0.15025	0.528000	0.53228	GTA	EFCAB1	-	NULL	ENSG00000034239		0.353	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1	-	0.00	46	0	A	NM_024593		49644005	-1	tier1	-	no_errors	ENST00000262103	ensembl	human	known	74_37	missense	25.00	24	8	SNP	0.028	G
EMC3	55831	genome.wustl.edu	37	3	10016090	10016091	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:10016090_10016091insA	ENST00000245046.2	-	4	847_848	c.389_390insT	c.(388-390)atgfs	p.M130fs	EMC3_ENST00000429759.1_Frame_Shift_Ins_p.M168fs|EMC3_ENST00000497557.1_5'UTR	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	130						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CTGAGAATGTCATGTTGATCCA	0.411																																																	0																																										SO:0001589	frameshift_variant	0			AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.390dupT	3.37:g.10016091_10016091dupA	ENSP00000245046:p.Met130fs		B2R4Z9|Q53GH8|Q6ZMC2	Frame_Shift_Ins	INS	pfam_DUF106_TM,pirsf_UCP010045_TM_euk	p.M130fs	ENST00000245046.2	37	c.390_389	CCDS2594.1	3																																																																																			EMC3	-	pfam_DUF106_TM,pirsf_UCP010045_TM_euk	ENSG00000125037		0.411	EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC3	HGNC	protein_coding	OTTHUMT00000250532.1		0.00	53	0	-	NM_018447		10016091	-1	tier1		no_errors	ENST00000245046	ensembl	human	known	74_37	frame_shift_ins	40.82	29	20	INS	1.000:1.000	A
FXYD2	486	genome.wustl.edu	37	11	117691332	117691332	+	Intron	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:117691332C>A	ENST00000292079.2	-	5	273				RP11-728F11.3_ENST00000596805.1_RNA|FXYD6-FXYD2_ENST00000532984.1_Intron|FXYD2_ENST00000514385.1_5'Flank|FXYD2_ENST00000532119.1_Intron|FXYD2_ENST00000528014.1_Intron|RP11-728F11.3_ENST00000531850.2_RNA|FXYD2_ENST00000260287.2_Intron	NM_001680.4	NP_001671.2	P54710	ATNG_HUMAN	FXYD domain containing ion transport regulator 2						ion transmembrane transport (GO:0034220)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ion channel activity (GO:0005216)|sodium:potassium-exchanging ATPase activity (GO:0005391)|transporter activity (GO:0005215)			breast(1)|kidney(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;2.83e-05)|Epithelial(105;0.00114)	Cyclothiazide(DB00606)	CTGTTGCTCCCAAGCCTGCCC	0.542																																																	0													43.0	44.0	44.0					11																	117691332		692	1591	2283	SO:0001627	intron_variant	0			AF241236	CCDS8385.1, CCDS8386.1	11q23	2008-02-05	2003-02-28						4026	protein-coding gene	gene with protein product		601814	"""hypomagnesemia 2, renal"""	ATP1G1, HOMG2		9048881, 9915957	Standard	NM_021603		Approved	MGC12372		P54710		ENST00000292079.2:c.198+48G>T	11.37:g.117691332C>A			Q15332|Q53YC1|Q9GZP3|Q9GZQ7	RNA	SNP	-	NULL	ENST00000292079.2	37	NULL	CCDS8386.1	11																																																																																			RP11-728F11.3	-	-	ENSG00000254844		0.542	FXYD2-002	KNOWN	basic|CCDS	protein_coding	ENSG00000254844	Clone_based_vega_gene	protein_coding	OTTHUMT00000390050.1	-	0.00	35	0	C	NM_021603		117691332	+1	tier1	-	no_errors	ENST00000531850	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.000	A
EPOR	2057	genome.wustl.edu	37	19	11492471	11492471	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:11492471T>A	ENST00000222139.6	-	4	586	c.482A>T	c.(481-483)cAc>cTc	p.H161L	EPOR_ENST00000592375.2_Missense_Mutation_p.H161L	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	161	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CAACACTACGTGGCCGCTCTC	0.682											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	21.0	22.0					19																	11492471		2202	4298	6500	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.482A>T	19.37:g.11492471T>A	ENSP00000222139:p.His161Leu	672	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pirsf_Erythropoietin_rcpt,pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H161L	ENST00000222139.6	37	c.482	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	T	9.977	1.227030	0.22542	.	.	ENSG00000187266	ENST00000222139	T	0.56776	0.44	4.9	3.81	0.43845	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.374166	0.30791	N	0.008867	T	0.33585	0.0868	L	0.27053	0.805	0.27875	N	0.939889	B	0.18863	0.031	B	0.12837	0.008	T	0.12268	-1.0554	10	0.16420	T	0.52	-30.5506	7.985	0.30207	0.0:0.0:0.2078:0.7922	.	161	P19235	EPOR_HUMAN	L	161	ENSP00000222139:H161L	ENSP00000222139:H161L	H	-	2	0	EPOR	11353471	1.000000	0.71417	0.992000	0.48379	0.049000	0.14656	2.694000	0.47035	1.853000	0.53794	0.254000	0.18369	CAC	EPOR	-	pirsf_Erythropoietin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187266		0.682	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	-	0.00	29	0	T			11492471	-1	tier1	-	no_errors	ENST00000222139	ensembl	human	known	74_37	missense	66.67	25	50	SNP	0.827	A
ESCO1	114799	genome.wustl.edu	37	18	19112452	19112452	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr18:19112452C>T	ENST00000269214.5	-	11	3294	c.2357G>A	c.(2356-2358)cGc>cAc	p.R786H		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	786					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TTCAATCATGCGAGAAGCAAT	0.403																																																	0													123.0	114.0	117.0					18																	19112452		2203	4300	6503	SO:0001583	missense	0			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2357G>A	18.37:g.19112452C>T	ENSP00000269214:p.Arg786His		B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	NULL	p.R786H	ENST00000269214.5	37	c.2357	CCDS32800.1	18	.	.	.	.	.	.	.	.	.	.	C	34	5.393305	0.96009	.	.	ENSG00000141446	ENST00000269214	D	0.83335	-1.71	5.57	5.57	0.84162	.	0.063272	0.64402	D	0.000004	D	0.92077	0.7489	M	0.84156	2.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92204	0.5770	10	0.56958	D	0.05	-6.3648	19.5519	0.95324	0.0:1.0:0.0:0.0	.	786	Q5FWF5	ESCO1_HUMAN	H	786	ENSP00000269214:R786H	ENSP00000269214:R786H	R	-	2	0	ESCO1	17366450	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.623000	0.88846	0.467000	0.42956	CGC	ESCO1	-	NULL	ENSG00000141446		0.403	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO1	HGNC	protein_coding	OTTHUMT00000443942.1		0.00	24	0	C	NM_052911		19112452	-1			no_errors	ENST00000269214	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
ESRRA	2101	genome.wustl.edu	37	11	64081712	64081713	+	Splice_Site	INS	-	-	GTGC			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:64081712_64081713insGTGC	ENST00000405666.1	+	4	678_679	c.444_445insGTGC	c.(445-447)gtg>GTGCgtg	p.-150fs	ESRRA_ENST00000000442.6_Splice_Site_p.-150fs|ESRRA_ENST00000406310.1_Splice_Site_p.-150fs	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha						cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CAATTCAAGGAGTGCGCCTGGA	0.673																																																	0																																										SO:0001630	splice_region_variant	0			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.443-1->GTGC	11.37:g.64081713_64081716dupGTGC			Q14514	Frame_Shift_Ins	INS	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L150fs	ENST00000405666.1	37	c.444_445	CCDS41667.1	11																																																																																			ESRRA	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	ENSG00000173153		0.673	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ESRRA	HGNC	protein_coding	OTTHUMT00000319304.1		0.00	35	0	-	NM_004451	Frame_Shift_Ins	64081713	+1	tier1		no_errors	ENST00000000442	ensembl	human	known	74_37	frame_shift_ins	24.44	34	11	INS	0.995:1.000	GTGC
EXOC8	149371	genome.wustl.edu	37	1	231471716	231471716	+	Silent	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:231471716C>T	ENST00000360394.2	-	1	1862	c.1776G>A	c.(1774-1776)gaG>gaA	p.E592E	EXOC8_ENST00000366645.1_Silent_p.E588E|SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank|SPRTN_ENST00000008440.9_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	592					cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				AACTTTTCATCTCTTCTTTGA	0.458																																																	0													123.0	120.0	121.0					1																	231471716		2203	4300	6503	SO:0001819	synonymous_variant	0			AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.1776G>A	1.37:g.231471716C>T			B3KU33|Q5TE82	Silent	SNP	superfamily_Cullin_repeat-like_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E592	ENST00000360394.2	37	c.1776	CCDS1593.1	1																																																																																			EXOC8	-	NULL	ENSG00000116903		0.458	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOC8	HGNC	protein_coding			0.00	32	0	C	NM_175876		231471716	-1			no_errors	ENST00000360394	ensembl	human	known	74_37	silent	12.50	21	3	SNP	1.000	T
F2RL3	9002	genome.wustl.edu	37	19	17001241	17001241	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:17001241G>C	ENST00000248076.3	+	2	1297	c.967G>C	c.(967-969)Gtg>Ctg	p.V323L		NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	323					blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						TGGTGCCTACGTGCCCAGCCT	0.647																																																	0													30.0	28.0	29.0					19																	17001241		2202	4298	6500	SO:0001583	missense	0			AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0		ENST00000248076.3:c.967G>C	19.37:g.17001241G>C	ENSP00000248076:p.Val323Leu		O76067|Q6DK42	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prot_act_rcpt_4,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.V323L	ENST00000248076.3	37	c.967	CCDS12350.1	19	.	.	.	.	.	.	.	.	.	.	G	6.044	0.376455	0.11466	.	.	ENSG00000127533	ENST00000248076	T	0.35973	1.28	4.15	-4.63	0.03359	GPCR, rhodopsin-like superfamily (1);	0.242826	0.29987	U	0.010696	T	0.11495	0.0280	N	0.11341	0.13	0.30514	N	0.769087	B	0.15473	0.013	B	0.17722	0.019	T	0.38628	-0.9652	10	0.02654	T	1	.	6.0953	0.20017	0.3948:0.4294:0.1758:0.0	.	323	Q96RI0	PAR4_HUMAN	L	323	ENSP00000248076:V323L	ENSP00000248076:V323L	V	+	1	0	F2RL3	16862241	0.001000	0.12720	0.789000	0.31954	0.041000	0.13682	-0.277000	0.08502	-0.800000	0.04433	-0.339000	0.08088	GTG	F2RL3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prot_act_rcpt_4,prints_GPCR_Rhodpsn	ENSG00000127533		0.647	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2RL3	HGNC	protein_coding	OTTHUMT00000462875.1		0.00	23	0	G			17001241	+1			no_errors	ENST00000248076	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.986	C
F8	2157	genome.wustl.edu	37	X	154158117	154158117	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:154158117T>C	ENST00000360256.4	-	14	4148	c.3948A>G	c.(3946-3948)atA>atG	p.I1316M		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1316	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TATTAGGAGATATCCTTGTGG	0.393																																																	0													197.0	168.0	178.0					X																	154158117		2203	4300	6503	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3948A>G	X.37:g.154158117T>C	ENSP00000353393:p.Ile1316Met		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.I1316M	ENST00000360256.4	37	c.3948	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	t	0	-2.756680	0.00085	.	.	ENSG00000185010	ENST00000360256	D	0.99121	-5.45	4.08	0.153	0.14897	.	0.601453	0.15504	N	0.258900	D	0.92341	0.7570	N	0.02011	-0.69	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	D	0.88558	0.3121	10	0.31617	T	0.26	-0.5201	3.2855	0.06930	0.0:0.399:0.2078:0.3933	.	1316	P00451	FA8_HUMAN	M	1316	ENSP00000353393:I1316M	ENSP00000353393:I1316M	I	-	3	3	F8	153811311	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.948000	0.03897	0.016000	0.14998	-0.291000	0.09656	ATA	F8	-	NULL	ENSG00000185010		0.393	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4		0.00	31	0	T			154158117	-1			no_errors	ENST00000360256	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.000	C
FARSA	2193	genome.wustl.edu	37	19	13041426	13041427	+	Splice_Site	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:13041426_13041427insA	ENST00000314606.4	-	2	302_303	c.284_285insT	c.(283-285)atg>atTg	p.M95fs	FARSA_ENST00000588025.1_Splice_Site_p.M135fs|FARSA_ENST00000423140.2_Splice_Site_p.M95fs|CTC-425F1.2_ENST00000592636.1_RNA	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	95					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CAGCTCCTACCATAAGCTCGCT	0.634																																																	0																																										SO:0001630	splice_region_variant	0			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.285+1->T	19.37:g.13041427_13041427dupA			B4E363|Q9NSD8|Q9Y4W8	Frame_Shift_Ins	INS	pfam_Phenylalanyl-tRNA_Synthase,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_asu	p.M95fs	ENST00000314606.4	37	c.285_284	CCDS12287.1	19																																																																																			FARSA	-	NULL	ENSG00000179115		0.634	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSA	HGNC	protein_coding	OTTHUMT00000451935.1		0.00	34	0	-	NM_004461	Frame_Shift_Ins	13041427	-1	tier1		no_errors	ENST00000314606	ensembl	human	known	74_37	frame_shift_ins	15.00	68	12	INS	1.000:1.000	A
FAT3	120114	genome.wustl.edu	37	11	92590461	92590461	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:92590461G>A	ENST00000298047.6	+	19	11464	c.11447G>A	c.(11446-11448)aGc>aAc	p.S3816N	FAT3_ENST00000525166.1_Missense_Mutation_p.S3666N|FAT3_ENST00000533797.1_Missense_Mutation_p.S151N|FAT3_ENST00000409404.2_Missense_Mutation_p.S3816N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3816	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TATGAAGCCAGCAGGAGACCG	0.532										TCGA Ovarian(4;0.039)																																							0													114.0	122.0	119.0					11																	92590461		2032	4198	6230	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11447G>A	11.37:g.92590461G>A	ENSP00000298047:p.Ser3816Asn		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S3816N	ENST00000298047.6	37	c.11447		11	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116562	0.37339	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.95	5.03	0.67393	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.34890	0.0913	L	0.61218	1.895	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.08868	-1.0701	9	0.34782	T	0.22	.	11.0343	0.47791	0.1518:0.0:0.8482:0.0	.	3816;3816	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	N	3816;3816;3666;151	ENSP00000298047:S3816N;ENSP00000387040:S3816N;ENSP00000432586:S3666N;ENSP00000436399:S151N	ENSP00000298047:S3816N	S	+	2	0	FAT3	92230109	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.493000	0.45320	2.824000	0.97209	0.655000	0.94253	AGC	FAT3	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000165323		0.532	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	34	0	G	NM_001008781		92590461	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	23.33	23	7	SNP	1.000	A
FBXO39	162517	genome.wustl.edu	37	17	6684108	6684108	+	Silent	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:6684108G>T	ENST00000321535.4	+	2	1051	c.921G>T	c.(919-921)ccG>ccT	p.P307P		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	307								p.P307P(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						AGGAGATCCCGATCAGGAGCA	0.532																																																	1	Substitution - coding silent(1)	large_intestine(1)											59.0	51.0	54.0					17																	6684108		2203	4300	6503	SO:0001819	synonymous_variant	0			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.921G>T	17.37:g.6684108G>T				Silent	SNP	NULL	p.P307	ENST00000321535.4	37	c.921	CCDS11082.1	17																																																																																			FBXO39	-	NULL	ENSG00000177294		0.532	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO39	HGNC	protein_coding	OTTHUMT00000219866.2		0.00	36	0	G	NM_153230		6684108	+1			no_errors	ENST00000321535	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.000	T
FGFR4	2264	genome.wustl.edu	37	5	176519413	176519413	+	Silent	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:176519413G>T	ENST00000292408.4	+	7	1064	c.819G>T	c.(817-819)gtG>gtT	p.V273V	FGFR4_ENST00000393637.1_Silent_p.V273V|FGFR4_ENST00000502906.1_Silent_p.V273V|FGFR4_ENST00000393648.2_Silent_p.V273V|FGFR4_ENST00000292410.3_Silent_p.V273V	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	273	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TGTGCAAGGTGTACAGCGATG	0.657										TSP Lung(9;0.080)																																							0													38.0	37.0	38.0					5																	176519413		2203	4300	6503	SO:0001819	synonymous_variant	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.819G>T	5.37:g.176519413G>T			G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V273	ENST00000292408.4	37	c.819	CCDS4410.1	5																																																																																			FGFR4	-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000160867		0.657	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	-	0.00	24	0	G			176519413	+1	tier1	-	no_errors	ENST00000292408	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.998	T
MACROD1	28992	genome.wustl.edu	37	11	63885526	63885526	+	Intron	SNP	A	A	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:63885526A>C	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.K596T	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						GGCAGCAGGAAAAAGGATGAC	0.617																																																	0													41.0	41.0	41.0					11																	63885526		2201	4297	6498	SO:0001627	intron_variant	0			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+33184T>G	11.37:g.63885526A>C			Q9UH96	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.K596T	ENST00000255681.6	37	c.1787	CCDS8056.1	11	.	.	.	.	.	.	.	.	.	.	A	8.884	0.952245	0.18431	.	.	ENSG00000126500	ENST00000246841	T	0.54279	0.58	5.03	2.61	0.31194	.	0.315265	0.31612	N	0.007347	T	0.40119	0.1104	L	0.36672	1.1	0.30558	N	0.76479	B	0.19445	0.036	B	0.15052	0.012	T	0.41288	-0.9517	10	0.87932	D	0	-6.2658	9.0035	0.36097	0.8413:0.0:0.1587:0.0	.	568	Q9NZU1	FLRT1_HUMAN	T	596	ENSP00000246841:K596T	ENSP00000246841:K596T	K	+	2	0	FLRT1	63642102	1.000000	0.71417	0.993000	0.49108	0.563000	0.35712	3.549000	0.53681	0.318000	0.23185	0.459000	0.35465	AAA	FLRT1	-	NULL	ENSG00000126500		0.617	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT1	HGNC	protein_coding	OTTHUMT00000396570.1	-	0.00	29	0	A	NM_014067		63885526	+1	tier1	-	no_errors	ENST00000246841	ensembl	human	known	74_37	missense	14.58	41	7	SNP	0.978	C
FRMD8	83786	genome.wustl.edu	37	11	65154535	65154535	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:65154535C>A	ENST00000317568.5	+	2	191	c.28C>A	c.(28-30)Cag>Aag	p.Q10K	FRMD8_ENST00000531296.1_Missense_Mutation_p.Q10K|FRMD8_ENST00000355991.5_Missense_Mutation_p.Q10K|FRMD8_ENST00000416776.2_Missense_Mutation_p.Q10K	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	10						cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						CAGTGCCGGGCAGCCCGGCCC	0.667																																																	0													73.0	84.0	80.0					11																	65154535		2200	4297	6497	SO:0001583	missense	0			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.28C>A	11.37:g.65154535C>A	ENSP00000319726:p.Gln10Lys		B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.Q10K	ENST00000317568.5	37	c.28	CCDS8102.1	11	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199393	0.38806	.	.	ENSG00000126391	ENST00000317568;ENST00000531296;ENST00000533782;ENST00000355991;ENST00000416776;ENST00000526201;ENST00000525156	D;T;T;D	0.82433	-1.59;-1.19;-1.17;-1.61	5.05	5.05	0.67936	.	0.181255	0.33327	N	0.005029	T	0.75715	0.3887	L	0.36672	1.1	0.27929	N	0.937938	B;B;B	0.19817	0.039;0.027;0.016	B;B;B	0.21917	0.037;0.017;0.011	T	0.63337	-0.6660	10	0.24483	T	0.36	-12.3562	14.2707	0.66149	0.0:1.0:0.0:0.0	.	10;10;10	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	K	10	ENSP00000319726:Q10K;ENSP00000435913:Q10K;ENSP00000348270:Q10K;ENSP00000392111:Q10K	ENSP00000319726:Q10K	Q	+	1	0	FRMD8	64911111	0.998000	0.40836	0.996000	0.52242	0.460000	0.32559	3.777000	0.55364	2.537000	0.85549	0.561000	0.74099	CAG	FRMD8	-	NULL	ENSG00000126391		0.667	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD8	HGNC	protein_coding	OTTHUMT00000388833.1	-	0.00	75	0	C	NM_031904		65154535	+1	tier1	-	no_errors	ENST00000317568	ensembl	human	known	74_37	missense	13.95	74	12	SNP	0.988	A
FSCB	84075	genome.wustl.edu	37	14	44975361	44975361	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:44975361G>A	ENST00000340446.4	-	1	1121	c.830C>T	c.(829-831)gCc>gTc	p.A277V	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	277						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TTTAGCAGTGGCCTCTTCAAC	0.488																																																	0													56.0	59.0	58.0					14																	44975361		2203	4300	6503	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.830C>T	14.37:g.44975361G>A	ENSP00000344579:p.Ala277Val		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.A277V	ENST00000340446.4	37	c.830	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526404	0.27299	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.17691	2.26	4.48	-2.08	0.07254	.	.	.	.	.	T	0.10465	0.0256	L	0.29908	0.895	0.09310	N	1	P	0.40332	0.713	B	0.39562	0.303	T	0.25606	-1.0127	9	0.28530	T	0.3	3.6913	5.65	0.17610	0.3056:0.2554:0.439:0.0	.	277	Q5H9T9	FSCB_HUMAN	V	277	ENSP00000344579:A277V	ENSP00000344579:A277V	A	-	2	0	FSCB	44045111	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.074000	0.11450	-0.576000	0.05974	-0.889000	0.02933	GCC	FSCB	-	NULL	ENSG00000189139		0.488	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1		0.00	38	0	G	NM_032135		44975361	-1			no_errors	ENST00000340446	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.018	A
GAB2	9846	genome.wustl.edu	37	11	77934560	77934560	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:77934560G>T	ENST00000361507.4	-	6	1550	c.1465C>A	c.(1465-1467)Ctt>Att	p.L489I	GAB2_ENST00000340149.2_Missense_Mutation_p.L451I	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	489					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GGGTAGCCAAGTGAGTCAAAG	0.557																																																	0													216.0	205.0	209.0					11																	77934560		2200	4292	6492	SO:0001583	missense	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1465C>A	11.37:g.77934560G>T	ENSP00000354952:p.Leu489Ile		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L489I	ENST00000361507.4	37	c.1465	CCDS8259.1	11	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126493	0.56721	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.15718	2.4;2.62	5.49	5.49	0.81192	.	0.271361	0.30940	U	0.008578	T	0.10937	0.0267	L	0.28458	0.855	0.33324	D	0.567662	P	0.35077	0.483	B	0.18871	0.023	T	0.18871	-1.0323	10	0.19147	T	0.46	-11.6519	14.7533	0.69543	0.0:0.1552:0.8448:0.0	.	489	Q9UQC2	GAB2_HUMAN	I	451;489	ENSP00000343959:L451I;ENSP00000354952:L489I	ENSP00000343959:L451I	L	-	1	0	GAB2	77612208	1.000000	0.71417	0.053000	0.19242	0.995000	0.86356	4.237000	0.58681	2.583000	0.87209	0.561000	0.74099	CTT	GAB2	-	NULL	ENSG00000033327		0.557	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1	-	0.00	66	0	G	NM_080491		77934560	-1	tier1	-	no_errors	ENST00000361507	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.697	T
GALC	2581	genome.wustl.edu	37	14	88431853	88431853	+	Silent	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:88431853T>C	ENST00000261304.2	-	9	1135	c.1029A>G	c.(1027-1029)gtA>gtG	p.V343V	GALC_ENST00000393569.2_Silent_p.V317V|GALC_ENST00000393568.4_Silent_p.V320V|GALC_ENST00000544807.2_Silent_p.V287V	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	343					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCATACCTGATACCCAGACAG	0.448																																																	0													87.0	93.0	91.0					14																	88431853		1901	4125	6026	SO:0001819	synonymous_variant	0			L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1029A>G	14.37:g.88431853T>C			B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Silent	SNP	pfam_Glyco_hydro_59,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_59	p.V343	ENST00000261304.2	37	c.1029	CCDS9878.2	14																																																																																			GALC	-	pfam_Glyco_hydro_59,superfamily_Glycoside_hydrolase_SF	ENSG00000054983		0.448	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	HGNC	protein_coding	OTTHUMT00000071559.2		0.00	20	0	T			88431853	-1			no_errors	ENST00000261304	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.016	C
GK2	2712	genome.wustl.edu	37	4	80328426	80328426	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr4:80328426C>G	ENST00000358842.3	-	1	946	c.929G>C	c.(928-930)aGa>aCa	p.R310T		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						TGGCTTCTCTCTGCCTAGTTT	0.428																																																	0													118.0	104.0	109.0					4																	80328426		2203	4300	6503	SO:0001583	missense	0			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.929G>C	4.37:g.80328426C>G	ENSP00000351706:p.Arg310Thr		Q7Z4Q4	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.R310T	ENST00000358842.3	37	c.929	CCDS3585.1	4	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.506244	0.00992	.	.	ENSG00000196475	ENST00000358842	D	0.84660	-1.88	3.88	-3.81	0.04294	Carbohydrate kinase, FGGY, C-terminal (1);	0.120530	0.56097	D	0.000033	T	0.74489	0.3723	L	0.35414	1.06	0.41117	D	0.98578	P	0.39131	0.661	B	0.42087	0.375	T	0.66372	-0.5940	10	0.14656	T	0.56	-21.9544	11.4311	0.50041	0.0:0.3043:0.0:0.6957	.	310	Q14410	GLPK2_HUMAN	T	310	ENSP00000351706:R310T	ENSP00000351706:R310T	R	-	2	0	GK2	80547450	0.802000	0.28943	0.070000	0.20053	0.003000	0.03518	-0.015000	0.12634	-1.245000	0.02513	-1.628000	0.00784	AGA	GK2	-	pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	ENSG00000196475		0.428	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	-	0.00	50	0	C	NM_033214		80328426	-1	tier1	-	no_errors	ENST00000358842	ensembl	human	known	74_37	missense	19.57	37	9	SNP	0.991	G
GOLGA6L1	283767	genome.wustl.edu	37	15	22742849	22742849	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr15:22742849C>A	ENST00000560659.2	+	8	1084	c.1084C>A	c.(1084-1086)Cag>Aag	p.Q362K	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.Q412K			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	406										NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						ggagaagaggcaggagcagga	0.557																																																	0													1.0	1.0	1.0					15																	22742849		72	87	159	SO:0001583	missense	0			AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.1084C>A	15.37:g.22742849C>A	ENSP00000452626:p.Gln362Lys			Missense_Mutation	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.Q412K	ENST00000560659.2	37	c.1234		15	.	.	.	.	.	.	.	.	.	.	.	0.033	-1.320062	0.01320	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.09723	2.95	.	.	.	.	.	.	.	.	T	0.05914	0.0154	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.42120	-0.9470	5	0.05620	T	0.96	.	.	.	.	.	.	.	.	K	412	ENSP00000320207:Q412K	ENSP00000320207:Q412K	Q	+	1	0	GOLGA6L1	20294213	0.007000	0.16637	0.187000	0.23214	0.188000	0.23474	0.104000	0.15313	0.149000	0.19098	0.152000	0.16155	CAG	GOLGA6L1	-	NULL	ENSG00000197414		0.557	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	GOLGA6L1	HGNC	protein_coding	OTTHUMT00000415616.2	-	0.00	45	0	C	NM_001001413		22742849	+1	tier1	-	no_errors	ENST00000316397	ensembl	human	known	74_37	missense	58.54	17	24	SNP	0.199	A
GREB1L	80000	genome.wustl.edu	37	18	18975495	18975495	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr18:18975495G>T	ENST00000580732.2	+	5	886	c.505G>T	c.(505-507)Gat>Tat	p.D169Y	GREB1L_ENST00000400483.4_Missense_Mutation_p.D169Y|GREB1L_ENST00000424526.1_Missense_Mutation_p.D169Y|GREB1L_ENST00000269218.6_Missense_Mutation_p.D169Y|GREB1L_ENST00000431264.1_Missense_Mutation_p.D169Y|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000578368.1_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	169						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						ATTTCTACCAGATGATCATGG	0.408																																																	0													107.0	89.0	95.0					18																	18975495		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.505G>T	18.37:g.18975495G>T	ENSP00000464162:p.Asp169Tyr		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.D169Y	ENST00000580732.2	37	c.505	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175681	0.57692	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.23348	2.69;2.59;1.91;1.91	4.71	4.71	0.59529	.	.	.	.	.	T	0.52885	0.1762	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.57814	-0.7746	9	0.66056	D	0.02	.	17.8529	0.88752	0.0:0.0:1.0:0.0	.	169;169	Q9C091;Q9C091-2	GRB1L_HUMAN;.	Y	169	ENSP00000412060:D169Y;ENSP00000269218:D169Y;ENSP00000383331:D169Y;ENSP00000393125:D169Y	ENSP00000269218:D169Y	D	+	1	0	GREB1L	17229493	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	9.657000	0.98554	2.433000	0.82419	0.462000	0.41574	GAT	GREB1L	-	NULL	ENSG00000141449		0.408	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	47	0	G	NM_024935		18975495	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
GRIP2	80852	genome.wustl.edu	37	3	14547144	14547146	+	RNA	DEL	TCC	TCC	-	rs374133419	byFrequency	TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:14547144_14547146delTCC	ENST00000273083.3	-	0	2614_2616							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						CTCCCAATCATCCTCCTCCTCCT	0.66																																																	0																																												0			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14547153_14547155delTCC			Q8TEH9|Q9H7H3	RNA	DEL	-	NULL	ENST00000273083.3	37	NULL		3																																																																																			GRIP2	-	-	ENSG00000144596		0.660	GRIP2-001	KNOWN	basic	processed_transcript	GRIP2	HGNC	processed_transcript	OTTHUMT00000340582.2		0.00	47	0	TCC	NM_001080423		14547146	-1	tier1		no_errors	ENST00000273083	ensembl	human	known	74_37	rna	11.11	32	4	DEL	0.866:0.967:0.974	-
HEATR2	54919	genome.wustl.edu	37	7	769417	769417	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:769417G>C	ENST00000297440.6	+	2	733	c.713G>C	c.(712-714)gGc>gCc	p.G238A	PRKAR1B_ENST00000403562.1_5'Flank|HEATR2_ENST00000313147.5_Missense_Mutation_p.G238A|PRKAR1B_ENST00000537384.1_5'Flank|HEATR2_ENST00000438961.1_3'UTR|PRKAR1B_ENST00000488474.1_5'Flank	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	238						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		ATCCATTTTGGCAACGGGAAG	0.572																																																	0													133.0	108.0	116.0					7																	769417		2203	4300	6503	SO:0001583	missense	0			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.713G>C	7.37:g.769417G>C	ENSP00000297440:p.Gly238Ala		Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.G238A	ENST00000297440.6	37	c.713	CCDS34580.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.959661|3.959661	0.74016|0.74016	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000297440;ENST00000313147|ENST00000440747	T;T|.	0.65364|.	-0.15;-0.15|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.68924|0.68924	0.3054|0.3054	L|L	0.46819|0.46819	1.47|1.47	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	P|.	0.61940|.	0.896|.	T|T	0.65573|0.65573	-0.6135|-0.6135	10|5	0.62326|.	D|.	0.03|.	-48.6796|-48.6796	18.7191|18.7191	0.91686|0.91686	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	238|.	Q86Y56|.	HEAT2_HUMAN|.	A|C	238|39	ENSP00000297440:G238A;ENSP00000321451:G238A|.	ENSP00000297440:G238A|.	G|W	+|+	2|3	0|0	HEATR2|HEATR2	735943|735943	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.388000|0.388000	0.30384|0.30384	8.852000|8.852000	0.92215|0.92215	2.420000|2.420000	0.82092|0.82092	0.655000|0.655000	0.94253|0.94253	GGC|TGG	HEATR2	-	superfamily_ARM-type_fold	ENSG00000164818		0.572	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	HGNC	protein_coding	OTTHUMT00000322542.1	-	0.00	51	0	G	NM_017802		769417	+1	tier1	-	no_errors	ENST00000297440	ensembl	human	known	74_37	missense	11.43	62	8	SNP	1.000	C
HELLS	3070	genome.wustl.edu	37	10	96331177	96331177	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr10:96331177G>T	ENST00000348459.5	+	7	573	c.468G>T	c.(466-468)aaG>aaT	p.K156N	HELLS_ENST00000371332.4_Missense_Mutation_p.K156N|HELLS_ENST00000394044.1_Missense_Mutation_p.K156N|HELLS_ENST00000394036.1_3'UTR|HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394045.1_Missense_Mutation_p.K156N	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		AAAATAAAAAGGAGAATGAGG	0.254																																																	0													44.0	51.0	49.0					10																	96331177		2171	4269	6440	SO:0001583	missense	0			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.468G>T	10.37:g.96331177G>T	ENSP00000239027:p.Lys156Asn			Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K156N	ENST00000348459.5	37	c.468	CCDS7434.1	10	.	.	.	.	.	.	.	.	.	.	G	0.605	-0.827478	0.02734	.	.	ENSG00000119969	ENST00000419900;ENST00000348459;ENST00000394045;ENST00000394044;ENST00000371332	T;T;D;T	0.96136	0.39;0.39;-3.92;0.39	4.32	2.39	0.29439	.	1.269340	0.05139	N	0.493907	D	0.89030	0.6599	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B	0.33477	0.191;0.032;0.005;0.413;0.0	B;B;B;B;B	0.31869	0.043;0.021;0.002;0.137;0.001	T	0.79955	-0.1585	10	0.20046	T	0.44	-1.6951	6.2654	0.20924	0.1854:0.1549:0.6597:0.0	.	140;156;156;156;156	Q9NRZ9-2;Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;.;HELLS_HUMAN	N	140;156;156;156;156	ENSP00000239027:K156N;ENSP00000377609:K156N;ENSP00000377608:K156N;ENSP00000360383:K156N	ENSP00000239027:K156N	K	+	3	2	HELLS	96321167	1.000000	0.71417	0.992000	0.48379	0.058000	0.15608	0.607000	0.24209	0.935000	0.37341	-0.208000	0.12717	AAG	HELLS	-	NULL	ENSG00000119969		0.254	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELLS	HGNC	protein_coding	OTTHUMT00000049475.1	-	0.00	46	0	G	NM_018063		96331177	+1	tier1	-	no_errors	ENST00000371332	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.998	T
HIST1H1C	3006	genome.wustl.edu	37	6	26056317	26056317	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:26056317C>G	ENST00000343677.2	-	1	382	c.340G>C	c.(340-342)Ggg>Cgg	p.G114R		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	114					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TTGGCTTCCCCGGAGGCTGCC	0.577																																																	0													70.0	79.0	76.0					6																	26056317		2203	4300	6503	SO:0001583	missense	0			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.340G>C	6.37:g.26056317C>G	ENSP00000339566:p.Gly114Arg		A8K4I2	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.G114R	ENST00000343677.2	37	c.340	CCDS4577.1	6	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667548	0.29604	.	.	ENSG00000187837	ENST00000343677	T	0.08546	3.08	5.54	5.54	0.83059	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.741779	0.12413	N	0.471125	T	0.12008	0.0292	L	0.52011	1.625	0.21416	N	0.999698	D	0.76494	0.999	D	0.66084	0.941	T	0.13495	-1.0507	10	0.40728	T	0.16	-22.4812	12.1964	0.54300	0.0:0.9218:0.0:0.0782	.	114	P16403	H12_HUMAN	R	114	ENSP00000339566:G114R	ENSP00000339566:G114R	G	-	1	0	HIST1H1C	26164296	0.026000	0.19158	0.435000	0.26784	0.025000	0.11179	2.188000	0.42612	2.763000	0.94921	0.655000	0.94253	GGG	HIST1H1C	-	prints_Histone_H5	ENSG00000187837		0.577	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	HGNC	protein_coding	OTTHUMT00000043372.1	-	0.00	27	0	C	NM_005319		26056317	-1	tier1	-	no_errors	ENST00000343677	ensembl	human	known	74_37	missense	14.29	30	5	SNP	0.191	G
IBTK	25998	genome.wustl.edu	37	6	82921212	82921212	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:82921212C>T	ENST00000306270.7	-	14	2918	c.2369G>A	c.(2368-2370)aGa>aAa	p.R790K	RNU6-130P_ENST00000411112.1_RNA|IBTK_ENST00000503631.1_Missense_Mutation_p.R589K|IBTK_ENST00000510291.1_Missense_Mutation_p.R790K	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	790	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CCTACCAAGTCTAGCACAAAG	0.318																																																	0													85.0	80.0	82.0					6																	82921212		2203	4300	6503	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2369G>A	6.37:g.82921212C>T	ENSP00000305721:p.Arg790Lys		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.R790K	ENST00000306270.7	37	c.2369	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175798	0.78564	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.69926	-0.44;-0.44;-0.44	6.08	6.08	0.98989	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.84288	0.5439	M	0.88031	2.925	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;1.0	D;D;P;D	0.85130	0.987;0.997;0.897;0.997	D	0.85312	0.1079	10	0.72032	D	0.01	-26.4567	20.6721	0.99693	0.0:1.0:0.0:0.0	.	589;790;790;790	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	K	790;589;790	ENSP00000305721:R790K;ENSP00000422762:R589K;ENSP00000426405:R790K	ENSP00000305721:R790K	R	-	2	0	IBTK	82977931	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	7.463000	0.80869	2.894000	0.99253	0.591000	0.81541	AGA	IBTK	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000005700		0.318	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2	-	0.00	46	0	C	NM_015525		82921212	-1	tier1	-	no_errors	ENST00000306270	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	T
IFT88	8100	genome.wustl.edu	37	13	21189967	21189967	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr13:21189967C>A	ENST00000319980.6	+	16	1502	c.1175C>A	c.(1174-1176)gCa>gAa	p.A392E	IFT88_ENST00000537103.1_Missense_Mutation_p.A364E|IFT88_ENST00000382778.4_Missense_Mutation_p.A392E|IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000351808.5_Missense_Mutation_p.A383E	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	392					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		ATGACATCTGCAAAACTCATT	0.299																																																	0													85.0	95.0	91.0					13																	21189967		2203	4294	6497	SO:0001583	missense	0			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1175C>A	13.37:g.21189967C>A	ENSP00000323580:p.Ala392Glu		A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat,smart_Sel1-like,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A392E	ENST00000319980.6	37	c.1175	CCDS31944.1	13	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927156	0.92389	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.38722	1.13;1.12;1.13;1.14	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.71617	0.3361	M	0.88310	2.945	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.85130	0.995;0.989;0.997;0.994	T	0.77138	-0.2698	10	0.87932	D	0	-17.2129	18.3588	0.90368	0.0:1.0:0.0:0.0	.	364;392;190;392	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	E	392;255;383;392;364	ENSP00000372228:A392E;ENSP00000261632:A383E;ENSP00000323580:A392E;ENSP00000437719:A364E	ENSP00000323580:A392E	A	+	2	0	IFT88	20087967	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.060000	0.76692	2.625000	0.88918	0.650000	0.86243	GCA	IFT88	-	NULL	ENSG00000032742		0.299	IFT88-002	KNOWN	basic|CCDS	protein_coding	IFT88	HGNC	protein_coding	OTTHUMT00000044075.3	-	0.00	37	0	C	NM_006531		21189967	+1	tier1	-	no_errors	ENST00000319980	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	A
IGF2R	3482	genome.wustl.edu	37	6	160481680	160481680	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:160481680C>T	ENST00000356956.1	+	23	3341	c.3193C>T	c.(3193-3195)Cga>Tga	p.R1065*		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1065					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GCAAGGGATCCGAAACACTTA	0.507																																																	0													164.0	148.0	154.0					6																	160481680		2203	4300	6503	SO:0001587	stop_gained	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.3193C>T	6.37:g.160481680C>T	ENSP00000349437:p.Arg1065*		Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.R1065*	ENST00000356956.1	37	c.3193	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	43	9.975429	0.99308	.	.	ENSG00000197081	ENST00000356956	.	.	.	4.91	2.76	0.32466	.	0.287341	0.33127	N	0.005245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-8.3181	11.8795	0.52566	0.0:0.8267:0.0:0.1733	.	.	.	.	X	1065	.	ENSP00000349437:R1065X	R	+	1	2	IGF2R	160401670	0.994000	0.37717	0.234000	0.24042	0.997000	0.91878	2.740000	0.47418	1.052000	0.40392	0.591000	0.81541	CGA	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.507	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	0.00	106	0	C	NM_000876		160481680	+1	tier1	-	no_errors	ENST00000356956	ensembl	human	known	74_37	nonsense	13.59	89	14	SNP	0.895	T
ILDR1	286676	genome.wustl.edu	37	3	121712109	121712109	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:121712109C>T	ENST00000344209.5	-	7	1613	c.1487G>A	c.(1486-1488)cGc>cAc	p.R496H	ILDR1_ENST00000393631.1_Missense_Mutation_p.R407H|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000273691.3_Missense_Mutation_p.R452H|ILDR1_ENST00000462014.1_Missense_Mutation_p.R464H	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	496					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)	p.R496H(1)|p.R452H(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		CGAGCCGCGGCGGTGGGCCCG	0.637																																																	2	Substitution - Missense(2)	large_intestine(2)											19.0	21.0	21.0					3																	121712109		2201	4296	6497	SO:0001583	missense	0			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.1487G>A	3.37:g.121712109C>T	ENSP00000345667:p.Arg496His		Q6ZP61|Q7Z578	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.R496H	ENST00000344209.5	37	c.1487	CCDS56271.1	3	.	.	.	.	.	.	.	.	.	.	C	0.854	-0.737671	0.03111	.	.	ENSG00000145103	ENST00000273691;ENST00000344209;ENST00000393631;ENST00000462014	T;T;T;T	0.80909	-0.73;-0.71;-1.43;-0.3	4.38	-2.18	0.07037	.	0.665977	0.12494	N	0.464005	T	0.60728	0.2291	N	0.13043	0.29	0.18873	N	0.999987	B;B;B;B	0.12013	0.003;0.002;0.003;0.005	B;B;B;B	0.08055	0.003;0.001;0.002;0.002	T	0.48614	-0.9020	10	0.59425	D	0.04	-9.9973	6.3034	0.21125	0.0:0.2715:0.4706:0.2579	.	407;496;452;464	Q86SU0-5;Q86SU0;Q86SU0-2;Q86SU0-6	.;ILDR1_HUMAN;.;.	H	452;496;407;464	ENSP00000273691:R452H;ENSP00000345667:R496H;ENSP00000377251:R407H;ENSP00000419414:R464H	ENSP00000273691:R452H	R	-	2	0	ILDR1	123194799	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.407000	0.07178	-0.460000	0.07003	-0.216000	0.12614	CGC	ILDR1	-	NULL	ENSG00000145103		0.637	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ILDR1	HGNC	protein_coding	OTTHUMT00000355666.1	-	0.00	53	0	C	NM_175924		121712109	-1	tier1	-	no_errors	ENST00000344209	ensembl	human	known	74_37	missense	24.66	54	18	SNP	0.000	T
KIAA0408	9729	genome.wustl.edu	37	6	127771344	127771344	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:127771344G>T	ENST00000483725.3	-	3	625	c.289C>A	c.(289-291)Cac>Aac	p.H97N	SOGA3_ENST00000368268.2_3'UTR|SOGA3_ENST00000481848.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	97										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		CCATCTTTGTGATTCGTCCTT	0.353																																																	0													128.0	128.0	128.0					6																	127771344		2203	4300	6503	SO:0001583	missense	0			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.289C>A	6.37:g.127771344G>T	ENSP00000435150:p.His97Asn		B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Missense_Mutation	SNP	NULL	p.H97N	ENST00000483725.3	37	c.289	CCDS34531.1	6	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.281000	0.00254	.	.	ENSG00000189367	ENST00000483725;ENST00000487331	T;T	0.41400	1.0;1.0	5.7	1.58	0.23477	.	1.806050	0.04366	U	0.358361	T	0.11410	0.0278	N	0.19112	0.55	0.09310	N	1	B	0.30361	0.277	B	0.28638	0.092	T	0.23332	-1.0191	10	0.25106	T	0.35	-0.0264	8.8772	0.35352	0.2714:0.1107:0.618:0.0	.	97	Q6ZU52	K0408_HUMAN	N	97;109	ENSP00000435150:H97N;ENSP00000434384:H109N	ENSP00000435150:H97N	H	-	1	0	KIAA0408	127813037	0.005000	0.15991	0.003000	0.11579	0.006000	0.05464	0.296000	0.19083	0.333000	0.23563	0.650000	0.86243	CAC	KIAA0408	-	NULL	ENSG00000189367		0.353	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA0408	HGNC	protein_coding	OTTHUMT00000042145.3	-	0.00	32	0	G	NM_014702		127771344	-1	tier1	-	no_errors	ENST00000483725	ensembl	human	novel	74_37	missense	33.33	18	9	SNP	0.000	T
KIAA1841	84542	genome.wustl.edu	37	2	61361295	61361295	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:61361295C>A	ENST00000295031.5	+	21	2429	c.2052C>A	c.(2050-2052)gaC>gaA	p.D684E		NM_032506.2	NP_115895.2	Q6NSI8	K1841_HUMAN	KIAA1841	0								p.D684D(1)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			gacccagagacggcactgtgt	0.403																																																	1	Substitution - coding silent(1)	large_intestine(1)											152.0	139.0	144.0					2																	61361295		2203	4300	6503	SO:0001583	missense	0			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000295031.5:c.2052C>A	2.37:g.61361295C>A	ENSP00000295031:p.Asp684Glu		Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.D684E	ENST00000295031.5	37	c.2052	CCDS1867.1	2	.	.	.	.	.	.	.	.	.	.	C	0.082	-1.181482	0.01633	.	.	ENSG00000162929	ENST00000295031	.	.	.	2.12	0.921	0.19403	.	2.720490	0.02360	N	0.076817	T	0.17534	0.0421	.	.	.	0.18873	N	0.999987	B	0.18166	0.026	B	0.15870	0.014	T	0.15896	-1.0421	8	0.09843	T	0.71	.	3.873	0.09044	0.0:0.193:0.0:0.807	.	684	Q6NSI8-2	.	E	684	.	ENSP00000295031:D684E	D	+	3	2	KIAA1841	61214799	0.458000	0.25760	0.199000	0.23439	0.286000	0.27126	-0.376000	0.07465	0.278000	0.22164	-0.752000	0.03492	GAC	KIAA1841	-	NULL	ENSG00000162929		0.403	KIAA1841-001	KNOWN	basic|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000251580.1	-	0.00	79	0	C	NM_032506		61361295	+1	tier1	-	no_errors	ENST00000295031	ensembl	human	known	74_37	missense	21.43	55	15	SNP	0.203	A
KIAA2022	340533	genome.wustl.edu	37	X	73963734	73963734	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:73963734T>C	ENST00000055682.6	-	3	1269	c.658A>G	c.(658-660)Act>Gct	p.T220A		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	220					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GGTTTCTCAGTTTCTCGTCTG	0.448																																																	0													135.0	122.0	126.0					X																	73963734		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.658A>G	X.37:g.73963734T>C	ENSP00000055682:p.Thr220Ala		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.T220A	ENST00000055682.6	37	c.658	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	T	0.339	-0.951758	0.02285	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.27890	1.64;1.64	5.97	1.93	0.25924	.	0.382752	0.30159	N	0.010271	T	0.11196	0.0273	N	0.12182	0.205	0.24919	N	0.991998	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	10	0.06891	T	0.86	-1.1774	2.8651	0.05599	0.1307:0.5329:0.1198:0.2167	.	220	Q5QGS0	K2022_HUMAN	A	220	ENSP00000362567:T220A;ENSP00000055682:T220A	ENSP00000055682:T220A	T	-	1	0	KIAA2022	73880459	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.548000	0.36201	0.592000	0.29728	-0.287000	0.09952	ACT	KIAA2022	-	NULL	ENSG00000050030		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	25	0	T	NM_001008537		73963734	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.999	C
KIF14	9928	genome.wustl.edu	37	1	200572411	200572411	+	Missense_Mutation	SNP	G	G	A	rs142004534		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:200572411G>A	ENST00000367350.4	-	10	2360	c.1922C>T	c.(1921-1923)tCg>tTg	p.S641L		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	641	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)	p.S641L(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGCTTGTTCCGAAAGTGCAGA	0.303																																																	1	Substitution - Missense(1)	lung(1)						G	LEU/SER	2,4404	4.2+/-10.8	0,2,2201	97.0	100.0	99.0		1922	5.6	0.2	1	dbSNP_134	99	1,8595	1.2+/-3.3	0,1,4297	no	missense	KIF14	NM_014875.2	145	0,3,6498	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	641/1649	200572411	3,12999	2203	4298	6501	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1922C>T	1.37:g.200572411G>A	ENSP00000356319:p.Ser641Leu		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S641L	ENST00000367350.4	37	c.1922	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.142914	0.94560	4.54E-4	1.16E-4	ENSG00000118193	ENST00000367350	T	0.75589	-0.95	5.56	5.56	0.83823	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.86961	0.6059	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.88033	0.2776	10	0.87932	D	0	.	19.5216	0.95187	0.0:0.0:1.0:0.0	.	641	Q15058	KIF14_HUMAN	L	641	ENSP00000356319:S641L	ENSP00000356319:S641L	S	-	2	0	KIF14	198839034	1.000000	0.71417	0.176000	0.23000	0.976000	0.68499	9.444000	0.97578	2.602000	0.87976	0.591000	0.81541	TCG	KIF14	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom	ENSG00000118193		0.303	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1		0.00	27	0	G	NM_014875		200572411	-1			no_errors	ENST00000367350	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.998	A
KIF16B	55614	genome.wustl.edu	37	20	16488617	16488617	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr20:16488617T>C	ENST00000354981.2	-	7	842	c.685A>G	c.(685-687)Atc>Gtc	p.I229V	KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000355755.3_Missense_Mutation_p.I229V|KIF16B_ENST00000408042.1_Missense_Mutation_p.I229V	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	229	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GTGAACTTGATGGTGAAGATG	0.527																																																	0													208.0	169.0	182.0					20																	16488617		2203	4300	6503	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.685A>G	20.37:g.16488617T>C	ENSP00000347076:p.Ile229Val		A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.I229V	ENST00000354981.2	37	c.685	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	T	16.21	3.057588	0.55325	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	T;T;T	0.76968	-1.06;-1.06;-1.06	5.84	5.84	0.93424	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	T	0.71592	0.3358	L	0.45744	1.44	0.80722	D	1	B;B;B;B	0.24092	0.025;0.097;0.011;0.014	B;B;B;B	0.23419	0.019;0.046;0.012;0.021	T	0.69942	-0.5008	10	0.59425	D	0.04	.	11.2771	0.49174	0.0:0.0706:0.0:0.9294	.	229;229;229;229	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	V	229	ENSP00000347076:I229V;ENSP00000347995:I229V;ENSP00000384164:I229V	ENSP00000347076:I229V	I	-	1	0	KIF16B	16436617	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.166000	0.64965	2.230000	0.72887	0.455000	0.32223	ATC	KIF16B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000089177		0.527	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	-	0.00	44	0	T	NM_017683		16488617	-1	tier1	-	no_errors	ENST00000408042	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	C
KIF1A	547	genome.wustl.edu	37	2	241724476	241724476	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:241724476G>A	ENST00000320389.7	-	7	808	c.650C>T	c.(649-651)tCc>tTc	p.S217F	KIF1A_ENST00000498729.2_Missense_Mutation_p.S217F	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	217	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GACGGCGTGGGAGCGACTGCT	0.612																																																	0													235.0	247.0	243.0					2																	241724476		2202	4300	6502	SO:0001583	missense	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.650C>T	2.37:g.241724476G>A	ENSP00000322791:p.Ser217Phe		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S217F	ENST00000320389.7	37	c.650	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688472	0.88639	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	D;D;D	0.88124	-2.34;-2.34;-2.34	4.14	4.14	0.48551	Kinesin, motor domain (5);	0.000000	0.85682	U	0.000000	D	0.96870	0.8978	H	0.99842	4.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.97;0.999	D	0.99466	1.0944	10	0.87932	D	0	.	16.7934	0.85595	0.0:0.0:1.0:0.0	.	217;217;217	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	F	217	ENSP00000322791:S217F;ENSP00000438388:S217F;ENSP00000384231:S217F	ENSP00000322791:S217F	S	-	2	0	KIF1A	241373149	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.441000	0.97557	2.026000	0.59711	0.563000	0.77884	TCC	KIF1A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000130294		0.612	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	-	0.00	41	0	G	NM_138483		241724476	-1	tier1	-	no_errors	ENST00000498729	ensembl	human	known	74_37	missense	49.21	32	31	SNP	1.000	A
KNOP1	400506	genome.wustl.edu	37	16	19718330	19718330	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr16:19718330T>A	ENST00000219837.7	-	5	1357	c.1279A>T	c.(1279-1281)Aag>Tag	p.K427*	AC002550.5_ENST00000565916.1_RNA|KNOP1_ENST00000568230.1_Nonsense_Mutation_p.K106*	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	427	Interaction with ZNF106. {ECO:0000250}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CGGCTGTACTTCCAGCTCATG	0.592																																																	0													77.0	84.0	82.0					16																	19718330		1873	4098	5971	SO:0001587	stop_gained	0			BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.1279A>T	16.37:g.19718330T>A	ENSP00000219837:p.Lys427*		O43328|Q5FWF3	Nonsense_Mutation	SNP	NULL	p.K427*	ENST00000219837.7	37	c.1279	CCDS42127.1	16	.	.	.	.	.	.	.	.	.	.	T	38	6.801554	0.97849	.	.	ENSG00000103550	ENST00000219837	.	.	.	4.87	3.75	0.43078	.	0.824426	0.11110	N	0.598667	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.4599	11.6228	0.51128	0.0:0.0:0.1492:0.8508	.	.	.	.	X	427	.	.	K	-	1	0	C16orf88	19625831	1.000000	0.71417	0.999000	0.59377	0.809000	0.45718	1.374000	0.34283	0.836000	0.34901	0.460000	0.39030	AAG	KNOP1	-	NULL	ENSG00000103550		0.592	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNOP1	HGNC	protein_coding	OTTHUMT00000435993.2	-	0.00	52	0	T	NM_001012991		19718330	-1	tier1	-	no_errors	ENST00000219837	ensembl	human	known	74_37	nonsense	29.73	26	11	SNP	1.000	A
KRT15	3866	genome.wustl.edu	37	17	39670288	39670288	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:39670288T>C	ENST00000254043.3	-	8	4943	c.1358A>G	c.(1357-1359)aAg>aGg	p.K453R	KRT15_ENST00000393974.3_Missense_Mutation_p.K288R|KRT15_ENST00000393981.3_3'UTR|KRT15_ENST00000393976.2_Missense_Mutation_p.K453R	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	453	Tail.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				GATTTCTCTCTTGTGGGAAGA	0.517																																																	0													157.0	144.0	148.0					17																	39670288		2203	4300	6503	SO:0001583	missense	0				CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.1358A>G	17.37:g.39670288T>C	ENSP00000254043:p.Lys453Arg		B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K453R	ENST00000254043.3	37	c.1358	CCDS11398.1	17	.	.	.	.	.	.	.	.	.	.	T	10.04	1.242604	0.22796	.	.	ENSG00000171346	ENST00000254043;ENST00000393974;ENST00000393976	D;T;D	0.81908	-1.55;-1.39;-1.55	5.75	4.67	0.58626	.	0.132339	0.33631	N	0.004712	T	0.65626	0.2709	N	0.08118	0	0.80722	D	1	B;B;B	0.30406	0.041;0.278;0.278	B;B;B	0.24974	0.037;0.057;0.057	T	0.63919	-0.6528	10	0.49607	T	0.09	.	10.1019	0.42511	0.0:0.0:0.1686:0.8314	.	288;453;453	A8MT21;B3KVF5;P19012	.;.;K1C15_HUMAN	R	453;288;453	ENSP00000254043:K453R;ENSP00000377544:K288R;ENSP00000377546:K453R	ENSP00000254043:K453R	K	-	2	0	KRT15	36923814	0.998000	0.40836	0.966000	0.40874	0.035000	0.12851	2.440000	0.44855	1.004000	0.39156	-0.264000	0.10439	AAG	KRT15	-	NULL	ENSG00000171346		0.517	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT15	HGNC	protein_coding	OTTHUMT00000257301.1	-	0.00	18	0	T	NM_002275		39670288	-1	tier1	-	no_errors	ENST00000254043	ensembl	human	known	74_37	missense	22.58	24	7	SNP	0.966	C
KRTDAP	388533	genome.wustl.edu	37	19	35978335	35978335	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:35978335G>T	ENST00000338897.3	-	6	383	c.295C>A	c.(295-297)Cag>Aag	p.Q99K	KRTDAP_ENST00000479340.1_5'UTR|KRTDAP_ENST00000484218.2_Missense_Mutation_p.Q85K	NM_207392.2	NP_997275.1	P60985	KTDAP_HUMAN	keratinocyte differentiation-associated protein	99					cell differentiation (GO:0030154)	extracellular region (GO:0005576)				breast(1)|lung(4)|prostate(1)	6	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CATGGTCACTGGGCATCAGGA	0.542																																																	0													129.0	123.0	125.0					19																	35978335		2203	4300	6503	SO:0001583	missense	0			AA297512	CCDS12462.1, CCDS59377.1	19q13.12	2013-06-20			ENSG00000188508	ENSG00000188508			16313	protein-coding gene	gene with protein product						11054531	Standard	NM_207392		Approved	KDAP, UNQ467	uc002nzh.3	P60985	OTTHUMG00000155449	ENST00000338897.3:c.295C>A	19.37:g.35978335G>T	ENSP00000339251:p.Gln99Lys		A1L4D7	Missense_Mutation	SNP	NULL	p.Q99K	ENST00000338897.3	37	c.295	CCDS12462.1	19	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715023	0.48622	.	.	ENSG00000188508	ENST00000338897	.	.	.	5.67	2.24	0.28232	.	0.333888	0.26003	N	0.026933	T	0.36991	0.0987	.	.	.	0.30860	N	0.733591	B	0.30146	0.27	B	0.31812	0.136	T	0.40776	-0.9545	8	0.87932	D	0	-31.4114	6.4283	0.21782	0.085:0.0:0.5938:0.3211	.	99	P60985	KTDAP_HUMAN	K	99	.	ENSP00000339251:Q99K	Q	-	1	0	KRTDAP	40670175	1.000000	0.71417	0.373000	0.26003	0.109000	0.19521	0.872000	0.28037	0.291000	0.22468	0.655000	0.94253	CAG	KRTDAP	-	NULL	ENSG00000188508		0.542	KRTDAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTDAP	HGNC	protein_coding	OTTHUMT00000340164.1	-	0.00	79	0	G			35978335	-1	tier1	-	no_errors	ENST00000338897	ensembl	human	known	74_37	missense	36.59	52	30	SNP	0.875	T
L1CAM	3897	genome.wustl.edu	37	X	153130787	153130787	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:153130787C>T	ENST00000370060.1	-	21	2905	c.2716G>A	c.(2716-2718)Gcc>Acc	p.A906T	L1CAM_ENST00000538883.1_Missense_Mutation_p.A908T|L1CAM_ENST00000361699.4_Missense_Mutation_p.A906T|L1CAM_ENST00000543994.1_Missense_Mutation_p.A908T|L1CAM_ENST00000370057.3_Missense_Mutation_p.A906T|L1CAM_ENST00000361981.3_Missense_Mutation_p.A901T|L1CAM_ENST00000370055.1_Missense_Mutation_p.A901T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	906	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AACTCGCTGGCGGGCCCCGAT	0.667													c|||	2	0.000529801	0.0	0.0	3775	,	,		10864	0.002		0.0	False		,,,				2504	0.0																0													58.0	56.0	56.0					X																	153130787		2203	4300	6503	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2716G>A	X.37:g.153130787C>T	ENSP00000359077:p.Ala906Thr		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A908T	ENST00000370060.1	37	c.2722	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	C	8.834	0.940594	0.18281	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.17	2.25	0.28309	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.695406	0.12802	N	0.437933	T	0.36110	0.0955	L	0.59436	1.845	0.23386	N	0.997781	P;P;P	0.45569	0.861;0.489;0.545	B;B;B	0.35899	0.213;0.085;0.129	T	0.14699	-1.0463	10	0.15499	T	0.54	.	9.1665	0.37054	0.128:0.5032:0.3687:0.0	.	901;906;906	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	T	906;908;906;908;901;901;906	ENSP00000359077:A906T;ENSP00000438430:A908T;ENSP00000359074:A906T;ENSP00000439645:A908T;ENSP00000354712:A901T;ENSP00000359072:A901T;ENSP00000355380:A906T	ENSP00000355380:A906T	A	-	1	0	L1CAM	152783981	0.665000	0.27466	0.206000	0.23566	0.018000	0.09664	1.947000	0.40293	0.947000	0.37659	0.529000	0.55759	GCC	L1CAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000198910		0.667	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	-	0.00	12	0	C	NM_024003		153130787	-1	tier1	-	no_errors	ENST00000543994	ensembl	human	known	74_37	missense	47.62	11	10	SNP	0.246	T
L3MBTL1	26013	genome.wustl.edu	37	20	42157355	42157355	+	Silent	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr20:42157355C>A	ENST00000427442.2	+	8	1014	c.855C>A	c.(853-855)gcC>gcA	p.A285A	L3MBTL1_ENST00000373135.3_Silent_p.A217A|L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000418998.1_Silent_p.A285A|L3MBTL1_ENST00000373134.1_Silent_p.A217A|L3MBTL1_ENST00000444063.1_Silent_p.A217A			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	217					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						AGCAGAAGGCCATTACTGCTC	0.552																																																	0													120.0	100.0	107.0					20																	42157355		2203	4300	6503	SO:0001819	synonymous_variant	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.855C>A	20.37:g.42157355C>A			B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.A285	ENST00000427442.2	37	c.855	CCDS46602.2	20																																																																																			L3MBTL1	-	smart_Mbt,pfscan_Mbt	ENSG00000185513		0.552	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3		0.00	33	0	C	NM_032107		42157355	+1			no_errors	ENST00000418998	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.119	A
LCE2A	353139	genome.wustl.edu	37	1	152671424	152671424	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:152671424G>T	ENST00000368779.1	+	2	98	c.47G>T	c.(46-48)tGc>tTc	p.C16F		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	16	Cys-rich.				keratinization (GO:0031424)					breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCCCAAGTGCCCCCCAAAA	0.572																																																	0													70.0	84.0	79.0					1																	152671424		2203	4300	6503	SO:0001583	missense	0				CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.47G>T	1.37:g.152671424G>T	ENSP00000357768:p.Cys16Phe		A4QMZ9	Missense_Mutation	SNP	NULL	p.C16F	ENST00000368779.1	37	c.47	CCDS1021.1	1	.	.	.	.	.	.	.	.	.	.	G	6.295	0.422545	0.11928	.	.	ENSG00000187173	ENST00000368779	T	0.10005	2.92	4.72	2.79	0.32731	.	.	.	.	.	T	0.07458	0.0188	M	0.90252	3.1	0.09310	N	1	B	0.17465	0.022	B	0.13407	0.009	T	0.30031	-0.9992	9	0.87932	D	0	.	5.7352	0.18063	0.1031:0.0:0.705:0.192	.	16	Q5TA79	LCE2A_HUMAN	F	16	ENSP00000357768:C16F	ENSP00000357768:C16F	C	+	2	0	LCE2A	150938048	0.982000	0.34865	0.014000	0.15608	0.864000	0.49448	2.031000	0.41117	0.377000	0.24735	0.557000	0.71058	TGC	LCE2A	-	NULL	ENSG00000187173		0.572	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2A	HGNC	protein_coding	OTTHUMT00000034512.1	-	0.00	58	0	G	NM_178428		152671424	+1	tier1	-	no_errors	ENST00000368779	ensembl	human	known	74_37	missense	15.07	62	11	SNP	0.100	T
LGSN	51557	genome.wustl.edu	37	6	63990251	63990251	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:63990251C>G	ENST00000370657.4	-	4	1238	c.1205G>C	c.(1204-1206)gGc>gCc	p.G402A	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	402					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TATCCGGGTGCCTTTCTCTCC	0.438																																																	0													117.0	120.0	119.0					6																	63990251		2203	4300	6503	SO:0001583	missense	0			AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1205G>C	6.37:g.63990251C>G	ENSP00000359691:p.Gly402Ala		A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.G402A	ENST00000370657.4	37	c.1205	CCDS4964.1	6	.	.	.	.	.	.	.	.	.	.	C	9.935	1.215839	0.22373	.	.	ENSG00000146166	ENST00000370657	D	0.85339	-1.97	5.96	5.96	0.96718	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.045227	0.85682	D	0.000000	D	0.85035	0.5605	L	0.37800	1.135	0.80722	D	1	P	0.46064	0.872	P	0.56612	0.802	T	0.83289	-0.0034	10	0.38643	T	0.18	-24.6636	19.4101	0.94667	0.0:1.0:0.0:0.0	.	402	Q5TDP6	LGSN_HUMAN	A	402	ENSP00000359691:G402A	ENSP00000359691:G402A	G	-	2	0	LGSN	64048210	1.000000	0.71417	0.988000	0.46212	0.040000	0.13550	4.350000	0.59392	2.832000	0.97577	0.655000	0.94253	GGC	LGSN	-	pfam_Gln_synth_cat_dom	ENSG00000146166		0.438	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGSN	HGNC	protein_coding	OTTHUMT00000041076.2	-	0.00	34	0	C	NM_016571		63990251	-1	tier1	-	no_errors	ENST00000370657	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.998	G
LINC01128	643837	genome.wustl.edu	37	1	762330	762330	+	RNA	SNP	G	G	T	rs74045217		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:762330G>T	ENST00000445118.2	+	0	0				LINC00115_ENST00000473798.1_lincRNA	NR_047519.1|NR_047520.1|NR_047521.1|NR_047522.1|NR_047523.1|NR_047524.1|NR_047525.1																						CACCGCTAGTGGGAGGCGATT	0.622																																																	0																																												0																															1.37:g.762330G>T				RNA	SNP	-	NULL	ENST00000445118.2	37	NULL		1																																																																																			LINC00115	-	-	ENSG00000225880		0.622	RP11-206L10.11-001	KNOWN	basic	lincRNA	LINC00115	HGNC	processed_transcript	OTTHUMT00000007015.2		0.00	50	0	G			762330	-1			no_errors	ENST00000473798	ensembl	human	known	74_37	rna	7.32	38	3	SNP	0.007	T
LPHN2	23266	genome.wustl.edu	37	1	82456953	82456954	+	3'UTR	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:82456953_82456954insA	ENST00000370728.1	+	0	5149_5150				LPHN2_ENST00000370715.1_3'UTR|LPHN2_ENST00000370717.2_3'UTR|LPHN2_ENST00000370725.1_3'UTR|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000370721.1_3'UTR|LPHN2_ENST00000271029.4_3'UTR|LPHN2_ENST00000394879.1_3'UTR|LPHN2_ENST00000370727.1_3'UTR|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000319517.6_3'UTR|LPHN2_ENST00000370730.1_3'UTR|LPHN2_ENST00000335786.5_3'UTR|LPHN2_ENST00000359929.3_3'UTR|LPHN2_ENST00000370723.1_3'UTR			O95490	LPHN2_HUMAN	latrophilin 2						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TTCTCTGGTGTAAAAAAGATGA	0.366																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.*125->A	1.37:g.82456959_82456959dupA			A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	RNA	INS	-	NULL	ENST00000370728.1	37	NULL		1																																																																																			LPHN2	-	-	ENSG00000117114		0.366	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1		0.00	36	0	-	NM_012302		82456954	+1	tier1		no_errors	ENST00000469377	ensembl	human	known	74_37	rna	47.62	11	10	INS	0.838:0.005	A
LPO	4025	genome.wustl.edu	37	17	56329698	56329698	+	Silent	SNP	C	C	T	rs369628308		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:56329698C>T	ENST00000262290.4	+	8	1252	c.936C>T	c.(934-936)tcC>tcT	p.S312S	LPO_ENST00000543544.1_Silent_p.S253S|LPO_ENST00000421678.2_Silent_p.S229S|LPO_ENST00000582328.1_Silent_p.S229S	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	312					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGTACAGCTCCGAGCCAAGCC	0.632																																																	0								C	,	0,4406		0,0,2203	59.0	53.0	55.0		687,936	-10.6	0.0	17		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LPO	NM_001160102.1,NM_006151.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	229/630,312/713	56329698	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.936C>T	17.37:g.56329698C>T			A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Silent	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.S312	ENST00000262290.4	37	c.936	CCDS32689.1	17																																																																																			LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000167419		0.632	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	-	0.00	40	0	C			56329698	+1	tier1	-	no_errors	ENST00000262290	ensembl	human	known	74_37	silent	22.00	39	11	SNP	0.000	T
LTV1	84946	genome.wustl.edu	37	6	144179139	144179139	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:144179139G>T	ENST00000367576.5	+	6	924	c.790G>T	c.(790-792)Gag>Tag	p.E264*		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	264						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TGAGAGGTTTGAGAAGGTAAG	0.423																																																	0													68.0	68.0	68.0					6																	144179139		2203	4300	6503	SO:0001587	stop_gained	0			BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.790G>T	6.37:g.144179139G>T	ENSP00000356548:p.Glu264*		Q96JX8	Nonsense_Mutation	SNP	pfam_LTV	p.E264*	ENST00000367576.5	37	c.790	CCDS5201.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.431726	0.98279	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	0.6556	20.0553	0.97649	0.0:0.0:1.0:0.0	.	.	.	.	X	264	.	ENSP00000356548:E264X	E	+	1	0	LTV1	144220832	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.415000	0.97375	2.754000	0.94517	0.585000	0.79938	GAG	LTV1	-	pfam_LTV	ENSG00000135521		0.423	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTV1	HGNC	protein_coding	OTTHUMT00000042532.1		0.00	32	0	G	NM_032860		144179139	+1			no_errors	ENST00000367576	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	1.000	T
MAP4K5	11183	genome.wustl.edu	37	14	50895961	50895961	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:50895961delA	ENST00000013125.4	-	28	2500	c.2182delT	c.(2182-2184)tccfs	p.S728fs		NM_006575.4|NM_198794.2	NP_006566.2|NP_942089.1	Q9Y4K4	M4K5_HUMAN	mitogen-activated protein kinase kinase kinase kinase 5	728	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_epithelial(31;0.000415)|Breast(41;0.0102)					ACATGAATGGAATCTAACTGC	0.308																																																	0													71.0	66.0	67.0					14																	50895961		1820	4075	5895	SO:0001589	frameshift_variant	0			U77129		14q11.2-q21	2011-06-09				ENSG00000012983		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6867	protein-coding gene	gene with protein product	"""germinal center kinase-related"""	604923				9038372, 8274451	Standard	NM_198794		Approved	KHS1, GCKR, KHS	uc001wyb.3	Q9Y4K4		ENST00000013125.4:c.2182delT	14.37:g.50895961delA	ENSP00000013125:p.Ser728fs		Q8IYF6	Frame_Shift_Del	DEL	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.S728fs	ENST00000013125.4	37	c.2182		14																																																																																			MAP4K5	-	pfam_Citron,smart_Citron	ENSG00000012983		0.308	MAP4K5-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	MAP4K5	HGNC	protein_coding	OTTHUMT00000410880.1		0.00	27	0	A	NM_006575		50895961	-1	tier1		no_errors	ENST00000013125	ensembl	human	known	74_37	frame_shift_del	21.88	25	7	DEL	1.000	-
MAP7D3	79649	genome.wustl.edu	37	X	135313964	135313964	+	Silent	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:135313964T>C	ENST00000316077.9	-	8	1372	c.1152A>G	c.(1150-1152)gcA>gcG	p.A384A	MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370661.1_Silent_p.A349A|MAP7D3_ENST00000370663.5_Silent_p.A366A	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	384					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CCTCCGGGGATGCTACTATGC	0.592																																																	0													61.0	63.0	62.0					X																	135313964		2059	4195	6254	SO:0001819	synonymous_variant	0			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1152A>G	X.37:g.135313964T>C			A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Silent	SNP	pfam_MAP7	p.A366	ENST00000316077.9	37	c.1098	CCDS44004.1	X																																																																																			MAP7D3	-	NULL	ENSG00000129680		0.592	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	-	0.00	9	0	T			135313964	-1	tier1	-	no_errors	ENST00000370663	ensembl	human	known	74_37	silent	25.00	12	4	SNP	0.000	C
HDAC10	83933	genome.wustl.edu	37	22	50688799	50688799	+	Intron	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr22:50688799C>T	ENST00000216271.5	-	3	644				HDAC10_ENST00000498366.1_Intron|MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000448072.1_Intron|HDAC10_ENST00000349505.4_Intron	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10						chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGCTGTGAACGCTCAAAGGC	0.637																																																	0																																										SO:0001627	intron_variant	0			AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.291+56G>A	22.37:g.50688799C>T			Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	RNA	SNP	-	NULL	ENST00000216271.5	37	NULL	CCDS14088.1	22																																																																																			MAPK12	-	-	ENSG00000188130		0.637	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK12	HGNC	protein_coding	OTTHUMT00000104141.4	-	0.00	38	0	C	NM_032019		50688799	-1	tier1	-	no_errors	ENST00000497036	ensembl	human	known	74_37	rna	11.11	56	7	SNP	0.000	T
MAPKAPK2	9261	genome.wustl.edu	37	1	206858691	206858691	+	Silent	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:206858691C>G	ENST00000367103.3	+	1	310	c.117C>G	c.(115-117)ccC>ccG	p.P39P	MAPKAPK2_ENST00000294981.4_Silent_p.P39P	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	39	Poly-Pro.|Pro-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			cgccgccgcccccgcagcagt	0.741																																																	0													13.0	14.0	13.0					1																	206858691		2203	4298	6501	SO:0001819	synonymous_variant	0			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.117C>G	1.37:g.206858691C>G			Q5SY30|Q5SY41|Q8IYD6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P39	ENST00000367103.3	37	c.117	CCDS31001.1	1																																																																																			MAPKAPK2	-	NULL	ENSG00000162889		0.741	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1		0.00	10	0	C	NM_004759		206858691	+1			no_errors	ENST00000367103	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.954	G
MC4R	4160	genome.wustl.edu	37	18	58039556	58039556	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr18:58039556C>T	ENST00000299766.3	-	1	445	c.27G>A	c.(25-27)atG>atA	p.M9I		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	9					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GAGAAGTGTGCATCCCACGGT	0.542																																																	0													45.0	44.0	44.0					18																	58039556		2203	4296	6499	SO:0001583	missense	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.27G>A	18.37:g.58039556C>T	ENSP00000299766:p.Met9Ile		B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.M9I	ENST00000299766.3	37	c.27	CCDS11976.1	18	.	.	.	.	.	.	.	.	.	.	C	9.059	0.993986	0.19043	.	.	ENSG00000166603	ENST00000299766	T	0.56611	0.45	5.56	4.69	0.59074	.	0.236421	0.36234	N	0.002706	T	0.31104	0.0786	N	0.08118	0	0.36157	D	0.847839	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	10	0.56958	D	0.05	.	9.0884	0.36596	0.0:0.8336:0.0:0.1664	.	9	P32245	MC4R_HUMAN	I	9	ENSP00000299766:M9I	ENSP00000299766:M9I	M	-	3	0	MC4R	56190536	0.460000	0.25776	0.996000	0.52242	0.852000	0.48524	1.009000	0.29886	1.501000	0.48654	-0.123000	0.14984	ATG	MC4R	-	prints_Mcort_rcpt_4	ENSG00000166603		0.542	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1	-	0.00	68	0	C	NM_005912		58039556	-1	tier1	-	no_errors	ENST00000299766	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.997	T
MED23	9439	genome.wustl.edu	37	6	131927730	131927730	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:131927730G>T	ENST00000368068.3	-	13	1435	c.1256C>A	c.(1255-1257)tCa>tAa	p.S419*	MED23_ENST00000539158.1_Nonsense_Mutation_p.S419*|MED23_ENST00000403834.3_Nonsense_Mutation_p.S425*|MED23_ENST00000368058.1_Nonsense_Mutation_p.S425*|MED23_ENST00000354577.4_Nonsense_Mutation_p.S425*|MED23_ENST00000368060.3_Nonsense_Mutation_p.S419*|MED23_ENST00000368053.4_Nonsense_Mutation_p.S425*|MED23_ENST00000540546.1_Nonsense_Mutation_p.S425*|MED23_ENST00000545957.1_Nonsense_Mutation_p.S60*	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	419					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GGCATGGGTTGACTGGGGTTT	0.328																																																	0													89.0	88.0	88.0					6																	131927730		2203	4300	6503	SO:0001587	stop_gained	0			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1256C>A	6.37:g.131927730G>T	ENSP00000357047:p.Ser419*		B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Nonsense_Mutation	SNP	pfam_Mediator_Med23	p.S425*	ENST00000368068.3	37	c.1274	CCDS5147.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.425307	0.96131	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957;ENST00000368053;ENST00000540546;ENST00000539158	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-16.5014	19.6667	0.95895	0.0:0.0:1.0:0.0	.	.	.	.	X	425;419;425;419;425;60;425;425;419	.	ENSP00000346588:S425X	S	-	2	0	MED23	131969423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.823000	0.99369	2.632000	0.89209	0.650000	0.86243	TCA	MED23	-	pfam_Mediator_Med23	ENSG00000112282		0.328	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED23	HGNC	protein_coding	OTTHUMT00000042215.1	-	0.00	49	0	G			131927730	-1	tier1	-	no_errors	ENST00000368058	ensembl	human	known	74_37	nonsense	12.90	27	4	SNP	1.000	T
MIA3	375056	genome.wustl.edu	37	1	222826634	222826634	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:222826634A>G	ENST00000344922.5	+	15	4299	c.4274A>G	c.(4273-4275)aAt>aGt	p.N1425S	MIA3_ENST00000340535.7_Missense_Mutation_p.N303S|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Missense_Mutation_p.N1425S	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1425					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		GAGGGTCAAAATAAAGGTGGA	0.408																																																	0													133.0	126.0	128.0					1																	222826634		1867	4103	5970	SO:0001583	missense	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.4274A>G	1.37:g.222826634A>G	ENSP00000340900:p.Asn1425Ser		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.N1425S	ENST00000344922.5	37	c.4274	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	A	9.666	1.145349	0.21288	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	T;T;T	0.37584	1.19;1.19;1.3	5.66	0.365	0.16131	.	.	.	.	.	T	0.19087	0.0458	N	0.19112	0.55	0.09310	N	1	B;B;B	0.24132	0.063;0.001;0.098	B;B;B	0.18263	0.013;0.006;0.021	T	0.26538	-1.0100	9	0.19590	T	0.45	.	6.4825	0.22071	0.5035:0.1292:0.3673:0.0	.	1366;303;1425	Q5JRA6-2;Q5JRA6-4;Q5JRA6	.;.;MIA3_HUMAN	S	1425;1425;1366;303;303	ENSP00000340900:N1425S;ENSP00000340587:N1425S;ENSP00000345866:N303S	ENSP00000284471:N303S	N	+	2	0	MIA3	220893257	0.062000	0.20869	0.003000	0.11579	0.831000	0.47069	0.455000	0.21843	-0.190000	0.10465	-0.429000	0.05907	AAT	MIA3	-	NULL	ENSG00000154305		0.408	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	-	0.00	30	0	A	NM_198551		222826634	+1	tier1	-	no_errors	ENST00000344441	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.003	G
MICAL3	57553	genome.wustl.edu	37	22	18300260	18300260	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr22:18300260T>C	ENST00000441493.2	-	26	5519	c.5167A>G	c.(5167-5169)Aag>Gag	p.K1723E	MICAL3_ENST00000580469.1_5'Flank	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1723					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GAGCTGGGCTTCTCCGGGGGC	0.592																																																	0													30.0	33.0	32.0					22																	18300260		1867	4098	5965	SO:0001583	missense	0			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5167A>G	22.37:g.18300260T>C	ENSP00000416015:p.Lys1723Glu		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.K1723E	ENST00000441493.2	37	c.5167	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	T	8.124	0.781565	0.16120	.	.	ENSG00000093100	ENST00000441493	T	0.66995	-0.24	4.65	3.58	0.41010	.	0.448292	0.22834	N	0.055079	T	0.47340	0.1440	L	0.27053	0.805	0.80722	D	1	B	0.30741	0.293	B	0.25140	0.058	T	0.27773	-1.0064	10	0.10636	T	0.68	.	11.2404	0.48966	0.0:0.0:0.1537:0.8463	.	1723	Q7RTP6	MICA3_HUMAN	E	1723	ENSP00000416015:K1723E	ENSP00000416015:K1723E	K	-	1	0	XXbac-B461K10.4	16680260	1.000000	0.71417	0.695000	0.30226	0.032000	0.12392	2.536000	0.45693	0.769000	0.33313	0.459000	0.35465	AAG	MICAL3	-	NULL	ENSG00000243156		0.592	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1		0.00	24	0	T			18300260	-1			no_errors	ENST00000441493	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.916	C
MOXD1	26002	genome.wustl.edu	37	6	132649624	132649624	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:132649624T>C	ENST00000367963.3	-	5	891	c.773A>G	c.(772-774)tAt>tGt	p.Y258C	MOXD1_ENST00000336749.3_Missense_Mutation_p.Y190C	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	258						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		GTTGGGGTGATAGCACTCGTG	0.512																																																	0													166.0	142.0	150.0					6																	132649624		2203	4300	6503	SO:0001583	missense	0			AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.773A>G	6.37:g.132649624T>C	ENSP00000356940:p.Tyr258Cys		Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.Y258C	ENST00000367963.3	37	c.773	CCDS5152.2	6	.	.	.	.	.	.	.	.	.	.	T	20.5	3.994833	0.74703	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.35789	1.29;1.29	5.13	5.13	0.70059	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.000000	0.85682	D	0.000000	T	0.60183	0.2249	M	0.89601	3.045	0.80722	D	1	B;D	0.89917	0.216;1.0	B;D	0.85130	0.444;0.997	T	0.69038	-0.5251	10	0.54805	T	0.06	-29.71	15.2222	0.73320	0.0:0.0:0.0:1.0	.	258;190	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	C	258;190	ENSP00000356940:Y258C;ENSP00000336998:Y190C	ENSP00000336998:Y190C	Y	-	2	0	MOXD1	132691317	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	4.824000	0.62701	2.047000	0.60756	0.533000	0.62120	TAT	MOXD1	-	pfam_Cu2_ascorb_mOase_N,superfamily_PHM/PNGase_F_dom	ENSG00000079931		0.512	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MOXD1	HGNC	protein_coding	OTTHUMT00000125837.1	-	0.00	50	0	T	NM_015529		132649624	-1	tier1	-	no_errors	ENST00000367963	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	C
MROH2A	339766	genome.wustl.edu	37	2	234723293	234723293	+	Silent	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:234723293G>T	ENST00000389758.3	+	26	2992	c.2826G>T	c.(2824-2826)ctG>ctT	p.L942L				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	972																	AGAGGCAGCTGGACCCCAAGG	0.627																																																	0																																										SO:0001819	synonymous_variant	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.2826G>T	2.37:g.234723293G>T				Silent	SNP	superfamily_ARM-type_fold	p.L942	ENST00000389758.3	37	c.2826		2																																																																																			MROH2A	-	superfamily_ARM-type_fold	ENSG00000185038		0.627	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	MROH2A	HGNC	protein_coding	OTTHUMT00000130646.6	-	0.00	53	0	G	XM_291007		234723293	+1	tier1	-	no_errors	ENST00000389758	ensembl	human	novel	74_37	silent	7.84	47	4	SNP	1.000	T
MS4A12	54860	genome.wustl.edu	37	11	60268516	60268516	+	Splice_Site	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:60268516A>G	ENST00000016913.4	+	3	333		c.e3-1		MS4A12_ENST00000537076.1_Intron	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12							integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						TTCTTTTTTCAGGTGATCCAG	0.348																																																	0													248.0	248.0	248.0					11																	60268516		2203	4300	6503	SO:0001630	splice_region_variant	0			AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.277-1A>G	11.37:g.60268516A>G			F5GX98|Q8N6L4	Splice_Site	SNP	-	e2-2	ENST00000016913.4	37	c.277-2	CCDS7988.1	11	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250980	0.39797	.	.	ENSG00000071203	ENST00000016913;ENST00000530007	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3274	0.49456	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MS4A12	60025092	1.000000	0.71417	0.975000	0.42487	0.514000	0.34195	4.477000	0.60223	1.923000	0.55706	0.379000	0.24179	.	MS4A12	-	-	ENSG00000071203		0.348	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A12	HGNC	protein_coding	OTTHUMT00000383627.1	-	0.00	75	0	A		Intron	60268516	+1	tier1	-	no_errors	ENST00000016913	ensembl	human	known	74_37	splice_site	5.19	73	4	SNP	0.990	G
MS4A10	341116	genome.wustl.edu	37	11	60559760	60559760	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:60559760C>T	ENST00000308287.1	+	4	422	c.326C>T	c.(325-327)gCg>gTg	p.A109V		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	109						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						GGGATCTTGGCGATAACAATG	0.453																																																	0													193.0	176.0	182.0					11																	60559760		2203	4300	6503	SO:0001583	missense	0			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.326C>T	11.37:g.60559760C>T	ENSP00000311862:p.Ala109Val		B2RP45|Q96PG3	Missense_Mutation	SNP	pfam_CD20-like	p.A109V	ENST00000308287.1	37	c.326	CCDS7992.1	11	.	.	.	.	.	.	.	.	.	.	C	8.984	0.976139	0.18736	.	.	ENSG00000172689	ENST00000308287	T	0.02606	4.23	3.15	1.17	0.20885	.	0.486738	0.15413	N	0.263649	T	0.03390	0.0098	L	0.57536	1.79	0.09310	N	1	B	0.18863	0.031	B	0.15870	0.014	T	0.36792	-0.9733	10	0.42905	T	0.14	-8.7409	4.9663	0.14093	0.0:0.6924:0.0:0.3076	.	109	Q96PG2	M4A10_HUMAN	V	109	ENSP00000311862:A109V	ENSP00000311862:A109V	A	+	2	0	MS4A10	60316336	0.003000	0.15002	0.004000	0.12327	0.307000	0.27823	-0.017000	0.12590	0.312000	0.23038	0.555000	0.69702	GCG	MS4A10	-	pfam_CD20-like	ENSG00000172689		0.453	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A10	HGNC	protein_coding	OTTHUMT00000395619.1	-	0.00	52	0	C	NM_206893		60559760	+1	tier1	-	no_errors	ENST00000308287	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.004	T
MTHFD1	4522	genome.wustl.edu	37	14	64926531	64926531	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:64926531G>T	ENST00000545908.1	+	27	3170	c.2941G>T	c.(2941-2943)Gcc>Tcc	p.A981S	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000555424.1_Intron|MTHFD1_ENST00000216605.8_3'UTR|MTHFD1_ENST00000556284.1_3'UTR			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	0					folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	GTCTATTCAGGCCCACTGGGA	0.428																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)												0																																										SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2941G>T	14.37:g.64926531G>T	ENSP00000438588:p.Ala981Ser		B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,superfamily_P-loop_NTPase,prints_THF_DH/CycHdrlase	p.A981S	ENST00000545908.1	37	c.2941		14	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043545	0.36085	.	.	ENSG00000100714	ENST00000545908	T	0.12465	2.68	3.83	1.89	0.25635	.	.	.	.	.	T	0.10465	0.0256	.	.	.	0.19775	N	0.999959	B	0.30281	0.275	B	0.24269	0.052	T	0.21211	-1.0252	8	0.54805	T	0.06	.	9.9772	0.41791	0.0:0.4472:0.5528:0.0	.	981	F5H2F4	.	S	981	ENSP00000438588:A981S	ENSP00000438588:A981S	A	+	1	0	MTHFD1	63996284	0.001000	0.12720	0.023000	0.16930	0.224000	0.24922	0.151000	0.16283	0.535000	0.28714	0.467000	0.42956	GCC	MTHFD1	-	NULL	ENSG00000100714		0.428	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	-	0.00	42	0	G			64926531	+1	tier1	-	no_errors	ENST00000545908	ensembl	human	novel	74_37	missense	9.30	39	4	SNP	0.022	T
MTMR4	9110	genome.wustl.edu	37	17	56581213	56581213	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:56581213G>T	ENST00000323456.5	-	15	1827	c.1703C>A	c.(1702-1704)gCt>gAt	p.A568D	MTMR4_ENST00000579925.1_Missense_Mutation_p.A511D	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	568	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAGATAAACAGCTGTCCAGAG	0.522																																																	0													137.0	136.0	136.0					17																	56581213		2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1703C>A	17.37:g.56581213G>T	ENSP00000325285:p.Ala568Asp		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.A568D	ENST00000323456.5	37	c.1703	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769555	0.69992	.	.	ENSG00000108389	ENST00000323456	D	0.89746	-2.56	5.98	5.98	0.97165	Myotubularin phosphatase domain (1);	0.312106	0.36066	N	0.002809	D	0.91985	0.7461	L	0.43646	1.37	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	D	0.92016	0.5622	10	0.66056	D	0.02	.	14.9653	0.71188	0.0:0.1421:0.8579:0.0	.	568	Q9NYA4	MTMR4_HUMAN	D	568	ENSP00000325285:A568D	ENSP00000325285:A568D	A	-	2	0	MTMR4	53936212	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.182000	0.94881	2.837000	0.97791	0.591000	0.81541	GCT	MTMR4	-	NULL	ENSG00000108389		0.522	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	-	0.00	40	0	G	NM_004687		56581213	-1	tier1	-	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
ASB12	142689	genome.wustl.edu	37	X	63444300	63444300	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:63444300G>T	ENST00000396130.2	-	2	844	c.845C>A	c.(844-846)gCc>gAc	p.A282D	MTMR8_ENST00000453546.1_Missense_Mutation_p.A666D|ASB12_ENST00000362002.2_Missense_Mutation_p.A291D			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	282	SOCS box.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						CTGGCACAAGGCTCTGCGGAC	0.502																																																	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)											112.0	89.0	97.0					X																	63444300		2203	4300	6503	SO:0001583	missense	0			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.845C>A	X.37:g.63444300G>T	ENSP00000379435:p.Ala282Asp		J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A666D	ENST00000396130.2	37	c.1997		X	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580962	0.28180	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.47177	0.85;0.85;0.85	3.73	3.73	0.42828	SOCS protein, C-terminal (2);	0.721690	0.14333	N	0.326224	T	0.38081	0.1027	L	0.50333	1.59	0.09310	N	1	B;B	0.22909	0.04;0.077	B;B	0.22152	0.038;0.026	T	0.31779	-0.9931	10	0.62326	D	0.03	-0.6315	3.9893	0.09530	0.1237:0.0:0.6381:0.2382	.	666;282	B4DQL0;Q8WXK4	.;ASB12_HUMAN	D	291;282;259;666	ENSP00000355195:A291D;ENSP00000379435:A282D;ENSP00000394003:A666D	ENSP00000354626:A259D	A	-	2	0	ASB12;MTMR8	63361025	0.986000	0.35501	0.837000	0.33122	0.267000	0.26476	3.116000	0.50399	2.118000	0.64928	0.529000	0.55759	GCC	MTMR8	-	pfam_SOCS_C,smart_SOCS_C	ENSG00000102043		0.502	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	MTMR8	HGNC	protein_coding		-	0.00	22	0	G			63444300	-1	tier1	-	no_errors	ENST00000453546	ensembl	human	known	74_37	missense	55.17	13	16	SNP	0.158	T
MUC12	10071	genome.wustl.edu	37	7	100657300	100657300	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:100657300C>T	ENST00000379442.3	+	12	16174	c.16174C>T	c.(16174-16176)Ctc>Ttc	p.L5392F	RP11-395B7.4_ENST00000448513.1_RNA|RP11-395B7.4_ENST00000441882.1_RNA|MUC12_ENST00000536621.1_Missense_Mutation_p.L5249F			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5392					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GGTGCTGCTGCTCGCATTGAT	0.547																																																	0													130.0	113.0	119.0					7																	100657300		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.16174C>T	7.37:g.100657300C>T	ENSP00000368755:p.Leu5392Phe		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.L5249F	ENST00000379442.3	37	c.15745		7	.	.	.	.	.	.	.	.	.	.	C	4.772	0.143641	0.09134	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.47177	0.85;0.85	2.85	-0.218	0.13142	.	0.817641	0.09602	U	0.780069	T	0.44307	0.1287	L	0.55213	1.73	0.09310	N	1	.	.	.	.	.	.	T	0.45963	-0.9225	8	0.72032	D	0.01	.	3.3476	0.07141	0.2903:0.2381:0.4716:0.0	.	.	.	.	F	5392;5249	ENSP00000368755:L5392F;ENSP00000441929:L5249F	ENSP00000306919:L66F	L	+	1	0	MUC12	100444020	0.000000	0.05858	0.073000	0.20177	0.011000	0.07611	-1.337000	0.02657	-0.173000	0.10761	-0.519000	0.04390	CTC	MUC12	-	NULL	ENSG00000205277		0.547	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	27	0	C	XM_379904		100657300	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	32.08	36	17	SNP	0.120	T
MUC16	94025	genome.wustl.edu	37	19	9084850	9084850	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:9084850G>A	ENST00000397910.4	-	1	7168	c.6965C>T	c.(6964-6966)gCt>gTt	p.A2322V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2322	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTGGAGCAGCAGAGGTGAT	0.473																																																	0													92.0	94.0	93.0					19																	9084850		1989	4145	6134	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6965C>T	19.37:g.9084850G>A	ENSP00000381008:p.Ala2322Val		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.A2322V	ENST00000397910.4	37	c.6965	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.374	0.437134	0.12104	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	0.225	0.225	0.15325	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	.	.	.	D	0.60575	0.988	P	0.59948	0.866	T	0.46275	-0.9203	7	0.87932	D	0	.	.	.	.	.	2322	B5ME49	.	V	2322	ENSP00000381008:A2322V	ENSP00000381008:A2322V	A	-	2	0	MUC16	8945850	0.001000	0.12720	0.287000	0.24848	0.293000	0.27360	-0.105000	0.10907	0.300000	0.22699	0.305000	0.20034	GCT	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	118	0	G	NM_024690		9084850	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	14.17	109	18	SNP	0.384	A
MUC16	94025	genome.wustl.edu	37	19	9090486	9090486	+	Silent	SNP	A	A	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:9090486A>T	ENST00000397910.4	-	1	1532	c.1329T>A	c.(1327-1329)tcT>tcA	p.S443S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	443	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCCAGGAGCAGAGGTCTCAA	0.473																																																	0													175.0	163.0	167.0					19																	9090486		1952	4144	6096	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1329T>A	19.37:g.9090486A>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S443	ENST00000397910.4	37	c.1329	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	74	0	A	NM_024690		9090486	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	19.57	37	9	SNP	0.004	T
MUC2	4583	genome.wustl.edu	37	11	1093845	1093845	+	Silent	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:1093845G>A	ENST00000441003.2	+	30	5691	c.5664G>A	c.(5662-5664)acG>acA	p.T1888T	MUC2_ENST00000333592.6_Silent_p.T176T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4250					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGACCAGCACGGCCCCACCCT	0.637																																																	0													119.0	154.0	142.0					11																	1093845		2185	4275	6460	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5664G>A	11.37:g.1093845G>A			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T1888	ENST00000441003.2	37	c.5664		11																																																																																			MUC2	-	NULL	ENSG00000198788		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	-	0.00	23	0	G	NM_002457		1093845	+1	tier1	-	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	43.48	13	10	SNP	0.000	A
MVB12A	93343	genome.wustl.edu	37	19	17534317	17534317	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:17534317G>A	ENST00000317040.7	+	5	1479	c.424G>A	c.(424-426)Ggc>Agc	p.G142S	MVB12A_ENST00000529939.1_Missense_Mutation_p.G142S|MVB12A_ENST00000543795.1_Missense_Mutation_p.G142S|MVB12A_ENST00000528515.1_Silent_p.A99A|MVB12A_ENST00000392702.2_Intron|CTD-2521M24.6_ENST00000593957.1_RNA			Q96EY5	MB12A_HUMAN	multivesicular body subunit 12A	142	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|vesicle (GO:0031982)	lipid binding (GO:0008289)|ubiquitin binding (GO:0043130)										GGACATGGGCGGCTTTGCCAT	0.682																																																	0													45.0	50.0	48.0					19																	17534317		2203	4300	6503	SO:0001583	missense	0			BC011840	CCDS12359.1	19p13.11	2013-10-11	2012-12-03	2012-12-03	ENSG00000141971	ENSG00000141971			25153	protein-coding gene	gene with protein product			"""family with sequence similarity 125, member A"""	FAM125A		18005716, 20654576, 22232651	Standard	NM_138401		Approved	FLJ32495	uc002ngo.1	Q96EY5	OTTHUMG00000166252	ENST00000317040.7:c.424G>A	19.37:g.17534317G>A	ENSP00000324810:p.Gly142Ser		Q96I18	Missense_Mutation	SNP	pfam_FAM125	p.G142S	ENST00000317040.7	37	c.424	CCDS12359.1	19	.	.	.	.	.	.	.	.	.	.	.	17.57	3.422553	0.62622	.	.	ENSG00000141971	ENST00000528911;ENST00000528604;ENST00000317040;ENST00000529939;ENST00000543795	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.82	4.82	0.62117	MABP domain (1);	0.048359	0.85682	D	0.000000	T	0.44932	0.1317	L	0.31294	0.92	0.43667	D	0.996095	D	0.67145	0.996	P	0.54401	0.751	T	0.18999	-1.0319	10	0.11182	T	0.66	-3.2248	13.4651	0.61249	0.0:0.0:1.0:0.0	.	142	Q96EY5	F125A_HUMAN	S	50;3;142;142;142	ENSP00000433280:G50S;ENSP00000435052:G3S;ENSP00000324810:G142S;ENSP00000432526:G142S;ENSP00000444653:G142S	ENSP00000324810:G142S	G	+	1	0	FAM125A	17395317	0.998000	0.40836	0.988000	0.46212	0.959000	0.62525	3.363000	0.52321	2.245000	0.73994	0.558000	0.71614	GGC	MVB12A	-	pfam_FAM125	ENSG00000141971		0.682	MVB12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12A	HGNC	protein_coding	OTTHUMT00000388723.2	-	0.00	39	0	G	NM_138401		17534317	+1	tier1	-	no_errors	ENST00000317040	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.984	A
MYH2	4620	genome.wustl.edu	37	17	10431151	10431151	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:10431151A>G	ENST00000245503.5	-	28	4169	c.3785T>C	c.(3784-3786)cTg>cCg	p.L1262P	RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.L1262P|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1262					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CAGTTCACTCAGTTGGTCCTC	0.463																																																	0													91.0	93.0	93.0					17																	10431151		2203	4300	6503	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3785T>C	17.37:g.10431151A>G	ENSP00000245503:p.Leu1262Pro		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1262P	ENST00000245503.5	37	c.3785	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	A	16.68	3.191679	0.58017	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.82167	-1.58;-1.58	4.78	4.78	0.61160	Myosin tail (1);	0.576988	0.12771	U	0.440549	D	0.94072	0.8100	H	0.95679	3.705	0.58432	D	0.999995	B	0.29341	0.242	P	0.54140	0.743	D	0.93450	0.6801	10	0.87932	D	0	.	14.7694	0.69665	1.0:0.0:0.0:0.0	.	1262	Q9UKX2	MYH2_HUMAN	P	1262	ENSP00000245503:L1262P;ENSP00000380367:L1262P	ENSP00000245503:L1262P	L	-	2	0	MYH2	10371876	0.910000	0.30920	0.998000	0.56505	0.027000	0.11550	7.267000	0.78462	2.136000	0.66102	0.379000	0.24179	CTG	MYH2	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000125414		0.463	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	42	0	A	NM_017534		10431151	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	28.12	46	18	SNP	1.000	G
MYO9B	4650	genome.wustl.edu	37	19	17294679	17294680	+	Splice_Site	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:17294679_17294680insA	ENST00000594824.1	+	16	2520		c.e16+2		MYO9B_ENST00000397274.2_Splice_Site|MYO9B_ENST00000595618.1_Splice_Site			Q13459	MYO9B_HUMAN	myosin IXB						actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.?(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						ATTCCAAAGGTAAAAAAAAAAA	0.411																																																	2	Unknown(2)	soft_tissue(2)																																								SO:0001630	splice_region_variant	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2373+2->A	19.37:g.17294690_17294690dupA			O75314|Q9NUJ2|Q9UHN0	Splice_Site	INS	-	e15+2	ENST00000594824.1	37	c.2373+2_2373+1		19																																																																																			MYO9B	-	-	ENSG00000099331		0.411	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1		0.00	16	0	-		Intron	17294680	+1	tier1		no_errors	ENST00000594824	ensembl	human	known	74_37	splice_site_ins	16.00	21	4	INS	1.000:1.000	A
NAV3	89795	genome.wustl.edu	37	12	78598799	78598799	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:78598799G>A	ENST00000397909.2	+	39	7092	c.6919G>A	c.(6919-6921)Gag>Aag	p.E2307K	NAV3_ENST00000541270.1_Missense_Mutation_p.E137K|NAV3_ENST00000228327.6_Missense_Mutation_p.E2285K|NAV3_ENST00000266692.7_Missense_Mutation_p.E2108K|NAV3_ENST00000536525.2_Missense_Mutation_p.E2285K			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2307						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCTGCCTCAGGAGAGCCCAGC	0.498										HNSCC(70;0.22)																																							0													74.0	76.0	75.0					12																	78598799		2051	4199	6250	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6919G>A	12.37:g.78598799G>A	ENSP00000381007:p.Glu2307Lys		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.E2307K	ENST00000397909.2	37	c.6919		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.67|16.67	3.188574|3.188574	0.57909|0.57909	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000541270|ENST00000552895;ENST00000551162	T;T;T;T;T|.	0.45276|.	1.65;1.65;1.65;1.58;0.9|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.171734|.	0.26355|.	U|.	0.024848|.	T|T	0.76169|0.76169	0.3950|0.3950	M|M	0.72479|0.72479	2.2|2.2	0.80722|0.80722	D|D	1|1	P;B;B;P|.	0.48089|.	0.905;0.241;0.393;0.787|.	P;B;B;B|.	0.49451|.	0.611;0.075;0.19;0.359|.	T|T	0.75136|0.75136	-0.3424|-0.3424	10|5	0.66056|.	D|.	0.02|.	-9.5164|-9.5164	19.1641|19.1641	0.93546|0.93546	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2285;2108;2307;2285|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	K|E	2285;2307;2285;2108;137|1179;174	ENSP00000446132:E2285K;ENSP00000381007:E2307K;ENSP00000228327:E2285K;ENSP00000266692:E2108K;ENSP00000444918:E137K|.	ENSP00000228327:E2285K|.	E|G	+|+	1|2	0|0	NAV3|NAV3	77122930|77122930	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.061000|0.061000	0.15899|0.15899	9.869000|9.869000	0.99810|0.99810	2.532000|2.532000	0.85374|0.85374	0.591000|0.591000	0.81541|0.81541	GAG|GGA	NAV3	-	NULL	ENSG00000067798		0.498	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1		0.00	26	0	G	NM_001024383		78598799	+1			no_errors	ENST00000397909	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
NFE2L2	4780	genome.wustl.edu	37	2	178098809	178098809	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:178098809T>C	ENST00000397062.3	-	2	790	c.236A>G	c.(235-237)gAg>gGg	p.E79G	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E63G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E63G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E63G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E63G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	79					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E79G(1)|p.E79_T80insE(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTCACCTGTCTCTTCATCTAG	0.438			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	2	Insertion - In frame(1)|Substitution - Missense(1)	upper_aerodigestive_tract(1)|oesophagus(1)											146.0	145.0	145.0					2																	178098809		1902	4109	6011	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.236A>G	2.37:g.178098809T>C	ENSP00000380252:p.Glu79Gly		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.E79G	ENST00000397062.3	37	c.236	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468923	0.63625	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.62258	0.2413	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.997;0.994;0.998;0.997	T	0.69461	-0.5139	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	63;63;63;79	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	63;79;63;63;63;63;63	ENSP00000380253:E63G;ENSP00000380252:E79G;ENSP00000411575:E63G;ENSP00000391590:E63G;ENSP00000400073:E63G;ENSP00000412191:E63G;ENSP00000410015:E63G	ENSP00000380252:E79G	E	-	2	0	NFE2L2	177807055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.503000	0.81632	2.210000	0.71456	0.460000	0.39030	GAG	NFE2L2	-	NULL	ENSG00000116044		0.438	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	107	0	T	NM_006164		178098809	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	38.61	62	39	SNP	1.000	C
NHLH1	4807	genome.wustl.edu	37	1	160340918	160340918	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:160340918G>A	ENST00000302101.5	+	2	843	c.397G>A	c.(397-399)Gtc>Atc	p.V133I		NM_005598.3	NP_005589.1	Q02575	HEN1_HUMAN	nescient helix loop helix 1	133					cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGTGCTGGACGTCTGAACTCA	0.597																																																	0													72.0	72.0	72.0					1																	160340918		2203	4300	6503	SO:0001583	missense	0			BC013789	CCDS1204.1	1q22	2013-05-21			ENSG00000171786	ENSG00000171786		"""Basic helix-loop-helix proteins"""	7817	protein-coding gene	gene with protein product		162360		HEN1			Standard	NM_005598		Approved	NSCL, NSCL1, bHLHa35	uc001fwa.2	Q02575	OTTHUMG00000033121	ENST00000302101.5:c.397G>A	1.37:g.160340918G>A	ENSP00000302189:p.Val133Ile			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V133I	ENST00000302101.5	37	c.397	CCDS1204.1	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887133	0.72410	.	.	ENSG00000171786	ENST00000302101	D	0.95724	-3.79	3.98	3.98	0.46160	Helix-loop-helix DNA-binding (1);	0.000000	0.49305	D	0.000146	T	0.82024	0.4947	N	0.08118	0	0.51767	D	0.999937	P	0.52463	0.953	B	0.34536	0.185	D	0.86031	0.1513	10	0.40728	T	0.16	.	15.1633	0.72801	0.0:0.0:1.0:0.0	.	133	Q02575	HEN1_HUMAN	I	133	ENSP00000302189:V133I	ENSP00000302189:V133I	V	+	1	0	NHLH1	158607542	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.649000	0.83500	2.215000	0.71742	0.655000	0.94253	GTC	NHLH1	-	smart_bHLH_dom	ENSG00000171786		0.597	NHLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLH1	HGNC	protein_coding	OTTHUMT00000080676.1		0.00	22	0	G	NM_005598		160340918	+1			no_errors	ENST00000302101	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	A
NKX2-6	137814	genome.wustl.edu	37	8	23560288	23560288	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:23560288C>A	ENST00000325017.3	-	2	581	c.582G>T	c.(580-582)aaG>aaT	p.K194N	NKX2-6_ENST00000418222.1_Missense_Mutation_p.K112N	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	194					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTTCCAGCGACTTGTCCTGGC	0.677																																																	0													41.0	39.0	40.0					8																	23560288		692	1591	2283	SO:0001583	missense	0			CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.582G>T	8.37:g.23560288C>A	ENSP00000320089:p.Lys194Asn			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.K194N	ENST00000325017.3	37	c.582		8	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966707	0.53507	.	.	ENSG00000180053	ENST00000325017;ENST00000418222	D;D	0.91011	-2.6;-2.77	3.98	3.98	0.46160	Homeobox (1);	0.613309	0.14343	N	0.325572	D	0.93726	0.7995	M	0.79614	2.46	0.27086	N	0.962962	D	0.59357	0.985	P	0.57009	0.811	D	0.88055	0.2790	10	0.62326	D	0.03	.	13.5989	0.62007	0.0:1.0:0.0:0.0	.	194	A6NCS4	NKX26_HUMAN	N	194;112	ENSP00000320089:K194N;ENSP00000402231:K112N	ENSP00000320089:K194N	K	-	3	2	NKX2-6	23616233	0.835000	0.29415	0.998000	0.56505	0.385000	0.30292	0.421000	0.21280	2.039000	0.60335	0.462000	0.41574	AAG	NKX2-6	-	smart_Homeobox_dom	ENSG00000180053		0.677	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	NKX2-6	HGNC	protein_coding	OTTHUMT00000376057.4	-	0.00	41	0	C	NM_001136271		23560288	-1	tier1	-	no_errors	ENST00000325017	ensembl	human	known	74_37	missense	19.67	49	12	SNP	1.000	A
NLRP14	338323	genome.wustl.edu	37	11	7064621	7064621	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:7064621C>G	ENST00000299481.4	+	4	1710	c.1364C>G	c.(1363-1365)tCt>tGt	p.S455C		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	455	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTAACTCAATCTGATGTCTCT	0.423																																																	0													120.0	124.0	122.0					11																	7064621		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1364C>G	11.37:g.7064621C>G	ENSP00000299481:p.Ser455Cys		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S455C	ENST00000299481.4	37	c.1364	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	C	1.336	-0.595479	0.03771	.	.	ENSG00000158077	ENST00000299481	D	0.84442	-1.85	4.34	-3.94	0.04130	.	1.409870	0.04626	N	0.402789	D	0.82513	0.5053	M	0.82132	2.575	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.65693	-0.6106	10	0.62326	D	0.03	.	3.2897	0.06944	0.4344:0.164:0.3152:0.0864	.	455	Q86W24	NAL14_HUMAN	C	455	ENSP00000299481:S455C	ENSP00000299481:S455C	S	+	2	0	NLRP14	7021197	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.592000	0.05747	-0.471000	0.06891	-0.895000	0.02911	TCT	NLRP14	-	NULL	ENSG00000158077		0.423	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	-	0.00	36	0	C	NM_176822		7064621	+1	tier1	-	no_errors	ENST00000299481	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.000	G
NOS3	4846	genome.wustl.edu	37	7	150707823	150707823	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:150707823G>T	ENST00000297494.3	+	22	3181	c.2824G>T	c.(2824-2826)Gtc>Ttc	p.V942F	ATG9B_ENST00000494791.1_5'Flank|NOS3_ENST00000461406.1_Missense_Mutation_p.V736F|NOS3_ENST00000477227.1_3'UTR	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTACTACTCAGTCAGCTCGGC	0.657																																																	0													31.0	33.0	33.0					7																	150707823		2203	4300	6503	SO:0001583	missense	0				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.2824G>T	7.37:g.150707823G>T	ENSP00000297494:p.Val942Phe		Q495E5	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.V942F	ENST00000297494.3	37	c.2824	CCDS5912.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.616327|4.616327	0.87359|0.87359	.|.	.|.	ENSG00000164867|ENSG00000164867	ENST00000475017|ENST00000297494;ENST00000461406	.|T;T	.|0.35421	.|1.31;1.31	4.85|4.85	4.85|4.85	0.62838|0.62838	.|Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	.|0.108905	.|0.39475	.|N	.|0.001352	T|T	0.46288|0.46288	0.1385|0.1385	L|L	0.39245|0.39245	1.2|1.2	0.80722|0.80722	D|D	1|1	.|P;D	.|0.53151	.|0.915;0.958	.|P;D	.|0.65573	.|0.906;0.936	T|T	0.42599|0.42599	-0.9442|-0.9442	5|10	.|0.87932	.|D	.|0	-13.1133|-13.1133	8.9683|8.9683	0.35890|0.35890	0.0984:0.0:0.9016:0.0|0.0984:0.0:0.9016:0.0	.|.	.|736;942	.|E7ESA7;P29474	.|.;NOS3_HUMAN	H|F	235|942;736	.|ENSP00000297494:V942F;ENSP00000417143:V736F	.|ENSP00000297494:V942F	Q|V	+|+	3|1	2|0	NOS3|NOS3	150338756|150338756	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.904000|0.904000	0.53231|0.53231	4.366000|4.366000	0.59492|0.59492	2.519000|2.519000	0.84933|0.84933	0.484000|0.484000	0.47621|0.47621	CAG|GTC	NOS3	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	ENSG00000164867		0.657	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000350750.2	-	0.00	29	0	G	NM_000603		150707823	+1	tier1	-	no_errors	ENST00000297494	ensembl	human	known	74_37	missense	35.14	24	13	SNP	0.995	T
NOTCH1	4851	genome.wustl.edu	37	9	139411817	139411817	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:139411817C>T	ENST00000277541.6	-	9	1537	c.1462G>A	c.(1462-1464)Gag>Aag	p.E488K	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	488	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTGTTGACCTCGCAGTGCACA	0.652			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													29.0	36.0	33.0					9																	139411817		2103	4224	6327	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1462G>A	9.37:g.139411817C>T	ENSP00000277541:p.Glu488Lys		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.E488K	ENST00000277541.6	37	c.1462	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811656	0.90707	.	.	ENSG00000148400	ENST00000277541	D	0.95001	-3.58	4.54	4.54	0.55810	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.171931	0.49916	D	0.000128	D	0.97170	0.9075	M	0.93197	3.39	0.80722	D	1	P	0.52577	0.954	P	0.54140	0.743	D	0.97943	1.0327	10	0.54805	T	0.06	.	16.2616	0.82550	0.0:1.0:0.0:0.0	.	488	P46531	NOTC1_HUMAN	K	488	ENSP00000277541:E488K	ENSP00000277541:E488K	E	-	1	0	NOTCH1	138531638	0.997000	0.39634	0.918000	0.36340	0.772000	0.43724	3.532000	0.53553	2.062000	0.61559	0.557000	0.71058	GAG	NOTCH1	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.652	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	22	0	C	NM_017617		139411817	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	29.03	44	18	SNP	1.000	T
NOX4	50507	genome.wustl.edu	37	11	89223663	89223663	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:89223663T>C	ENST00000263317.4	-	2	354	c.116A>G	c.(115-117)cAa>cGa	p.Q39R	NOX4_ENST00000528341.1_Intron|NOX4_ENST00000542487.1_Missense_Mutation_p.Q15R|NOX4_ENST00000531342.1_Missense_Mutation_p.Q39R|NOX4_ENST00000532825.1_Missense_Mutation_p.Q15R|NOX4_ENST00000535633.1_Missense_Mutation_p.Q15R|NOX4_ENST00000534731.1_Missense_Mutation_p.Q39R|NOX4_ENST00000393282.2_Missense_Mutation_p.Q39R|NOX4_ENST00000527626.1_5'UTR|NOX4_ENST00000343727.5_Missense_Mutation_p.Q15R|NOX4_ENST00000527956.1_Missense_Mutation_p.Q15R|NOX4_ENST00000375979.3_Missense_Mutation_p.Q39R|NOX4_ENST00000424319.1_Missense_Mutation_p.Q15R|NOX4_ENST00000525196.1_Missense_Mutation_p.Q39R|NOX4_ENST00000413594.2_Missense_Mutation_p.Q60R			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	39					bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CTCTGGCCCTTGGTTATACAG	0.428																																																	0													140.0	135.0	137.0					11																	89223663		2201	4299	6500	SO:0001583	missense	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.116A>G	11.37:g.89223663T>C	ENSP00000263317:p.Gln39Arg		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.Q60R	ENST00000263317.4	37	c.179	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514245	0.44763	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000413594;ENST00000531342;ENST00000375979;ENST00000393282	D;D;D;D;D;D;D;D;D;D;D;D	0.95103	-3.55;-3.55;-3.55;-3.5;-3.55;-3.45;-3.61;-3.55;-3.55;-3.56;-2.99;-2.94	5.23	4.11	0.48088	.	0.505173	0.20230	N	0.096498	D	0.91848	0.7420	N	0.12746	0.255	0.28367	N	0.920207	B;B;P;P;B;B	0.48294	0.0;0.0;0.908;0.908;0.0;0.0	B;B;P;P;B;B	0.61397	0.001;0.001;0.888;0.888;0.002;0.0	D	0.85118	0.0967	9	.	.	.	-3.4037	7.6576	0.28383	0.0:0.0963:0.0:0.9037	.	15;39;39;39;39;39	E9PMY6;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;NOX4_HUMAN	R	15;15;15;39;39;39;15;15;15;60;39;39;39	ENSP00000412446:Q15R;ENSP00000440172:Q15R;ENSP00000344747:Q15R;ENSP00000436892:Q39R;ENSP00000436716:Q39R;ENSP00000263317:Q39R;ENSP00000434924:Q15R;ENSP00000433797:Q15R;ENSP00000439373:Q15R;ENSP00000405705:Q60R;ENSP00000435039:Q39R;ENSP00000365146:Q39R	.	Q	-	2	0	NOX4	88863311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.332000	0.19751	0.846000	0.35142	0.379000	0.24179	CAA	NOX4	-	NULL	ENSG00000086991		0.428	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	55	0	T	NM_016931		89223663	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	missense	40.82	29	20	SNP	1.000	C
NPRL3	8131	genome.wustl.edu	37	16	139733	139733	+	Silent	SNP	G	G	A	rs559760517		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr16:139733G>A	ENST00000399953.3	-	11	1731	c.1329C>T	c.(1327-1329)aaC>aaT	p.N443N	Z69720.2_ENST00000601483.1_RNA|NPRL3_ENST00000399951.3_Silent_p.N264N|NPRL3_ENST00000405960.3_5'UTR	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	443					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)			endometrium(1)|large_intestine(3)|ovary(2)	6						AGCTGAGGGCGTTGGGCGTGC	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16709	0.0		0.0	False		,,,				2504	0.0																0													15.0	21.0	19.0					16																	139733		2162	4262	6424	SO:0001819	synonymous_variant	0				CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.1329C>T	16.37:g.139733G>A			D3DU40|Q1W6H0|Q4TT56|Q92469	Silent	SNP	pfam_NPR3,superfamily_Galactose-bd-like	p.N443	ENST00000399953.3	37	c.1329		16																																																																																			NPRL3	-	NULL	ENSG00000103148		0.687	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	NPRL3	HGNC	protein_coding			0.00	32	0	G	NM_001039476		139733	-1			no_errors	ENST00000399953	ensembl	human	known	74_37	silent	14.00	43	7	SNP	0.902	A
NR1H4	9971	genome.wustl.edu	37	12	100897237	100897238	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:100897237_100897238insT	ENST00000551379.1	+	1	100_101	c.72_73insT	c.(73-75)tttfs	p.F25fs	NR1H4_ENST00000546380.1_Intron|NR1H4_ENST00000392986.3_Intron|NR1H4_ENST00000188403.7_Frame_Shift_Ins_p.F25fs|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000548884.1_Intron			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	25					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	CGCCGTCAGGATTTTTCATGGA	0.455																																																	0																																										SO:0001589	frameshift_variant	0			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.77dupT	12.37:g.100897242_100897242dupT	ENSP00000447149:p.Phe25fs		A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Frame_Shift_Ins	INS	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.M26fs	ENST00000551379.1	37	c.72_73	CCDS55876.1	12																																																																																			NR1H4	-	NULL	ENSG00000012504		0.455	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	HGNC	protein_coding	OTTHUMT00000409140.1		0.00	73	0	-	NM_005123		100897238	+1	tier1		no_errors	ENST00000551379	ensembl	human	known	74_37	frame_shift_ins	18.18	45	10	INS	0.144:0.146	T
NUP160	23279	genome.wustl.edu	37	11	47837042	47837042	+	Silent	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:47837042G>A	ENST00000378460.2	-	13	1721	c.1675C>T	c.(1675-1677)Ctg>Ttg	p.L559L	NUP160_ENST00000528501.1_Silent_p.L123L|NUP160_ENST00000528071.1_Silent_p.L445L|NUP160_ENST00000530326.1_Silent_p.L445L|NUP160_ENST00000531016.1_5'UTR	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	559					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TTTTTCAGCAGGCACACCATG	0.418																																																	0													135.0	121.0	125.0					11																	47837042		2201	4298	6499	SO:0001819	synonymous_variant	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.1675C>T	11.37:g.47837042G>A			B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	pfam_Nucleoporin_Nup160	p.L559	ENST00000378460.2	37	c.1675	CCDS31484.1	11																																																																																			NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.418	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	-	0.00	26	0	G	NM_015231		47837042	-1	tier1	-	no_errors	ENST00000378460	ensembl	human	known	74_37	silent	21.21	26	7	SNP	1.000	A
NUP160	23279	genome.wustl.edu	37	11	47861526	47861526	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:47861526G>T	ENST00000378460.2	-	4	663	c.617C>A	c.(616-618)gCa>gAa	p.A206E	NUP160_ENST00000532747.1_Intron|NUP160_ENST00000530326.1_Missense_Mutation_p.A92E|NUP160_ENST00000526870.1_3'UTR|NUP160_ENST00000528071.1_Missense_Mutation_p.A92E	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	206					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TCCAGGTACTGCTGGAATTAA	0.463																																																	0													115.0	110.0	112.0					11																	47861526		2201	4298	6499	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.617C>A	11.37:g.47861526G>T	ENSP00000367721:p.Ala206Glu		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.A206E	ENST00000378460.2	37	c.617	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	7.337	0.620048	0.14193	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.41065	1.01;1.01;1.01	5.44	4.52	0.55395	.	0.846890	0.10827	N	0.629757	T	0.34600	0.0903	L	0.44542	1.39	0.09310	N	0.999999	B	0.19445	0.036	B	0.30716	0.119	T	0.39702	-0.9601	10	0.02654	T	1	.	11.1197	0.48281	0.0737:0.1361:0.7902:0.0	.	206	Q12769	NU160_HUMAN	E	206;92;92	ENSP00000367721:A206E;ENSP00000433590:A92E;ENSP00000432367:A92E	ENSP00000367721:A206E	A	-	2	0	NUP160	47818102	0.006000	0.16342	0.939000	0.37840	0.846000	0.48090	1.038000	0.30254	2.551000	0.86045	0.655000	0.94253	GCA	NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.463	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2		0.00	32	0	G	NM_015231		47861526	-1			no_errors	ENST00000378460	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.006	T
NUP35	129401	genome.wustl.edu	37	2	183995746	183995746	+	Intron	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:183995746G>A	ENST00000295119.4	+	3	442				NUP35_ENST00000497330.1_3'UTR|NUP35_ENST00000409798.1_Intron|NUP35_ENST00000541912.1_De_novo_Start_InFrame	NM_138285.3	NP_612142.2	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8						gtcctgatcagttgcccaggc	0.478																																																	0																																										SO:0001627	intron_variant	0			AF514993	CCDS2290.1, CCDS74614.1	2q32	2008-02-05			ENSG00000163002	ENSG00000163002			29797	protein-coding gene	gene with protein product		608140					Standard	XM_005246284		Approved	MP44	uc002upf.3	Q8NFH5	OTTHUMG00000132621	ENST00000295119.4:c.339+473G>A	2.37:g.183995746G>A			B4DP57|B4DYB4|Q4ZFZ9|Q53S95|Q8TDJ1	Silent	SNP	NULL	p.Q121	ENST00000295119.4	37	c.363	CCDS2290.1	2																																																																																			NUP35	-	NULL	ENSG00000163002		0.478	NUP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP35	HGNC	protein_coding	OTTHUMT00000255865.1	-	0.00	23	0	G	NM_138285		183995746	+1	tier1	-	no_errors	ENST00000452137	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.002	A
NYAP2	57624	genome.wustl.edu	37	2	226516200	226516200	+	Silent	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:226516200T>A	ENST00000272907.6	+	6	2294	c.1881T>A	c.(1879-1881)ccT>ccA	p.P627P		NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	627					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CAGGTGTGCCTCCTCCATCAG	0.498																																																	0													208.0	211.0	210.0					2																	226516200		2138	4250	6388	SO:0001819	synonymous_variant	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1881T>A	2.37:g.226516200T>A			A2RRN4|Q96NL2	Silent	SNP	NULL	p.P627	ENST00000272907.6	37	c.1881	CCDS46529.1	2																																																																																			NYAP2	-	NULL	ENSG00000144460		0.498	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	-	0.00	50	0	T	NM_020864		226516200	+1	tier1	-	no_errors	ENST00000272907	ensembl	human	known	74_37	silent	17.54	47	10	SNP	1.000	A
OLFM3	118427	genome.wustl.edu	37	1	102269966	102269966	+	Missense_Mutation	SNP	G	G	T	rs369114043		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:102269966G>T	ENST00000338858.5	-	6	1264	c.1265C>A	c.(1264-1266)aCc>aAc	p.T422N	OLFM3_ENST00000370103.4_Missense_Mutation_p.T402N|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	422	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GGAGGTTTTGGTGGAATAGGA	0.443																																																	0													272.0	236.0	248.0					1																	102269966		2203	4300	6503	SO:0001583	missense	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1265C>A	1.37:g.102269966G>T	ENSP00000345192:p.Thr422Asn		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.T422N	ENST00000338858.5	37	c.1265		1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095269	0.76870	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.89939	-2.59;-2.59	5.77	5.77	0.91146	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.96213	0.8765	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.992;0.995	D	0.96647	0.9478	10	0.87932	D	0	.	19.9831	0.97336	0.0:0.0:1.0:0.0	.	402;422	Q5T3V6;Q96PB7	.;NOE3_HUMAN	N	402;422	ENSP00000359121:T402N;ENSP00000345192:T422N	ENSP00000345192:T422N	T	-	2	0	OLFM3	102042554	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.728000	0.93425	0.650000	0.86243	ACC	OLFM3	-	pfam_Olfac-like,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	ENSG00000118733		0.443	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030142.1	-	0.00	53	0	G			102269966	-1	tier1	-	no_errors	ENST00000338858	ensembl	human	known	74_37	missense	18.00	41	9	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228487173	228487173	+	Intron	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:228487173A>G	ENST00000422127.1	+	43	11703				RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000366707.4_Missense_Mutation_p.Y1165C|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.Y4475C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AACGGGGTGTACTCATGTGTG	0.542																																																	0													188.0	158.0	167.0					1																	228487173		876	1991	2867	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+4429A>G	1.37:g.228487173A>G			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Y1165C	ENST00000422127.1	37	c.3494	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222442	0.58668	.	.	ENSG00000154358	ENST00000366707	T	0.26373	1.74	4.66	4.66	0.58398	.	.	.	.	.	T	0.45013	0.1321	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48246	-0.9052	6	0.87932	D	0	.	14.2589	0.66070	1.0:0.0:0.0:0.0	.	.	.	.	C	1165	ENSP00000355668:Y1165C	ENSP00000355668:Y1165C	Y	+	2	0	OBSCN	226553796	1.000000	0.71417	0.988000	0.46212	0.022000	0.10575	8.368000	0.90115	1.952000	0.56665	0.459000	0.35465	TAC	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154358		0.542	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	103	0	A	NM_052843		228487173	+1	tier1	-	no_errors	ENST00000366707	ensembl	human	known	74_37	missense	17.61	116	25	SNP	1.000	G
OLFM4	10562	genome.wustl.edu	37	13	53616187	53616187	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr13:53616187delA	ENST00000219022.2	+	3	578	c.500delA	c.(499-501)gaafs	p.E167fs		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	167					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AAGGAGATGGAAAAACTGGTC	0.433																																																	0													115.0	100.0	105.0					13																	53616187		2203	4300	6503	SO:0001589	frameshift_variant	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.500delA	13.37:g.53616187delA	ENSP00000219022:p.Glu167fs		O95362|Q5VWG0|Q86T22	Frame_Shift_Del	DEL	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.K168fs	ENST00000219022.2	37	c.500	CCDS9440.1	13																																																																																			OLFM4	-	NULL	ENSG00000102837		0.433	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2		0.00	53	0	A	NM_006418		53616187	+1	tier1		no_errors	ENST00000219022	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.973	-
OR2M2	391194	genome.wustl.edu	37	1	248343907	248343907	+	Missense_Mutation	SNP	T	T	C	rs535058818	byFrequency	TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:248343907T>C	ENST00000359682.2	+	1	620	c.620T>C	c.(619-621)cTt>cCt	p.L207P		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATAGTAATGCTTGTTTTCCCT	0.423																																																	0													241.0	227.0	231.0					1																	248343907		2203	4300	6503	SO:0001583	missense	0			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.620T>C	1.37:g.248343907T>C	ENSP00000352710:p.Leu207Pro		A3KFT4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L207P	ENST00000359682.2	37	c.620	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	t	9.594	1.126993	0.20959	.	.	ENSG00000198601	ENST00000359682	T	0.39229	1.09	1.88	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.299145	0.17967	U	0.155965	T	0.64875	0.2638	M	0.92833	3.35	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.54166	-0.8334	10	0.87932	D	0	.	3.5412	0.07812	0.0:0.1474:0.2313:0.6213	.	207	Q96R28	OR2M2_HUMAN	P	207	ENSP00000352710:L207P	ENSP00000352710:L207P	L	+	2	0	OR2M2	246410530	0.005000	0.15991	0.001000	0.08648	0.001000	0.01503	0.730000	0.26043	0.873000	0.35799	0.373000	0.22412	CTT	OR2M2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198601		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	HGNC	protein_coding	OTTHUMT00000097356.2	-	0.00	100	0	T	NM_001004688		248343907	+1	tier1	-	no_errors	ENST00000359682	ensembl	human	known	74_37	missense	6.00	94	6	SNP	0.000	C
OR4C46	119749	genome.wustl.edu	37	11	51515287	51515287	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:51515287G>T	ENST00000328188.1	+	1	6	c.6G>T	c.(4-6)gaG>gaT	p.E2D		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						AATACATGGAGAATAGGAATA	0.274																																																	0													105.0	101.0	102.0					11																	51515287		2201	4296	6497	SO:0001583	missense	0				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.6G>T	11.37:g.51515287G>T	ENSP00000329056:p.Glu2Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E2D	ENST00000328188.1	37	c.6	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	5.684	0.310685	0.10733	.	.	ENSG00000185926	ENST00000328188	T	0.00456	7.3	2.44	-2.21	0.06973	.	0.224693	0.22250	U	0.062572	T	0.00241	0.0007	L	0.32530	0.975	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.44283	-0.9338	10	0.48119	T	0.1	.	4.5526	0.12120	0.5769:0.189:0.2341:0.0	.	2	A6NHA9	O4C46_HUMAN	D	2	ENSP00000329056:E2D	ENSP00000329056:E2D	E	+	3	2	OR4C46	51371863	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.436000	0.02421	-0.361000	0.08125	0.134000	0.15878	GAG	OR4C46	-	NULL	ENSG00000185926		0.274	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	HGNC	protein_coding	OTTHUMT00000391155.1		0.00	35	0	G	NM_001004703		51515287	+1			no_errors	ENST00000328188	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.017	T
OR4Q3	441669	genome.wustl.edu	37	14	20216269	20216269	+	Missense_Mutation	SNP	C	C	T	rs187324686		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:20216269C>T	ENST00000331723.1	+	1	683	c.683C>T	c.(682-684)aCa>aTa	p.T228I		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACCCTGAGAACACACTTCTGC	0.493																																																	0													173.0	148.0	156.0					14																	20216269		2203	4300	6503	SO:0001583	missense	0			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.683C>T	14.37:g.20216269C>T	ENSP00000330049:p.Thr228Ile		Q6IEX4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T228I	ENST00000331723.1	37	c.683	CCDS32020.1	14	.	.	.	.	.	.	.	.	.	.	.	8.922	0.961355	0.18583	.	.	ENSG00000182652	ENST00000331723	T	0.00016	9.11	4.1	0.839	0.18907	GPCR, rhodopsin-like superfamily (1);	0.188478	0.25464	U	0.030493	T	0.00039	0.0001	N	0.00456	-1.48	0.09310	N	1	P	0.40660	0.726	P	0.46389	0.515	T	0.44847	-0.9301	10	0.66056	D	0.02	.	9.5028	0.39028	0.5509:0.4491:0.0:0.0	.	228	Q8NH05	OR4Q3_HUMAN	I	228	ENSP00000330049:T228I	ENSP00000330049:T228I	T	+	2	0	OR4Q3	19286109	0.000000	0.05858	0.750000	0.31169	0.109000	0.19521	-0.022000	0.12480	0.318000	0.23185	0.509000	0.49947	ACA	OR4Q3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000182652		0.493	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	HGNC	protein_coding	OTTHUMT00000409818.2	-	0.00	54	0	C			20216269	+1	tier1	-	no_errors	ENST00000331723	ensembl	human	known	74_37	missense	23.26	33	10	SNP	0.002	T
OR4K1	79544	genome.wustl.edu	37	14	20403917	20403917	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:20403917T>C	ENST00000285600.4	+	1	151	c.92T>C	c.(91-93)tTc>tCc	p.F31S		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F31S(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TTTGCCATCTTCTCTATAGTC	0.378																																																	1	Substitution - Missense(1)	kidney(1)											345.0	377.0	366.0					14																	20403917		2203	4300	6503	SO:0001583	missense	0				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.92T>C	14.37:g.20403917T>C	ENSP00000285600:p.Phe31Ser		B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F31S	ENST00000285600.4	37	c.92	CCDS32025.1	14	.	.	.	.	.	.	.	.	.	.	.	13.80	2.344102	0.41498	.	.	ENSG00000155249	ENST00000285600	T	0.04551	3.6	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000013	T	0.18002	0.0432	M	0.75447	2.3	0.24403	N	0.994698	D	0.89917	1.0	D	0.97110	1.0	T	0.09100	-1.0690	10	0.22109	T	0.4	.	12.2701	0.54702	0.0:0.0:0.0:1.0	.	31	Q8NGD4	OR4K1_HUMAN	S	31	ENSP00000285600:F31S	ENSP00000285600:F31S	F	+	2	0	OR4K1	19473757	0.976000	0.34144	0.844000	0.33320	0.382000	0.30200	4.906000	0.63293	2.008000	0.58898	0.459000	0.35465	TTC	OR4K1	-	prints_GPCR_Rhodpsn	ENSG00000155249		0.378	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	HGNC	protein_coding	OTTHUMT00000409881.1	-	0.00	88	0	T			20403917	+1	tier1	-	no_errors	ENST00000285600	ensembl	human	known	74_37	missense	16.18	57	11	SNP	0.368	C
OR5T1	390155	genome.wustl.edu	37	11	56043679	56043679	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:56043679G>C	ENST00000313033.2	+	1	651	c.565G>C	c.(565-567)Gtc>Ctc	p.V189L		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					AATTAGGCATGTCTTTTGTAA	0.403																																																	0													246.0	230.0	236.0					11																	56043679		2201	4296	6497	SO:0001583	missense	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.565G>C	11.37:g.56043679G>C	ENSP00000323612:p.Val189Leu		B2RNM9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V189L	ENST00000313033.2	37	c.565	CCDS31525.1	11	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417775	0.25552	.	.	ENSG00000181698	ENST00000313033	T	0.00063	8.78	3.44	-3.58	0.04597	GPCR, rhodopsin-like superfamily (1);	0.478727	0.17402	N	0.175494	T	0.00073	0.0002	N	0.02539	-0.55	0.09310	N	1	B	0.27166	0.17	B	0.33121	0.158	T	0.28933	-1.0028	10	0.87932	D	0	.	8.4601	0.32923	0.0945:0.0:0.1957:0.7098	.	189	Q8NG75	OR5T1_HUMAN	L	189	ENSP00000323612:V189L	ENSP00000323612:V189L	V	+	1	0	OR5T1	55800255	0.000000	0.05858	0.004000	0.12327	0.048000	0.14542	-0.448000	0.06820	-0.411000	0.07530	-0.571000	0.04153	GTC	OR5T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181698		0.403	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	-	0.00	92	0	G	NM_001004745		56043679	+1	tier1	-	no_errors	ENST00000313033	ensembl	human	known	74_37	missense	19.23	83	20	SNP	0.000	C
OR5M8	219484	genome.wustl.edu	37	11	56258778	56258778	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:56258778T>A	ENST00000327216.2	-	1	93	c.69A>T	c.(67-69)caA>caT	p.Q23H		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					AGAGGAGAATTTGTAATTCCC	0.502																																																	0													88.0	92.0	91.0					11																	56258778		2201	4296	6497	SO:0001583	missense	0			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.69A>T	11.37:g.56258778T>A	ENSP00000323354:p.Gln23His		B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q23H	ENST00000327216.2	37	c.69	CCDS31533.1	11	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737827	0.30774	.	.	ENSG00000181371	ENST00000327216	T	0.00601	6.29	4.13	1.13	0.20643	.	0.000000	0.30949	U	0.008557	T	0.00754	0.0025	M	0.64170	1.965	0.22017	N	0.999412	B	0.18166	0.026	B	0.20767	0.031	T	0.43956	-0.9359	10	0.66056	D	0.02	-4.4222	8.1658	0.31226	0.0:0.7077:0.0:0.2923	.	23	Q8NGP6	OR5M8_HUMAN	H	23	ENSP00000323354:Q23H	ENSP00000323354:Q23H	Q	-	3	2	OR5M8	56015354	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.088000	0.11198	-0.005000	0.14395	-1.610000	0.00802	CAA	OR5M8	-	NULL	ENSG00000181371		0.502	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M8	HGNC	protein_coding	OTTHUMT00000391641.1		0.00	22	0	T	NM_001005282		56258778	-1			no_errors	ENST00000327216	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.380	A
OR6N1	128372	genome.wustl.edu	37	1	158735878	158735878	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:158735878C>A	ENST00000335094.2	-	1	614	c.595G>T	c.(595-597)Gat>Tat	p.D199Y		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D199Y(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					ATAACAAAATCTACTAGGACA	0.483																																																	1	Substitution - Missense(1)	lung(1)											104.0	110.0	108.0					1																	158735878		2203	4300	6503	SO:0001583	missense	0			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.595G>T	1.37:g.158735878C>A	ENSP00000335535:p.Asp199Tyr		Q5VUU8|Q96R35	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D199Y	ENST00000335094.2	37	c.595	CCDS30905.1	1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373764	0.24857	.	.	ENSG00000197403	ENST00000335094	T	0.00084	8.75	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000191	T	0.00210	0.0006	L	0.42581	1.335	0.40698	D	0.98245	D	0.89917	1.0	D	0.97110	1.0	D	0.93176	0.6570	10	0.52906	T	0.07	-15.5463	16.7399	0.85456	0.0:1.0:0.0:0.0	.	199	Q8NGY5	OR6N1_HUMAN	Y	199	ENSP00000335535:D199Y	ENSP00000335535:D199Y	D	-	1	0	OR6N1	157002502	0.000000	0.05858	1.000000	0.80357	0.951000	0.60555	0.236000	0.17967	2.454000	0.82982	0.655000	0.94253	GAT	OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197403		0.483	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1		0.00	18	0	C	NM_001005185		158735878	-1			no_errors	ENST00000335094	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52651532	52651532	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:52651532G>A	ENST00000296302.7	-	14	1565	c.1564C>T	c.(1564-1566)Cga>Tga	p.R522*	PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R537*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R490*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R537*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R522*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R522*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R522*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R522*			Q86U86	PB1_HUMAN	polybromo 1	522					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATTTTCATTCGCTGCTTTCTT	0.363			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													68.0	67.0	68.0					3																	52651532		2203	4300	6503	SO:0001587	stop_gained	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1564C>T	3.37:g.52651532G>A	ENSP00000296302:p.Arg522*		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.R522*	ENST00000296302.7	37	c.1564		3	.	.	.	.	.	.	.	.	.	.	G	37	6.471896	0.97594	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.84	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.0556	13.5687	0.61834	0.0:0.0:0.6745:0.3255	.	.	.	.	X	490;522;522;522;522;522;537;537;522;481	.	ENSP00000296302:R522X	R	-	1	2	PBRM1	52626572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.152000	0.50677	2.764000	0.94973	0.655000	0.94253	CGA	PBRM1	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000163939		0.363	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	-	0.00	9	0	G	NM_018165		52651532	-1	tier1	-	no_errors	ENST00000296302	ensembl	human	known	74_37	nonsense	71.43	2	5	SNP	1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52702535	52702535	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr3:52702535G>T	ENST00000296302.7	-	3	364	c.363C>A	c.(361-363)aaC>aaA	p.N121K	PBRM1_ENST00000409767.1_Missense_Mutation_p.N121K|PBRM1_ENST00000356770.4_Missense_Mutation_p.N121K|PBRM1_ENST00000409114.3_Missense_Mutation_p.N121K|PBRM1_ENST00000394830.3_Missense_Mutation_p.N121K|PBRM1_ENST00000409057.1_Missense_Mutation_p.N121K|PBRM1_ENST00000410007.1_Missense_Mutation_p.N121K|PBRM1_ENST00000337303.4_Missense_Mutation_p.N121K			Q86U86	PB1_HUMAN	polybromo 1	121	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.N121fs*8(3)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACTTTGCATTGTTAAAAAGAA	0.308			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Insertion - Frameshift(3)	kidney(3)											71.0	66.0	68.0					3																	52702535		2202	4298	6500	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.363C>A	3.37:g.52702535G>T	ENSP00000296302:p.Asn121Lys		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.N121K	ENST00000296302.7	37	c.363		3	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886989	0.52014	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103;ENST00000431678;ENST00000420148	T;T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.51	3.68	0.42216	Bromodomain (5);Bromodomain, conserved site (1);	0.193585	0.53938	D	0.000049	T	0.16981	0.0408	L	0.28344	0.845	0.48288	D	0.999624	B;B;B;B;B;B;B;B;B	0.25563	0.068;0.006;0.012;0.011;0.003;0.085;0.129;0.011;0.031	B;B;B;B;B;B;B;B;B	0.21151	0.014;0.013;0.009;0.006;0.006;0.021;0.033;0.006;0.014	T	0.07290	-1.0780	10	0.19590	T	0.45	-2.6577	5.9814	0.19409	0.217:0.1429:0.6401:0.0	.	121;121;121;121;121;121;121;121;121	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	K	121;121;121;121;121;121;121;121;121;65;121;121	ENSP00000349213:N121K;ENSP00000378307:N121K;ENSP00000296302:N121K;ENSP00000338302:N121K;ENSP00000386593:N121K;ENSP00000386529:N121K;ENSP00000386643:N121K;ENSP00000386601:N121K;ENSP00000387775:N121K;ENSP00000397662:N65K;ENSP00000409939:N121K;ENSP00000389390:N121K	ENSP00000296302:N121K	N	-	3	2	PBRM1	52677575	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.829000	0.27449	1.447000	0.47661	0.655000	0.94253	AAC	PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000163939		0.308	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1		0.00	29	0	G	NM_018165		52702535	-1			no_errors	ENST00000296302	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
PCDHA7	56141	genome.wustl.edu	37	5	140214386	140214386	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:140214386C>G	ENST00000525929.1	+	1	418	c.418C>G	c.(418-420)Ctg>Gtg	p.L140V	PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.L140V|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	140	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAAGGAATCTGTTCATCGC	0.567																																					NSCLC(160;258 2013 5070 22440 28951)												0													84.0	79.0	80.0					5																	140214386		2203	4292	6495	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.418C>G	5.37:g.140214386C>G	ENSP00000436426:p.Leu140Val		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L140V	ENST00000525929.1	37	c.418	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	0.570	-0.841691	0.02671	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.18960	2.18;2.18	4.17	3.28	0.37604	Cadherin (2);Cadherin-like (1);	0.367798	0.15099	U	0.280646	T	0.21881	0.0527	L	0.44542	1.39	0.09310	N	1	B;B	0.33612	0.143;0.419	B;B	0.43478	0.189;0.421	T	0.13124	-1.0521	10	0.29301	T	0.29	.	6.6077	0.22734	0.3068:0.606:0.0:0.0872	.	140;140	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	140	ENSP00000436426:L140V;ENSP00000367365:L140V	ENSP00000367365:L140V	L	+	1	2	PCDHA7	140194570	0.000000	0.05858	0.098000	0.21074	0.068000	0.16541	-0.694000	0.05115	2.021000	0.59480	0.455000	0.32223	CTG	PCDHA7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000204963		0.567	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	28	0	C	NM_018910		140214386	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.006	G
PCSK2	5126	genome.wustl.edu	37	20	17208123	17208123	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr20:17208123G>A	ENST00000262545.2	+	1	488	c.173G>A	c.(172-174)cGa>cAa	p.R58Q	PCSK2_ENST00000377899.1_Missense_Mutation_p.R39Q|PCSK2_ENST00000536609.1_Missense_Mutation_p.R58Q	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	58					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTGGAGTCCGAAAGGTAAGC	0.522																																																	0													57.0	49.0	52.0					20																	17208123		2203	4300	6503	SO:0001583	missense	0			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.173G>A	20.37:g.17208123G>A	ENSP00000262545:p.Arg58Gln		B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.R58Q	ENST00000262545.2	37	c.173	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953649	0.53293	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.74106	1.5;1.5;-0.81	5.46	5.46	0.80206	Proteinase inhibitor, propeptide (1);	0.334685	0.27797	N	0.017807	T	0.70237	0.3201	L	0.54323	1.7	0.49213	D	0.99976	D;P	0.53885	0.963;0.899	B;B	0.40825	0.341;0.297	T	0.71213	-0.4659	10	0.33141	T	0.24	-7.6583	16.807	0.85708	0.0:0.0:1.0:0.0	.	58;58	B4DFQ3;P16519	.;NEC2_HUMAN	Q	39;58;58	ENSP00000367131:R39Q;ENSP00000262545:R58Q;ENSP00000437458:R58Q	ENSP00000262545:R58Q	R	+	2	0	PCSK2	17156123	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.230000	0.72301	2.587000	0.87381	0.655000	0.94253	CGA	PCSK2	-	superfamily_Prot_inh_propept	ENSG00000125851		0.522	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2		0.00	13	0	G	NM_002594		17208123	+1			no_errors	ENST00000262545	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	A
PCSK7	9159	genome.wustl.edu	37	11	117079693	117079693	+	Silent	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:117079693T>A	ENST00000320934.3	-	13	2241	c.1611A>T	c.(1609-1611)ccA>ccT	p.P537P	PCSK7_ENST00000540028.1_Silent_p.P178P|PCSK7_ENST00000529458.1_5'Flank	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	537					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TGCCGCGCCGTGGGTGAGTGA	0.622			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													37.0	37.0	37.0					11																	117079693		2201	4295	6496	SO:0001819	synonymous_variant	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1611A>T	11.37:g.117079693T>A			B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.P537	ENST00000320934.3	37	c.1611	CCDS8382.1	11																																																																																			PCSK7	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000160613		0.622	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	-	0.00	89	0	T	NM_004716		117079693	-1	tier1	-	no_errors	ENST00000320934	ensembl	human	known	74_37	silent	13.18	111	17	SNP	0.443	A
PLEKHM1	9842	genome.wustl.edu	37	17	43545911	43545911	+	Missense_Mutation	SNP	G	G	T	rs564130886		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:43545911G>T	ENST00000430334.3	-	5	1105	c.972C>A	c.(970-972)aaC>aaA	p.N324K	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.N235K|RN7SL730P_ENST00000583727.1_RNA	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	324					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GGCTCAGTCCGTTGGTTGGCA	0.517																																																	0													138.0	136.0	137.0					17																	43545911		2203	4300	6503	SO:0001583	missense	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.972C>A	17.37:g.43545911G>T	ENSP00000389913:p.Asn324Lys		Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.N324K	ENST00000430334.3	37	c.972	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	G	6.238	0.412021	0.11812	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.62364	0.03;0.03	4.69	-2.6	0.06190	.	1.097330	0.06946	N	0.813671	T	0.44623	0.1302	L	0.51422	1.61	0.09310	N	1	B;B	0.22604	0.024;0.072	B;B	0.14578	0.01;0.011	T	0.22034	-1.0228	10	0.10636	T	0.68	.	1.1715	0.01826	0.3807:0.1439:0.3283:0.1471	.	235;324	F8W648;Q9Y4G2	.;PKHM1_HUMAN	K	324;273;235	ENSP00000389913:N324K;ENSP00000414352:N235K	ENSP00000414352:N235K	N	-	3	2	PLEKHM1	40901694	0.000000	0.05858	0.001000	0.08648	0.290000	0.27261	0.228000	0.17814	-0.517000	0.06461	-0.982000	0.02568	AAC	PLEKHM1	-	NULL	ENSG00000225190		0.517	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	-	0.00	47	0	G	NM_014798		43545911	-1	tier1	-	no_errors	ENST00000430334	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.000	T
PLEKHM3	389072	genome.wustl.edu	37	2	208841726	208841726	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:208841726C>T	ENST00000427836.2	-	3	1684	c.1195G>A	c.(1195-1197)Gag>Aag	p.E399K	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.E399K|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.E399K	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	399	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)	p.E399K(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGTGGATCCTCGTCTAGCTTG	0.512																																																	1	Substitution - Missense(1)	large_intestine(1)											58.0	61.0	60.0					2																	208841726		2026	4186	6212	SO:0001583	missense	0			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1195G>A	2.37:g.208841726C>T	ENSP00000417003:p.Glu399Lys		B9EKV2|Q8WW68	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E399K	ENST00000427836.2	37	c.1195	CCDS42808.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.16|12.16	1.856078|1.856078	0.32791|0.32791	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206|ENST00000447645	T;T;T|.	0.10477|.	2.87;2.87;2.87|.	5.82|5.82	5.82|5.82	0.92795|0.92795	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.294052|.	0.38005|.	N|.	0.001853|.	T|T	0.56891|0.56891	0.2016|0.2016	N|N	0.22421|0.22421	0.69|0.69	0.51767|0.51767	D|D	0.99993|0.99993	D;P|.	0.53151|.	0.958;0.873|.	B;B|.	0.43990|.	0.438;0.355|.	T|T	0.49234|0.49234	-0.8961|-0.8961	10|5	0.07482|.	T|.	0.82|.	.|.	20.0991|20.0991	0.97865|0.97865	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	399;399|.	C9J119;Q6ZWE6|.	.;PKHM3_HUMAN|.	K|Q	399|150	ENSP00000417003:E399K;ENSP00000373899:E399K;ENSP00000400150:E399K|.	ENSP00000373899:E399K|.	E|R	-|-	1|2	0|0	PLEKHM3|PLEKHM3	208549971|208549971	0.979000|0.979000	0.34478|0.34478	0.975000|0.975000	0.42487|0.42487	0.388000|0.388000	0.30384|0.30384	2.275000|2.275000	0.43399|0.43399	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	GAG|CGA	PLEKHM3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000178385		0.512	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1		0.00	18	0	C	NM_001080475		208841726	-1			no_errors	ENST00000427836	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.997	T
PLXNA2	5362	genome.wustl.edu	37	1	208225788	208225788	+	Silent	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:208225788G>T	ENST00000367033.3	-	15	3634	c.2877C>A	c.(2875-2877)ctC>ctA	p.L959L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	959	IPT/TIG 2.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGATTGGGTTGAGTGACAGCA	0.522																																																	0													76.0	70.0	72.0					1																	208225788		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2877C>A	1.37:g.208225788G>T			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L959	ENST00000367033.3	37	c.2877	CCDS31013.1	1																																																																																			PLXNA2	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000076356		0.522	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6		0.00	38	0	G	NM_025179		208225788	-1			no_errors	ENST00000367033	ensembl	human	known	74_37	silent	7.50	37	3	SNP	1.000	T
PLXNB3	5365	genome.wustl.edu	37	X	153044743	153044743	+	3'UTR	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:153044743G>A	ENST00000361971.5	+	0	6093				SRPK3_ENST00000370104.1_5'Flank|SRPK3_ENST00000393786.3_5'Flank|SRPK3_ENST00000370100.1_5'Flank|PLXNB3_ENST00000538776.1_3'UTR|SRPK3_ENST00000370101.3_5'Flank|PLXNB3_ENST00000538966.1_3'UTR|SRPK3_ENST00000489426.1_5'UTR|SRPK3_ENST00000370108.3_5'Flank	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3						axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GTATTTATTTGCCTGCTGGAA	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.*249G>A	X.37:g.153044743G>A			B7Z3E6|F5H773|Q9HDA4	RNA	SNP	-	NULL	ENST00000361971.5	37	NULL	CCDS14729.1	X																																																																																			PLXNB3	-	-	ENSG00000198753		0.483	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	-	0.00	46	0	G			153044743	+1	tier1	-	no_errors	ENST00000469190	ensembl	human	known	74_37	rna	39.02	25	16	SNP	1.000	A
POC1B	282809	genome.wustl.edu	37	12	89890964	89890964	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:89890964G>T	ENST00000313546.3	-	3	384	c.256C>A	c.(256-258)Ctc>Atc	p.L86I	POC1B_ENST00000549035.1_Missense_Mutation_p.L44I|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000393179.4_Intron|POC1B_ENST00000378528.2_5'UTR	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	86					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						GGAATCCAGAGTCTCACGGTT	0.453																																																	0													139.0	139.0	139.0					12																	89890964		2203	4300	6503	SO:0001583	missense	0			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.256C>A	12.37:g.89890964G>T	ENSP00000323302:p.Leu86Ile		G3V1X0	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L86I	ENST00000313546.3	37	c.256	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213038	0.58452	.	.	ENSG00000139323	ENST00000313546;ENST00000549035	T;T	0.60299	0.2;0.2	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	N	0.25245	0.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58803	-0.7572	10	0.32370	T	0.25	.	12.3479	0.55132	0.0779:0.0:0.9221:0.0	.	86	Q8TC44	POC1B_HUMAN	I	86;44	ENSP00000323302:L86I;ENSP00000447916:L44I	ENSP00000323302:L86I	L	-	1	0	POC1B	88415095	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.725000	0.61979	2.582000	0.87167	0.467000	0.42956	CTC	POC1B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139323		0.453	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1	-	0.00	41	0	G	NM_172240		89890964	-1	tier1	-	no_errors	ENST00000313546	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PRDM9	56979	genome.wustl.edu	37	5	23526968	23526968	+	Missense_Mutation	SNP	T	T	C	rs200381384		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:23526968T>C	ENST00000296682.3	+	11	1953	c.1771T>C	c.(1771-1773)Tgg>Cgg	p.W591R		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	591					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGCTTTAGCTGGCAGTCAGT	0.602										HNSCC(3;0.000094)																																							0								G	ARG/TRP	3,4259		0,3,2128	39.0	44.0	43.0		1771	-4.6	0.0	5		43	3,8461		0,3,4229	no	missense	PRDM9	NM_020227.2	101	0,6,6357	CC,CT,TT		0.0354,0.0704,0.0471	benign	591/895	23526968	6,12720	2131	4232	6363	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1771T>C	5.37:g.23526968T>C	ENSP00000296682:p.Trp591Arg		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.W591R	ENST00000296682.3	37	c.1771	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.945267	0.00479	7.04E-4	3.54E-4	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.35048	1.33	2.31	-4.63	0.03359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	4.809070	0.00695	N	0.000755	T	0.13243	0.0321	N	0.01431	-0.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36114	-0.9761	10	0.06625	T	0.88	31.5291	8.9666	0.35881	0.0:0.1514:0.5687:0.2799	.	591	Q9NQV7	PRDM9_HUMAN	R	591;357	ENSP00000296682:W591R	ENSP00000253473:W357R	W	+	1	0	PRDM9	23562725	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-20.000000	0.00000	-5.111000	0.00021	-4.935000	0.00002	TGG	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.602	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	67	0	T	NM_020227		23526968	+1	tier1	rs200381384	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	25.00	39	13	SNP	0.000	C
PTH2R	5746	genome.wustl.edu	37	2	209345854	209345854	+	Silent	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:209345854C>T	ENST00000272847.2	+	10	1254	c.1041C>T	c.(1039-1041)acC>acT	p.T347T	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	347					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TCTGGGAGACCAATGCAGTTG	0.348																																																	0													99.0	97.0	98.0					2																	209345854		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1041C>T	2.37:g.209345854C>T			Q8N429	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T347	ENST00000272847.2	37	c.1041	CCDS2383.1	2																																																																																			PTH2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000144407		0.348	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256519.2	-	0.00	53	0	C	NM_005048		209345854	+1	tier1	-	no_errors	ENST00000272847	ensembl	human	known	74_37	silent	20.45	35	9	SNP	1.000	T
PTPN2	5771	genome.wustl.edu	37	18	12859247	12859247	+	Silent	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr18:12859247G>T	ENST00000309660.5	-	2	169	c.76C>A	c.(76-78)Cga>Aga	p.R26R	PTPN2_ENST00000327283.3_Silent_p.R26R|PTPN2_ENST00000353319.4_Silent_p.R26R|PTPN2_ENST00000589086.1_5'UTR|PTPN2_ENST00000591115.1_Silent_p.R26R	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	26	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)	p.R26*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				GACTCATTTCGAATTTCCtta	0.358																																																	1	Substitution - Nonsense(1)	large_intestine(1)											88.0	73.0	78.0					18																	12859247		2203	4300	6503	SO:0001819	synonymous_variant	0			M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.76C>A	18.37:g.12859247G>T			A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Silent	SNP	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R26	ENST00000309660.5	37	c.76	CCDS11865.1	18																																																																																			PTPN2	-	pirsf_Ptpn1/Ptpn2,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000175354		0.358	PTPN2-002	KNOWN	basic|CCDS	protein_coding	PTPN2	HGNC	protein_coding	OTTHUMT00000254613.3	-	0.00	49	0	G	NM_002828, NM_080422, NM_080423		12859247	-1	tier1	-	no_errors	ENST00000309660	ensembl	human	known	74_37	silent	23.44	49	15	SNP	1.000	T
PTPRS	5802	genome.wustl.edu	37	19	5214590	5214590	+	Silent	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:5214590C>T	ENST00000587303.1	-	28	4575	c.4476G>A	c.(4474-4476)cgG>cgA	p.R1492R	PTPRS_ENST00000592099.1_Silent_p.R1045R|PTPRS_ENST00000588012.1_Silent_p.R1454R|PTPRS_ENST00000348075.2_Silent_p.R1454R|PTPRS_ENST00000357368.4_Silent_p.R1492R|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Silent_p.R1472R|PTPRS_ENST00000372412.4_Silent_p.R1493R|PTPRS_ENST00000353284.2_Silent_p.R1045R			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1492	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCTCCTCCAGCCGCGTCATCA	0.632																																																	0													60.0	51.0	54.0					19																	5214590		2203	4300	6503	SO:0001819	synonymous_variant	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4476G>A	19.37:g.5214590C>T			O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.R1493	ENST00000587303.1	37	c.4479	CCDS45930.1	19																																																																																			PTPRS	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000105426		0.632	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2		0.00	11	0	C			5214590	-1			no_errors	ENST00000372412	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.760	T
RFTN2	130132	genome.wustl.edu	37	2	198508925	198508925	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:198508925G>T	ENST00000295049.4	-	3	931	c.395C>A	c.(394-396)tCt>tAt	p.S132Y		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	132					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TTGTGCCTCAGAAGTTAGGGG	0.413																																																	0													185.0	174.0	178.0					2																	198508925		2203	4300	6503	SO:0001583	missense	0			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.395C>A	2.37:g.198508925G>T	ENSP00000295049:p.Ser132Tyr		Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	NULL	p.S132Y	ENST00000295049.4	37	c.395	CCDS2323.1	2	.	.	.	.	.	.	.	.	.	.	G	3.153	-0.173819	0.06421	.	.	ENSG00000162944	ENST00000295049	T	0.29917	1.55	5.39	0.491	0.16867	.	0.552403	0.19492	N	0.112976	T	0.06781	0.0173	N	0.00538	-1.39	0.23445	N	0.99767	B	0.02656	0.0	B	0.01281	0.0	T	0.26710	-1.0095	10	0.36615	T	0.2	-1.619	2.0387	0.03545	0.131:0.1279:0.147:0.594	.	132	Q52LD8	RFTN2_HUMAN	Y	132	ENSP00000295049:S132Y	ENSP00000295049:S132Y	S	-	2	0	RFTN2	198217170	0.045000	0.20229	0.880000	0.34516	0.985000	0.73830	0.094000	0.15107	-0.054000	0.13266	-0.271000	0.10264	TCT	RFTN2	-	NULL	ENSG00000162944		0.413	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	HGNC	protein_coding	OTTHUMT00000256106.2	-	0.00	78	0	G	NM_144629		198508925	-1	tier1	-	no_errors	ENST00000295049	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.981	T
RILPL1	353116	genome.wustl.edu	37	12	123957223	123957223	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:123957223G>T	ENST00000376874.4	-	7	1309	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	SNRNP35_ENST00000527158.2_3'UTR|RILPL1_ENST00000340724.6_Missense_Mutation_p.S238R|RILPL1_ENST00000544468.1_Missense_Mutation_p.S31R	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	358					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)		p.S358R(3)		endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GGGAGAAGAAGCTAAACCTTT	0.498																																																	3	Substitution - Missense(3)	kidney(2)|endometrium(1)											65.0	63.0	63.0					12																	123957223		1944	4154	6098	SO:0001583	missense	0			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.1074C>A	12.37:g.123957223G>T	ENSP00000366070:p.Ser358Arg		Q66K36|Q8N1M0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,pfam_RILP	p.S358R	ENST00000376874.4	37	c.1074	CCDS45006.1	12	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028945	0.75504	.	.	ENSG00000188026	ENST00000376874;ENST00000340724;ENST00000544468	T;T;T	0.27720	1.65;1.65;1.65	5.47	4.47	0.54385	.	.	.	.	.	T	0.37892	0.1020	L	0.29908	0.895	0.51767	D	0.999936	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.991	T	0.11717	-1.0576	9	0.49607	T	0.09	-0.9352	6.5327	0.22336	0.2105:0.0:0.7895:0.0	.	358;207	Q5EBL4;Q5EBL4-3	RIPL1_HUMAN;.	R	358;238;31	ENSP00000366070:S358R;ENSP00000345874:S238R;ENSP00000442991:S31R	ENSP00000345874:S238R	S	-	3	2	RILPL1	122523176	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.403000	0.44530	2.566000	0.86566	0.655000	0.94253	AGC	RILPL1	-	NULL	ENSG00000188026		0.498	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RILPL1	HGNC	protein_coding	OTTHUMT00000400595.1		0.00	25	0	G	NM_178314		123957223	-1			no_errors	ENST00000376874	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	T
RLTPR	146206	genome.wustl.edu	37	16	67688336	67688336	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr16:67688336G>A	ENST00000334583.6	+	31	3651	c.3323G>A	c.(3322-3324)cGt>cAt	p.R1108H	RLTPR_ENST00000545661.1_Missense_Mutation_p.R1072H	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	1108					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		AAGAAGCCTCGTTCAACGCGG	0.647																																																	0													21.0	24.0	23.0					16																	67688336		1955	4128	6083	SO:0001583	missense	0			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.3323G>A	16.37:g.67688336G>A	ENSP00000334958:p.Arg1108His		B8X2Z3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R1108H	ENST00000334583.6	37	c.3323	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558260	0.86231	.	.	ENSG00000159753	ENST00000334583;ENST00000398282;ENST00000545661	T;T	0.26373	1.74;1.78	5.25	5.25	0.73442	.	0.000000	0.56097	D	0.000030	T	0.15652	0.0377	L	0.32530	0.975	0.41284	D	0.986937	P;P	0.40107	0.703;0.703	B;B	0.30401	0.115;0.115	T	0.02404	-1.1164	10	0.54805	T	0.06	-10.9528	8.1093	0.30905	0.1347:0.0:0.8653:0.0	.	1072;1108	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	H	1108;205;1072	ENSP00000334958:R1108H;ENSP00000441481:R1072H	ENSP00000334958:R1108H	R	+	2	0	RLTPR	66245837	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.241000	0.51376	2.744000	0.94065	0.563000	0.77884	CGT	RLTPR	-	NULL	ENSG00000159753		0.647	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	-	0.00	57	0	G	NM_001013838		67688336	+1	tier1	-	no_errors	ENST00000334583	ensembl	human	known	74_37	missense	12.94	74	11	SNP	1.000	A
RMND5B	64777	genome.wustl.edu	37	5	177569912	177569912	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:177569912G>C	ENST00000515098.1	+	6	696	c.345G>C	c.(343-345)caG>caC	p.Q115H	RMND5B_ENST00000542098.1_Missense_Mutation_p.Q102H|RMND5B_ENST00000313386.4_Missense_Mutation_p.Q115H			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	115								p.Q115Q(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCGGGAACAGCAGCAGCAGA	0.617																																																	1	Substitution - coding silent(1)	endometrium(1)											147.0	137.0	141.0					5																	177569912		2203	4300	6503	SO:0001583	missense	0			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.345G>C	5.37:g.177569912G>C	ENSP00000420875:p.Gln115His		Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.Q115H	ENST00000515098.1	37	c.345	CCDS4431.1	5	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207927	0.39003	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098;ENST00000507457	.	.	.	4.74	4.74	0.60224	.	0.183943	0.47093	D	0.000246	T	0.45776	0.1359	N	0.25647	0.755	0.36642	D	0.876924	B;B;B	0.20052	0.024;0.041;0.0	B;B;B	0.14023	0.004;0.01;0.0	T	0.51236	-0.8731	9	0.45353	T	0.12	-15.4998	15.2307	0.73386	0.0:0.0:1.0:0.0	.	102;102;115	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	H	115;115;102;115	.	ENSP00000320623:Q115H	Q	+	3	2	RMND5B	177502518	1.000000	0.71417	0.990000	0.47175	0.628000	0.37860	4.772000	0.62324	2.161000	0.67846	0.563000	0.77884	CAG	RMND5B	-	NULL	ENSG00000145916		0.617	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMND5B	HGNC	protein_coding	OTTHUMT00000373542.1	-	0.00	23	0	G	NM_022762		177569912	+1	tier1	-	no_errors	ENST00000313386	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	C
ROS1	6098	genome.wustl.edu	37	6	117709183	117709183	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:117709183T>C	ENST00000368508.3	-	13	1972	c.1774A>G	c.(1774-1776)Agt>Ggt	p.S592G	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	592	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATAATATCACTGATCAGGATG	0.453			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													82.0	83.0	83.0					6																	117709183		2203	4300	6503	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1774A>G	6.37:g.117709183T>C	ENSP00000357494:p.Ser592Gly		Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S592G	ENST00000368508.3	37	c.1774	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	T	17.62	3.435944	0.62955	.	.	ENSG00000047936	ENST00000368508	D	0.82433	-1.61	4.64	3.48	0.39840	.	0.813069	0.10960	N	0.615123	T	0.55625	0.1932	N	0.22421	0.69	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.54768	-0.8244	10	0.66056	D	0.02	.	8.2948	0.31980	0.0:0.0906:0.0:0.9094	.	592	P08922	ROS1_HUMAN	G	592	ENSP00000357494:S592G	ENSP00000357494:S592G	S	-	1	0	ROS1	117815876	0.001000	0.12720	0.045000	0.18777	0.697000	0.40408	0.676000	0.25247	0.933000	0.37291	0.379000	0.24179	AGT	ROS1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000047936		0.453	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	-	0.00	24	0	T			117709183	-1	tier1	-	no_errors	ENST00000368508	ensembl	human	known	74_37	missense	36.36	14	8	SNP	0.062	C
RPS15A	6210	genome.wustl.edu	37	16	18795982	18795983	+	Intron	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr16:18795982_18795983insA	ENST00000565420.1	-	4	668				RPS15A_ENST00000575669.1_5'UTR|RPS15A_ENST00000576436.1_3'UTR|RPS15A_ENST00000563390.1_Intron|RPS15A_ENST00000322989.4_Intron|RPS15A_ENST00000569083.1_3'UTR			P62244	RS15A_HUMAN	ribosomal protein S15a						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2						CAGAAAAAAAGAAAAAAACCCT	0.342																																																	0																																										SO:0001627	intron_variant	0			AB007154	CCDS10571.1	16p12.3	2011-04-05			ENSG00000134419	ENSG00000134419		"""S ribosomal proteins"""	10389	protein-coding gene	gene with protein product		603674				9582194	Standard	NM_001019		Approved	S15A	uc002dfi.1	P62244	OTTHUMG00000131365	ENST00000565420.1:c.299+76->T	16.37:g.18795989_18795989dupA			P39027|P39031|Q3MHD9|Q8C023|Q9BV24	RNA	INS	-	NULL	ENST00000565420.1	37	NULL	CCDS10571.1	16																																																																																			RPS15A	-	-	ENSG00000134419		0.342	RPS15A-005	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	RPS15A	HGNC	protein_coding	OTTHUMT00000435778.1		0.00	21	0	-	NM_001019		18795983	-1	tier1		no_errors	ENST00000575669	ensembl	human	known	74_37	rna	50.00	10	10	INS	0.000:0.001	A
SCFD1	23256	genome.wustl.edu	37	14	31171539	31171539	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr14:31171539C>T	ENST00000458591.2	+	17	1675	c.1448C>T	c.(1447-1449)gCa>gTa	p.A483V	SCFD1_ENST00000544052.2_Missense_Mutation_p.A416V|SCFD1_ENST00000541123.1_Missense_Mutation_p.A298V|SCFD1_ENST00000396629.2_Missense_Mutation_p.A391V|SCFD1_ENST00000421551.3_Missense_Mutation_p.A424V|SCFD1_ENST00000554486.1_3'UTR	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	483					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TTAACTGATGCAGGATGCAAC	0.289																																																	0													70.0	75.0	74.0					14																	31171539		2203	4300	6503	SO:0001583	missense	0			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1448C>T	14.37:g.31171539C>T	ENSP00000390783:p.Ala483Val		A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.A483V	ENST00000458591.2	37	c.1448	CCDS9639.1	14	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485797	0.63962	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.78000	0.4215	M	0.64676	1.99	0.80722	D	1	B;B;B;B	0.26445	0.072;0.147;0.149;0.147	B;B;B;B	0.30105	0.099;0.071;0.091;0.111	T	0.76342	-0.2994	10	0.49607	T	0.09	-4.9512	18.3989	0.90509	0.0:1.0:0.0:0.0	.	424;416;391;483	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	V	483;416;424;298;391	ENSP00000390783:A483V;ENSP00000443010:A416V;ENSP00000388078:A424V;ENSP00000443537:A298V;ENSP00000379870:A391V	ENSP00000309417:A491V	A	+	2	0	SCFD1	30241290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.343000	0.72986	2.512000	0.84698	0.655000	0.94253	GCA	SCFD1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000092108		0.289	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	HGNC	protein_coding	OTTHUMT00000276612.3		0.00	37	0	C	NM_182835		31171539	+1			no_errors	ENST00000458591	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
SCIN	85477	genome.wustl.edu	37	7	12644288	12644288	+	Splice_Site	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:12644288G>A	ENST00000297029.5	+	4	767	c.666G>A	c.(664-666)aaG>aaA	p.K222K	SCIN_ENST00000519209.1_5'UTR|SCIN_ENST00000445618.2_5'UTR	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	222	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		AACTTATAAAGGTATTGTGAC	0.463																																																	0													256.0	225.0	234.0					7																	12644288		692	1591	2283	SO:0001630	splice_region_variant	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.666+1G>A	7.37:g.12644288G>A			A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Silent	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.K222	ENST00000297029.5	37	c.666	CCDS47545.1	7																																																																																			SCIN	-	smart_Villin/Gelsolin	ENSG00000006747		0.463	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	HGNC	protein_coding	OTTHUMT00000326041.1	-	0.00	60	0	G	NM_033128	Silent	12644288	+1	tier1	-	no_errors	ENST00000297029	ensembl	human	known	74_37	silent	8.62	53	5	SNP	1.000	A
SCN2A	6326	genome.wustl.edu	37	2	166245183	166245183	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:166245183A>T	ENST00000375437.2	+	27	5157	c.4867A>T	c.(4867-4869)Acc>Tcc	p.T1623S	SCN2A_ENST00000375427.2_Missense_Mutation_p.T1623S|SCN2A_ENST00000357398.3_Missense_Mutation_p.T1623S|SCN2A_ENST00000283256.6_Missense_Mutation_p.T1623S	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1623			T -> N (in EIEE11; the disease progresses to West syndrome). {ECO:0000269|PubMed:23935176}.		intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTGTCCCCTACCCTGTTCCG	0.413																																																	0													104.0	105.0	105.0					2																	166245183		2203	4300	6503	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4867A>T	2.37:g.166245183A>T	ENSP00000364586:p.Thr1623Ser		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.T1623S	ENST00000375437.2	37	c.4867	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851097	0.51270	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.49	5.49	0.81192	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.96411	0.8829	L	0.46819	1.47	0.58432	D	0.999998	P;B	0.48640	0.913;0.136	P;B	0.49528	0.614;0.173	D	0.96986	0.9718	10	0.87932	D	0	.	15.9354	0.79698	1.0:0.0:0.0:0.0	.	1623;1623	Q99250-2;Q99250	.;SCN2A_HUMAN	S	1623	ENSP00000364586:T1623S;ENSP00000349973:T1623S;ENSP00000283256:T1623S;ENSP00000364576:T1623S	ENSP00000283256:T1623S	T	+	1	0	SCN2A	165953429	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.316000	0.96319	2.220000	0.72140	0.451000	0.29950	ACC	SCN2A	-	pfam_Ion_trans_dom	ENSG00000136531		0.413	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	85	0	A	NM_021007		166245183	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	20.43	74	19	SNP	1.000	T
SERPINB9	5272	genome.wustl.edu	37	6	2892151	2892151	+	Silent	SNP	G	G	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:2892151G>C	ENST00000380698.4	-	6	728	c.639C>G	c.(637-639)cgC>cgG	p.R213R		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	213					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				GCAGCTGCGCGCGCACCTCGC	0.627																																																	0													60.0	62.0	61.0					6																	2892151		2203	4300	6503	SO:0001819	synonymous_variant	0			L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.639C>G	6.37:g.2892151G>C			B2RBW3|Q5TD03	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Serpin_B9/Maspin	p.R213	ENST00000380698.4	37	c.639	CCDS4478.1	6																																																																																			SERPINB9	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000170542		0.627	SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB9	HGNC	protein_coding	OTTHUMT00000039656.1	-	0.00	18	0	G			2892151	-1	tier1	-	no_errors	ENST00000380698	ensembl	human	known	74_37	silent	25.00	12	4	SNP	0.000	C
SESN2	83667	genome.wustl.edu	37	1	28599234	28599234	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:28599234delC	ENST00000253063.3	+	5	1001	c.680delC	c.(679-681)gccfs	p.A227fs		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	227					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAGCCCTGCCCCCCAGGCA	0.632																																																	0													70.0	63.0	65.0					1																	28599234		2203	4300	6503	SO:0001589	frameshift_variant	0			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.680delC	1.37:g.28599234delC	ENSP00000253063:p.Ala227fs		Q5T7D0|Q96SI5	Frame_Shift_Del	DEL	pfam_PA26	p.Q229fs	ENST00000253063.3	37	c.680	CCDS321.1	1																																																																																			SESN2	-	pfam_PA26	ENSG00000130766		0.632	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESN2	HGNC	protein_coding	OTTHUMT00000009840.1		0.00	28	0	C			28599234	+1	tier1		no_errors	ENST00000253063	ensembl	human	known	74_37	frame_shift_del	7.69	24	2	DEL	0.924	-
SLC22A9	114571	genome.wustl.edu	37	11	63149670	63149671	+	Frame_Shift_Ins	INS	-	-	A	rs564236291|rs78765214|rs76547355|rs568732086|rs201804022	byFrequency	TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr11:63149670_63149671insA	ENST00000279178.3	+	6	1243_1244	c.994_995insA	c.(994-996)caafs	p.Q332fs	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	332					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GGAGGCAGCACAAAAAAAAAAA	0.401																																																	0																																										SO:0001589	frameshift_variant	0			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.1005dupA	11.37:g.63149681_63149681dupA	ENSP00000279178:p.Gln332fs		A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Frame_Shift_Ins	INS	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K336fs	ENST00000279178.3	37	c.994_995	CCDS8043.1	11																																																																																			SLC22A9	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000149742		0.401	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A9	HGNC	protein_coding	OTTHUMT00000396371.1		0.00	45	0	-	NM_080866		63149671	+1	tier1		no_errors	ENST00000279178	ensembl	human	known	74_37	frame_shift_ins	10.00	36	4	INS	0.001:0.005	A
SLC5A6	8884	genome.wustl.edu	37	2	27427736	27427737	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:27427736_27427737insA	ENST00000310574.3	-	8	1270_1271	c.797_798insT	c.(796-798)atgfs	p.M266fs	SLC5A6_ENST00000408041.1_Frame_Shift_Ins_p.M266fs|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	266					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	AGGAGAGCATCATGAAGACACC	0.584																																																	0																																										SO:0001589	frameshift_variant	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.798dupT	2.37:g.27427737_27427737dupA	ENSP00000310208:p.Met266fs		B2RB85|D6W549|Q969Y5	Frame_Shift_Ins	INS	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.M266fs	ENST00000310574.3	37	c.798_797	CCDS1740.1	2																																																																																			SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.584	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1		0.00	27	0	-	NM_021095		27427737	-1	tier1		no_errors	ENST00000310574	ensembl	human	known	74_37	frame_shift_ins	12.00	22	3	INS	1.000:1.000	A
SLIT1	6585	genome.wustl.edu	37	10	98799826	98799826	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr10:98799826G>A	ENST00000266058.4	-	21	2461	c.2216C>T	c.(2215-2217)gCc>gTc	p.A739V	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.A739V	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	739	LRRNT 4.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GTCCAGGCAGGCGCACTCCTG	0.657																																																	0													42.0	38.0	40.0					10																	98799826		2203	4300	6503	SO:0001583	missense	0			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2216C>T	10.37:g.98799826G>A	ENSP00000266058:p.Ala739Val		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_EG-like_dom,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.A739V	ENST00000266058.4	37	c.2216	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043180	0.75732	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.95588	-3.75;-3.75;-3.75	5.11	5.11	0.69529	Leucine-rich repeat-containing N-terminal (2);	0.205916	0.50627	D	0.000115	D	0.90659	0.7070	N	0.10664	0.02	0.80722	D	1	B;B	0.28128	0.084;0.201	B;B	0.31442	0.052;0.13	D	0.88865	0.3329	10	0.87932	D	0	.	18.7361	0.91755	0.0:0.0:1.0:0.0	.	749;739	E7EWQ8;O75093	.;SLIT1_HUMAN	V	739;749;739;732	ENSP00000266058:A739V;ENSP00000360109:A739V;ENSP00000315005:A732V	ENSP00000266058:A739V	A	-	2	0	SLIT1	98789816	1.000000	0.71417	0.983000	0.44433	0.836000	0.47400	7.423000	0.80229	2.657000	0.90304	0.655000	0.94253	GCC	SLIT1	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000187122		0.657	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	HGNC	protein_coding	OTTHUMT00000049636.1	-	0.00	35	0	G	NM_003061		98799826	-1	tier1	-	no_errors	ENST00000266058	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	A
SMC5	23137	genome.wustl.edu	37	9	72915086	72915086	+	Silent	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:72915086A>G	ENST00000361138.5	+	10	1492	c.1434A>G	c.(1432-1434)aaA>aaG	p.K478K		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	478	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						ACAAATTTAAACAAAGAGTCT	0.328																																																	0													88.0	84.0	85.0					9																	72915086		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1434A>G	9.37:g.72915086A>G			A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	p.K478	ENST00000361138.5	37	c.1434	CCDS6632.1	9																																																																																			SMC5	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000198887		0.328	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	-	0.00	40	0	A	NM_015110		72915086	+1	tier1	-	no_errors	ENST00000361138	ensembl	human	known	74_37	silent	53.57	26	30	SNP	0.995	G
SON	6651	genome.wustl.edu	37	21	34924731	34924731	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr21:34924731C>A	ENST00000356577.4	+	3	3669	c.3194C>A	c.(3193-3195)tCc>tAc	p.S1065Y	SON_ENST00000381679.4_Missense_Mutation_p.S1065Y|SON_ENST00000290239.6_Missense_Mutation_p.S1065Y|SON_ENST00000300278.4_Missense_Mutation_p.S1065Y|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1065	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TATGAACGCTCCATGATGTCA	0.502																																																	0													132.0	123.0	126.0					21																	34924731		2203	4300	6503	SO:0001583	missense	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3194C>A	21.37:g.34924731C>A	ENSP00000348984:p.Ser1065Tyr		D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,superfamily_WD40_repeat_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_dsRNA-bd_dom	p.S1065Y	ENST00000356577.4	37	c.3194	CCDS13629.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.47|14.47	2.544066|2.544066	0.45280|0.45280	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.32272	.|1.46;1.46;1.46;1.46	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.53938	.|D	.|0.000056	T|T	0.56485|0.56485	0.1988|0.1988	M|M	0.68593|0.68593	2.085|2.085	0.34696|0.34696	D|D	0.726205|0.726205	.|D;D;D;D;D	.|0.89917	.|1.0;0.999;0.999;1.0;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.996;0.978;0.998;0.998	T|T	0.64837|0.64837	-0.6313|-0.6313	5|10	.|0.72032	.|D	.|0.01	.|.	18.1147|18.1147	0.89549|0.89549	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1065;1065;746;1065;1065	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	T|Y	60|1065	.|ENSP00000348984:S1065Y;ENSP00000290239:S1065Y;ENSP00000300278:S1065Y;ENSP00000371095:S1065Y	.|ENSP00000290239:S1065Y	P|S	+|+	1|2	0|0	SON|SON	33846601|33846601	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	2.697000|2.697000	0.47060|0.47060	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CCA|TCC	SON	-	NULL	ENSG00000159140		0.502	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	-	0.00	39	0	C	NM_138927		34924731	+1	tier1	-	no_errors	ENST00000356577	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	A
SPAG9	9043	genome.wustl.edu	37	17	49072830	49072830	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:49072830A>T	ENST00000262013.7	-	17	2241	c.2033T>A	c.(2032-2034)cTg>cAg	p.L678Q	SPAG9_ENST00000505279.1_Missense_Mutation_p.L668Q|SPAG9_ENST00000357122.4_Missense_Mutation_p.L664Q|SPAG9_ENST00000510283.1_Missense_Mutation_p.L521Q	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	678					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TTTTTCATCCAGAGGTCTGAG	0.338																																																	0													91.0	87.0	88.0					17																	49072830		2203	4300	6503	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.2033T>A	17.37:g.49072830A>T	ENSP00000262013:p.Leu678Gln		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L678Q	ENST00000262013.7	37	c.2033	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	A	25.4	4.637736	0.87760	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000357791;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.44083	0.96;0.93;0.99;0.96	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	T	0.69079	0.3071	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;0.998	T	0.75991	-0.3122	10	0.87932	D	0	-7.9713	15.0059	0.71513	1.0:0.0:0.0:0.0	.	664;678;668;678;664;521	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	Q	678;434;424;214;521;668;664;276	ENSP00000262013:L678Q;ENSP00000423165:L521Q;ENSP00000426900:L668Q;ENSP00000349636:L664Q	ENSP00000262013:L678Q	L	-	2	0	SPAG9	46427829	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.249000	0.95470	1.957000	0.56846	0.482000	0.46254	CTG	SPAG9	-	NULL	ENSG00000008294		0.338	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	-	0.00	25	0	A	NM_003971		49072830	-1	tier1	-	no_errors	ENST00000262013	ensembl	human	known	74_37	missense	29.63	19	8	SNP	1.000	T
STAU2	27067	genome.wustl.edu	37	8	74333612	74333612	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:74333612C>A	ENST00000524300.1	-	15	2058	c.1708G>T	c.(1708-1710)Gtc>Ttc	p.V570F	STAU2-AS1_ENST00000517604.1_lincRNA|STAU2_ENST00000523558.1_Missense_Mutation_p.V398F|STAU2_ENST00000521210.1_Missense_Mutation_p.V504F|STAU2_ENST00000522695.1_Missense_Mutation_p.V538F	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	570	Required for dendritic transport. {ECO:0000250}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			AGCTGCTAGACGGCCGAGTTT	0.522																																																	0													88.0	81.0	83.0					8																	74333612		692	1591	2283	SO:0001583	missense	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000524300.1:c.1708G>T	8.37:g.74333612C>A	ENSP00000428756:p.Val570Phe		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.V570F	ENST00000524300.1	37	c.1708	CCDS55247.1	8	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142190	0.57044	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000523558;ENST00000521210	T;T;T;T	0.34859	1.39;1.4;1.39;1.34	5.11	1.54	0.23209	.	0.541842	0.18364	N	0.143493	T	0.29588	0.0738	L	0.44542	1.39	0.80722	D	1	P;B;P;B	0.48089	0.905;0.447;0.745;0.447	B;B;B;B	0.44163	0.443;0.279;0.279;0.279	T	0.06826	-1.0805	10	0.87932	D	0	-17.8909	5.9804	0.19403	0.0:0.4641:0.0:0.5359	.	504;398;538;570	E9PEI3;E7ER74;E9PH62;E9PF26	.;.;.;.	F	538;570;398;504	ENSP00000428456:V538F;ENSP00000428756:V570F;ENSP00000428741:V398F;ENSP00000429173:V504F	ENSP00000344030:V398F	V	-	1	0	STAU2	74496166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.102000	0.57776	0.444000	0.26612	-0.122000	0.15005	GTC	STAU2	-	NULL	ENSG00000040341		0.522	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2	HGNC	protein_coding	OTTHUMT00000379000.2	-	0.00	55	0	C	NM_001164380		74333612	-1	tier1	-	no_errors	ENST00000524300	ensembl	human	known	74_37	missense	7.14	51	4	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152675870	152675870	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:152675870G>T	ENST00000367255.5	-	67	11451	c.10850C>A	c.(10849-10851)gCa>gAa	p.A3617E	SYNE1_ENST00000265368.4_Missense_Mutation_p.A3617E|SYNE1_ENST00000423061.1_Missense_Mutation_p.A3624E|SYNE1_ENST00000341594.5_Missense_Mutation_p.A3588E|SYNE1_ENST00000448038.1_Missense_Mutation_p.A3624E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3617					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTCTCCTCTGCTGTTTTGAG	0.443										HNSCC(10;0.0054)																																							0													251.0	220.0	230.0					6																	152675870		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10850C>A	6.37:g.152675870G>T	ENSP00000356224:p.Ala3617Glu		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A3617E	ENST00000367255.5	37	c.10850	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	6.989	0.552633	0.13374	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	5.4	0.435	0.16544	.	1.027660	0.07747	N	0.947929	T	0.08714	0.0216	N	0.08118	0	0.80722	D	1	B;B;B;B	0.21905	0.062;0.062;0.062;0.05	B;B;B;B	0.23716	0.018;0.018;0.018;0.048	T	0.16012	-1.0417	10	0.51188	T	0.08	.	9.0781	0.36534	0.72:0.0:0.28:0.0	.	3617;3617;3617;3624	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	E	3617;3624;3617;3624;3588	ENSP00000356224:A3617E;ENSP00000396024:A3624E;ENSP00000265368:A3617E;ENSP00000390975:A3624E;ENSP00000341887:A3588E	ENSP00000265368:A3617E	A	-	2	0	SYNE1	152717563	1.000000	0.71417	0.069000	0.20011	0.363000	0.29612	4.132000	0.57977	-0.089000	0.12484	-0.312000	0.09012	GCA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	66	0	G	NM_182961		152675870	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.831	T
TMEM246	84302	genome.wustl.edu	37	9	104238534	104238534	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:104238534T>C	ENST00000374851.1	-	4	1988	c.841A>G	c.(841-843)Atg>Gtg	p.M281V	TMEM246_ENST00000374848.3_Missense_Mutation_p.M281V|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.M281V|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	281						integral component of membrane (GO:0016021)											GCAAACCTCATGTATATCCAG	0.557																																																	0													108.0	112.0	110.0					9																	104238534		2203	4300	6503	SO:0001583	missense	0			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.841A>G	9.37:g.104238534T>C	ENSP00000363984:p.Met281Val		Q49AQ4	Missense_Mutation	SNP	NULL	p.M281V	ENST00000374851.1	37	c.841	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	T	1.642	-0.516168	0.04200	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.69	3.41	0.39046	.	0.467318	0.24147	N	0.041106	T	0.07234	0.0183	N	0.00707	-1.245	0.29273	N	0.870563	B	0.06786	0.001	B	0.04013	0.001	T	0.29671	-1.0004	9	0.11182	T	0.66	-21.4437	5.296	0.15752	0.1521:0.1297:0.0:0.7182	.	281	Q9BRR3	CI125_HUMAN	V	281	.	ENSP00000363980:M281V	M	-	1	0	C9orf125	103278355	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.870000	0.28010	2.177000	0.69029	0.455000	0.32223	ATG	TMEM246	-	NULL	ENSG00000165152		0.557	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	-	0.00	30	0	T	NM_032342		104238534	-1	tier1	-	no_errors	ENST00000374847	ensembl	human	known	74_37	missense	28.00	17	7	SNP	0.822	C
TNIP1	10318	genome.wustl.edu	37	5	150410284	150410284	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr5:150410284C>G	ENST00000389378.2	-	18	2489	c.1901G>C	c.(1900-1902)gGg>gCg	p.G634A	TNIP1_ENST00000523200.1_Missense_Mutation_p.G570A|TNIP1_ENST00000521423.1_5'Flank|TNIP1_ENST00000315050.7_Missense_Mutation_p.G634A|TNIP1_ENST00000518977.1_Intron|TNIP1_ENST00000522226.1_Missense_Mutation_p.G634A|TNIP1_ENST00000524280.1_Missense_Mutation_p.G538R|TNIP1_ENST00000520931.1_Missense_Mutation_p.G581A|TNIP1_ENST00000523338.1_Intron|TNIP1_ENST00000521591.1_Missense_Mutation_p.G634A	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	634	Pro-rich.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCACTGAGGCCCCTCACGGTC	0.443																																																	0													83.0	82.0	82.0					5																	150410284		2203	4300	6503	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1901G>C	5.37:g.150410284C>G	ENSP00000374029:p.Gly634Ala		A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G634A	ENST00000389378.2	37	c.1901	CCDS34280.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.482|4.482	0.089444|0.089444	0.08632|0.08632	.|.	.|.	ENSG00000145901|ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000523200|ENST00000544828;ENST00000524280	T;T;T;T;T;T|T	0.12672|0.62639	2.67;2.68;2.68;2.68;2.68;2.66|0.01	5.44|5.44	4.58|4.58	0.56647|0.56647	.|.	0.424017|0.424017	0.23504|0.23504	N|N	0.047476|0.047476	T|T	0.52805|0.52805	0.1757|0.1757	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B|P	0.29301|0.36837	0.241;0.241|0.571	B;B|B	0.26969|0.42030	0.075;0.075|0.373	T|T	0.40553|0.40553	-0.9557|-0.9557	10|10	0.02654|0.18276	T|T	1|0.48	-15.3599|-15.3599	10.1284|10.1284	0.42663|0.42663	0.0:0.9082:0.0:0.0918|0.0:0.9082:0.0:0.0918	.|.	570;634|538	E7ET96;Q15025|E7EPY1	.;TNIP1_HUMAN|.	A|R	581;634;634;527;596;634;634;570|495;538	ENSP00000429891:G581A;ENSP00000374029:G634A;ENSP00000317891:G634A;ENSP00000428187:G634A;ENSP00000430760:G634A;ENSP00000431105:G570A|ENSP00000429912:G538R	ENSP00000317891:G634A|ENSP00000429912:G538R	G|G	-|-	2|1	0|0	TNIP1|TNIP1	150390477|150390477	0.088000|0.088000	0.21588|0.21588	0.334000|0.334000	0.25495|0.25495	0.865000|0.865000	0.49528|0.49528	1.339000|1.339000	0.33885|0.33885	1.297000|1.297000	0.44761|0.44761	0.448000|0.448000	0.29417|0.29417	GGG|GGC	TNIP1	-	NULL	ENSG00000145901		0.443	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	-	0.00	44	0	C	NM_006058		150410284	-1	tier1	-	no_errors	ENST00000315050	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.316	G
TOX	9760	genome.wustl.edu	37	8	59727949	59727949	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:59727949T>A	ENST00000361421.1	-	7	1560	c.1340A>T	c.(1339-1341)aAc>aTc	p.N447I	RNU4-50P_ENST00000364361.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	447						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GGGGAGCTGGTTCCCAAGGGG	0.587																																					Pancreas(161;610 1969 17913 21374 22725)												0													75.0	78.0	77.0					8																	59727949		2203	4300	6503	SO:0001583	missense	0				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.1340A>T	8.37:g.59727949T>A	ENSP00000354842:p.Asn447Ile		Q96AV5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.N447I	ENST00000361421.1	37	c.1340	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	T	11.96	1.793211	0.31685	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.12039	2.72	5.97	-2.09	0.07232	.	0.676502	0.15485	N	0.259881	T	0.06371	0.0164	N	0.14661	0.345	0.36401	D	0.863116	B	0.19935	0.04	B	0.25614	0.062	T	0.40534	-0.9558	9	.	.	.	.	6.9452	0.24514	0.0:0.342:0.1229:0.535	.	447	O94900	TOX_HUMAN	I	447;197	ENSP00000354842:N447I	.	N	-	2	0	TOX	59890503	1.000000	0.71417	0.929000	0.37066	0.975000	0.68041	1.607000	0.36836	-0.559000	0.06110	0.477000	0.44152	AAC	TOX	-	NULL	ENSG00000198846		0.587	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1		0.00	58	0	T	NM_014729		59727949	-1			no_errors	ENST00000361421	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr17:7577114C>A	ENST00000269305.4	-	8	1013	c.824G>T	c.(823-825)tGt>tTt	p.C275F	TP53_ENST00000455263.2_Missense_Mutation_p.C275F|TP53_ENST00000420246.2_Missense_Mutation_p.C275F|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C275F|TP53_ENST00000445888.2_Missense_Mutation_p.C275F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>T	17.37:g.7577114C>A	ENSP00000269305:p.Cys275Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275F	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536533	0.85812	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	0.993;1.0;0.993;0.993	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	275;275;275;275;275;264;143	ENSP00000352610:C275F;ENSP00000269305:C275F;ENSP00000398846:C275F;ENSP00000391127:C275F;ENSP00000391478:C275F;ENSP00000425104:C143F	ENSP00000269305:C275F	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	300	0	C	NM_000546		7577114	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	50.53	138	142	SNP	1.000	A
TRPV5	56302	genome.wustl.edu	37	7	142622702	142622702	+	Silent	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:142622702G>A	ENST00000265310.1	-	8	1392	c.1044C>T	c.(1042-1044)gtC>gtT	p.V348V	TRPV5_ENST00000442623.1_Silent_p.V348V	NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	348					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					GGGGGCGGTAGACGCAGCACG	0.527																																																	0													139.0	119.0	126.0					7																	142622702		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1044C>T	7.37:g.142622702G>A			A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV5,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.V348	ENST00000265310.1	37	c.1044	CCDS5875.1	7																																																																																			TRPV5	-	prints_TRPV5/TRPV6,tigrfam_TRP_channel	ENSG00000127412		0.527	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV5	HGNC	protein_coding	OTTHUMT00000347660.1	-	0.00	41	0	G	NM_019841		142622702	-1	tier1	-	no_errors	ENST00000265310	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.998	A
TSHZ3	57616	genome.wustl.edu	37	19	31770292	31770292	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:31770292A>G	ENST00000240587.4	-	2	734	c.407T>C	c.(406-408)cTc>cCc	p.L136P		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	136					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGCAGGTTGAGGTTGAGGTT	0.592																																																	0													122.0	124.0	123.0					19																	31770292		2198	4293	6491	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.407T>C	19.37:g.31770292A>G	ENSP00000240587:p.Leu136Pro		Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L136P	ENST00000240587.4	37	c.407	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979312	0.53827	.	.	ENSG00000121297	ENST00000240587	T	0.19532	2.14	5.77	5.77	0.91146	.	0.228459	0.28465	U	0.015252	T	0.33789	0.0875	L	0.57536	1.79	0.80722	D	1	D	0.55385	0.971	P	0.50440	0.641	T	0.07578	-1.0765	10	0.87932	D	0	-22.5273	16.0947	0.81112	1.0:0.0:0.0:0.0	.	136	Q63HK5	TSH3_HUMAN	P	136	ENSP00000240587:L136P	ENSP00000240587:L136P	L	-	2	0	TSHZ3	36462132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.903000	0.92573	2.182000	0.69389	0.528000	0.53228	CTC	TSHZ3	-	NULL	ENSG00000121297		0.592	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2		0.00	72	0	A	NM_020856		31770292	-1			no_errors	ENST00000240587	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	G
TSNAX	7257	genome.wustl.edu	37	1	231700352	231700352	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:231700352G>A	ENST00000366639.4	+	6	732	c.574G>A	c.(574-576)Gct>Act	p.A192T	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	192	Interaction with C1D.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				TCTGGGAGTGGCTGACTTAAC	0.448																																																	0													205.0	201.0	203.0					1																	231700352		2203	4300	6503	SO:0001583	missense	0			X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.574G>A	1.37:g.231700352G>A	ENSP00000355599:p.Ala192Thr		B1APC6	Missense_Mutation	SNP	pfam_Translin,superfamily_Translin	p.A192T	ENST00000366639.4	37	c.574	CCDS1596.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.613496	0.96637	.	.	ENSG00000116918	ENST00000366639	.	.	.	5.77	5.77	0.91146	Translin, C-terminal (1);	0.045912	0.85682	D	0.000000	T	0.78635	0.4314	M	0.76838	2.35	0.80722	D	1	D	0.62365	0.991	D	0.64877	0.93	T	0.72561	-0.4256	9	0.21014	T	0.42	.	20.3485	0.98803	0.0:0.0:1.0:0.0	.	192	Q99598	TSNAX_HUMAN	T	192	.	ENSP00000355599:A192T	A	+	1	0	TSNAX	229766975	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.316000	0.96319	2.885000	0.99019	0.650000	0.86243	GCT	TSNAX	-	pfam_Translin,superfamily_Translin	ENSG00000116918		0.448	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAX	HGNC	protein_coding	OTTHUMT00000095267.2	-	0.00	60	0	G	NM_005999		231700352	+1	tier1	-	no_errors	ENST00000366639	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
TSPAN9	10867	genome.wustl.edu	37	12	3390480	3390480	+	Silent	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:3390480G>A	ENST00000011898.5	+	7	710	c.549G>A	c.(547-549)acG>acA	p.T183T	TSPAN9_ENST00000537971.1_Silent_p.T183T|TSPAN9_ENST00000407263.1_Silent_p.T183T	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	183						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			ACGCCACCACGCCTTTGTGGA	0.662																																																	0													26.0	20.0	22.0					12																	3390480		2057	3921	5978	SO:0001819	synonymous_variant	0			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.549G>A	12.37:g.3390480G>A			D3DUQ7|Q53FV2|Q6FGJ8	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T183	ENST00000011898.5	37	c.549	CCDS8520.1	12																																																																																			TSPAN9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000011105		0.662	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	HGNC	protein_coding	OTTHUMT00000317606.2	-	0.00	29	0	G	NM_006675		3390480	+1	tier1	-	no_errors	ENST00000011898	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.085	A
TTN	7273	genome.wustl.edu	37	2	179433512	179433512	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr2:179433512G>A	ENST00000591111.1	-	276	72648	c.72424C>T	c.(72424-72426)Cgg>Tgg	p.R24142W	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16910W|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16843W|TTN_ENST00000460472.2_Missense_Mutation_p.R16718W|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25783W|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R23215W|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24142	Fibronectin type-III 75. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAAGGGACCGAGGATCACTT	0.413																																																	0													83.0	80.0	81.0					2																	179433512		1891	4099	5990	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72424C>T	2.37:g.179433512G>A	ENSP00000465570:p.Arg24142Trp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R23215W	ENST00000591111.1	37	c.69643		2	.	.	.	.	.	.	.	.	.	.	G	8.589	0.884161	0.17467	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.84	2.02	0.26589	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72391	0.3454	M	0.86343	2.81	0.44825	D	0.997832	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.954;0.954;0.982	T	0.72906	-0.4150	9	0.87932	D	0	.	10.3216	0.43769	0.0:0.0654:0.5249:0.4097	.	16718;16843;16910;24142	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	23215;16718;16910;16843;16716	ENSP00000343764:R23215W;ENSP00000434586:R16718W;ENSP00000340554:R16910W;ENSP00000352154:R16843W	ENSP00000340554:R16910W	R	-	1	2	TTN	179141758	0.982000	0.34865	0.950000	0.38849	0.910000	0.53928	1.114000	0.31196	0.087000	0.17167	-0.274000	0.10170	CGG	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	24	0	G	NM_133378		179433512	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	50.00	13	13	SNP	0.935	A
UBC	7316	genome.wustl.edu	37	12	125397187	125397187	+	Silent	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:125397187G>A	ENST00000536769.1	-	1	2707	c.1131C>T	c.(1129-1131)ctC>ctT	p.L377L	UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_Silent_p.L301L|UBC_ENST00000339647.5_Silent_p.L377L|UBC_ENST00000538617.1_Intron|MIR5188_ENST00000583467.1_RNA			P0CG48	UBC_HUMAN	ubiquitin C	377	Ubiquitin-like 5. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TCCCACCTCTGAGACGGAGCA	0.522																																																	0													226.0	213.0	217.0					12																	125397187		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1131C>T	12.37:g.125397187G>A			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.L377	ENST00000536769.1	37	c.1131	CCDS9260.1	12																																																																																			UBC	-	pfam_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000150991		0.522	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400177.1		0.00	82	0	G	NM_021009		125397187	-1			no_errors	ENST00000339647	ensembl	human	known	74_37	silent	5.66	100	6	SNP	0.984	A
UBC	7316	genome.wustl.edu	37	12	125397207	125397207	+	Silent	SNP	A	A	G	rs201589267	byFrequency	TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:125397207A>G	ENST00000536769.1	-	1	2687	c.1111T>C	c.(1111-1113)Ttg>Ctg	p.L371L	UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_Silent_p.L295L|UBC_ENST00000339647.5_Silent_p.L371L|UBC_ENST00000538617.1_Intron|MIR5188_ENST00000583467.1_RNA			P0CG48	UBC_HUMAN	ubiquitin C	371	Ubiquitin-like 5. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		ACCAGGTGCAAGGTGGACTCT	0.542													G|||	2	0.000399361	0.0015	0.0	5008	,	,		29699	0.0		0.0	False		,,,				2504	0.0																0													225.0	205.0	212.0					12																	125397207		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1111T>C	12.37:g.125397207A>G			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.L371	ENST00000536769.1	37	c.1111	CCDS9260.1	12																																																																																			UBC	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000150991		0.542	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400177.1		0.00	80	0	A	NM_021009		125397207	-1			no_errors	ENST00000339647	ensembl	human	known	74_37	silent	5.13	111	6	SNP	1.000	G
UNC5D	137970	genome.wustl.edu	37	8	35402037	35402037	+	Intron	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:35402037C>T	ENST00000404895.2	+	2	431				UNC5D_ENST00000416672.1_Intron|UNC5D_ENST00000287272.2_Intron|UNC5D_ENST00000453357.2_Silent_p.S24S|UNC5D_ENST00000420357.1_Intron	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGGACTTTTCCTCCCAAACTT	0.403																																																	0													128.0	123.0	125.0					8																	35402037		2203	4300	6503	SO:0001627	intron_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.104-4773C>T	8.37:g.35402037C>T			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.S24	ENST00000404895.2	37	c.72	CCDS6093.2	8																																																																																			UNC5D	-	NULL	ENSG00000156687		0.403	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	77	0	C			35402037	+1	tier1	-	no_errors	ENST00000453357	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.002	T
VCPIP1	80124	genome.wustl.edu	37	8	67547064	67547064	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr8:67547064G>A	ENST00000310421.4	-	3	3599	c.3341C>T	c.(3340-3342)tCt>tTt	p.S1114F		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	1114					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CTGAATAGAAGAAACCATTTC	0.448																																					NSCLC(179;265 2915 6144 43644)												0													70.0	72.0	71.0					8																	67547064		2203	4300	6503	SO:0001583	missense	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.3341C>T	8.37:g.67547064G>A	ENSP00000309031:p.Ser1114Phe		Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.S1114F	ENST00000310421.4	37	c.3341	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101150	0.56183	.	.	ENSG00000175073	ENST00000310421	T	0.40476	1.03	5.74	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.53417	0.1795	L	0.36672	1.1	0.80722	D	1	P	0.50943	0.94	D	0.63488	0.915	T	0.57171	-0.7857	10	0.87932	D	0	-12.4959	15.0287	0.71691	0.0685:0.0:0.9315:0.0	.	1114	Q96JH7	VCIP1_HUMAN	F	1114	ENSP00000309031:S1114F	ENSP00000309031:S1114F	S	-	2	0	VCPIP1	67709618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.188000	0.94921	1.425000	0.47237	0.591000	0.81541	TCT	VCPIP1	-	NULL	ENSG00000175073		0.448	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	-	0.00	34	0	G			67547064	-1	tier1	-	no_errors	ENST00000310421	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	A
WDR17	116966	genome.wustl.edu	37	4	177041086	177041086	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr4:177041086C>T	ENST00000280190.4	+	5	604	c.448C>T	c.(448-450)Cca>Tca	p.P150S	WDR17_ENST00000508596.1_Missense_Mutation_p.P126S|WDR17_ENST00000393643.2_Missense_Mutation_p.P126S|WDR17_ENST00000507824.2_Missense_Mutation_p.P150S			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	150										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CCACAGAGGCCCACTGTTCAT	0.428																																																	0													208.0	194.0	199.0					4																	177041086		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.448C>T	4.37:g.177041086C>T	ENSP00000280190:p.Pro150Ser		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P150S	ENST00000280190.4	37	c.448	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	C	13.42	2.233083	0.39498	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.65364	-0.15;-0.15;-0.15	5.33	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.72523	-0.4267	10	0.25106	T	0.35	-13.8928	19.0102	0.92870	0.0:1.0:0.0:0.0	.	126;150	E7EQX0;Q8IZU2	.;WDR17_HUMAN	S	126;126;150;150	ENSP00000422763:P126S;ENSP00000377258:P126S;ENSP00000280190:P150S	ENSP00000280190:P150S	P	+	1	0	WDR17	177278080	1.000000	0.71417	0.725000	0.30721	0.057000	0.15508	7.259000	0.78381	2.473000	0.83533	0.655000	0.94253	CCA	WDR17	-	superfamily_WD40_repeat_dom	ENSG00000150627		0.428	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	59	0	C			177041086	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	T
WDR46	9277	genome.wustl.edu	37	6	33255939	33255939	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr6:33255939C>T	ENST00000374617.4	-	5	903	c.547G>A	c.(547-549)Gca>Aca	p.A183T	PFDN6_ENST00000374607.1_5'Flank|PFDN6_ENST00000374610.2_5'Flank|WDR46_ENST00000477718.1_5'UTR|PFDN6_ENST00000395131.1_5'Flank|PFDN6_ENST00000374606.5_5'Flank|PFDN6_ENST00000463584.1_5'Flank	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	183							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						GCTGCACTTGCAATGTCCACA	0.527																																																	0													349.0	332.0	338.0					6																	33255939		2203	4300	6503	SO:0001583	missense	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.547G>A	6.37:g.33255939C>T	ENSP00000363746:p.Ala183Thr		A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A183T	ENST00000374617.4	37	c.547	CCDS4772.1	6	.	.	.	.	.	.	.	.	.	.	C	4.352	0.064873	0.08388	.	.	ENSG00000227057	ENST00000374617;ENST00000444176	T;T	0.21932	2.17;1.98	4.28	3.4	0.38934	.	0.113393	0.64402	D	0.000012	T	0.03434	0.0099	N	0.20401	0.57	0.41423	D	0.987818	B;B	0.18741	0.009;0.03	B;B	0.19666	0.012;0.026	T	0.27839	-1.0062	10	0.09590	T	0.72	-8.5741	5.3066	0.15807	0.2025:0.6935:0.0:0.1039	.	129;183	B4DP15;O15213	.;WDR46_HUMAN	T	183;118	ENSP00000363746:A183T;ENSP00000405568:A118T	ENSP00000363746:A183T	A	-	1	0	WDR46	33363917	0.999000	0.42202	0.999000	0.59377	0.995000	0.86356	2.532000	0.45659	0.991000	0.38814	0.448000	0.29417	GCA	WDR46	-	NULL	ENSG00000227057		0.527	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	-	0.00	31	0	C	NM_005452		33255939	-1	tier1	-	no_errors	ENST00000374617	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	T
WFDC8	90199	genome.wustl.edu	37	20	44187625	44187625	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr20:44187625G>T	ENST00000357199.4	-	3	221	c.143C>A	c.(142-144)cCa>cAa	p.P48Q	WFDC8_ENST00000289953.2_Missense_Mutation_p.P48Q|RNA5SP485_ENST00000365053.1_RNA	NM_181510.2	NP_852611.2	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8	48	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|stomach(1)|upper_aerodigestive_tract(1)	15		Myeloproliferative disorder(115;0.0122)				ACATAACCCTGGTTTGTCTGC	0.428																																																	0													147.0	138.0	141.0					20																	44187625		2203	4300	6503	SO:0001583	missense	0			AL031663	CCDS13361.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000158901	ENSG00000158901		"""WAP four-disulfide core domain containing"""	16163	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 170"""	C20orf170		12206714	Standard	NM_130896		Approved	dJ461P17.1, WAP8	uc002xow.3	Q8IUA0	OTTHUMG00000046342	ENST00000357199.4:c.143C>A	20.37:g.44187625G>T	ENSP00000361735:p.Pro48Gln		E1P623|Q5TDV2|Q96A34	Missense_Mutation	SNP	pfam_WAP-type_4-diS_core,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,prints_WAP-type_4-diS_core	p.P48Q	ENST00000357199.4	37	c.143	CCDS13361.1	20	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255158	0.59321	.	.	ENSG00000158901	ENST00000357199;ENST00000289953	T;T	0.74106	-0.81;-0.81	4.4	3.44	0.39384	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	0.418487	0.20580	N	0.089543	D	0.82788	0.5113	M	0.75150	2.29	0.26015	N	0.981938	D	0.89917	1.0	D	0.79108	0.992	T	0.72584	-0.4249	10	0.72032	D	0.01	.	7.6164	0.28160	0.116:0.0:0.884:0.0	.	48	Q8IUA0	WFDC8_HUMAN	Q	48	ENSP00000361735:P48Q;ENSP00000289953:P48Q	ENSP00000289953:P48Q	P	-	2	0	WFDC8	43621039	1.000000	0.71417	0.981000	0.43875	0.124000	0.20399	0.996000	0.29719	1.418000	0.47098	0.655000	0.94253	CCA	WFDC8	-	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,prints_WAP-type_4-diS_core	ENSG00000158901		0.428	WFDC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC8	HGNC	protein_coding	OTTHUMT00000106958.1	-	0.00	60	0	G			44187625	-1	tier1	-	no_errors	ENST00000289953	ensembl	human	known	74_37	missense	9.52	57	6	SNP	0.986	T
XPNPEP1	7511	genome.wustl.edu	37	10	111633191	111633192	+	Intron	INS	-	-	A	rs560321692		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr10:111633191_111633192insA	ENST00000502935.1	-	16	1511				XPNPEP1_ENST00000369683.1_Intron|XPNPEP1_ENST00000322238.8_Intron|XPNPEP1_ENST00000369680.4_Intron					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CATCCCTTTCCAAAAAAAGGAC	0.465																																																	0																																										SO:0001627	intron_variant	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1392-6->T	10.37:g.111633198_111633198dupA				RNA	INS	-	NULL	ENST00000502935.1	37	NULL	CCDS7560.2	10																																																																																			XPNPEP1	-	-	ENSG00000108039		0.465	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2		0.00	38	0	-			111633192	-1	tier1		no_errors	ENST00000510988	ensembl	human	known	74_37	rna	11.54	23	3	INS	1.000:0.923	A
ZFC3H1	196441	genome.wustl.edu	37	12	72023435	72023435	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr12:72023435C>G	ENST00000378743.3	-	19	4138	c.3780G>C	c.(3778-3780)caG>caC	p.Q1260H		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1260					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GAACAGCCATCTGGTCCATTG	0.343																																																	0													136.0	129.0	131.0					12																	72023435		1932	4122	6054	SO:0001583	missense	0			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3780G>C	12.37:g.72023435C>G	ENSP00000368017:p.Gln1260His		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.Q1260H	ENST00000378743.3	37	c.3780	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917609	0.73098	.	.	ENSG00000133858	ENST00000378743	T	0.37584	1.19	5.63	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.44174	-0.9345	10	0.66056	D	0.02	.	11.0796	0.48051	0.0:0.8391:0.0:0.1609	.	1260	O60293	ZC3H1_HUMAN	H	1260	ENSP00000368017:Q1260H	ENSP00000368017:Q1260H	Q	-	3	2	ZFC3H1	70309702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.197000	0.42696	1.361000	0.45981	0.591000	0.81541	CAG	ZFC3H1	-	NULL	ENSG00000133858		0.343	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1		0.00	39	0	C	NM_144982		72023435	-1			no_errors	ENST00000378743	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	G
ZMYM4	9202	genome.wustl.edu	37	1	35857881	35857881	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr1:35857881A>G	ENST00000314607.6	+	16	2736	c.2656A>G	c.(2656-2658)Ata>Gta	p.I886V	ZMYM4_ENST00000373297.2_Missense_Mutation_p.I797V	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	886					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GACTCCAGTTATAGCCAATGT	0.408																																																	0													78.0	74.0	75.0					1																	35857881		2203	4300	6503	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2656A>G	1.37:g.35857881A>G	ENSP00000322915:p.Ile886Val		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH_dom	p.I886V	ENST00000314607.6	37	c.2656	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.7|22.7	4.324911|4.324911	0.81580|0.81580	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.31510|.	1.55;1.49|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74230|0.74230	0.3689|0.3689	M|M	0.74647|0.74647	2.275|2.275	0.47153|0.47153	D|D	0.999337|0.999337	P|.	0.45715|.	0.865|.	P|.	0.52066|.	0.689|.	T|T	0.75365|0.75365	-0.3343|-0.3343	10|5	0.34782|.	T|.	0.22|.	-12.9619|-12.9619	14.9464|14.9464	0.71035|0.71035	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	886|.	Q5VZL5|.	ZMYM4_HUMAN|.	V|C	886;797|545	ENSP00000322915:I886V;ENSP00000362394:I797V|.	ENSP00000322915:I886V|.	I|Y	+|+	1|2	0|0	ZMYM4|ZMYM4	35630468|35630468	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.725000|7.725000	0.84808|0.84808	1.994000|1.994000	0.58287|0.58287	0.482000|0.482000	0.46254|0.46254	ATA|TAT	ZMYM4	-	NULL	ENSG00000146463		0.408	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	-	0.00	44	0	A	NM_005095		35857881	+1	tier1	-	no_errors	ENST00000314607	ensembl	human	known	74_37	missense	16.22	31	6	SNP	1.000	G
ZNF273	10793	genome.wustl.edu	37	7	64349249	64349249	+	Intron	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr7:64349249C>G	ENST00000527278.1	+	2	293				RP11-797H7.5_ENST00000340779.3_RNA			Q14593	ZN273_HUMAN	zinc finger protein 273						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				GTTCATCTATCTGCCAGGGAA	0.577																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0																																										SO:0001627	intron_variant	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000527278.1:c.294-4541C>G	7.37:g.64349249C>G			B3KQZ5|Q6P3V4	RNA	SNP	-	NULL	ENST00000527278.1	37	NULL		7																																																																																			ZNF273	-	-	ENSG00000198039		0.577	ZNF273-002	KNOWN	basic	processed_transcript	ZNF273	HGNC	protein_coding	OTTHUMT00000313503.2	-	0.00	36	0	C			64349249	+1	tier1	-	no_errors	ENST00000476730	ensembl	human	putative	74_37	rna	29.41	24	10	SNP	0.004	G
ZNF335	63925	genome.wustl.edu	37	20	44598230	44598230	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr20:44598230C>G	ENST00000322927.2	-	3	402	c.302G>C	c.(301-303)gGc>gCc	p.G101A	ZNF335_ENST00000494955.1_5'Flank|ZNF335_ENST00000426788.1_Intron	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	101			G -> S (in dbSNP:rs6094231).		brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TGGGGGACCGCCTGTCACCCC	0.617											OREG0025987	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													61.0	62.0	61.0					20																	44598230		2203	4300	6503	SO:0001583	missense	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.302G>C	20.37:g.44598230C>G	ENSP00000325326:p.Gly101Ala	925	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G101A	ENST00000322927.2	37	c.302	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066743	0.55539	.	.	ENSG00000198026	ENST00000322927	T	0.06768	3.26	4.67	2.63	0.31362	.	0.143602	0.47852	N	0.000209	T	0.04272	0.0118	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40365	-0.9567	10	0.30854	T	0.27	-9.9337	4.9553	0.14036	0.0:0.6342:0.1753:0.1905	.	101	Q9H4Z2	ZN335_HUMAN	A	101	ENSP00000325326:G101A	ENSP00000325326:G101A	G	-	2	0	ZNF335	44031637	0.489000	0.26004	0.024000	0.17045	0.862000	0.49288	1.040000	0.30278	1.183000	0.42943	0.563000	0.77884	GGC	ZNF335	-	NULL	ENSG00000198026		0.617	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	-	0.00	34	0	C	NM_022095		44598230	-1	tier1	-	no_errors	ENST00000322927	ensembl	human	known	74_37	missense	15.22	39	7	SNP	0.501	G
ZNF609	23060	genome.wustl.edu	37	15	64967549	64967549	+	Silent	SNP	A	A	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr15:64967549A>T	ENST00000326648.3	+	4	2624	c.2496A>T	c.(2494-2496)ggA>ggT	p.G832G		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	832						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCCAGAATGGAGCTGAAGCCA	0.552																																																	0													75.0	74.0	74.0					15																	64967549		2203	4299	6502	SO:0001819	synonymous_variant	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2496A>T	15.37:g.64967549A>T			Q0D2I2	Silent	SNP	pfscan_Znf_C2H2	p.G832	ENST00000326648.3	37	c.2496	CCDS32270.1	15																																																																																			ZNF609	-	NULL	ENSG00000180357		0.552	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	-	0.00	18	0	A	XM_042833		64967549	+1	tier1	-	no_errors	ENST00000326648	ensembl	human	known	74_37	silent	47.37	10	9	SNP	0.950	T
ZNF616	90317	genome.wustl.edu	37	19	52619109	52619109	+	Silent	SNP	A	A	G			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:52619109A>G	ENST00000600228.1	-	4	1569	c.1308T>C	c.(1306-1308)acT>acC	p.T436T	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TGCATTTGTAAGTTTTCTGTC	0.393																																																	0													152.0	132.0	139.0					19																	52619109		2203	4300	6503	SO:0001819	synonymous_variant	0			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1308T>C	19.37:g.52619109A>G			B3KRV1|Q0P658|Q658V7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T436	ENST00000600228.1	37	c.1308	CCDS33090.1	19																																																																																			ZNF616	-	pfscan_Znf_C2H2	ENSG00000204611		0.393	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	HGNC	protein_coding	OTTHUMT00000462451.1	-	0.00	45	0	A	XM_030892		52619109	-1	tier1	-	no_errors	ENST00000600228	ensembl	human	known	74_37	silent	15.38	33	6	SNP	0.209	G
ZNF658	26149	genome.wustl.edu	37	9	40774731	40774731	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr9:40774731C>T	ENST00000602553.1	-	5	838	c.544G>A	c.(544-546)Gct>Act	p.A182T	ZNF658_ENST00000441795.1_Missense_Mutation_p.A180T|ZNF658_ENST00000377626.3_Missense_Mutation_p.A182T			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TCAGCATGAGCTTTCTCATGC	0.318																																																	0													8.0	8.0	8.0					9																	40774731		1966	3877	5843	SO:0001583	missense	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.544G>A	9.37:g.40774731C>T	ENSP00000473484:p.Ala182Thr		Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A182T	ENST00000602553.1	37	c.544	CCDS35023.1	9	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.913438	0.00503	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.05199	3.76;3.48	1.81	-2.55	0.06288	.	.	.	.	.	T	0.01661	0.0053	N	0.00841	-1.15	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.48490	-0.9031	9	0.13853	T	0.58	.	6.6194	0.22794	0.0:0.4582:0.0:0.5418	.	182;182	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	T	180;182	ENSP00000408462:A180T;ENSP00000366853:A182T	ENSP00000366853:A182T	A	-	1	0	ZNF658	40764731	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	-0.615000	0.05597	-0.608000	0.05731	-0.525000	0.04345	GCT	ZNF658	-	NULL	ENSG00000196409		0.318	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1		0.00	85	0	C	NM_033160		40774731	-1			no_errors	ENST00000377626	ensembl	human	known	74_37	missense	6.82	81	6	SNP	0.000	T
ZNF676	163223	genome.wustl.edu	37	19	22363052	22363052	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:22363052G>T	ENST00000397121.2	-	3	1784	c.1467C>A	c.(1465-1467)ttC>ttA	p.F489L		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TAAGGATTGAGAACGTACTAA	0.408																																																	0													80.0	85.0	83.0					19																	22363052		2161	4277	6438	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1467C>A	19.37:g.22363052G>T	ENSP00000380310:p.Phe489Leu		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F489L	ENST00000397121.2	37	c.1467	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	1.320	-0.599652	0.03744	.	.	ENSG00000196109	ENST00000397121	T	0.33654	1.4	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09992	0.0245	N	0.01446	-0.86	0.09310	N	1	B	0.24317	0.101	B	0.17979	0.02	T	0.21965	-1.0230	9	0.34782	T	0.22	.	0.1492	0.00091	0.2463:0.2473:0.2584:0.2481	.	489	Q8N7Q3	ZN676_HUMAN	L	489	ENSP00000380310:F489L	ENSP00000380310:F489L	F	-	3	2	ZNF676	22154892	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	-4.384000	0.00242	0.181000	0.19994	0.184000	0.17185	TTC	ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.408	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	29	0	G	NM_001001411		22363052	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	missense	35.00	39	21	SNP	0.000	T
ZNF676	163223	genome.wustl.edu	37	19	22363760	22363760	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:22363760G>T	ENST00000397121.2	-	3	1076	c.759C>A	c.(757-759)taC>taA	p.Y253*		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CTTCACATTTGTAGGGTTTCT	0.383																																																	0													77.0	85.0	82.0					19																	22363760		2165	4280	6445	SO:0001587	stop_gained	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.759C>A	19.37:g.22363760G>T	ENSP00000380310:p.Tyr253*		A8MVX5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y253*	ENST00000397121.2	37	c.759	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	18.84	3.709501	0.68730	.	.	ENSG00000196109	ENST00000397121	.	.	.	0.85	-0.442	0.12253	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.5685	0.12198	0.4815:0.0:0.5185:0.0	.	.	.	.	X	253	.	ENSP00000380310:Y253X	Y	-	3	2	ZNF676	22155600	0.000000	0.05858	0.021000	0.16686	0.021000	0.10359	-0.063000	0.11655	0.192000	0.20272	0.195000	0.17529	TAC	ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.383	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	58	0	G	NM_001001411		22363760	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	nonsense	8.57	64	6	SNP	0.519	T
ZNF721	170960	genome.wustl.edu	37	4	436616	436616	+	Missense_Mutation	SNP	T	T	G	rs534408130		TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr4:436616T>G	ENST00000338977.5	-	2	1652	c.1604A>C	c.(1603-1605)cAt>cCt	p.H535P	ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.H547P|ZNF721_ENST00000506646.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	535					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AATTCTCCTATGTACATAAAG	0.398																																																	0													89.0	97.0	94.0					4																	436616		2103	4257	6360	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1604A>C	4.37:g.436616T>G	ENSP00000340524:p.His535Pro		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H547P	ENST00000338977.5	37	c.1640		4	.	.	.	.	.	.	.	.	.	.	T	17.56	3.421184	0.62622	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	D;D	0.86865	-2.18;-2.18	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94522	0.8236	H	0.96720	3.87	0.27122	N	0.962118	D;D;D	0.67145	0.996;0.988;0.986	D;D;D	0.79108	0.992;0.992;0.986	D	0.85585	0.1242	9	0.87932	D	0	.	6.3325	0.21279	0.0:0.0:0.0:1.0	.	535;547;547	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	P	535;547	ENSP00000340524:H535P;ENSP00000428878:H547P	ENSP00000340524:H535P	H	-	2	0	ZNF721	426616	1.000000	0.71417	0.007000	0.13788	0.775000	0.43874	5.401000	0.66326	0.561000	0.29186	0.155000	0.16302	CAT	ZNF721	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182903		0.398	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	-	0.00	61	0	T	NM_133474		436616	-1	tier1	-	no_errors	ENST00000511833	ensembl	human	known	74_37	missense	25.00	42	14	SNP	0.606	G
ZNF90	7643	genome.wustl.edu	37	19	20228869	20228870	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:20228869_20228870insA	ENST00000418063.2	+	4	618_619	c.506_507insA	c.(505-510)ggaaaafs	p.GK169fs	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	169					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						AGAGATACTGGAAAAAAACCTT	0.342																																																	0										1,4117		0,1,2058						-0.4	0.0			30	1,8173		0,1,4086	no	frameshift	ZNF90	NM_007138.1		0,2,6144	A1A1,A1R,RR		0.0122,0.0243,0.0163				2,12290				SO:0001589	frameshift_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.513dupA	19.37:g.20228876_20228876dupA	ENSP00000410466:p.Gly169fs		B9EH87	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P172fs	ENST00000418063.2	37	c.506_507	CCDS46028.1	19																																																																																			ZNF90	-	NULL	ENSG00000213988		0.342	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1		0.00	47	0	-	NM_007138		20228870	+1	tier1		no_errors	ENST00000418063	ensembl	human	known	74_37	frame_shift_ins	13.56	51	8	INS	0.965:0.952	A
ZNF880	400713	genome.wustl.edu	37	19	52887840	52887840	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chr19:52887840G>A	ENST00000422689.2	+	4	1022	c.1007G>A	c.(1006-1008)gGt>gAt	p.G336D		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	336					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TTTTCAGGGGGTTCAGGCCTT	0.403																																																	0													37.0	36.0	36.0					19																	52887840		692	1591	2283	SO:0001583	missense	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1007G>A	19.37:g.52887840G>A	ENSP00000406318:p.Gly336Asp		B4DNA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G336D	ENST00000422689.2	37	c.1007	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	G	5.308	0.242265	0.10077	.	.	ENSG00000221923	ENST00000422689	T	0.07444	3.19	1.89	-3.79	0.04320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03915	0.0110	N	0.19112	0.55	0.09310	N	1	B	0.27498	0.18	B	0.28139	0.086	T	0.41070	-0.9529	8	.	.	.	.	1.282	0.02043	0.2278:0.1638:0.4418:0.1665	.	336	Q6PDB4	ZN880_HUMAN	D	336	ENSP00000406318:G336D	.	G	+	2	0	ZNF880	57579652	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.143000	0.01297	-1.706000	0.01404	-0.506000	0.04501	GGT	ZNF880	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000221923		0.403	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	46	0	G	NM_001145434		52887840	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.000	A
ZXDB	158586	genome.wustl.edu	37	X	57619961	57619961	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A50L-01A-11D-A27G-09	TCGA-IG-A50L-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	9ab2fe81-6c92-4a51-833c-02eaf3bd333d	d1df52b2-f7fe-40bb-ae0e-d964d9272175	g.chrX:57619961T>C	ENST00000374888.1	+	1	1693	c.1480T>C	c.(1480-1482)Tct>Cct	p.S494P		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	494	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CTGTGGGAAATCTTTCACGAG	0.542																																																	0													74.0	69.0	71.0					X																	57619961		2203	4300	6503	SO:0001583	missense	0			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1480T>C	X.37:g.57619961T>C	ENSP00000364023:p.Ser494Pro		A8K151|Q9UBB3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S494P	ENST00000374888.1	37	c.1480	CCDS35313.1	X	.	.	.	.	.	.	.	.	.	.	.	15.91	2.971533	0.53614	.	.	ENSG00000198455	ENST00000374888	T	0.55234	0.53	3.64	3.64	0.41730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.66587	0.2804	M	0.69185	2.1	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	T	0.68992	-0.5263	10	0.72032	D	0.01	.	9.6879	0.40109	0.0:0.0:0.0:1.0	.	494	P98169	ZXDB_HUMAN	P	494	ENSP00000364023:S494P	ENSP00000364023:S494P	S	+	1	0	ZXDB	57636686	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.463000	0.66712	1.475000	0.48197	0.393000	0.25936	TCT	ZXDB	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198455		0.542	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	-	0.00	23	0	T	NM_007157		57619961	+1	tier1	-	no_errors	ENST00000374888	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	C
